KR20230155649A - Pharmaceutical composition for preventing or treating metabolic diseases comprising Licochalcone D or analogs thereof - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of metabolic diseases, and more specifically, to a pharmaceutical composition for the prevention or treatment of metabolic diseases, which suppresses weight gain and liver fat caused by a high-calorie diet by comprising a compound of the following formula (1) or a pharmaceutically acceptable salt thereof. It can reduce the accumulation of fat in liver tissue, regulate the expression of genes related to fat metabolism, and ultimately have excellent preventive and therapeutic effects on metabolic diseases:
[Formula 1]

(In Formula 1, R ₁ is H or C1 to C6 alkyl, R ₂ is H or C1 to C6 alkyl, and R ₃ is H or C1 to C6 alkyl).

Description

Pharmaceutical composition for preventing or treating metabolic diseases comprising Licochalcone D or analogs thereof}

The present invention relates to a pharmaceutical composition for preventing or treating metabolic diseases.

The present invention relates to a food composition for preventing or improving metabolic diseases.

Metabolic disease is a disease in which risk factors for death such as obesity, diabetes, insulin resistance, fatty liver, dyslipidemia, arteriosclerosis or their complications exist together, and is also called 'metabolic syndrome'. Recently, it is known that the incidence of metabolic diseases is rapidly increasing not only in Korea but also in the United States and Western European countries.

Obesity refers to a condition in which energy intake and consumption are not balanced due to lifestyle or genetic causes, excess energy is accumulated as fat, body fat increases abnormally, and metabolic abnormalities are caused. Obesity is common among modern people due to the improvement in living standards due to economic development, and is a major cause of increasing the risk of high blood pressure, hyperlipidemia, arteriosclerosis, heart disease, and diabetes.

Diabetes mellitus is a disease in which insulin secretion is insufficient or normal function is not achieved. It is characterized by hyperglycemia, which increases the concentration of glucose in the blood. Hyperglycemia causes various symptoms and signs and causes glucose to be excreted in the urine. In addition, over a long period of time, it is a disease that causes vascular disorders and dysfunction of nerves, kidneys, and retina, and can even lead to loss of life.

Dyslipidemia refers to a condition in which the concentration of total cholesterol, triglycerides, and LDL cholesterol in the blood is high or the concentration of HDL cholesterol is low. When lipid components such as LDL cholesterol or neutral fat in the blood increase, blood flow becomes difficult and lipid components adhere to the artery walls, causing a chronic inflammatory response and narrowing the inner walls of the arteries, causing arteriosclerosis, which hardens the blood vessels. . In the long term, the blood clots formed from this can block the coronary arteries or cerebral blood vessels, causing myocardial infarction, stroke, or cerebral infarction.

Fatty liver medically refers to a pathological condition in which fat exceeds 5% or more of the total liver weight, and liver disease containing it is known to be the second most serious disease after cancer in the cause of death among adults in their 40s and 50s in developed countries. In particular, nonalcoholic fatty liver disease (NAFLD) continues to increase due to excessive nutrition associated with modern people's high-fat and high-carbohydrate intake. Nonalcoholic fatty liver disease refers to a wide range of liver diseases that include liver disease that progresses to nonalcoholic simple steatosis, nonalcoholic steatohepatitis (NASH), and nonalcoholic fatty liver-related cirrhosis. Nonalcoholic fatty liver disease is characterized by accumulation of fat (fatty infiltration) in liver cells (hepatocytes). Nonalcoholic simple fatty liver disease can progress to nonalcoholic steatohepatitis. Fat accumulation in non-alcoholic steatohepatitis is known to be associated with varying degrees of liver inflammation and scarring, and in many cases, insulin resistance, dyslipidemia, and hypertension.

Drugs to treat these metabolic diseases have been developed, but satisfactory treatment methods or drugs have not yet been developed. Accordingly, there is a need to develop new materials that can prevent or treat the above metabolic diseases without side effects.

Korean Patent No. 2299407

The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating metabolic diseases.

The purpose of the present invention is to provide a food composition for preventing or improving metabolic diseases.

1. Pharmaceutical composition for preventing or treating metabolic diseases containing a compound of formula 1 below or a pharmaceutically acceptable salt thereof:

[Formula 1]

(In Formula 1, R ₁ is H or C1 to C6 alkyl, R ₂ is H or C1 to C6 alkyl, and R ₃ is H or C1 to C6 alkyl).

2. The pharmaceutical composition of 1 above, wherein the metabolic disease is at least one selected from the group consisting of obesity, diabetes, dyslipidemia, fatty liver, arteriosclerosis, stroke, hyperglycemia, insulin resistance disease, and hyperinsulinemia.

3. The pharmaceutical composition of 1 above, wherein R ₁ is C1 alkyl, R ₂ is C1 alkyl, and R ₃ is C1 alkyl.

4. Food composition for preventing or improving metabolic diseases containing a compound of the following formula (1) or a foodologically acceptable salt thereof:

[Formula 1]

(In Formula 1, R ₁ is H or C1 to C6 alkyl, R ₂ is H or C1 to C6 alkyl, and R ₃ is H or C1 to C6 alkyl).

The composition of the present invention can suppress weight gain and liver fat caused by a high-calorie diet, and reduce the accumulation of fat in liver tissue. Additionally, the composition of the present invention can regulate the expression of genes related to fat metabolism. Moreover, the composition of the present invention can reduce blood sugar and improve glucose tolerance.

The composition of the present invention has preventive and therapeutic effects on metabolic diseases such as obesity, diabetes, hyperlipidemia, hypertriglyceridemia, liver disease, arteriosclerosis, stroke, myocardial infarction, cardiovascular disease, hyperglycemia, insulin resistance disease, and hyperinsulinemia. great.

Figure 1 shows the results confirming that Licochalcone D increases the activation of AMPK, SIRT1, and ACC in HepG2 cells (*P < 0.05 and **P < 0.01).
Figure 2 shows the results confirming that Compund C inhibits AMPK, SIRT1, and ACC activated by licochalcone D in HepG2 cells (*P < 0.05 and **P < 0.01).
Figure 3 shows the results confirming that licochalcone D inhibits lipid accumulation in HepG2 cells (*P < 0.05 and ***P < 0.001).
Figure 4 shows the results confirming the effect of licochalcone D in reducing lipid synthesis and increasing lipid oxidation and gluconeogenesis in HepG2 cells (*P < 0.05, **P < 0.01, ***P < 0.001) .
Figure 5 confirms the effect of licochalcone D in reducing body weight and liver weight in a T2D-induced mouse model (diabetic mouse model) (*P < 0.05, **P < 0.01, ***P < 0.001 and *** *P < 0.0001).
Figure 6 confirms the effect of licochalcone D in lowering blood sugar levels and improving glucose tolerance (glucose tolerance) in a T2D-induced mouse model (*P < 0.05, **P < 0.01, ***P < 0.001, *** P < 0.0001).
Figure 7 shows the effect of licochalcone D in enhancing AMPK/SIRT1 pathway activity in liver tissue of a T2D-induced mouse model confirmed by immunoblot (*P < 0.05, **P < 0.01, ***P < 0.001).
Figure 8 confirms the effect of licochalcone D on lipid metabolism and liver inflammation in liver tissue of a T2D-induced mouse model (*P < 0.05, **P < 0.01, ***P < 0.001).
Figure 9 confirms that licochalcone D activates LKB1, PGC1α, and CRTC2, which are upstream signals of AMPK, in liver tissue of a T2D-induced mouse model (*P < 0.05, **P < 0.01, ***P < 0.001) .
Figure 10 is a schematic diagram showing that licochalcone D increases lipid oxidation and reduces lipid synthesis and inflammation through activation of the SIRT1-mediated AMPK pathway.

Hereinafter, the present invention will be described.

The present invention provides a pharmaceutical composition for preventing or treating metabolic diseases comprising a compound of formula 1 below or a pharmaceutically acceptable salt thereof:

[Formula 1]

(In Formula 1, R ₁ is H or C1 to C6 alkyl, R ₂ is H or C1 to C6 alkyl, and R ₃ is H or C1 to C6 alkyl).

In Formula 1, R ₁ may be H or C1 to C6 alkyl. In Formula 1, R ₁ may be H or C1 to C3 alkyl.

In Formula 1, R ₂ may be H or C1 to C6 alkyl. In Formula 1, R ₂ may be H or C1 to C3 alkyl.

In Formula 1, R ₃ may be H or C1 to C6 alkyl. In Formula 1, R ₃ may be H or C1 to C3 alkyl.

In Formula 1, R ₁ may be H or C1 to C3 alkyl, R ₂ may be H or C1 to C3 alkyl, and R ₃ may be H or C1 to C3 alkyl.

The compound of Formula 1 may be a substance extracted from nature or may be chemically synthesized.

According to one embodiment, in Formula 1, R ₁ may be C1 alkyl, R ₂ may be C1 alkyl, and R ₃ may be C1 alkyl. In Formula 1, R ₁ is C1 alkyl, R ₂ is C1 alkyl, and R ₃ is C1 alkyl. The structure is Licochalcone D.

That is, the present invention can provide a pharmaceutical composition for preventing or treating metabolic diseases containing Licochalcone D or a pharmaceutically acceptable salt thereof.

In Formula 1, the compounds in which R ₁ , R ₂ and R ₃ are each independently C1 to C6 alkyl have the same parent and similar substituents, so they are expected to have similar structural and chemical properties and thus have similar effects. possible. For example, from the metabolic disease prevention or treatment effect of a compound where R ₁ , R ₂ and R ₃ are C1 alkyl, the metabolic disease prevention or treatment effect of a compound where R ₁ , R ₂ and R ₃ are C2 to C6 is within a sufficiently predictable range. .

In Formula 1, compounds in which R ₁ , R ₂ and R ₃ are each independently C1 to C3 alkyl have the same parent and their substituents are also short alkyl substituents, so they have similar structural and chemical properties and thus have similar effects. It is quite predictable that it will happen.

Licochalcone D is a known ingredient contained in licorice and may be a compound having the structure of Formula 2 below.

[Formula 2]

The composition of the present invention may exhibit the effect of reducing lipid accumulation in liver cells, reducing body weight and liver weight, and regulating gene expression related to lipid metabolism in hepatocytes. Additionally, the composition of the present invention can exhibit the effect of reducing blood sugar and improving glucose tolerance. The composition of the present invention can activate AMPK and SIRT1 in liver cells. In relation to these effects, the composition of the present invention may exhibit an effect in preventing or treating metabolic diseases.

The term “metabolic disease” refers to a general term for diseases caused by metabolic disorders in the body.

The metabolic disease may be at least one selected from the group consisting of obesity, diabetes, dyslipidemia, fatty liver, arteriosclerosis, stroke, myocardial infarction, cardiovascular disease, hyperglycemia, insulin resistance disease, and hyperinsulinemia, but is not limited thereto.

The term “obesity” may refer to a state of excessive accumulation of fat in the body. The standard for obesity is that body fat is more than 25% of body weight, or more than 30-35% for women. A common measurement method is body mass index (BMI), which is expressed as weight (kg)/height (m) ² . Body Mass Index) is widely used.

The term “dyslipidemia” may refer to a state in which lipid components such as triglycerides, LDL cholesterol, phospholipids, and free fatty acids in the blood are increased or HDL cholesterol is decreased. For example, the dyslipidemia may be any one or more selected from the group consisting of hyperlipidemia, hyperlipidemia, hyperlipidemia, hypertriglyceridemia, and hypolipidemia.

The term “fatty liver disease (FLD)” is medically defined as a pathological condition in which fat exceeds 5% of the total liver weight and is related to metabolic diseases such as obesity or diabetes. Fatty liver may be hepatic steatosis or Non-Alcholic Fatty Liver Disease (NAFLD).

The term “pharmaceutically acceptable” means that a compound or composition exhibits properties that do not cause serious irritation to the subject, cell, or tissue to which it is administered and do not impair the biological activity and physical properties of the compound.

The term “pharmaceutically acceptable salt” refers to a salt prepared using a particular compound according to the present invention and a relatively non-toxic acid or base. Pharmaceutically acceptable salts may be, for example, acid addition salts or metal salts.

Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, as well as aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxyalkanoates and alkanes. It can be formed from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids. These pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, and iodine. Ide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propylate, oxalate, malonate, succinate, suberate, Sebacate, fumarate, maleate, butyne-1,4-dioate, nucleic acid-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitro benzoate, hydroxybenzoate, methoxy Benzoate, phthalate, terephthalate, benzenesulfonate, rtuenesulfonate, chlorobenzenesulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β_hydroxybutyrate, glycol It may include nitrate, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate or mandelate. For example, acid addition salts can be obtained by dissolving the compound in an excess of aqueous acid and precipitating the salt using a hydratable organic solvent such as methanol, ethanol, acetone or acetonitrile.

The metal salt may be a sodium, potassium or calcium salt. Metal salts can be prepared using a base, for example, an alkali metal or alkaline earth metal salt by dissolving the compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt and evaporating the filtrate. Alternatively, it can be obtained by drying.

The term “prophylaxis” refers to prophylactic measures that result in any degree of reduction in the likelihood of developing the condition to be prevented or of reoccurrence or recurrence, including total prevention as well as slight, substantial or significant reduction in the likelihood of development or recurrence of the condition. Refers to an action, and the degree of probability reduction is at least a slight reduction.

The term “treatment” refers to treatment that results in a beneficial effect on the subject or patient suffering from the condition being treated, including cure as well as any degree of relief, including minor relief, substantial relief, major relief, the degree of relief being At least it is mild relief.

The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injection solutions according to conventional methods. , but is not limited to this.

Carriers, excipients and diluents that may be contained in the composition include lactose, dextrose, sucrose, dextrin, maltodextrin, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, Examples include, but are not limited to, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants, but is not limited thereto.

Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, etc., but these solid preparations may contain at least one excipient, such as starch or calcium carbonate, to the compound. It is prepared by mixing , sucrose or lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used.

Liquid preparations for oral use include suspensions, oral solutions, emulsions, syrups, etc. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. . Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type of patient's disease, severity, activity of the drug, and the drug. It can be determined based on factors including sensitivity to, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the field of medicine. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.

The effective amount in the pharmaceutical composition of the present invention may vary depending on the patient's age, gender, and weight, and is generally 1 to 6000 mg per kg of body weight, preferably 60 to 600 mg, administered once or in three divided doses. there is. However, since it may increase or decrease depending on the route of administration, severity of disease, gender, weight, age, etc., the above dosage does not limit the scope of the present invention in any way.

The present invention provides a food composition for preventing or improving metabolic diseases comprising a compound of the following formula (1) or a foodologically acceptable salt thereof:

[Formula 1]

(In Formula 1, R ₁ is H or C1 to C6 alkyl, R ₂ is H or C1 to C6 alkyl, and R ₃ is H or C1 to C6 alkyl).

The compound of Formula 1 and metabolic diseases may be within the above-mentioned range, but are not limited thereto.

The term “foodologically acceptable” means that a compound or composition exhibits properties that do not cause serious irritation to the subject, cell, or tissue to which it is administered and do not impair the biological activity and physical properties of the compound.

The term “foodologically acceptable salt” refers to a salt prepared using a specific compound according to the present invention and a relatively non-toxic acid or base, and the foodologically acceptable salt may be, for example, an acid addition salt or a metal salt. and the acid addition salt and metal salt may be within the above-mentioned range, but are not limited thereto.

Food compositions can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc.

Food compositions may contain common food additives, and their suitability as food additives is determined by the specifications and standards for the relevant item in accordance with the general provisions of the Food Additives Code and General Test Methods approved by the Food and Drug Administration, unless otherwise specified. It is decided by

Items listed in the Food Additives Code include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; Natural additives such as dark pigment, licorice extract, crystalline cellulose, high-quality pigment, and guar gum; It includes, but is not limited to, mixed preparations such as L-glutamate sodium preparations, noodle added alkaline preparations, preservative preparations, and tar coloring preparations.

For example, a food composition in the form of a tablet is made by granulating a mixture of the composition with excipients, binders, disintegrants and other additives in a conventional manner, then adding a lubricant and compression molding, or directly compressing the mixture. It can be molded. Additionally, the food composition in tablet form may contain a flavoring agent, etc., if necessary.

Among capsule-type food compositions, hard capsules can be manufactured by filling a regular hard capsule with a mixture of the composition mixed with additives such as excipients, and soft capsules can be manufactured by filling a mixture of the composition with additives such as excipients. It can be manufactured by filling a capsule base such as gelatin. The soft capsule may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, etc., if necessary.

The food composition in the form of a ring can be prepared by molding a mixture of the composition and excipients, binders, disintegrants, etc. by a previously known method, and if necessary, it can be coated with white sugar or other coating agent, or starch, The surface can also be coated with a substance such as talc.

The food composition in the form of granules can be prepared by mixing the composition with excipients, binders, disintegrants, etc. into granules using a known method, and may contain flavoring agents, flavoring agents, etc. as needed.

Food compositions include beverages, meat, chocolate, foods, and confectionery. These may include pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements.

The food composition can be applied orally as a nutritional supplement, and the form of application is not particularly limited. For example, when administered orally, the daily intake is preferably 5000 mg or less, more preferably 2000 mg or less, and most preferably 500 to 1500 mg or 650 mg per day. When formulated as a capsule or tablet, one tablet can be administered once a day with water.

Additionally, the present invention provides a composition for activating AMPK or SIRT1 comprising a compound of the following formula (1) or a pharmaceutically acceptable salt thereof:

[Formula 1]

(In Formula 1, R ₁ is H or C1 to C6 alkyl, R ₂ is H or C1 to C6 alkyl, and R ₃ is H or C1 to C6 alkyl).

The compound of Formula 1 may be within the above-mentioned range, but is not limited thereto.

The composition may be a composition for activating AMPK or SIRT1 in vitro.

Hereinafter, the present invention will be described in detail with reference to examples.

Experimental materials and methods

1. Chemicals and reagents

Licochalcone D was purchased from ChemFaces (#CFN99805; Wuhan, Hubei). Methylthiazolyldiphenyl-tetrazolium bromide (#M2128) MTT assay; D-glucose (#G7021) was purchased from Sigma-Aldrich (USA). Compound C was purchased from Calbiochem (Darmstadt, Germany), Radioimmunoprecipitation (RIPA) lysis buffer was purchased from Santa Cruz Biotechnology (USA), and Pierce BCA protein assay kit was purchased from Thermo Fisher Scientific (USA). RNAiso Plus (#9109; Total RNA extraction reagent) and Primescript™ II 1st strand cDNA synthesis kit (#6210A) were purchased from Takara Bio Inc. (Japan) Primary antibodies SIRT1 (#sc-74465), LKB1 and GAPDH (#sc-365062) was purchased from Santa Cruz Biotechnology, INC. (TX, USA) AMPK (#5832), p-AMPK (#2535), ACC (#3662) and p-ACC (#3661) were purchased from Santa Cruz Biotechnology, INC. (TX, USA). Appropriate HRP-conjugated secondary antibodies, mouse anti-rabbit (#sc-2357) and mouse anti-goat (#sc-2354) antibodies were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). ), horse anti-mouse (#7076) antibody was purchased from Cell Signaling Technology (USA), and ECL Western blotting detection reagent (RPN2209) was purchased from GE Healthcare (Buckinghamshire, UK).

2. Cell culture

HepG2 hepatocytes were cultured in low glucose Dulbecco's modified Eagle medium (DMEM) (Gibco, Life Technologies, Grand Island, NY) supplemented with 10% FBS (Gibco, Life Technologies, USA), L-glutamine, and 1% penicillin/streptomycin solution. USA). Cells were manipulated under sterile conditions in a humidified incubator at 37°C with 5% CO ₂ . Cells were subcultured as soon as they reached confluence. Cells were monitored continuously under a bright-field microscope (Nikon Eclipse TS100, Tokyo, Japan), and the medium was changed every 3 days.

3. Preparation and processing of stock solutions of free fatty acids

Free fatty acid (FFA) was prepared from a combination of palmitic acid (PA) and oleic acid (OA). Briefly, stocks of 100mM palmitic acid and 100mM oleic acid dissolved in sodium hydroxide were prepared. This stock solution was conjugated with 10% BSA (1:9). All stock solutions were stored at -20°C. After the cells were seeded and attached to a 6-well plate; Cells were treated with a mixture of 0.2mM PA and 0.4mM OA (1:2) for 24 hours or with the same volume of 10% BSA solution for 24 hours. The next day, FFA was removed and 10 μM licochalcone D was added and left for 24 hours. The plates were then used for protein and oil red staining.

4. Oil Red O Staining

An Oil Red O stock solution dissolved in isopropyl alcohol was prepared by magnetic stirring for 2 hours at room temperature, and the prepared solution was stored at room temperature. Oil Red O working solution was prepared by mixing 1.5 parts of stock solution and 1 part of water (3:2), and incubated at 4°C for 10 minutes. The solution was filtered through a 0.02 μm filter and used within 6 hours. HepG2 cells were treated as in 3 above, and 24 hours later, the cells were washed with sterile PBS, fixed with 4% formaldehyde for 20 minutes, and incubated with 0.5% Oil red O dissolved in isopropanol for 3 minutes at room temperature. It was stained with . Cells stained with Oil red O were rinsed several times with PBS to remove excess staining. Stained lipid droplets within cells were visualized and photographed under a light microscope. Stained lipid droplets were dissolved in 2-propanol, and lipid accumulation was quantified by measuring absorbance at 520 nm.

5. Protein isolation and western blot

Total proteins were extracted with the RIPA lysis buffer system containing phenylmethylsulfonyl fluoride (PMSF), sodium orthovanadate (Na ₃ VO ₄ ), and protease inhibitor cocktail (Santa Cruz Biotechnology) for 30 minutes at 4°C, and the samples were was centrifuged at 16,000 xg for 20 minutes. The concentration of total proteins was quantified using the Pierce BCA protein assay kit (Thermo Fisher Scientific). Proteins (30–50 μg) were loaded and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted on PVDF membranes (GE Healthcare, Germany). To prevent non-specific binding of the primary antibody, the membrane was blocked with TBST containing 1% non-fat dry milk for 1 hour and 30 minutes at room temperature (RT). The membranes were then incubated with the respective primary antibodies overnight at 4°C. Secondary antibodies were conjugated with horseradish peroxidase and visualized with an enhanced chemiluminescence detection kit (GE Healthcare). Densitometric analysis was performed using Image J software.

6. Animal model and drug administration

Six-week-old male C57BL/6 mice (weight 22±2 g) were purchased from Samtako Bio Korea Co., Ltd. (Osan, Gyeonggi, Korea). Mice were maintained at 23-25°C under a 12-h light/dark cycle with ad libitum access to food and water in a pathogen-free animal facility center. All animal experiments were approved in accordance with the Chosun University Animal Care and Use Committee (CIACUC2020-S0009). All animals were fed normal chow pellets (ND, SAM #31, Samtako, Inc.) and underwent an adaptation period of 1 week. Over the next week, animals were randomized according to body weight, and one-third of the animals were classified as normal controls, which were fed normal chow pellets throughout the study. On the other hand, the remaining animals were fed a high-fat diet (HFD; 60% Kcal energy as fat) (research diet; #D12492; New Brunswick, NJ 08901 USA) for 2 weeks to induce insulin resistance, and the diet was fed at the end of the study. It continued until. T2DM was then induced in the animals by administering STZ (30 mg/kg, i.p.) for 5 consecutive days starting from the 4th week. On the other hand, normal control animals were administered the same volume of citric acid buffer instead of STZ. Blood glucose levels were measured at the end of the 5th week, and animals showing fasting blood glucose levels (FBG) ≥ 200 mg/dl were selected for the study. Finally, the animals were divided into three groups: Group 1: Normal control mice (Control) treated with saline, Group 2: Diabetic control mice (HFD) treated with saline, Group 3: Diabetic mice (Lico D) treated with licochalcone D (1 mg/kg/day, i.p.). Treatment with saline and licochalcone D (hereinafter referred to as drug treatment) was performed for 3 consecutive weeks. Group 1 was fed normal chow pellets until the study was completed, while groups 2-3 were fed a high-fat diet (see Figure 5). Fasting blood glucose level (FBG) and glucose tolerance test (GTT) were performed 3 weeks after drug treatment. Blood samples were collected from the retro orbital sinus, and plasma samples were collected by centrifuging the blood at 1000 rpm for 5 minutes. Plasma samples were stored at -80°C for further experiments. At the end of the study, all animals were sacrificed, and liver tissue was immediately isolated, frozen, and stored in liquid nitrogen until further use.

7. Glucose tolerance test

The three groups of mouse models were fasted overnight and then intraperitoneally injected with 1.5 g/kg of d-glucose. To measure fasting blood glucose levels, the Green Doctor blood glucose monitoring system (G400; Green Doctor, GC Pharma, Yongin-si, South-Korea) was used at 0, 15, 30, 60, 90, and 120 minutes after glucose infusion. Blood samples were collected from the tail of the mouse.

8. RNA extraction and quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

Total RNA was isolated from the liver tissue of the mouse model using RNAisoPlus (Takara). Then, total RNA (2.5 μg) was reverse transcribed using Primescript™II 1st strand cDNA synthesis kit (Takara) and quantified using Power SYBR Green PCR Master mix (Applied BioSystems). Primer pairs are listed in Table 1. Real-time PCR reactions were performed using the StepOne™Real-Time PCR system (Applied Bio Systems), and primer pairs were synthesized by GenoTech (Daejeon, Korea).

gene Sequence (5'->3') PCR product size gene accession number CES1 Forward GACCCCAGAGAGAGTCAACC (SEQ ID NO: 1) 132 > NM_001025195.2 Reverse CTCCTGCTGTTAATTCCGACC (SEQ ID NO: 2) CES2 Forward CTTTCAGCCTGTCCCTAGCA (SEQ ID NO: 3) 160 > NM_003869.6 Reverse TGTAGGAGGCAACATCAGCA (SEQ ID NO: 4) CPT1A Forward GGGCTACAAATTACGTGAGCGA (SEQ ID NO: 5) 133 > NM_001876.4 Reverse CTTGCTGCCTGAATGTGAGT (SEQ ID NO: 6) MLXIPL1 Forward CCTCTTCGAGTGCTTGAGCC (SEQ ID NO: 7) 156 > NM_032951.3 Reverse CTCTTCCTCCGCTTCACATACTG (SEQ ID NO: 8) CRTC2 Forward GTGTGATGAACCCCAGTCCC (SEQ ID NO: 9) 90 >NM_181715.3 Reverse CACCATCCAGAATACCCCCAC (SEQ ID NO: 10) ACTB Forward ATCCGCAAAGACCTGTACGC (SEQ ID NO: 11) 115 >NM_001101.5 Reverse TCTTCATTGTGCTGGGTGCC (SEQ ID NO: 12) Cpt1a Forward ATGAGGCTTCCATGACTCGG (SEQ ID NO: 13) 124 >NM_013495.2 Reverse AACCTCTGCTCTGCCGTTG (SEQ ID NO: 14) Cpt1b Forward GTTAGCTCTCCTTTTCCTGGCT (SEQ ID NO: 15) 147 >NM_009948.2 Reverse ATCCGCCACGGGACCAAAG (SEQ ID NO: 16) Stk11 Forward CTGACCTACTCCGAGGGATG (SEQ ID NO: 17) 134 >NM_011492.5 Reverse GTCTGGGCTTGGTGGGATAG (SEQ ID NO: 18) Ppargc1a Forward CCCAGAGTCACCAAATGACC (SEQ ID NO: 19) 113 >NM_008904.2 Reverse GAGGAGTTGTGGGAGGAGTT (SEQ ID NO: 20) Fasn Forward GACTCGGCTACTGACACGAC (SEQ ID NO: 21) 123 >NM_007988.3 Reverse CGAGTTGAGCTGGGTTAGGG (SEQ ID NO: 22) Srebf1 Forward TACAGCGTGGCTGGGAAC (SEQ ID NO: 23) 140 >NM_011480.4 Reverse GCATCTGAGAACTCCCTGTCT (SEQ ID NO: 24) Crtc2 Forward GATACCCCCGCCACATTGAC (SEQ ID NO: 25) 126 >NM_028881.3 Reverse GTCTAAACAACTGCCCCTTCTC (SEQ ID NO: 26) Il1α Forward CCACCAAAGAACAAAGTCGGG (SEQ ID NO: 27) 121 >NM_010554.4 Reverse CAGACTGTCAGCACTTCCCAA (SEQ ID NO: 28) Il1β Forward AAGAGCCCATCCTCTGTGACT (SEQ ID NO: 29) 87 >NM_008361.4 Reverse GGAGCCTTGTAGTGCAGTTGT (SEQ ID NO: 30) IL6 Forward AGACAAAGCCAGAGTCCTTCAG (SEQ ID NO: 31) 110 >NM_031168.2 Reverse GAGCATTGGAAATTGGGGTAGG (SEQ ID NO: 32) Trp53 Forward GTATTTCACCCTCAAGATCCGC (SEQ ID NO: 33) 111 >NM_011640.3 Reverse CTGCTGTCTCCAGACTCCTCT (SEQ ID NO: 34) tnf Forward GTGCCTATGTCTCAGCCTCTTC (SEQ ID NO: 35) 118 >NM_013693.3 Reverse GAGGCCATTTGGGAACTTCTCATC (SEQ ID NO: 36) Ager Forward AGGTGGGGACATGTGTGTC (SEQ ID NO: 37) 129 >NM_007425.3 Reverse TCTCAGGGTGTCTCCTGGTC (SEQ ID NO: 38) actb Forward CCACCATGTACCCAGGCATT (SEQ ID NO: 39) 189 >NM_007393.5 Reverse CGGACTCATCGTACTCCTGC (SEQ ID NO: 40)

9. Statistical analysis

All data were expressed as mean ± standard deviation from at least three biological replicates. Differences between data sets were assessed by Student's t-test and analysis of variance (ANOVA) with Holm-Sidak's multiple comparison test using GraphPad Prism (GraphPad Software). Statistical significance levels are indicated in the figures using asterisks: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.

Experiment result

1. Confirmation of SIRT1 and AMPK activation effects in liver cells

The activities of SIRT1 and AMPK were measured according to the treatment concentration of Lico D in HepG2 cells. SIRT1, AMPK, and ACC expression was significantly increased in a dose-dependent manner by Lico D (see Figure 1). Meanwhile, a significant increase was observed at 10 μM, but the increased expression decreased at high concentrations. Next, the activation of SIRT1, AMPK, and ACC was confirmed using Compound C (CC, AMPK inhibitor). As expected, CC treatment significantly reduced Lico D-induced expression of SIRT1, AMPK, and ACC proteins in HepG2 cells (see Figure 2). The above results suggest that Lico D activates SIRT1, AMPK and ACC in liver cells.

2. Confirmation of lipid accumulation reduction effect in liver cells

The effect of Lico D on lipid accumulation in liver cells was confirmed. Specifically, the previous experimental method '3. As described in ‘Preparation and processing of free fatty acid stock solution’, FFA treatment induced lipid accumulation in liver cells (creation of a fatty liver cell model). Compared to control cells or cells treated with Lico D alone, the accumulation of hepatic lipids was significantly increased in FFA-treated HepG2 cells (see Figure 3A). Meanwhile, through oil red O staining, it was confirmed that lipid accumulation was reduced when FFA-treated HepG2 cells were treated with Lico D.

Additionally, AMPK and SIRT1 expression were examined in the FFA-treated HepG2 fatty liver cell model. Lico D restored the activation of AMPK, SIRT1, and ACC in FFA-treated liver cells (see Figure 3B). These results show that Lico D effectively reduced hepatic lipid accumulation in HepG2 cells through activation of AMPK and SIRT1 pathways.

3. Determination of expression levels of genes related to lipid metabolism in liver cells

The effect of Lico D on lipid metabolism was demonstrated by analyzing the expression of genes related to fat synthesis and oxidation in a fatty liver cell model. FFA treatment increased the expression of a lipid synthesis marker (ChREB) and decreased the expression of lipid β-oxidation markers (CES1, CES2, and CPT1A) (Figure 4A). Treatment with Lico D decreased the expression of lipid synthesis markers and increased the expression of lipid β-oxidation markers in the FFA-treated cell model (see Figures 4B and 4C). The above results suggest that Lico D increases lipid oxidation and reduces lipid synthesis in FFA-treated cell models.

4. Confirmation of weight loss and glucose tolerance improvement effects in a diabetic mouse model

To evaluate whether Lico D exerts an in vivo therapeutic effect in type 2 diabetic mice, Lico D (1 mg/kg/day, i.p.) was administered to HFD+STZ-induced type 2 diabetic mice (see Figure 5A). ). The Lico D mouse group had a gradual decrease in body weight and liver weight (see Figures 5B-5D). Next, fasting blood sugar levels were evaluated in a type 2 diabetes mouse model. As expected, fasting blood glucose levels were significantly increased in HFD+STZ-treated mice and significantly decreased in Lico D-treated mice.

In addition, the glucose tolerance of each mouse was evaluated by determining whether blood sugar levels were lowered within 2 hours after administering a glucose injection to the type 2 diabetes mouse model. The Lico D mouse group had improved glucose tolerance compared to mice treated only with HFD+STZ (HFD mouse group) (see Figure 6). From the above results, it can be seen that the Lico D-treated mouse group had superior effects on reducing body and liver weight and improving glucose tolerance compared to the Lico D-untreated diabetic mouse group (type 2 diabetes mouse model).

5. Effect of activation of AMPK and SIRT1 in liver tissue of diabetes mouse model

Elevated glucose levels are an early indicator of obesity-induced type 2 diabetes, a promising risk factor for NAFLD. Since AMPK and SIRT1 pathways are known to be able to reduce hepatic lipid accumulation, the expression of AMPK and SIRT1 was evaluated in mouse liver tissue. Mice treated with Lico D had activated AMPK and SIRT1 compared to mice treated with HFD+STZ (HFD mouse group) (see Figure 7).

6. Effect of increasing lipid oxidation and reducing lipid synthesis and inflammation in liver tissue of diabetes mouse model

The expression levels of lipogenesis-related genes (SREBP1, FASN, and ChREB) and β-oxidation-related genes (CPT1a and CPT1b) related to hepatic lipid metabolism were evaluated in a diabetic mouse model. As a result, the expression of SREBP1 and FASN, which are related to lipogenesis, was significantly increased in the HFD+STZ-treated HFD mouse group. On the other hand, the expression of SREBP1 and FASN was significantly decreased in the Lico D mouse group (see Figure 8A), and the expression of the lipid β-oxidation gene CPTa was significantly increased in the Lico D treated mice (see Figure 8B).

Additionally, the expression levels of inflammatory markers in the liver, such as IL1α, IL1β, IL6, p53, TNFα, and RAGE, were evaluated. The expression of most inflammatory markers was significantly reduced in the mouse group treated with Lico D compared to the HFD mouse group treated with HFD+STZ (see Figure 8C). Additionally, the expression levels of LKB1, PGC1a, and CRTC2 were evaluated in a diabetic mouse model. The expression of these markers increased upon Lico D treatment compared to the HFD mouse group treated with HFD+STZ (see Figure 9). The above results suggest that treatment with Lico D can potentially increase β-oxidation and reduce adipogenesis and inflammation in diabetic mouse models.

<110> Industry-Academic Cooperation Foundation, Chosun University <120> Pharmaceutical composition for preventing or treating metabolism diseases comprising Licochalcone D or analogs thereof <130> 21P09044 <160>40 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gaccccagag agagtcaacc 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctcctgcttg ttaattccga cc 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ctttcagcct gtccctagca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tgtaggaggc aacatcagca 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gggctacaaa ttacgtgagc ga 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cttgctgcct gaatgtgagt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 cctcttcgag tgcttgagcc 20 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ctcttcctcc gcttcacata ctg 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gtgtgatgaa ccccagtccc 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 caccatccag aataccccca c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 atccgcaaag acctgtacgc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tcttcattgt gctgggtgcc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 atgaggcttc catgactcgg 20 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aacctctgct ctgccgttg 19 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gttagctctc ctttcctggc t 21 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 atccgccacg ggaccaaag 19 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ctgacctact ccgagggatg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gtctgggctt ggtgggatag 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 cccagagtca ccaaatgacc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gaggagttgt gggaggagtt 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 gactcggcta ctgacacgac 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 cgagttgagc tgggttaggg 20 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 tacagcgtgg ctgggaac 18 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gcatctgaga actccctgtc t 21 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 gataccccccg ccacattgac 20 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gtctaaacaa ctgccccttc tc 22 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 ccaccaaaga acaaagtcgg g 21 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 cagactgtca gcacttccca a 21 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 aagagcccat cctctgtgac t 21 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400>30 ggagcctgta gtgcagttgt 20 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 agacaaagcc agagtccttc ag 22 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 gagcattgga aattggggta gg 22 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 gtatttcacc ctcaagatcc gc 22 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 ctgctgtctc cagactcctc t 21 <210> 35 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 gtgcctatgt ctcagcctct tc 22 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 gaggccattt gggaacttct catc 24 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 aggtggggac atgtgtgtc 19 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 tctcagggtg tctcctggtc 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 ccaccatgta cccaggcatt 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 cggactcatc gtactcctgc 20

Claims (4)

Pharmaceutical composition for preventing or treating metabolic diseases comprising a compound of formula 1 below or a pharmaceutically acceptable salt thereof:
[Formula 1]

(In Formula 1, R ₁ is H or C1 to C6 alkyl, R ₂ is H or C1 to C6 alkyl, and R ₃ is H or C1 to C6 alkyl).
The pharmaceutical composition according to claim 1, wherein the metabolic disease is at least one selected from the group consisting of obesity, diabetes, dyslipidemia, fatty liver, arteriosclerosis, stroke, hyperglycemia, insulin resistance disease, and hyperinsulinemia.
The pharmaceutical composition according to claim 1, wherein R ₁ is C1 alkyl, R ₂ is C1 alkyl, and R ₃ is C1 alkyl.
Food composition for preventing or improving metabolic diseases containing a compound of the following formula (1) or a foodologically acceptable salt thereof:
[Formula 1]

(In Formula 1, R ₁ is H or C1 to C6 alkyl, R ₂ is H or C1 to C6 alkyl, and R ₃ is H or C1 to C6 alkyl).