KR20230154703A - Method for Extracting Nucleic Acids of Aspergillus Species - Google Patents

Abstract

The present invention relates to a method of extracting nucleic acids of Aspergillus species and a method of performing PCR amplification using the same. Specifically, the present invention relates to a method of extracting nucleic acids of Aspergillus species by optimizing the chelating resin and the execution time of each step. Provides optimized standards for extraction. When using the above extraction method, the time required is shorter than that of the existing extraction method, and Aspergillus species can be identified more sensitively. According to the present invention, the extraction efficiency of nucleic acids of Aspergillus species is increased, and high purity nucleic acids can be obtained.

Description

{Method for Extracting Nucleic Acids of Aspergillus Species}

The present invention is a technology for extracting nucleic acids of Aspergillus species and performing PCR amplification using the same.

Aspergillus bacteria can cause chronic or acute mycoses in a variety of animals, including humans and birds. Aspergillus bacteria can be fatal, especially for patients with respiratory diseases and weakened immune systems, so early detection is required.

For example, Aspergillus fumigatus is an opportunistic human pathogenic fungus that is associated with organ transplantation, long-term administration of anticancer drugs, misuse of antibiotics, increase in the number of people with acquired immunodeficiency syndrome (AIDS), aging, and use of garters and prosthetics. It is a type of fungus whose infection has increased due to the increase in the number of people with weakened immune function. The fungus mainly penetrates the upper respiratory tract and alveoli through the respiratory tract, causing aspergillosis in patients with weak immune systems, and infects organ transplant patients or bone marrow transplant patients, resulting in a high mortality rate.

Conventionally, real-time PCR was used to detect Aspergillus using sputum samples, and Chelex 100 has been widely used to efficiently extract DNA for PCR (Walsh et al. 1991, Biotechniques 10:506). -513). Heme and its metabolites (Panaccio 1991, Nucleic Acid Res 19:291-292), acidic polysaccharides (Furukawa and Bahavanandan 1983, Biochim Biophys Acta 740:466-475), mineral ions and corrosion. Eliminates PCR inhibitors including humic acids (Tebbe and Vahjen 1993, Appl Environ Microbiol 59:2657-2665). However, DNA extraction using Chelex 100 requires time-consuming and tedious additional steps, including ethanol treatment and autoclaving (Berthold et al. 1993, Plant Molecular Biology Reporter 11:338-344), so a more sensitive, rapid and convenient method is needed. There is a need for method development.

Accordingly, the present inventors completed the present invention as a result of diligent efforts to perform species-specific identification of Aspergillus that is more rapid and sensitive than conventional complex steps and does not involve ethanol treatment or autoclaving.

Accordingly, the present inventors worked diligently to develop an optimized method for extracting Aspergillus without ethanol treatment and autoclaving, and as a result, completed the present invention, which can extract nucleic acids more quickly and sensitively than conventional complex steps. did.

The present invention proposes a method for extracting nucleic acids of Aspergillus species comprising the following steps (a) to (e), thereby contributing to extracting high purity nucleic acids and using them for early detection of Aspergillus bacteria:

(a) centrifuging the sample and separating the supernatant and the pellet;

(b) adding beads to the pellet, mixing them with the supernatant, and then centrifuging;

(c) adding distilled water to the silt and centrifuging it;

(d) Homogenizing the pellet by adding a chelating resin after removing the supernatant; and

(e) heating the homogenized sample and then centrifuging to recover the supernatant containing nucleic acids of Aspergillus species.

To achieve the above object, the present invention provides a method for extracting nucleic acids of Aspergillus species comprising the following steps (a) to (e):

(a) centrifuging the sample and separating the supernatant and the pellet;

(b) adding beads to the pellet, mixing them with the supernatant, and then centrifuging;

(c) adding distilled water to the silt and centrifuging it;

(d) Homogenizing the pellet by adding a chelating resin after removing the supernatant; and

(e) heating the homogenized sample and then centrifuging to recover the supernatant containing nucleic acids of Aspergillus species.

In one embodiment of the present invention, the sample in step (a) may be a respiratory sample.

In one embodiment of the present invention, the respiratory sample may be any one or more selected from the group consisting of sputum, bronchial lavage fluid, and bronchoalveolar lavage fluid.

In one embodiment of the present invention, the bead beating in step (b) may be performed 1 to 5 times for 10 to 60 seconds.

In one embodiment of the present invention, step (c) may be performed one to three times.

In one embodiment of the present invention, centrifugation in steps (a) to (c) may be performed for 5 to 20 minutes.

In one embodiment of the present invention, centrifugation in steps (a) to (c) may be performed at 11,000 to 15,000 rpm.

In one embodiment of the present invention, the concentration of the chelating resin in step (d) may be 2.5% to 5% (w/v).

In one embodiment of the present invention, the heating in step (e) may be characterized as boiling at 90 to 110°C for 5 to 30 minutes.

In one embodiment of the present invention, centrifugation in step (e) may be performed at 11,000 to 15,000 rpm for 4 to 6 minutes.

In one embodiment of the present invention, the method may have a detection limit of 10 ¹ CFU/ml.

In one embodiment of the present invention, the Aspergillus species include Aspergillus fumigatus , Aspergillus flavus , Aspergillus niger , and Aspergillus It may be any one or more species selected from the group consisting of Aspergillus terreus .

The present invention also provides a method of performing PCR amplification using nucleic acids extracted by the above method.

The present invention also provides a method for detecting Aspergillus species comprising the above method.

Aspergillus bacteria can be fatal to patients with weakened immunity, so early detection is required. The present invention uses respiratory specimens as samples and can be used as a diagnostic standard for respiratory specimens, rather than using existing kits. The price is competitive and the turnaround time is also short. When using the present invention, sensitive and specific detection is possible at the optimal temperature and time for extracting Aspergillus.

Figure 1 shows a graph drawn by averaging the PCR results after conidia spiking (10 ⁵ to 10 ¹ CFU/mL) for each bacterial species and three DNA extractions using the Qiagen Kit and the invention method.

Hereinafter, the present invention will be described in more detail.

The terms used herein are for descriptive purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as “comprise” or “have” are intended to designate the presence of features, numbers, steps, operations, components, parts, or combinations thereof described in the specification, but are not intended to indicate the presence of one or more other features. It should be understood that this does not exclude in advance the possibility of the existence or addition of elements, numbers, steps, operations, components, parts, or combinations thereof. Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the technical field to which the embodiments belong. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related technology, and unless clearly defined in the present application, should not be interpreted in an ideal or excessively formal sense. No.

As described above, in the present invention, since the existing method used to detect Aspergillus species includes ethanol treatment or autoclaving steps, the development of a more sensitive, rapid, and simple method was required. Accordingly, by setting optimization conditions such as adjusting the concentration of chelating resin, washing conditions, centrifugation time, and adding bead beating for bead binding, the present invention was completed, which is a method that enables detection more quickly and sensitively than existing methods. did.

Accordingly, the present invention provides a method for extracting nucleic acids of Aspergillus species comprising the following steps (a) to (e):

(a) centrifuging the sample and separating the supernatant and the pellet;

(b) adding beads to the pellet, mixing them with the supernatant, and then centrifuging;

(c) adding distilled water to the silt and centrifuging it;

(d) Homogenizing the pellet by adding a chelating resin after removing the supernatant; and

(e) heating the homogenized sample and then centrifuging to recover the supernatant containing nucleic acids of Aspergillus species.

In the present invention, the term "nucleic acid molecule" refers to all types of nucleic acids to be detected, including chromosomal base sequences from different species, subspecies, or variants, or chromosomal mutations within the same species. This can be characterized by, but is not limited to, all types of DNA, including genomic DNA, mitochondrial DNA, and viral DNA, or all types of RNA, including mRNA, ribosomal RNA, non-coding RNA, tRNA, and viral RNA. No.

As used herein, the term “nucleic acid” refers to a polymer of nucleotides. As used herein, the term “sequence” refers to the nucleotide sequence of an oligonucleotide or nucleic acid. The oligonucleotide or nucleic acid may be DNA, RNA, or an analog thereof (eg, a phosphorothioate analog). The oligonucleotide or nucleic acid may also include modified bases and/or backbones (e.g., modified phosphate linkages or modified sugar moieties). Non-limiting examples of synthetic backbones that impart stability and/or other advantages to nucleic acids may include phosphorothioate linkages, peptide nucleic acids, locked nucleic acids, xylose nucleic acids, or analogs thereof.

The term “nucleic acid” includes, for example, genomic DNA; Complementary DNA (cDNA) (this is a DNA representation of mRNA, usually obtained by reverse transcription or amplification of messenger RNA (mRNA)); A DNA molecule produced synthetically or by amplification; and any form of DNA or RNA, including mRNA.

The term “nucleic acid” includes single-stranded molecules as well as double- or triple-stranded nucleic acids. In a double or triple stranded nucleic acid, the nucleic acid strands need not be coextensive (i.e., a double stranded nucleic acid need not be double stranded along the entire length of both strands).

The term “nucleic acid” also includes any chemical modifications thereof, such as methylation and/or capping. Nucleic acid modifications may include the addition of chemical groups containing additional charge, polarizability, hydrogen bonding, electrostatic interactions, and functionality to individual nucleic acid bases or to the nucleic acid as a whole. These modifications include sugar modifications at the 2' position, pyrimidine modifications at the 5 position, purine modifications at the 8 position, modifications at cytosine exocyclic amines, substitution of 5-bromo-uracil, main chain modifications, and isobases isocytidine and isoguanidine. It may include base modifications such as specific base pair combinations.

In the present invention, the term "target nucleic acid" includes, for example, genes of pathogens or viruses, genes that cause genetic diseases, and parts thereof, but is not limited to these. Additionally, samples containing these target nucleic acids include body fluids such as blood, serum, plasma, urine, feces, bone marrow fluid, saliva, wiped fluid, various tissue fluids, various tissues, paraffin-embedded specimens (FFPE) and their sections, and various Examples include food and their dilutions, but are not limited to these. Additionally, the target nucleic acid used as a test substance may be a nucleic acid extracted from blood or cells by a conventional method, or DNA, RNA, etc. extracted from a specimen may be used.

In the present invention, the term “extraction” refers to separating only the target nucleic acid from the sample.

In the present invention, the term "primer" refers to an oligonucleotide, and conditions that induce the synthesis of a primer extension product complementary to a nucleic acid chain (template), that is, the presence of nucleotides and a polymerizing agent such as DNA polymerase, and an appropriate temperature. It can act as a starting point for synthesis under conditions of and pH. Preferably, the primers are deoxyribonucleotides and single stranded. Primers used in the present invention may include naturally occurring dNMP (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. Additionally, primers may also contain ribonucleotides. Primers should be sufficiently long to prime the synthesis of the extension product in the presence of a polymerizing agent. The suitable length of the primer depends on a number of factors, such as temperature, application, and source of the primer, but is typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form sufficiently stable hybrid complexes with the template. The term “annealing” or “priming” refers to the apposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, wherein a polymerase polymerizes the nucleotides to produce a nucleic acid molecule complementary to the template nucleic acid or portion thereof. Let it form.

Additionally, the primer nucleic acid sequence of the present invention may, if necessary, contain a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., horseradish peroxidase, alkaline phosphatase), radioisotopes (e.g., 32P), fluorescent molecules, chemical groups (e.g., biotin), etc. there is.

In the present invention, the “sample” used for analysis is food, water, liquid, or cells, tissues, blood, plasma, serum, saliva, nasal fluid, sputum, ascites, etc. to confirm that it contains Aspergillus bacteria. Includes biological samples that can confirm the possible presence of Aspergillus, such as vaginal secretions, urine, and stool. In one embodiment of the present invention, the sample in step (a) may be a respiratory sample.

In the present invention, “sample” refers to a sample in which the expression level of genes specific to each virus differs due to infection with various respiratory viruses, and can be used without limitation. Illustratively, the respiratory specimens include saliva or sputum, bronchial washing fluid, bronchoalveolar lavage (BAL), nasopharyngeal swabs (NPS), and nasal swabs ( It may be one or more types selected from the group consisting of Nasal swabs (NS), Throat swabs (TS), and Nasal aspirates (NA), and more preferably sputum and bronchial lavage fluid. and bronchoalveolar lavage fluid.

In the present invention, "Bronchial washing fluid" refers to washing fluid collected during bronchoscopy, and "Bronchoalveolar lavage (BAL)" refers to sterile saline solution after insertion of a bronchoscope. This refers to the washing liquid recovered by dispensing.

In one embodiment of the present invention, the bead beating in step (b) may be performed 1 to 5 times for 10 to 60 seconds, preferably 2 to 4 times for 20 to 40 seconds. It can be performed twice.

In the present invention, stainless steel beads, glass beads, and ceramic beads may be used as beads, and the bead size may be 0.5 mm to 3 mm. In one specific example, ceramic beads of 1.4 mm were used. In the present invention, bead beating is performed to break the cell wall so that fungal DNA can be released and homogenized. In a specific example of the present invention, it was confirmed that nucleic acid extraction efficiency increased when bead beating was performed compared to when bead beating was not performed (see Example 2, Table 3).

In one embodiment of the present invention, step (c) may be performed one to three times. In one specific example, in order to minimize the extraction method steps, the number of steps (c), which had been performed multiple times, was reduced. As a result, as shown in [Table 4], it was confirmed that the efficiency of extracted nucleic acids was better than that of the existing protocol when step (c) corresponding to the wash step was reduced to 1 time (see Example 3, [Table 4]) )

In one embodiment of the present invention, centrifugation in steps (a) to (c) may be performed for 5 to 20 minutes, and preferably for 7 to 15 minutes. In a specific example of the present invention, the optimal centrifugation time was confirmed by adjusting the centrifugation time differently, and as a result, it was confirmed that the efficiency was high when performed for 10 minutes as shown in [Table 2] (Example 1 , see [Table 2])

In one embodiment of the present invention, centrifugation in steps (a) to (c) may be performed at 11,000 to 15,000 rpm. When centrifugation is performed in the present invention, it can be divided into supernatant and precipitate. . In the present invention, supernatant is used in the same sense as “supernatant” and “supernatant,” and “sediment” can be used in the same sense as “sediment,” “subnatant,” and “pellet.”

In one embodiment of the present invention, the concentration of the chelating resin in step (d) may be 2.5% to 5% (w/v), preferably 2.5 to 5% (w/v). . In the method according to one embodiment of the present invention, the chelating resin refers to an ion exchange resin, preferably Chelex 100, but is not limited thereto. The mesh size of Chelex 100 may be 50-100, 100-200, or 200-400.

In one embodiment of the present invention, the heating in step (e) may be characterized as boiling at 90 to 110°C for 5 to 30 minutes.

In one embodiment of the present invention, centrifugation in step (e) may be performed at 11,000 to 15,000 rpm for 4 to 6 minutes. In one specific example, centrifugation in step (e) was performed at 12,300 rpm for 5 minutes.

In one embodiment of the present invention, the method may have a detection limit of 10 ¹ CFU/ml. In a specific embodiment of the present invention, the minimum detection limit concentration of nucleic acid was compared compared to the existing method. The minimum limit of detection (LOD) was designated as the minimum concentration value at which all three nucleic acids extracted from the same strain using the same extraction method were detected in real-time PCR. As a result, when extracting using the method of the present invention, all three bacteria except A. fumigatus showed a LOD value of 10 ¹ CFU/ml, confirming that it was superior to the method using the existing method.

In the present invention, “Aspergillus” species has the same meaning as Aspergillus, Aspergillus, and Aspergillus. Aspergillus species are not limited, but include Aspergillus insuetus, Aspergillus clavatus, Aspergillus restrictus, and Aspergillus okra. Aspergillus ochraceus, Aspergillus tamarii, Aspergillus oryzae, Aspergillus lentulus, Aspergillus sydowii, Aspergillus tubingensis, Aspergillus aculeatus, Aspergillus nidulans, Aspergillus fumigatus , Aspergillus It may be any one or more species selected from the group consisting of Aspergillus flavus , Aspergillus niger , and Aspergillus terreus , and more preferably Aspergillus fu It may be any one or more species selected from the group consisting of Aspergillus fumigatus , Aspergillus flavus , Aspergillus niger , and Aspergillus terreus . .

The present invention also provides a method of performing PCR amplification using nucleic acids extracted by the above method.

The method may be performed by including primers, probes, amplification buffer, dNTPs, controls, detection reagents, etc. in addition to the nucleic acids extracted by the method of the present invention, and may be performed by including additional components depending on the purpose. The method can typically be performed by further including materials required for PCR reaction and base sequence analysis. For example, DNA polymerases (e.g., thermostable DNA polymerases obtained from Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), dNTPs (dATP, It may contain a PCR reaction mixture consisting of (dCTP, dGTP, dTTP), reaction buffer, distilled water, etc., and may additionally contain agarose and electrophoresis buffer to confirm the detection of PCR products.

The present invention also provides a method for detecting Aspergillus species comprising the above method. In addition, using the above method, information for diagnosing Aspergillus can be provided.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be obvious to those skilled in the art that the scope of the present invention should not be construed as limited by these examples.

[Preparation example]

The strains used are as follows: A. fumigatus (ATCC 16424), A. terreus (ATCC 10690), A. flavus (ATCC 16883), and A. niger (ATCC 16888) were obtained from the Microbiology Laboratory, Department of Laboratory Medicine, Catholic University of Korea. .

The beads used in the step of the present invention are 1.4-mm ceramic beads (MagNALyser Green beads; Roche Diagnostics). Additionally, the primers, probes, and PCR conditions used in the real-time PCR of the present invention are as follows. J.C.M. 2011, p. Primers, probes, and conditions described in 4150-4157 were used.

Primers/probes and PCR conditions used for real-time PCR Assay Primer or probe Primer sequence (5’ -> 3’) order
number GenBank accession no. Nucleotide positions A. fumigatus A. fum-ForA. fum-probe
A. fum-Rev GCCCGCCGTTTCGAC
CCCGCCGAAGACCCCAACATG
CCGTTGTTGAAAGTTTTAACTGATTAC One
2
3 GU319985 86-100
136-156
195-221 A. flavus A. flav-ForA. flav-Probe
A. flav-Rev CGAGGTAGGGTTCCTAGCGA
TCCCACCCGTGTTTACTGTACCTTAGTTGCT
CCGGCGGCCATGAAT 4
5
6 HQ026744 59-79
88-118
133-147 A. niger A.nig-ForA. nig-Probe
A.nig-Rev GCCGGAGACCCCAACAC
AATCAACTCAGACTGCACGCTTTCAGACAG
TGTTGAAAGTTTTAACTGATTGCATT 7
8
9 GU256739 95-111
117-146
148-173 A. terreus A.terr-ForA. terr-Probe
A.terr-Rev CATTACCGAGTGCGGTCTTTA
CCCAACCTCCCACCCGTGACTATTG
CCCGCCGAAGCAACAAG 10
11
12 GU256739 12-33
37-61
65-81

Primer was purchased from Bionics (Seoul, Korea), master mix was TaqMan™ Fast Advanced Master Mix (cat number: 4444964) from Thermo Fisher, and resin was Chelex 100 Chelating Resin, analytical grade from Biorad (California, USA). , 100-200 mesh, sodium form, 500 g (cat number: 1422832) was purchased. Additionally, the Qiagen kit to be used as a control is the QIAamp DNA Mini KIT (Catalog nuber 51304) and was obtained from QIAGEN.

Real-time PCR conditions

After denaturation at 95°C for 20 seconds, the amplification cycle of denaturation at 95°C for 3 seconds and annealing and extension at 60°C for 30 seconds was repeated 45 times. Perform.

Real-time mixture

Master mixture (12.5ul), DNA template (7ul), each primer (1.5ul), and probe (0.2ul) were mixed to create a real-time PCR mixture.

Change of primary conditions to select optimal protocol - resin concentration, centrifugation time, wash buffer amount

The following experiment was conducted to establish the optimal protocol by changing the conditions of resin concentration, centrifugation time, and wash buffer amount. Nucleic acids were extracted twice from the same spiking sample under different conditions: ① Resin concentration (1.0%, 2.5%, 5.0%), ② Centrifugation time (5min, 10min), and ③ Wash buffer amount (500uL, 1ml).

At this time, real-time PCR was performed using the species-specific Primer/Probe listed in [Table 1] to confirm the Ct value. After comparing and evaluating the average Ct values obtained using nucleic acids extracted twice, the optimal resin concentration, centrifugation time, and amount of wash buffer were selected.

As a result, the average Ct value based on real-time PCR results using A. fumigatus (ATCC 16424) species-specific primer/probe is shown in [Table 2].

Sample Protocol Conditions resin 5% resin 2.5% resin 1% 10^6 CFU/mL
A. fumigatus
spiking
sample Wash buffer 500ul
(centrifugation 5min) 35.01 35.84 36.80 36.00 36.04 35.78 Wash buffer 500ul
(centrifugation 10 min) 33.24 35.39 36.70 35.03 33.13 33.99 Wash buffer 1ml
(centrifugation 5min) 35.09 33.27 35.15 35.32 36.15 37.34 Wash buffer 1ml
(centrifugation 10 min) 34.86 34.64 35.88 32.24 35.11 35.33 Qiagen DNA mini kit 34.12

As shown in [Table 2], the average Ct value of real-time PCR was lowest in the case of 5% resin, 10 min centrifugation, and 1 ml wash buffer conditions.

That is, the first changed protocol (5% resin, centrifugation 10 min, wash buffer 1ml) is as follows.

1. Mix 500ul of sample (sputum) well and centrifuge at 12,300g for 10 minutes.

2. Remove the supernatant, add 1ml of 0.45% NACL to the sediment, vortex, and centrifuge at 12,300g for 10 minutes.

3. Remove the supernatant, add 1ml of TE buffer to the sediment, vortex, and centrifuge at 12,300g for 10 minutes.

4. Remove the supernatant, add 1ml of D.W to the silt, vortex, and centrifuge at 12,300g for 10 minutes.

5. After removing the supernatant, add 100ul of Extraction buffer (5.0% resin) to the pellet, vortex, and boil at 100°C for 20 minutes.

6. Centrifuge at 12,300xg for 5 minutes and use the supernatant as template nucleic acid.

Secondary condition change experiment to select optimal protocol - Bead beating added to lysis step

Afterwards, the nucleic acid extraction efficiency of the protocol in which a lysis step using beads was added to the first modified protocol was evaluated.

Using the A. fumigatus spiking sample, each different extraction method ((1) Qiagen DNA mini kit, (2) 1st change from the same sample (concentration: 10^5, 10^3, 10^1 CFU/mL) Nucleic acids were extracted twice using the protocol (3) a second modified protocol with the addition of a lysis step using beads.

At this time, as described above in Example 1, real-time PCR was performed using a species-specific primer/probe to confirm the Ct value to evaluate the nucleic acid extraction efficiency of the second modified protocol.

The second changed protocol is as follows.

1. Mix 500ul of sample (sputum) well and centrifuge at 12,300g for 10 minutes.

2. Dispense the supernatant into a new tube, add beads to the pellet, beat the beads 3 times for 30 seconds, mix with the supernatant, and centrifuge at 12,300g for 10 minutes.

3. After removing the supernatant, add 1ml of 0.45% saline solution to the pellet, vortex, and centrifuge at 12,300xg for 10 minutes.

4. After removing the supernatant, add 1ml of TE buffer to the pellet, vortex, and centrifuge at 12,300xg for 10 minutes.

5. After removing the supernatant, add 1ml of D.W to the pellet, vortex, and centrifuge at 12,300xg for 10 minutes.

6. After removing the supernatant, add 100ul of Extraction buffer (5.0% resin) to the pellet, vortex, and boil at 100℃ for 20 minutes.

7. Centrifuge at 12,300xg for 5 minutes and use the supernatant as nucleic acid.

As a result, the Ct values based on real-time PCR results using A. fumigatus (ATCC 16424) species-specific primers/probes are shown in [Table 3].

Sample density
(CFU/mL) Qiagen DNA mini kit First change protocol Secondary Change Protocol
(Bead beating added to Lysis step) A. fumigatus 10^5 29.95 29.77 27.20 27.28 25.80 26.35 29.04 30.07 26.91 27.18 24.79 24.16 10^3 33.18 33.48 33.32 33.18 32.36 31.12 33.78 34.12 32.87 33.76 32.29 32.17 10^1 42.45 41.56 42.62 41.39 42.48 41.37 42.05 42.79 42.92 43.74 42.77 42.80

As shown in [Table 3], it was confirmed that the Ct value of the second change protocol that added lysis using bead beating in addition to the first change protocol method was lower than that of the first change protocol. Accordingly, the protocol was changed for the second time.

Third condition change experiment to select optimal protocol - Wash stage

In order to increase the efficiency of nucleic acid extraction, we attempted to minimize the extraction method steps by comparing the case of washing 3 times with D.W. in the second changed protocol and washing once with D.W.

Using two ATCC Aspergillus standard strains (A. fumigatus, A. flavus), residual sputum to be discarded from patients not suspected of having respiratory infections was spiked and each method (second change protocol and wash step) was performed. Nucleic acids were extracted using a shortened 3rd modified protocol).

Five spiking samples of different concentrations were used per bacterial species, and nucleic acids were extracted once using one extraction method for one concentration.

As in the above-described example, real-time PCR was performed using the extracted nucleic acid using a species-specific primer/probe to confirm the Ct value to evaluate the efficiency of nucleic acid extraction.

The 3rd changed protocol (Wash performed only once with D.W.) is as follows.

1. Mix 500ul of sample (sputum) well and centrifuge at 12,300g for 10 minutes.

2. Dispense the supernatant into a new tube, add beads to the pellet, bead beating, mix with the supernatant, and centrifuge at 12,300g for 10 minutes.

3. After removing the supernatant, add 1ml of D.W to the pellet, vortex, and centrifuge at 12,300xg for 10 minutes.

4. After removing the supernatant, add 100ul of Extraction buffer (5.0% resin) to the pellet, vortex, and boil at 100℃ for 20 minutes.

5. Centrifuge at 12,300xg for 5 minutes and use the supernatant as nucleic acid.

As a result, the real-time PCR results according to the change in the number of washes for A. fumigatus and A. flavus samples are shown in [Table 4].

Sample protocol Concentration (CFU/mL) 10^5 10^4 10^3 10^2 10^1 A. fumigatus 2nd change protocol (Wash 3 times) 30.33 35.78 37.7 39.8 42.16 3rd change protocol (1 wash) 28.25 32.99 35.74 37.17 37.98 A. flavus 2nd change protocol (Wash 3 times) 28.35 29.72 39.19 41.15 41.59 3rd change protocol (1 wash) 25.73 27.74 33.73 40.11 40.88

In other words, when the wash step was reduced to one in the second modified protocol that added bead beating, the efficiency of extracted nucleic acids was confirmed to be better than the existing three-step wash protocol. Therefore, the optimal protocol was to set the resin concentration to 5%, add a bead beating step in the lysis step, and simplify the wash step from 3 steps to 1 step. The final nucleic acid extraction method of the present invention is as follows.

1. Mix 500ul of sample (sputum) well and centrifuge at 12,300g for 10 minutes.

2. Pour the supernatant into a new tube, add an equal amount of beads to the pellet, bead beat 3 times for 30 seconds, mix with the supernatant, and centrifuge at 12,300g for 10 minutes.

3. After removing the supernatant, add 1ml of D.W to the pellet, vortex, and centrifuge at 12,300xg for 10 minutes.

4. After removing the supernatant, add 100ul of Extraction buffer (5.0% resin) to the pellet, vortex, and boil at 100℃ for 20 minutes.

5. Centrifuge at 12,300xg for 5 minutes and use the supernatant as nucleic acid.

Composition of extraction buffer: 5% Chelex-100 (Bio-Rad, Hercules, CA, USA) resin

Comparison of the amount and purity of nucleic acids extracted by the method of the present invention and the existing method

In order to determine whether the quantity and purity of nucleic acids extracted when using the method of the present invention are superior to those of the existing method, the nucleic acid extracted from sputum was analyzed using the method of the invention and the existing nucleic acid extraction method, QIAamp DNA Mini Kit (Qiagen). Purity was confirmed by measuring absorbance using a nanodrop.

Using the four ATCC Aspergillus standard strains shown below, residual sputum to be discarded from patients not suspected of having respiratory infections was spiked and nucleic acids were extracted using each method.

The spiked sample to be used in the experiment was made by adding 450uL of sputum to 50uL of the standard strain solution at a concentration of 1.8 ~ 5 x 10 ⁶ CFU/ml to make a total of 500uL of the spiked sample. The method of the present invention is as described above, and the control method (Qiagen DNA mini kit nucleic acid extraction method) is as follows.

1. Put 500ul of sample into a 1.5ml tube and add 20ul QIAGEN protease.

2. Add 500ul of AL buffer and vortex for 15s.

3. Incubate at 56℃ for 10 minutes and spindown.

4. Add 500ul of 100% ethanol and spindown after 15s vortex.

5. Place the mixture from step 4 into a 710ul QIAamp mini spin column and centrifuge at 6000 x g for 1 minute.

6. Put the remaining 710ul from step 5 into the QIAamp mini spin column once more and centrifuge at 6000 x g for 1 minute.

7. After removing the 2ml collection tube, place it in a new 2ml collection tube, add 500ul of AW1 buffer, and centrifuge at 6000 x g for 1 minute.

8. After removing the 2ml collection tube, place it in a new 2ml collection tube, add 500ul of AW2 buffer, and centrifuge at full speed for 3 minutes.

9. After removing the 2ml collection tube, centrifuge at full speed for 1 minute in a new 2ml collection tube.

10. Place the QIAamp mini spin column in a 1.5ml tube, add 100ul of AE buffer, leave at room temperature for 1 minute, centrifuge at 6000 x g for 1 minute, and use as template nucleic acid.

When measuring absorbance using a nanodrop, A260 refers to the wavelength of the nucleotides that make up nucleic acids, and A280 refers to the main wavelength of proteins containing trypsin. Therefore, the highest purity is achieved when the A260/A280 ratio is 1.7 - 2.0, and if it is lower than this, it can be interpreted as a case where protein-derived impurities are mixed in the extracted nucleic acid.

The amount of extracted nucleic acid when using the nucleic acid extraction method of the present invention and the Qiagen kit as an existing control method is shown in [Table 5] below.

Nucleic acid extraction method fungus Concentration (ng/uL) Amount of extracted nucleic acid
(concentration x elution volume) A260/A280 invention method A. fumigatusA. terreus
A. flavus
A. niger 45.25
32.6
19.75
60.23 452ng
326ng
197ng
602ng 1.26
1.20
1.41
1.2 Qiagen kit A. fumigatusA. terreus
A. flavus
A. niger 4.17
3.16
3.01
7.3 41ng
31ng
30ng
73ng 1.92
2.3
1.61
2.2

As a result, when using the existing nucleic acid extraction method, Qiagen Kit, A260/A280 was between 1.6 and 2.3, but when using the invented method, it was lower, around 1.2 - 1.4. Although the purity of the nucleic acid extracted using the invention method was measured to be somewhat low, it was confirmed that the amount of extracted nucleic acid showed a difference of 2 to more than 10 times.

Comparison of minimum detection limit concentrations of nucleic acids

The minimum detection limit concentration of the extracted nucleic acid was compared using the invented method and the existing QIAamp DNA Mini Kit (Qiagen).

Using the ATCC Aspergillus standard strain solution of known concentration ( ⁶ was diluted to a certain concentration by spiking, and nucleic acids were extracted using each method for various concentrations. Nucleic acids were extracted three times using one extraction method for one concentration.

The Ct value was confirmed by performing real-time PCR using the extracted nucleic acid using a species-specific primer/probe. The minimum limit of detection (LOD) was designated as the minimum concentration value at which all three nucleic acids extracted from the same bacterial species using the same extraction method were detected in real-time PCR (Cut off Ct value: 40). The results are shown in [Table 6] below.

Extraction method fungus Concentration (CFU/mL) Limit of detection (Mean ct at detection threshold) 10 ⁵ 10 ⁴ 10 ³ 10 ² 10 ¹ invention method A. fumigatus
A. terreus
A. flavus
A. niger Y/Y/Y
Y/Y/Y
Y/Y/Y
Y/Y/Y Y/Y/Y
Y/Y/Y
Y/Y/Y
Y/Y/Y Y/Y/Y
Y/Y/Y
Y/Y/Y
Y/Y/Y Y/Y/Y
Y/Y/Y
Y/Y/Y
Y/Y/Y N/Y/N
Y/Y/Y
Y/Y/Y
Y/Y/Y 10^2(31.61)
10^1(33.02)
10^1(41.69)
10^1(35.84) Qiagen kit A. fumigatus
A. terreus
A. flavus
A. niger Y/Y/Y
Y/Y/Y
Y/Y/Y
Y/Y/Y Y/Y/Y
Y/Y/Y
Y/Y/Y
Y/Y/Y Y/Y/Y
Y/Y/Y
Y/Y/Y
Y/Y/Y Y/Y/Y
Y/Y/Y
Y/Y/Y
Y/Y/Y N/Y/N
N/Y/Y
Y/Y/Y
Y/Y/Y 10^2(42.85)
10^2(40.79)
10^1(41.81)
10^1(43.22)

As a result, when using the existing nucleic acid extraction method, Qiagen Kit, the other two bacterial species except A. fumigatus and A. terreus showed a LOD value of 10 ¹ CFU/mL, but when extracted using the invented method, A. fumigatus It was confirmed that all three bacterial species except 10 ¹ CFU/mL LOD value was shown. For A. niger and A. flavus, the LOD in the two nucleic acid extraction methods showed the same LOD value of 10 ¹ CFU/mL, but the Ct value when performing real-time PCR using the nucleic acid extracted by the method of the invention was lower. It was confirmed that the efficacy of nucleic acids extracted using BoA's method was better in terms of sensitivity.

In summary, it was confirmed that the nucleic acid extracted by the invention method was superior to the existing Qiagen Kit in terms of sensitivity to the four representative Aspergillus sp.

Clinical application results

Using the residual sputum sample in which Aspergillus species was identified by MALDI-TOF in fungus culture, nucleic acids were extracted using the invented method and the Qiagen kit, and the results were confirmed by real-time PCR to compare and evaluate performance. Nucleic acids were extracted in duplicate from the sputum residual specimen scheduled for disposal using the invention method and the Qiagen method, and were tested using real-time PCR.

The results are shown in [Table 7] below.

Target species Specimen After extraction with Qiagen Kit
Real-time PCR results
(Ct value) After extraction using the invented method
Real-time PCR results
(Ct value) One ^st 2 ^nd Mean One ^st 2 ^nd Mean A. fumigatus CASE 1
CASE 2
CASE 3
CASE 4
CASE 5 33.37
35.07
36.87
31.47
28.72 33.02
32.11
34.69
40.47
28.55 33.02
33.59
35.78
35.97
28.63 32.01
31.18
35.43
27.40
27.72 30.74
31.06
33.68
31.06
27.68 31.37
31.12
34.55
29.23
27.7 A. niger CASE 6CASE 7
CASE 8 16.12
20.37
24.48 13.12
23.44
17.22 14.62
21.90
20.85 14.12
12.43
15.71 13.12
19.64
15.55 13.62
16.03
15.63 A. terreus CASE 9
CASE 10
CASE 11 30.28
31.07
30.94 27.07
29.01
29.25 28.67
30.04
30.09 28.37
27.22
23.66 26.51
22.31
21.11 27.44
24.76
22.38 A. flavus CASE 12
CASE 13
CASE 14
CASE 15
CASE 16 37.52
32.07
38.39
27.00
40.23 29.25
34.32
35.15
28.30
33.96 33.38
33.19
36.77
27.65
37.09 32.07
25.93
30.43
22.70
30.55 28.68
29.74
30.76
27.78
32.22 30.37
27.83
30.59
25.24
31.38

As a result, nucleic acids were extracted from a total of 16 sputum residual samples using each method and real-time PCR was performed. As a result, when PCR was performed with nucleic acids extracted using the invented method for 16 samples, the Ct value was lower. . Therefore, when the invented method is used as a nucleic acid extraction method for sputum samples, it was confirmed with actual samples that it can be detected more sensitively, confirming that it is superior to the existing method.

SEQUENCE LISTING <110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Method for Extracting Nucleic Acids of Aspergillus Species <130> 1069855 <160> 12 <170> PatentIn version 3.2 <210> 1 <211> 15 <212> DNA <213> Artificial <220> <223> A. fum-For <400> 1 gcccgccgtt tcgac 15 <210> 2 <211> 21 <212> DNA <213> Artificial <220> <223> A. fum-Probe <400> 2 cccgccgaag accccaacat g 21 <210> 3 <211> 27 <212> DNA <213> Artificial <220> <223> A. fum-Rev <400> 3 ccgttgttga aagttttaac tgattac 27 <210> 4 <211> 21 <212> DNA <213> Artificial <220> <223> A. flav-For <400> 4 cgagtgtagg gttcctagcg a 21 <210> 5 <211> 31 <212> DNA <213> Artificial <220> <223> A. flav-Probe <400> 5 tcccacccgt gtttactgta ccttagttgc t 31 <210> 6 <211> 15 <212> DNA <213> Artificial <220> <223> A. flav-Rev <400> 6 ccggcggcca tgaat 15 <210> 7 <211> 17 <212> DNA <213> Artificial <220> <223> A. nig-For <400> 7 gccggagacc ccaacac 17 <210> 8 <211> 30 <212> DNA <213> Artificial <220> <223> A. nig-Probe <400> 8 aatcaactca gactgcacgc tttcagacag 30 <210> 9 <211> 26 <212> DNA <213> Artificial <220> <223> A. nig-Rev <400> 9 tgttgaaagt tttaactgat tgcatt 26 <210> 10 <211> 22 <212> DNA <213> Artificial <220> <223> A. terr-For <400> 10 cattaccgag tgcgggtctt ta 22 <210> 11 <211> 25 <212> DNA <213> Artificial <220> <223> A. terr-Probe <400> 11 cccaacctcc cacccgtgac tattg 25 <210> 12 <211> 17 <212> DNA <213> Artificial <220> <223> A. terr-Rev <400> 12 cccgccgaag caacaag 17

Claims (14)

A method for extracting nucleic acids of Aspergillus species comprising the following steps (a) to (e):
(a) centrifuging the sample and separating the supernatant and the pellet;
(b) adding beads to the pellet, mixing them with the supernatant, and then centrifuging;
(c) adding distilled water to the silt and centrifuging it;
(d) Homogenizing the pellet by adding a chelating resin after removing the supernatant; and
(e) heating the homogenized sample and then centrifuging to recover the supernatant containing nucleic acids of Aspergillus species.
According to paragraph 1,
A method for extracting nucleic acid of Aspergillus species, wherein the sample in step (a) is a respiratory specimen.
According to paragraph 2,
A method of extracting nucleic acid of Aspergillus species, wherein the respiratory sample is at least one selected from the group consisting of sputum, bronchial lavage fluid, and bronchoalveolar lavage fluid.
According to paragraph 1,
A method for extracting nucleic acids of Aspergillus species, characterized in that the bead beating in step (b) is performed once to five times for 10 to 60 seconds.
According to paragraph 1,
A method for extracting nucleic acids of Aspergillus species, wherein step (c) is performed one to three times.
According to paragraph 1,
A method for extracting nucleic acids of Aspergillus species, wherein the centrifugation in steps (a) to (c) is performed for 5 to 20 minutes.
According to paragraph 1,
A method for extracting nucleic acids of Aspergillus species, wherein the centrifugation in steps (a) to (c) is performed at 11,000 to 15,000 rpm.
According to paragraph 1,
A method for extracting nucleic acids of Aspergillus species, characterized in that the concentration of the chelating resin in step (d) is 2.5% to 5% (w/v).
According to paragraph 1,
A method for extracting nucleic acids of Aspergillus species, characterized in that the heating in step (e) is boiled at 90 to 110 ° C. for 5 to 30 minutes.
According to paragraph 1,
A method for extracting nucleic acids of Aspergillus species, wherein the centrifugation in step (e) is performed at 11,000 to 15,000 rpm for 4 to 6 minutes.
According to paragraph 1,
The method is a method for extracting nucleic acids of Aspergillus species, characterized in that the detection limit is 10 ¹ CFU/ml.
According to paragraph 1,
The Aspergillus species include Aspergillus fumigatus , Aspergillus flavus, Aspergillus niger , and Aspergillus terreus . A method of extracting nucleic acid of Aspergillus species, characterized in that it is one or more species selected from the group consisting of.
A method of performing PCR amplification using nucleic acid extracted by the method of any one of claims 1 to 12.
A method for detecting Aspergillus species comprising the method of claim 13.