CN114150076A - Primer probe and method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid - Google Patents
Primer probe and method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid Download PDFInfo
- Publication number
- CN114150076A CN114150076A CN202110734001.9A CN202110734001A CN114150076A CN 114150076 A CN114150076 A CN 114150076A CN 202110734001 A CN202110734001 A CN 202110734001A CN 114150076 A CN114150076 A CN 114150076A
- Authority
- CN
- China
- Prior art keywords
- seq
- primers
- probe
- mycobacterium tuberculosis
- drug
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer probe for detecting rifampicin and isoniazid drug-resistant mutations of mycobacterium tuberculosis, which is mainly used for detecting a plurality of mutation sites of rifampicin and isoniazid drug-resistant genes of the mycobacterium tuberculosis by utilizing thermostable DNA polymerase (capable of having 5' nuclease activity) and an asymmetric PCR method.
Description
The technical field is as follows:
the invention belongs to the technical field of nucleic acid detection, and particularly relates to a primer probe and a method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid.
Background art:
2016 tuberculosis remains the tenth leading cause of death worldwide, especially in low-income and medium-low-income countries, which are ranked more advanced, and is currently still one of the most threatening infectious diseases to humans worldwide. According to the statistical estimation of the WHO pulmonary tuberculosis report, the latent tuberculosis infection population is about 17 hundred million and accounts for about 1/4 of the whole population. About 1000 million people worldwide in 2018 have tuberculosis, tuberculosis burden difference of various countries is large, incidence rate is distributed between 5/10 ten thousands and 500/10 thousands in some countries, and average about 130/10 thousands of people. From a geographical point of view, distribution is mainly in southeast asia (44%), africa (24%), the western pacific region (18%), the east mediterranean (8%), america (3%) and europe (3%); from the national distribution, the new patients in 30 tuberculosis-high-burden countries still account for 87% of the new patients worldwide, wherein the new patients in 8 countries such as india (27%), china (9%), indonesia (8%), philippines (6%), pakistan (6%), nigeria (4%), bangladesh (4%) and south africa (3%) account for 2/3 worldwide. The number of new estimated tuberculosis patients in China is 86.6 ten thousand (88.9 ten thousand in 2017), the estimated tuberculosis incidence rate is 61/10 ten thousand (63/10 ten thousand in 2017), and the estimated tuberculosis incidence rate in 30 tuberculosis-burdened countries is highest at 28 th, which is higher than Russia (54/10 ten thousand) and Brazil (45/10 ten thousand).
Tuberculosis resistance remains a serious public problem, and in 2018, rifampicin resistance (78% of cases are multidrug resistance) occurs in about 48.4 new tuberculosis cases all over the world, multidrug resistance or rifampicin resistance (MDR/RR-TB) occurs in about 3.4% of new tuberculosis cases and 18% of existing treatment cases, and the number of Chinese rifampicin-resistant tuberculosis patients calculated according to the number of discovered etiologically positive tuberculosis patients is about 2.5 ten thousand. The method for identifying the drug resistance of tuberculosis mainly comprises a drug resistance test of tubercle bacillus, a rapid molecular test and a sequencing method. The traditional tubercle bacillus drug resistance test detection method is mainly based on bacterial growth, the operation is complex, and the culture period is at least more than 4 weeks; the sequencing method can detect various unknown mutations and mutation properties, but the sensitivity of the first-generation sequencing is not enough, and the cost of the second-generation sequencing is too high. Therefore, it is necessary to establish a method for rapidly identifying the drug resistance gene of tuberculosis, which can guide the tuberculosis patients to scientifically, reasonably and effectively use drugs. At present, a molecular biological method for identifying drug-resistant genes of mycobacterium tuberculosis mainly utilizes a melting curve method and a reverse dot blot hybridization (RBD) method of asymmetric PCR amplification, wherein the RBD method is a biological method which combines a PCR technology and a reverse dot blot hybridization technology and can detect drug-resistant mutation. The asymmetric PCR melting curve analysis method is simple to operate, high in detection sensitivity and wider in application.
The information disclosed in this background section is only for enhancement of understanding of the general background of the invention and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person skilled in the art.
The invention content is as follows:
the invention aims to detect a plurality of mutation sites of rifampicin and isoniazid resistant genes of mycobacterium tuberculosis by adopting thermostable DNA polymerase (capable of having 5' nuclease activity) and an asymmetric PCR method, thereby overcoming the defects in the prior art.
In order to achieve the above object, the present invention provides a primer probe for detecting rifampicin and isoniazid resistance mutations of mycobacterium tuberculosis, comprising: designing primers of SEQ ID No. 1-No. 2 and probes of SEQ ID No. 3-No. 5 according to a 81bp drug-resistant core region of the mycobacterium tuberculosis, and covering and detecting 511, 513, 516, 522, 526, 531 and 533 sites of a rifampicin drug-resistant RpoB Gene (Gene ID: 888164); designing primers of SEQ ID No. 6-No. 7 and a probe of SEQ ID No.8 according to the region of isoniazid drug-resistant KatG gene (GeneID: 885638), and covering and detecting 315 sites of the KatG gene; primers of SEQ ID No. 9-No. 10 and a probe of SEQ ID No.11 are designed according to the region of the mabA (fabG1) -inhA promoter gene (GeneID: 886523), and sites-17, -15 and-8 of the mabA (fabG1) -inhA promoter gene are detected in a covering mode.
Preferably, in the above technical scheme, the 5 'end of the probe can be fluorescently labeled with FAM, VIC/HEX/JOE, ROX, CY3, CY5, etc., respectively, and the 3' end can be quenched with a fluorescent group such as BHQ1, BHQ2, BHQ3, DABCYL, TAMRA, etc.
A kit for detecting rifampicin and isoniazid drug-resistant mutation of mycobacterium tuberculosis comprises a primer probe reaction solution, wherein the primer probe reaction solution comprises an A reaction tube and a B reaction tube, the A reaction tube comprises 1 pair of primers and 2 probes aiming at an RpoB gene, and 1 pair of primers and 1 probe aiming at a KatG gene; the B reaction tube comprises 1 pair of primers and 1 probe for the RpoB gene, and 1 pair of primers and 1 probe for the mabA (fabG1) -inhA promoter gene region.
Preferably, in the above technical solution, in the reaction tube a: 1 pair of primers and 2 probes of the RpoB gene 1 are specifically primers of SEQ ID No. 1-No. 2 and probes of SEQ ID No. 3-No. 4; 1 pair of primers and 1 probe of the KatG gene are specifically primers of SEQ ID No. 6-No. 7 and a probe of SEQ ID No. 8;
preferably, in the above technical solution, in the reaction tube B: 1 pair of primers and 1 probe of the RpoB gene 1 are specifically primers of SEQ ID No. 1-No. 2 and a probe of SEQ ID No. 5; the 1 pair of primers and 1 probe in the gene region of the mabA (fabG1) -inhA promoter are specifically the primers of SEQ ID No. 9-No. 10 and the probe of SEQ ID No. 11.
The primer probe for rapidly detecting the drug-resistant gene of the mycobacterium tuberculosis comprises:
RpoB primer 1: 5 'CGCGATCAAGGAGTTCTTCG 3' (SEQ ID No. 1);
RpoB primer 2: 5 'GTCGCGGACCTCCAGCCC 3' (SEQ ID No. 2);
RpoB probe 1: 5 'AGCTGAGCCAATTCATGGACCAG 3' (SEQ ID No. 3);
RpoB probe 2: 5 'CTGTCGGGGTTGACCCACAA 3' (SEQ ID No. 4);
RpoB probe 3: 5 'ACTGTCGGCGCTGGGGCCCGG 3' (SEQ ID No. 5);
KatG primer 1: 5 'GAAGAGCTCGTATGGCA 3' (SEQ ID No. 6);
KatG primer 2: 5 'GCCGTACAGGATCTCGAG 3' (SEQ ID No. 7);
KatG probe: 5 'TCACCAGCGGCATCGAGGTCGT 3' (SEQ ID No. 8);
inhA primer 1: 5 'GCTCGTGGACATACCG 3' (SEQ ID No. 9);
inhA primer 2: 5 'AACGGGATACGAATGGGG 3' (SEQ ID No. 10);
inhA probe: 5 'CGCGGCGAGACGATAGGTTGTCGG 3' (SEQ ID No. 11);
a method for rapidly identifying drug-resistant genes of mycobacterium tuberculosis specifically comprises the following steps:
extraction of template DNA: extracting DNA of a sample to be detected, wherein the sample to be detected is a sputum sample or a separation culture which is identified as containing mycobacterium tuberculosis; asymmetric PCR reaction: preparing two groups of 20 mul reaction systems in 200 mul PCR tubes: 8 mul of primer mixed liquid A, 9 mul of nucleic acid amplification reaction liquid, 0.9 mul of DNA polymerase, 0.1 mul of UNG enzyme and 2 mul of template DNA; 8 mul of primer mixed liquid B, 9 mul of nucleic acid amplification reaction liquid, 0.9 mul of DNA polymerase, 0.1 mul of UNG enzyme and 2 mul of template DNA; amplifying the reaction tube in a fluorescent quantitative PCR instrument; and (3) performing melting curve analysis after DNA polymerase and asymmetric PCR amplification, and judging whether tuberculosis drug-resistant mutation exists or not according to the change of the Tm value.
Preferably, in the above technical scheme, the primer mixture A containing the 4 specific primers is specifically: the probes of SEQ ID No. 1-2, SEQ ID No. 6-7 and 3 are specifically as follows: SEQ ID No.3, SEQ ID No.5 and SEQ ID No.8, wherein the concentration of primers SEQ ID No.1 and SEQ ID No.6 is 10-50 nmol, the concentration of primers SEQ ID No.1 and SEQ ID No.6, and the concentration of probes SEQ ID No.3, SEQ ID No.5 and SEQ ID No.8 is 100-500 nmol; the primer mixed solution B contains the 4 specific primers, and specifically comprises the following components: the probes of SEQ ID No. 1-2, SEQ ID No. 9-10 and 2 are specifically as follows: SEQ ID No.4 and SEQ ID No.11, wherein the concentration of primers SEQ ID No.1 and SEQ ID No.9 is 10-50 nmol, the concentration of primers SEQ ID No.2 and SEQ ID No.10 and the concentration of probes SEQ ID No.4 and SEQ ID No.11 are 100-500 nmol, and the reaction solution contains 0.1-1 mM dNTPs, 2 XPCR reaction buffer solution, 2-4 mM MgCl2(ii) a The DNA polymerase can be common Taq DNA polymerase, and the concentration is 1-5U/mul.
Preferably, in the above technical solution, the PCR amplification and melting curve analysis program is as follows:
the method comprises the following steps: 5min at 37 ℃ for 1 cycle;
step two: 10min at 95 ℃ for 1 cycle;
step three: 10s at 95 ℃, 10-15 s at 60 ℃, 20-30 s at 72 ℃ and 15 cycles;
step four: collecting channel fluorescence signals of FAM, VIC/HEX/JOE, ROX, CY3, CY5 and the like at the temperature of 95 ℃ for 10s, 55 ℃ for 10-15 s, 72 ℃ for 20-30 s, 35 cycles and 72 ℃;
step five: collecting channel fluorescence signals of FAM, VIC/HEX/JOE, ROX, CY3, CY5 and the like at the temperature of 95 ℃ for 20s and 40-80 ℃ every 1 ℃.
Preferably, in the above technical solution, the determining of the change in the Tm value specifically includes: performing fluorescence quantitative PCR asymmetric amplification and melting curve analysis on the reaction system, and judging as drug-resistant mutation of the mycobacterium tuberculosis when the Tm value of a detection sample is more than 2 ℃ lower than that of a control tube; when the detected sample has double peaks, one peak Tm value is consistent with the control Tm value (the difference is less than 1), and one peak Tm value is lower than the control Tm value by more than 2 ℃, the result can be interpreted as the mycobacterium tuberculosis hybrid drug-resistant mutation.
Compared with the prior art, the invention has the following beneficial effects:
the mutation of the present invention is provided on a probe, and in order to increase the resolution of the probe, a partial base mutation is introduced into a base sequence on the probe to more easily distinguish a drug-resistant mutation.
The method ensures that the probe in the system is excessive, and the residual probe after PCR amplification and shearing can be subjected to melting curve analysis with the generated product single-stranded DNA.
Description of the drawings:
FIG. 1 is the melting curve analysis of the wild type and 516 locus resistance mutation of the A reaction tube for detecting the mycobacterium tuberculosis RpoB gene.
FIG. 2 is the melting curve analysis of the wild type and 531 locus resistance mutation of the A reaction tube for detecting the mycobacterium tuberculosis RpoB gene.
FIG. 3 is the melting curve analysis of the wild type and 315 site drug resistant mutation of the A reaction tube for detecting Mycobacterium tuberculosis KatG gene.
FIG. 4 is the melting curve analysis of the B reaction tube for detecting the wild type of the mycobacterium tuberculosis RpoB gene and the 526 locus drug resistance mutation.
FIG. 5 is the melting curve analysis of the B reaction tube for detecting the wild type and-15 site drug resistance mutation of the Mycobacterium tuberculosis mabA (fabG1) -inhA promoter gene.
FIG. 6 is melting curve analysis of 50% drug resistance mutation at 516 locus of the A reaction tube for detecting Mycobacterium tuberculosis RpoB gene.
FIG. 7 is a melting curve analysis map of national reference products N1-N10 for detecting the isoniazid drug-resistant gene of Mycobacterium tuberculosis in the A reaction tube.
FIG. 8 is a melting curve analysis chart of national reference products N1-N10 for a reagent for detecting a mycobacterium tuberculosis isoniazid drug-resistant gene in a B reaction liquid tube.
FIG. 9-FIG. 11 are analysis spectra of katG S315T1 site melting curve of national reference substance for detecting drug-resistant gene of Mycobacterium tuberculosis at different concentrations and at different drug-resistant ratios.
The specific implementation mode is as follows:
the following detailed description of specific embodiments of the invention is provided, but it should be understood that the scope of the invention is not limited to the specific embodiments.
Throughout the specification and claims, unless explicitly stated otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or component but not the exclusion of any other element or component.
Example 1
Preparation of an asymmetric PCR amplification reaction system:
(1) nucleic acid amplification reaction solution: 100mM dNTPs, 10 XPCR reaction buffer, 1M MgCl2dNTPs and MgCl2Final concentrations were 300uM and 3 mM;
(2) primer probe reaction solution a: the primer probe reaction solution A contains 25nmol RpoB primer 1, 25nmol KatG primer 1, 200nmol RpoB primer 2, 200nmol KatG primer 2, 200nmol RpoB probe 1, 200nmol RpoB probe 3 and 200nmol KatG probe in SEQ ID No. 1;
(3) primer probe reaction solution B: comprises 0.2pmol RpoB primer 1, 0.2pmol inhA primer 1, 10pmol RpoB primer 2, 10pmol inhA primer 2, 10pmol RpoB probe 2, 10pmol inhA probe;
(4) DNA polymerase: taq DNA polymerase with the concentration of 5U/mul is used in each reaction system by 0.9 mul;
(5) UNG enzyme: the concentration is 5U/mul, and 0.1 mul is used in each reaction system;
(6) fluorescent quantitative PCR instrument: ABI 7500, Roche LightCycler 480, Bio-Rad CFX96, and the like.
The drug resistance of the mycobacterium tuberculosis is detected by the reaction system according to the following method. The sample to be tested in this embodiment is sputum of a patient identified as Mycobacterium tuberculosis, and of course, may be a Mycobacterium tuberculosis isolated culture of a patient identified as Mycobacterium tuberculosis.
1. Collecting a sputum sample:
the sputum specimen is collected according to WS 288-2017 of pulmonary tuberculosis diagnosis. Can collect the instant phlegm, early morning phlegm and night phlegm of the patient. The qualified sputum specimen is the sputum with the properties of purulent sample, cheese sample or purulent mucus sample, and the amount of the sputum is preferably 3-5 mL. The container for keeping the sputum specimen adopts an international universal screw cap sputum flask or a plastic box which has a diameter of 40mm and a height of 20mm and can be sealed by a screw cap. The sputum specimen is preserved and detected in time, and the detection is finished within 3 days of preservation at the temperature of 2-8 ℃, and the sputum specimen can be preserved for 4 months at the temperature of-20 ℃ and 12 months at the temperature of-70 ℃. Repeated freeze thawing of the sample is avoided, the number of freeze thawing times cannot exceed 5, and the number of freeze thawing times cannot exceed 3 days by adopting ice bag low-temperature transportation.
2. Extracting template DNA:
1) placing 3ml of sputum specimen at room temperature;
2) adding an isometric sputum digestive juice (phosphate buffer solution containing 1g/L proteinase K) into the sputum sample, shaking and mixing uniformly, and carrying out digestion treatment;
3) after digesting for 5 minutes, adopting QIAamp Viral RNA Mini Kit of Qiagen company to extract nucleic acid;
4) the extracted nucleic acid is used as template DNA.
3. Asymmetric amplification reaction and dissolution curve analysis:
the formulation of reaction system A/B is shown in the following table:
the enzyme mixture comprises DNA polymerase and UNG enzyme.
Amplification procedure and melting curve analysis were as follows:
the method comprises the following steps: 5min at 37 ℃ for 1 cycle;
step two: 95 ℃, 10min, 1 cycle;
step three: 95 ℃, 10s, 60 ℃, 10-15 s, 72 ℃, 20-30 s, 15 cycles;
step four: collecting channel fluorescence signals of FAM, VIC/HEX/JOE, ROX, CY3, CY5 and the like at the temperature of 95 ℃, 10 seconds, 55 ℃, 10 seconds to 15 seconds, 72 ℃, 20 seconds to 30 seconds and 35 cycles;
step five: collecting channel fluorescent signals of FAM, VIC/HEX/JOE, ROX, CY3, CY5 and the like at the temperature of 95 ℃ for 20 seconds and 40-80 ℃ every 1 ℃.
4. And (4) judging a result:
and (3) analyzing a melting curve Tm value, and if the difference between the detected Tm value of the sample and the Tm value of a wild control is more than 2 ℃, determining that the mycobacterium tuberculosis drug-resistant mutation exists. When the detected sample has double peaks, one peak Tm value is consistent with the wild type control Tm value, and one peak Tm value is lower than the control Tm value by more than 2 ℃, the result can be interpreted as the mycobacterium tuberculosis heterozygosis drug-resistant mutation.
Example 2
Reaction system performance test-national reference substance detection for mycobacterium tuberculosis isoniazid drug-resistant gene detection reagent
1. National negative reference detection
The 10 negative reference substances are all mycobacterium tuberculosis sensitive to isoniazid, and the concentration is 1 multiplied by 105 CFU/ml. By adopting the PCR reaction system, 200ul of each reference product is extracted and detected, and the detection result is isoniazid sensitive type, thereby meeting the detection requirements of national reference products.
2. National negative reference detection
And (3) detecting 16 national positive reference substances, wherein all mutation sites covered under the system can be accurately detected, and detection results all meet corresponding requirements.
3. Minimum detection limit reference detection
And preparing detection limit reference substances with different concentrations and different drug-resistant ratios by using mixed bacteria liquid reference substances of sensitive bacteria and drug-resistant bacteria according to the following table, and respectively carrying out amplification detection and melting curve analysis.
At 1X 104 Under the concentration of CFU/ml bacterial liquid, 5% isoniazid katG S315T1 site mutation can be detected; at 1X 103 Under the concentration of CFU/ml bacterial liquid, 25% isoniazid katG S315T1 site mutation can be detected; at 1X 102 Under the CFU/ml bacterial liquid concentration, 50% isoniazid katG S315T1 site mutation can be detected. The primer probe and the method for combining the mycobacterium rifampicin and isoniazid drug-resistant mutation have high sensitivity.
The foregoing descriptions of specific exemplary embodiments of the present invention have been presented for purposes of illustration and description. It is not intended to limit the invention to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The exemplary embodiments were chosen and described in order to explain certain principles of the invention and its practical application to enable one skilled in the art to make and use various exemplary embodiments of the invention and various alternatives and modifications as are suited to the particular use contemplated. It is intended that the scope of the invention be defined by the claims and their equivalents.
Sequence listing
<110> Jiangsu Shuo Biotechnology Ltd
<120> primer probe and method for detecting rifampicin and isoniazid drug-resistant mutation of mycobacterium tuberculosis
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgcgatcaag gagttcttcg 20
<210> 2
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtcgcggacc tccagccc 18
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
agctgagcca attcatggac cag 23
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ctgtcggggt tgacccacaa 20
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
actgtcggcg ctggggcccg g 21
<210> 6
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gaagagctcg tatggca 17
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gccgtacagg atctcgag 18
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tcaccagcgg catcgaggtc gt 22
<210> 9
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gctcgtggac ataccg 16
<210> 10
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
aacgggatac gaatgggg 18
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cgcggcgaga cgataggttg tcgg 24
Claims (9)
1. A primer probe for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid is characterized in that: the method comprises the following steps: designing primers of SEQ ID No. 1-No. 2 and probes of SEQ ID No. 3-No. 5 according to a 81bp drug-resistant core region of the mycobacterium tuberculosis to cover and detect sites 511, 513, 516, 522, 526, 531 and 533 of a rifampicin drug-resistant RpoB gene; designing primers of SEQ ID No. 6-No. 7 and a probe of SEQ ID No.8 according to the isoniazid drug-resistant KatG gene region, and covering and detecting 315 sites of the KatG gene; primers of SEQ ID No. 9-No. 10 and a probe of SEQ ID No.11 are designed according to the gene region of the mabA (fabG1) -inhA promoter, and sites-17, -15 and-8 of the mabA (fabG1) -inhA promoter gene are detected in a covering mode.
2. The primer probe for detecting rifampicin and isoniazid resistance mutations of mycobacterium tuberculosis according to claim 1, characterized in that: the 5 'end of the probe can be respectively marked by FAM, VIC/HEX/JOE, ROX, CY3, CY5 and the like by fluorescein, and the 3' end can be marked by BHQ1, BHQ2, BHQ3, DABCYL, TAMRA and other quenching fluorescent groups.
3. A kit for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid comprises a primer probe reaction solution, and is characterized in that: the primer probe reaction solution comprises a reaction tube A and a reaction tube B, wherein the reaction tube A comprises 1 pair of primers and 2 probes aiming at an RpoB gene, and 1 pair of primers and 1 probe aiming at a KatG gene; the B reaction tube comprises 1 pair of primers and 1 probe for the RpoB gene, and 1 pair of primers and 1 probe for the mabA (fabG1) -inhA promoter gene region.
4. The kit for detecting rifampicin and isoniazid resistance mutations of mycobacterium tuberculosis according to claim 3, characterized in that: in the A reaction tube:
1 pair of primers and 2 probes of the RpoB gene 1 are specifically primers of SEQ ID No. 1-No. 2 and probes of SEQ ID No. 3-No. 4;
the 1 pair of primers and 1 probe of the KatG gene are specifically primers of SEQ ID No. 6-No. 7 and a probe of SEQ ID No. 8.
5. The kit for detecting rifampicin and isoniazid resistance mutations of mycobacterium tuberculosis according to claim 3, characterized in that: in the B reaction tube:
1 pair of primers and 1 probe of the RpoB gene 1 are specifically primers of SEQ ID No. 1-No. 2 and a probe of SEQ ID No. 5;
the 1 pair of primers and 1 probe in the gene region of the mabA (fabG1) -inhA promoter are specifically the primers of SEQ ID No. 9-No. 10 and the probe of SEQ ID No. 11.
6. A method for rapidly identifying drug-resistant genes of mycobacterium tuberculosis is characterized by comprising the following steps: the method specifically comprises the following steps:
extraction of template DNA: extracting DNA of a sample to be detected, wherein the sample to be detected is a sputum sample or a separation culture which is identified as containing mycobacterium tuberculosis; asymmetric PCR reaction: preparing two groups of 20 mul reaction systems in 200 mul PCR tubes: 8 mul of primer mixed liquid A, 9 mul of nucleic acid amplification reaction liquid, 0.9 mul of DNA polymerase, 0.1 mul of UNG enzyme and 2 mul of template DNA; 8 mul of primer mixed liquid B, 9 mul of nucleic acid amplification reaction liquid, 0.9 mul of DNA polymerase, 0.1 mul of UNG enzyme and 2 mul of template DNA; amplifying the reaction tube in a fluorescent quantitative PCR instrument; and (3) performing melting curve analysis after DNA polymerase and asymmetric PCR amplification, and judging whether tuberculosis drug-resistant mutation exists or not according to the change of the Tm value.
7. The method for rapidly identifying drug-resistant genes of Mycobacterium tuberculosis as claimed in claim 6, wherein: the primer mixed solution A contains the 4 specific primers, and specifically comprises the following components: the probes of SEQ ID No. 1-2, SEQ ID No. 6-7 and 3 are specifically as follows: SEQ ID No.3, SEQ ID No.5 and SEQ ID No.8, wherein the concentration of primers SEQ ID No.1 and SEQ ID No.6 is 10-50 nmol, the concentration of primers SEQ ID No.1 and SEQ ID No.6, and the concentration of probes SEQ ID No.3, SEQ ID No.5 and SEQ ID No.8 is 100-500 nmol; the primer mixed solution B contains the 4 specific primers, and specifically comprises the following components: the probes of SEQ ID No. 1-2, SEQ ID No. 9-10 and 2 are specifically as follows: SEQ ID No.4 and SEQ ID No.11, wherein the concentration of primers SEQ ID No.1 and SEQ ID No.9 is 10-50 nmol, the concentration of primers SEQ ID No.2 and SEQ ID No.10 and the concentration of probes SEQ ID No.4 and SEQ ID No.11 are 100-500 nmol, and the reaction solution contains 0.1-1 mM dNTPs, 2 XPCR reaction buffer solution, 2-4 mM MgCl2(ii) a The DNA polymerase can be common Taq DNA polymerase, and the concentration is 1-5U/mul.
8. The method for rapidly identifying drug-resistant genes of Mycobacterium tuberculosis as claimed in claim 6, wherein: the PCR amplification and melting curve analysis procedure was as follows:
the method comprises the following steps: 5min at 37 ℃ for 1 cycle;
step two: 10min at 95 ℃ for 1 cycle;
step three: 10s at 95 ℃, 10-15 s at 60 ℃, 20-30 s at 72 ℃ and 15 cycles;
step four: collecting channel fluorescence signals of FAM, VIC/HEX/JOE, ROX, CY3, CY5 and the like at the temperature of 95 ℃ for 10s, 55 ℃ for 10-15 s, 72 ℃ for 20-30 s, 35 cycles and 72 ℃;
step five: collecting channel fluorescence signals of FAM, VIC/HEX/JOE, ROX, CY3, CY5 and the like at the temperature of 95 ℃ for 20s and 40-80 ℃ every 1 ℃.
9. The method for rapidly identifying drug-resistant genes of Mycobacterium tuberculosis as claimed in claim 6, wherein: the change judgment of the Tm value is specifically as follows: performing fluorescence quantitative PCR asymmetric amplification and melting curve analysis on the reaction system, and judging as drug-resistant mutation of the mycobacterium tuberculosis when the Tm value of a detection sample is more than 2 ℃ lower than that of a control tube; when the detected sample has double peaks, one peak Tm value is consistent with the control Tm value (the difference is less than 1), and one peak Tm value is lower than the control Tm value by more than 2 ℃, the result can be interpreted as the mycobacterium tuberculosis hybrid drug-resistant mutation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110734001.9A CN114150076A (en) | 2021-06-30 | 2021-06-30 | Primer probe and method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110734001.9A CN114150076A (en) | 2021-06-30 | 2021-06-30 | Primer probe and method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114150076A true CN114150076A (en) | 2022-03-08 |
Family
ID=80461750
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110734001.9A Pending CN114150076A (en) | 2021-06-30 | 2021-06-30 | Primer probe and method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114150076A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114540524A (en) * | 2022-04-01 | 2022-05-27 | 领航基因科技（杭州）有限公司 | Digital PCR detection kit for mycobacterium tuberculosis and drug resistance thereof |
| CN117448466A (en) * | 2023-10-18 | 2024-01-26 | 鲲鹏基因（北京）科技有限责任公司 | Composition, kit and method for detecting isoniazid resistance of mycobacterium tuberculosis |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845503A (en) * | 2010-06-10 | 2010-09-29 | 无锡锐奇基因生物科技有限公司 | Method and kit for detecting multi-drug resistant mycobacterium tuberculosis (MDR-TB) |
| US20100273146A1 (en) * | 2004-02-11 | 2010-10-28 | Timothy Brown | TB resistance assay |
| CN107034277A (en) * | 2017-04-27 | 2017-08-11 | 厦门大学 | A kind of method for detecting low abundance gene mutation |
| CN112941210A (en) * | 2021-02-07 | 2021-06-11 | 中山大学达安基因股份有限公司 | Kit and method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid |
-
2021
- 2021-06-30 CN CN202110734001.9A patent/CN114150076A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100273146A1 (en) * | 2004-02-11 | 2010-10-28 | Timothy Brown | TB resistance assay |
| CN101845503A (en) * | 2010-06-10 | 2010-09-29 | 无锡锐奇基因生物科技有限公司 | Method and kit for detecting multi-drug resistant mycobacterium tuberculosis (MDR-TB) |
| CN107034277A (en) * | 2017-04-27 | 2017-08-11 | 厦门大学 | A kind of method for detecting low abundance gene mutation |
| CN112941210A (en) * | 2021-02-07 | 2021-06-11 | 中山大学达安基因股份有限公司 | Kit and method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid |
Non-Patent Citations (2)
| Title |
|---|
| ANNA SAJDUDA ET AL.: "Molecular Characterization of Rifampin- and Isoniazid-Resistant Mycobacterium tuberculosis Strains Isolated in Poland", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| 柳清云 等: "双通道实时荧光PCR熔解曲线法检测结核分枝杆菌药物耐药相关基因突变", 《中华检验医学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114540524A (en) * | 2022-04-01 | 2022-05-27 | 领航基因科技（杭州）有限公司 | Digital PCR detection kit for mycobacterium tuberculosis and drug resistance thereof |
| CN117448466A (en) * | 2023-10-18 | 2024-01-26 | 鲲鹏基因（北京）科技有限责任公司 | Composition, kit and method for detecting isoniazid resistance of mycobacterium tuberculosis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5317430B2 (en) | Probe set, probe carrier, and fungal discrimination identification method | |
| CN109055502B (en) | Detection method, detection kit and application of invasive fungal infection | |
| US6469156B1 (en) | Rapid and sensitive method for detecting histoplasma capsulatum | |
| AU2006209416A1 (en) | Method of quantitatively analysing microorganism targeting rRNA | |
| CN114150076A (en) | Primer probe and method for detecting drug-resistant mutation of mycobacterium tuberculosis rifampicin and isoniazid | |
| Osman et al. | Microarray detection of fungal infection in pulmonary tuberculosis | |
| Sales et al. | Validation of two real-time PCRs targeting the PE-PGRS 20 gene and the region of difference 4 for the characterization of Mycobacterium bovis isolates. | |
| CN110093432B (en) | sRNA marker for distinguishing mycobacterium tuberculosis from BCG vaccine and application thereof | |
| CN103451302A (en) | Deafness susceptible gene mitochondrion 12SrDNA 1555A>G and 1494C>T mutant ratio detection kit | |
| CN111471800B (en) | Kit for detecting novel coronavirus and amplification primer composition thereof | |
| CN110819709A (en) | Method for detecting CYP2C9 and VKORC1 gene polymorphism by fluorescent quantitative PCR (polymerase chain reaction) | |
| US20050170358A1 (en) | Molecular identification of aspergillus species | |
| CN106868113A (en) | SNP marker and its application for identifying mycobacterium bovis | |
| CN115873979A (en) | Constant-temperature nucleic acid amplification RAA primer probe combination for detecting candida auricula and application thereof | |
| KR101765677B1 (en) | Primer set for detection of mycobacterium tuberculosis and non-Tuberculosis mycobacteria and use thereof | |
| CN112795677B (en) | Kit for identifying skin leishmania species | |
| US20100311040A1 (en) | Dna Fragments, Primers, Kits, and Methods for Amplification the Detection and Identification of Clinically Relevant Candida Species | |
| CN114891928A (en) | Primer probe composition and detection kit for nucleic acid detection of measles virus, rubella virus and mumps virus | |
| CN102534030A (en) | Kit for jointly detecting four deafness predisposing genes and application thereof | |
| WO2019187240A1 (en) | Method for rapid identification of candida in which incomplete match probes are used | |
| CN110819708A (en) | Method for detecting ALDH2 gene polymorphism by fluorescent quantitative PCR | |
| JP6318239B2 (en) | Method for extracting fungal nucleic acid | |
| CN116426668B (en) | Primer group for detecting mucor based on nucleic acid mass spectrometry technology and application thereof | |
| KR101374045B1 (en) | Method for Detecting and Identifying Quinolone Resistant Campylobacter From Biological Sample Using Polymerase Chain Reaction and Kit Used for The Same Method | |
| CN112626263B (en) | Kit for detecting respiratory tract infection fungal pathogens at constant temperature by using enzyme digestion probe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |