KR20230142369A - Composition for preventing or treating neurodegenerative disease containing piperine metabolite - Google Patents

Abstract

The present invention relates to a composition for preventing or treating neurodegenerative diseases containing piperine metabolites.
It was confirmed that the piperine metabolite PM37 and its analogs PM61 and PM72 selected in the present invention activate Nurr1, which regulates the activity of dopaminergic neurons, and suppress neuroinflammatory responses. In addition, since it was confirmed that it not only improves behavioral ability in an animal model in which dopaminergic nervous system damage is induced, but also protects the dopaminergic nervous system, the piperine metabolites and analogs thereof of the present invention are used for the prevention or treatment of neurodegenerative diseases. It can be usefully used in pharmaceutical compositions or health functional foods.

Description

Composition for preventing or treating neurodegenerative diseases comprising piperine metabolites {COMPOSITION FOR PREVENTING OR TREATING NEURODEGENERATIVE DISEASE CONTAINING PIPERINE METABOLITE}

The present invention relates to a composition for preventing or treating neurodegenerative diseases containing piperine metabolites.

Microglia, which are brain phagocytes, exist in the central nervous system (CNS) and brain and are involved in the protection and recovery of primary nerve cells. However, many studies have reported that activated microglia induce neuroinflammatory responses, and that neuroinflammatory responses lead to the cause of various neurodegenerative diseases. Microglia are activated due to brain damage or various neurotoxins, and activated microglia produce nitric oxide (NO), reactive oxygen species (ROS), inflammatory enzymes iNOS (inducible nitric oxide synthase), and COX. -2 (cyclooxygenase-2) and induces the activity of pro-inflammatory cytokines such as IL-1b, IL-6, and TNF-α (Graeber and Streit, 2010). These substances cause multiple sclerosis, Parkinson's disease, and Alzheimer's disease. It has been reported that it is involved in the pathogenesis of neurodegenerative diseases such as Huntington's disease (Kim, DC, et al. , Molecules , 22(12):2130, 2017; He, X., et al. , Toxicology letters , 283: 58-68, 2018; Lim, H.-W., et al. , Food and chemical toxicology , 72: 265-272, 2014; Cho, D.-Y., et al. , Molecules , 21( 12):1718, 2016).

Therefore, it is believed that the control of neuroinflammation will play an important role in the prevention of neurodegenerative diseases. Therefore, it is necessary to search for and research substances that have a neuronal cell protection effect or a neuroinflammation inhibition effect.

Nurr1, which is attracting attention as playing an important role in neuroinflammation and nerve damage in degenerative brain disease research, is reported to be an important regulator of the development, differentiation, survival and maintenance of dopaminergic neurons, and Nurr1 expression was observed in normal groups and PD patients. As a result of the analysis, it was reported that the expression of Nurr1 in the PD patient group was suppressed compared to the normal group (Ruiz-Sanchez et al., 2017). Nurr1, which is believed to play an important role in maintaining the dopaminergic nervous system, has been reported to be activated by mediating signals from CRH (corticotropin-releasing hormone) through RXR (retinoid x receptor), and stimulation of CRH leads to the expression of Nurr2 and Nurr1. It has been reported that the function is activated by increasing and forming homo-/hetero-dimer. (Aarnisalo P. et al. , J. Biol. Chem. , 277:35118-35123, 2002).

In order for the Nurr1 transcription factor to function properly, a ligand that can be activated by binding to the ligand binding site is essential. Therefore, ligands or small molecule substances that can activate the Nurr1 transcription factor have a high possibility of being developed as new therapeutic agents because they play a very important role in the development, differentiation, and maintenance of nerve cells. In addition, Nurr1 also has an anti-neuroinflammatory function, so compounds that activate the Nurr1 protein can be applied as a treatment for various degenerative brain diseases.

Piperine is the main biologically active component that gives black pepper its irritating and pungent taste and is a type of alkaloid. Pepper is widely used around the world as a spice, but in some regions it has also been used as a type of traditional medicine with various therapeutic effects, and studies on piperine as an ingredient that exhibits the pharmacological effects of pepper are continuing. It has been in progress (Korea Registered Patent No. 10-0846125; Korea Registered Patent No. 10-1247802; Korea Registered Patent No. 10-1078376).

Accordingly, in the present invention, as a result of diligent efforts to select substances with excellent effects in preventing or improving neurodegenerative diseases, PM37, a piperine metabolite with excellent neuroinflammation inhibition effect, was discovered, and a novel piperine analogue based on PM37 was discovered. PM61 and PM72 were synthesized. It was confirmed that the piperine metabolites and piperine analogs of the present invention activated Nurr1, which regulates the activity of dopaminergic neurons, and suppressed neuroinflammatory responses. In addition, it was confirmed that it not only improves behavioral ability but also protects the dopaminergic nervous system in an animal model in which dopaminergic nervous system damage was induced, and the present invention was completed.

Therefore, the purpose of the present invention is to provide a composition for preventing or treating neurodegenerative diseases containing piperine metabolites or piperine analogs thereof as an active ingredient.

To achieve the above-mentioned purpose,

The present invention relates to a piperine metabolite represented by the following formula (2) or a pharmaceutically acceptable salt thereof;

A piperine analog represented by the following formula (3) or a pharmaceutically acceptable salt thereof; and

A pharmaceutical composition for the prevention or treatment of degenerative diseases containing as an active ingredient any one or more compounds selected from the group consisting of piperine analogs or pharmaceutically acceptable salts thereof represented by the following formula (4), or Provides a health functional food composition for prevention or improvement.

[Formula 2]

[Formula 3]

[Formula 4]

In a preferred embodiment of the present invention, the piperine metabolite or piperine analog increases Nurr1 activity. In a preferred embodiment of the present invention, the piperine metabolite or piperine analog increases Nurr1 activity. You can.

In another preferred embodiment of the present invention, the piperine metabolite or piperine analog is a neuroinflammatory factor selected from the group consisting of NO (Nitric Oxide), TNF-α, IL-6, iNOS, and COX-2. It can be suppressed.

In another preferred embodiment of the present invention, the piperine metabolite or piperine analog can inhibit TNF-R1 (TNF receptor-1) expression.

In another preferred embodiment of the present invention, the piperine metabolite or piperine analog can protect the dopaminergic nervous system by increasing the expression of tyrosine hydroxylase (TH).

In another preferred embodiment of the present invention, the neurodegenerative disease may be a neurodegenerative brain disease caused by dysfunction of the Nurr1 protein.

In another preferred embodiment of the present invention, the neurodegenerative diseases include multiple sclerosis, neuroblastoma, ischemic stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, It may be selected from the group consisting of schizophrenia or amyotrophic lateral sclerosis.

It was confirmed that the piperine metabolite PM37 and its analogs PM61 and PM72 selected in the present invention activate Nurr1, which regulates the activity of dopaminergic neurons, and suppress neuroinflammatory responses. In addition, since it was confirmed that it not only improves behavioral ability in an animal model in which dopaminergic nervous system damage is induced, but also protects the dopaminergic nervous system, the piperine metabolites and analogs thereof of the present invention are used for the prevention or treatment of neurodegenerative diseases. It can be usefully used in pharmaceutical compositions or health functional foods.

Figure 1 is a schematic diagram showing the chemical formulas of piperine metabolite PM37 and its analogues PM61 and PM72.
Figure 2 shows data confirming (A) inhibition of NO generation and (B) cytotoxicity when piperine metabolite PM37 and its analogues PM61 and PM72 were treated with BV-2 microglial cells stimulated with LPS or TNF-α. am.
Figure 3 is a schematic diagram showing the signal of TNF-α, a pro-inflammatory cytokine, and intracellular inflammatory response and apoptosis through TNF-R1.
Figure 4 shows data confirming the level of Nurr1 mRNA expression when TNF-α-stimulated BV-2 microglial cells were treated with the piperine metabolite PM37 and its analogues PM61 and PM72 at different concentrations.
Figure 5 shows (A) iNOS mRNA, (B) IL-6 mRNA, (C) when TNF-α-stimulated BV-2 microglial cells were treated with the piperine metabolite PM37 and its analogues PM61 and PM72. Data confirming the expression levels of TNF-α mRNA and (D) TNF-R1 mRNA over time.
Figure 6 shows the relative expression level of Nurr1 protein and the amount of Nurr1 protein compared to β-actin when LPS-stimulated BV-2 microglial cells were treated with the piperine metabolite PM37 and its analogues PM61 and PM72. This is data that confirmed .
Figure 7 shows (A) the expression levels of inflammatory mediator proteins iNOS and COX-2 and TNF-R1 proteins when LPS-stimulated BV-2 microglial cells were treated with the piperine metabolite PM37 and its analogues PM61 and PM72. and (B) data confirming the relative expression level to β-actin by quantifying the amount of these proteins.
Figure 8 is a schematic diagram showing the manufacturing process of an animal model whose dopaminergic nervous system is damaged by MPTP administration and the method of administering the piperine metabolite PM37 and its analogues PM61 and PM72.
Figure 9 shows data confirming the effect of improving behavioral ability using a Rotarod treadmill when piperine metabolite PM37 and its analogues PM61 and PM72 were administered to an animal model with damaged MPTP-dopamine nervous system.
Figure 10 shows tyrosine hydroxyase (tyrosine) in the (A) striatum and (B) SNpc of the mouse brain when the piperine metabolite PM37 and its analogues PM61 and PM72 were administered to an MPTP-dopamine nervous system damaged animal model. This is data confirming the level of hydroxylase (TH) expression. The left side of the figure is Western blot data, and the right side is data confirming the relative expression level of β-actin by quantifying the amount of TH protein.
Figure 11 shows BV-2 microglial cells transformed with plasmid DNA containing Nurr1 gene inserted at different concentrations to produce BV-2 microglial cells overexpressing Nurr1, (A) 2 days after transformation and (B) This data confirms the level of Nurr1 mRNA expression 3 days after transformation. The left side of the figure is PCR analysis data, and the right side is data confirming the relative expression level to GAPDH by quantifying the amount of Nurr1 mRNA.
Figure 12 shows data confirming the level of Nurr1 protein expression 2 days after transformation when BV-2 microglial cells were transformed at different concentrations of plasmid DNA into which the Nurr1 gene was inserted to prepare Nurr1-overexpressed BV-2 microglial cells. am.
Figure 13 shows the expression levels of Nurr1 mRNA, TNF-α mRNA, and TNF-R1 mRNA in BV-2 microglial cells treated with the piperine metabolite PM37 and its analogues PM61 and PM72 and in BV-2 microglial cells overexpressing Nurr1. This is data comparing . (A) is PCR analysis data, and (B) is data confirming the relative expression level of GAPDH by quantifying the amount of each mRNA.
Figure 14 shows data comparing the level of Nurr1 protein expression in BV-2 microglial cells treated with the piperine metabolite PM37 and its analogues PM61 and PM72 and in BV-2 microglial cells overexpressing Nurr1.
Figure 15 is data comparing the expression levels of Nurr1 protein and TH protein in HEK 293T cells overexpressing Nurr1, (A) is Western blot data, and (B) and (C) quantify the amount of Nurr1 protein and TH protein, respectively. This data confirms the relative expression level of β-actin.
Figure 16 is a schematic diagram showing the mechanism of suppressing neuroinflammation and neuronal cell death by the piperine metabolite PM37 and its analogues PM61 and PM72.

Hereinafter, the present invention will be described in detail.

Consistently, the present invention provides a piperine metabolite represented by the following formula (2) or a pharmaceutically acceptable salt thereof; A piperine analog represented by the following formula (3) or a pharmaceutically acceptable salt thereof; It relates to a pharmaceutical composition for the prevention or treatment of degenerative diseases comprising as an active ingredient one or more compounds selected from the group consisting of piperine analogs or pharmaceutically acceptable salts thereof represented by the following formula (4).

In another aspect, the present invention provides a piperine metabolite represented by the following formula (2) or a pharmaceutically acceptable salt thereof; A piperine analog represented by the following formula (3) or a pharmaceutically acceptable salt thereof; It relates to a health functional food composition for preventing or improving degenerative diseases, comprising as an active ingredient one or more compounds selected from the group consisting of piperine analogs or pharmaceutically acceptable salts thereof represented by the following formula (4).

[Formula 2]

[Formula 3]

[Formula 4]

In the present invention, the piperine metabolite or piperine analog is

(1) Increased Nurr1 activity;

(2) Inhibition of production of inflammatory mediators including NO, iNOS and COX-2;

(3) inhibiting the production of inflammatory cytokines selected from the group consisting of TNF-α and IL-6; or

(4) Inhibition of TNF-R1 (TNF receptor-1) expression can control neuroinflammation and prevent, improve, or treat neurodegenerative diseases.

In the present invention, the piperine metabolite or piperine analog can protect dopaminergic neurons by increasing the expression of tyrosine hydroxylase (TH).

In the present invention, the degenerative neurodegenerative disease may be a degenerative neurodegenerative brain disease caused by dysfunction of the Nurr1 proteome. Specifically, the degenerative neurodegenerative disease may include multiple sclerosis, neuroblastoma, ischemic stroke, Alzheimer's disease, and Parkinson's disease. , Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, or amyotrophic lateral sclerosis.

In a specific embodiment of the present invention, in order to select compounds among piperine series compounds that can prevent or treat neurodegenerative diseases without toxicity or side effects, the results of selecting compounds with high neuroinflammation inhibition efficacy among piperine metabolites were obtained. , the piperine metabolite (PM37) represented by Formula 2 was selected, and based on this, piperine analogues (PM61 and PM72) represented by Formula 3 or Formula 4 were prepared (Figure 1).

In another specific embodiment of the present invention, when BV-2 microglial cells stimulated with LPS or TNF-α are treated with the piperine metabolite PM37 and its analogues PM61 and PM72, NO generation is inhibited without cytotoxicity. This was confirmed, and in particular, PM61 was shown to promote the growth of microglial cells (Figure 2).

Neuroinflammatory reactions occur through complex biological pathways and signals. TNF-α (tumor necrosis factor alpha) is one of the pro-inflammatory cytokines involved in complex neuroinflammatory signals. ) is a powerful cytokine that plays an important role in the inflammatory response between cells and immune cells. TNF-α activates various MAPKs (mitogen-activated proteinkinases) by TNF-R1, a receptor that uses TNF-α as a ligand present in the cell membrane, thereby activating NF-κB, which is important in the inflammatory response, thereby reducing inflammation. Activates the reaction. In addition, TNF-α activates Caspase-8 and Caspase-3 through the TNF-R1/FADD pathway to decompose proteins and DNA within cells, resulting in apoptosis, a type of programmed cell death. By inducing, it causes not only an inflammatory reaction but also cell death due to the inflammatory reaction (Figure 3).

In another specific embodiment of the present invention, as a result of confirming whether piperine metabolites and analogs thereof inhibit the TNF-α pathway, piperine metabolites PM37 and analogs thereof were added to microglial cells that induced an inflammatory response with TNF-α. It was confirmed that Nurr1 mRNA and protein expression increased and the mRNA and protein expression of inflammatory mediator proteins (iNOS and COX-2) and cytokines (IL-6 and TNF-α) decreased by PM61 and PM72. In addition, it was confirmed that the expression of TNF-R1, a receptor for TNF-α, was also inhibited by the piperine metabolite PM37 and its analogs PM61 and PM72 (FIGS. 4 to 7).

That is, the piperine metabolite PM37 of the present invention, and its analogues PM61 and PM72, increase the expression of Nurr1, an orphan nuclear receptor predicted to play an important role in regulating the dopaminergic nervous system, and at the same time increase the expression of TNF- It was confirmed that it suppresses the α-activated neuroinflammatory response.

In another specific embodiment of the present invention, the process of manufacturing an animal model whose dopaminergic nervous system was damaged by administration of MPTP and the results of administering the piperine metabolite PM37 and its analogues PM61 and PM72 (FIG. 8) showed that mice with damaged dopaminergic nervous system It was confirmed that behavioral ability was improved (Figure 9), and the expression of tyrosine hydroxylase (TH) was confirmed to be increased in the striatum and (C and D) SNpc of the mouse brain (Figure 10) . TH is a protein highly expressed in domapine neurons, and the piperine metabolite PM37 and its analogues PM61 and PM72 were confirmed to protect the dopaminergic nervous system by increasing TH expression.

In another specific embodiment of the present invention, it was attempted to determine whether the piperine metabolite PM37 and its analogues PM61 and PM72 act as Nurr1 targeting compounds and are effective in the treatment of neurodegenerative diseases. For this purpose, plasmid DNA into which the Nurr1 (=NR4A2) gene, a target gene for the treatment and prevention of neurodegenerative diseases, was inserted was prepared, and this was transformed into BV-2 microglial cells to overexpress the Nurr1 gene (Figures 11 and 11). 12).

As a result of comparing Nurr1 mRNA expression levels in microglial cells overexpressing the Nurr1 gene and microglial cells treated with the piperine metabolite PM37 and its analogues PM61 and PM72, the piperine metabolite PM37 and its analogues PM61 and PM72 Nurr1 mRNA expression increased in a concentration-dependent manner, and higher levels of Nurr1 mRNA were found to be expressed in microglial cells that overexpressed the Nurr1 gene. In addition, in microglial cells overexpressing the Nurr1 gene, TNF-α expression did not significantly increase or decrease, but TNF-R1 expression decreased (FIG. 13).

As a result of comparing Nurr1 protein expression levels in microglial cells overexpressing the Nurr1 gene and microglial cells treated with the piperine metabolite PM37 and its analogues PM61 and PM72, the piperine metabolite PM37 and its analogues PM61 were compared to the control group. And Nurr1 protein expression increased with PM72 treatment, and most of it was found to exist in the form of ~43 kDa. In addition, in microglial cells overexpressing the Nurr1 gene, it was confirmed that it exists in the form of ~70 kDa, which is the size predicted in the protein database (UniProt ID: P43354) (FIG. 14).

Regulation of Nurr1 expression can regulate neuroinflammation by regulating the expression of TNF-R1, which plays an important role in inflammatory signaling, and can protect the dopaminergic nervous system by regulating TH expression (FIG. 15). Piperine metabolite PM37, and its piperine analogs PM61 and PM72 can increase Nurr1 activity, and the signal of TNF-α/TNF-R1, which is important for neuroinflammatory response, is regulated by Nurr1 with increased activity, and TH expression By increasing this, neuroinflammation and neuronal apoptosis can be suppressed (Figure 16).

Therefore, it was confirmed that the piperine metabolite PM37 of the present invention, and its analogues PM61 and PM72, can help restore function and improve behavioral ability in dopaminergic neurodegenerative diseases through regulation of Nurr1, TNF-R1, and TH. .

The pharmaceutical composition of the present invention can be formulated and used in various forms according to conventional methods. For example, it can be formulated into oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, etc., and can be formulated and used in the form of external preparations, suppositories, and sterile injection solutions. Depending on each dosage form, it may further include pharmaceutically acceptable carriers, excipients, and diluents. In addition, it can be formulated and used in the form of external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., and sterile injection solutions according to conventional methods.

The carriers, excipients and diluents include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, These include microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, and mineral oil. When formulating or formulating the pharmaceutical composition, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain at least one excipient, such as starch, calcium carbonate, or sucrose. It is prepared by mixing , lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.

As used herein, the term “administration” means providing the pharmaceutical composition of the invention to an individual by any suitable method. The present invention provides a pharmaceutical composition that provides an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human as considered by a researcher, veterinarian, doctor or other clinician, that is, alleviation of symptoms of the disease or disorder being treated. It can be administered in a therapeutically effective amount that induces . It is obvious to those skilled in the art that the therapeutically effective dosage and frequency of administration of the pharmaceutical composition of the present invention will vary depending on the desired effect. Therefore, the optimal dosage to be administered can be easily determined by a person skilled in the art, depending on the type of disease, the severity of the disease, the content of the active ingredient and other ingredients contained in the composition, the type of dosage form, the patient's age, weight, and general health condition. , gender and diet, administration time, administration route and secretion rate of the composition, treatment period, and various factors including concurrently used drugs. The pharmaceutical composition of the present invention can be administered to an individual through various routes. For example, it may be administered intravenously, intraperitoneally, intramuscularly, intraarterially, bucally, intracardiacally, intramedullary, intrathecally, transdermally, enterally, subcutaneously, sublingually, or topically, but is not limited thereto. The pharmaceutical composition of the present invention can be administered in an amount of 1 to 10,000 mg/kg/day, and may be administered once a day or divided into several times.

The health functional food composition of the present invention can be used as a health functional food, food additive, or dietary supplement. When using the composition of the present invention as a food additive, it can be used appropriately according to conventional methods, such as adding it as is or mixing it with other foods or food ingredients.

Additionally, the mixing amount of the health functional food composition may be appropriately changed depending on the purpose of use (prevention, health, or therapeutic treatment). As a specific example, when producing a food or beverage, the composition of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw materials. However, when consumed for a long period of time for health and hygiene purposes or health control, it can be added in an amount below the above range. Since there is no problem in terms of safety, the active ingredient can be used in an amount above the above range. there is.

There is no particular limitation on the type of food, but examples of food to which the composition of the present invention can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, and ice cream. It includes dairy products, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc., and includes all health foods in the conventional sense.

When the health functional food composition of the present invention is manufactured into a beverage, it may contain additional ingredients such as various flavoring agents or natural carbohydrates like ordinary beverages. The natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; Natural sweeteners such as dextrin and cyclodextrin; Synthetic sweeteners such as saccharin and aspartame may be used. The natural carbohydrate is contained in an amount of 0.01 to 10% by weight, preferably 0.01 to 0.1% by weight, based on the total weight of the food composition of the present invention.

The health functional food composition of the present invention includes various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, glycerin, and alcohol. , carbonating agents used in carbonated beverages, etc., and may include pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks, but are not limited thereto. These ingredients can be used independently or in combination. The ratio of the above additives is not greatly limited, but is preferably contained within the range of 0.01 to 0.1% by weight based on the total weight of the food composition of the present invention.

Hereinafter, the present invention will be described in more detail through examples.

These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Selection of piperine metabolites and preparation of their piperine analogues

In the present invention, we sought to select compounds among piperine-based compounds that can prevent or treat neurodegenerative diseases without toxicity or side effects.

Based on piperine represented by Formula 1 below, a piperine metabolite (PM37) represented by Formula 2 below, which has a high neuroinflammation inhibitory effect, was selected among piperine metabolites. Next, based on the piperine metabolite (PM37), a piperine analog (PM61) represented by the following formula (3) and a piperine analog (PM72) represented by the following formula (4) were selected (FIG. 4).

Confirmation of the neuroinflammation inhibitory effect of piperine metabolites and piperine analogues thereof

In the present invention, in order to confirm the effect of piperine metabolites and piperine analogues thereof on suppressing neuroinflammation, BV-2 microglial cells were treated with LPS (lipopolysccharide) and TNF-α (mouse) to reduce neuroinflammation. The goal was to induce a reaction.

First, BV-2 microglial cells were cultured in DMEM medium supplemented with 5% (v/v) FBS and 1% (v/v) penicillin/streptomycin at 37°C and 5% CO ₂ conditions. Cells grown to 70 to 80% confluence were subcultured by treatment with trypsin (0.05% trypsin-EDTA), and the medium was changed every two days. Each experiment was repeated three times for statistical analysis. Cells subcultured at least three times were used in each experiment.

To evaluate cell viability and nitric oxide (NO) release, BV-2 cells were cultured in 500 μl of DMEM at 8×10 ⁴ cells/well in a 24-well plate. After the cells attached, they were treated with PM37, PM61, and PM72 at various concentrations (5 μM, 10 μM, and 20 μM), respectively, and then treated with LPS (200 ng/ml) or TNF-α (mouse; 20 ng/ml). 24 It was cultured for some time. Afterwards, the culture medium was obtained for colorimetric NO release analysis using Griess reagent, and then the absorbance was measured at 550 nm in the UV spectrum using a microplate reader (SunriseTM, Tecan Trading AG, Switzerland).

For cell survival, MTT (5 mg/ml) was added and cultured for 1 hour, then the culture medium was removed and 400 μl of DMSO was added to dissolve the formazan crystals. Absorbance was measured at 540 nm using a microplate reader.

As a result, as shown in Figure 2, NO generation, which was significantly induced by LPS treatment, was effectively suppressed by PM37 treatment, especially by 20 μM PM37, but it was confirmed that it showed some cytotoxicity.

In terms of developing a non-toxic soft-drug, PM61 and PM72, analogues of PM37, were confirmed to suppress NO generation at a similar level to PM32 and at the same time do not affect cell survival. In particular, PM61 was confirmed to have no effect on microglial cell survival. has been shown to promote growth.

Confirmation of the efficacy of piperine metabolites and their piperine analogues in regulating Nurr1 and neuroinflammatory factor expression

Orphan nuclear receptors are biomolecules that play a major role in the activation of target genes in the nucleus where their ligands are absent or not found. Nurr1, one of the orphan nuclear receptors, is known to regulate the activity of dopaminergic neurons.

In the present invention, we sought to determine whether piperine metabolites and their analogues regulate the expression of Nurr1 as well as the expression of inflammatory mediator proteins (iNOS and COX-2) and cytokines (IL-6 and TNF-α).

3-1: Confirmation of mRNA expression

First, the cells were cultured in the same manner as in Example 2, and then treated at different times (1, 3, and 6 hours) so that the concentration of PM37, PM61, and PM72 was 20 μM, and then incubated with TNF-α (mouse; 20 μM). ng/ml) and cultured for 6 hours.

BV-2 cells were washed twice with cold PBS, 1 ml of Trizol reagent was added to each well, and reacted at room temperature for 30 seconds. Cells were carefully collected in an Eppendorf tube and centrifuged. cDNA was synthesized according to the manual using a high capacity cDNA synthesis kit (ThermoFisher scientific, USA).

Additionally, 1 μl of RT-mixed template was amplified using specific primers in Table 1. PCR products were electrophoresed using a 1.5% agarose gel containing GelRed® Nucleic Acid Gel Stain (Biotium Inc., USA).

PCR primer sequence Primer sequence (5'-3') order
number Nurr1
(243bp) forward GAGGAGGGCTTGTAGTAAAC One reverse GAGGGCTTTGTAGTAAACCGA 2 iNOS
(123bp) forward AGGAGAGAGATCCGATTTAG 3 reverse AGACTTCCCTGTCTCAGTAG 4 IL-6
(100bp) forward CTGTAGCTCATTCTGCTCTG 5 reverse GAAGGCAACTGGATGGAAGT 6 TNF-α
(116bp) forward CTACCTTGTTGCCTCCTCTT 7 reverse GAGCAGAGGTTCAGTGATGT 8 TNF-R1
(116bp) forward TCTGCTCTACGAATCACTCT 9 reverse ACAGCATACAGAATCGCAAG 10 GAPDH
(178bp) forward TGGCCTTCCGTGTTCCTACC 11 reverse GAGTTGCTGTTGAAGTCGCA 12

3-2: Confirmation of protein expression

First, the cells were cultured in the same manner as in Example 2, and then treated at different times (1, 3, and 6 hours) so that the concentration of PM37, PM61, and PM72 was 20 μM, and then incubated with TNF-α (mouse; 20 μM). ng/ml) and cultured for 24 hours.

BV-2 cells were washed twice with PBS and lysed using lysis buffer (1x RIPA lysis buffer containing protease and phosphatase inhibitor (1:1) cocktail). The same protein (20 μg/10 μl) was electrophoresed on an 8 to 15% sodium dodecyl sulphate-polyacrylamide electrophoresis (SDS-PAGE) gel and then transferred to a polyvinylidene-difluoride (PVDF) membrane (Amersham, USA).

To prevent non-specific binding, react with 5% skim milk at room temperature for 1 hour, then use the primary antibodies, anti-Nurr1 antibody, anti-TNF-R1 antibody, anti-iNOS antibody, and anti-COX-2. Antibody or anti-β-actin antibody was added and reacted at 4°C overnight. Next, secondary antibody, anti-mouse or anti-rabbit (1:10,000) was added and reacted at room temperature. Membranes were visualized according to the protocol of the enhanced chemiluminescence detection system (LAS 500; GE Healthcare Bio-Sciences AB, Sweden).

As a result, Nurr1 mRNA and protein expression was increased by the piperine metabolite PM37 and its analogues PM61 and PM72 in microglial cells that induced an inflammatory response with TNF-α (Figures 4 and 5), and inflammatory mediator proteins ( It was confirmed that the mRNA and protein expression of iNOS and COX-2) and cytokines (IL-6 and TNF-α) were decreased. In addition, it was confirmed that the expression of TNF-R1, a receptor for TNF-α, was also inhibited by the piperine metabolite PM37 and its analogues PM61 and PM72 (FIGS. 5 to 7).

That is, the piperine metabolite PM37 of the present invention, and its analogues PM61 and PM72, increase the expression of Nurr1, an orphan nuclear receptor predicted to play an important role in regulating the dopaminergic nervous system, and at the same time increase the expression of TNF- It was confirmed that it suppresses the α-activated neuroinflammatory response.

Confirmed improvement in behavioral ability of piperine metabolite and its piperine analogue in animal model with damaged dopaminergic nervous system by MPTP administration

4-1: Animal model production

MPTP ((1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridinehydrochloride) is known to be a substance that causes the death of dopaminergic neurons after being converted to MPP+ in the body, and is mainly manufactured for Parkinson's disease animal models. It is being used in .

In the present invention, 8-10 week old male C57BL/6 (32-36g) mice were prepared, the mice were divided into 5 groups as follows, and drugs were administered as shown in the schematic diagram in FIG. 8.

1) Vehicle (untreated group)

2) MPTP 20 mg/kg treatment group

3) MPTP 20 mg/kg + PM37 10 mg/kg treatment group

4) MPTP 20 mg/kg + PM61 10 mg/kg treatment group

5) MPTP 20 mg/kg + PM72 10 mg/kg treatment group

4-2 ; Rotarod treadmill

In Example 4-1, after administering PM37, PM61, and PM72 for 7 days, exercise ability associated with the dopaminergic nervous system was measured every day using a rotarod treadmill device, and behavioral ability records for each group were recorded. A bar graph was created based on this.

As a result, as shown in Figure 9, the behavioral ability of mice was reduced in the group administered MPTP alone, while the group administered the piperine metabolite PM37 and its analogues PM61 and PM72 showed continuous improvement in behavioral ability. did.

4-3: Confirmation of tyrosine hydroxylase (TH) expression level

In Example 4-1, 7 days after oral administration of PM37, PM61, and PM72, the mice were sacrificed and striatum and SNpc tissues of the mouse brain were collected.

Proteins were isolated from each of the brain's striatum and SNpc tissues, and then Western blot was performed in the same manner as in Example 3-2.

As a result, as shown in Figure 10, the expression of tyrosine hydroxylase (TH) was increased in the striatum and SNpc of the mouse brain by administration of the piperine metabolite PM37 and its analogues PM61 and PM72. confirmed.

TH is a protein highly expressed in dopaminergic neurons, and the piperine metabolite PM37 and its analogues PM61 and PM72 were confirmed to protect the dopaminergic nervous system by increasing TH expression.

Preparation of Nurr1-overexpressing microglial cells

5-1: Preparation of Nurr1 overexpressing microglial cells

To prepare Nurr1-overexpressing microglial cells, plasmid DNA (cmv-Nurr1-HA Plasmid DNA; abm, USA) into which the Nurr1 (=NR4A2) gene was inserted was used.

First, transformation was induced in chemically competent E. coli cells (Enzynomics, Korea) using heat shock (42°C, 30 to 60 seconds) according to the manual, and kanamycin was used to induce transformation. After selecting only cells in which conversion occurred, the bacteria were cultured in a shaking incubator (40°C, 200 rpm).

Next, the plasmid DNA amplified from E. coli competent cells was purified using a plasmid DNA prep kit (Invitrogen, USA), dissolved in TE (Tris-EDTA) buffer, and the amount of plasmid DNA was measured. was quantified (quick drop spectrometer; Moleculardevices, USA). Purified plasmid DNA was stored in a -20°C freezer until used in experiments.

BV-2 cells were cultured in the same manner as in Example 2, then inoculated into a 24-well plate and cultured overnight at 37°C and 5% CO ² conditions. Polybrene (Merk, USA) was used as the transfection reagent. Briefly, polybrene was diluted in DMEM medium according to the conditions (1/1,000, 1/500, 1/100) and vortexed, and then the plasmid DNA purified above (1 ㎍/ml) was added to form polybrene. The reaction was performed at room temperature for 15 to 20 minutes to form a polybrene transfection agent and plasmid DNA complex.

Next, the polybrene-plasmid DNA complex was treated with BV-2 cells cultured in a 24-well plate to prepare Nurr1-overexpressing microglial cells (tgBV-2 cells).

5-2: Confirmation of Nurr1 mRNA expression level

To confirm the efficiency of human Nurr1 gene introduction using the polybrene-plasmid DNA complex, total RNA from Nurr1-overexpressing microglial cells (tgBV-2 cells) was extracted at each time point, and then PCR was performed. PCR was performed after designing three sets of primers targeting the Nurr1 coding gene at different positions as shown in Table 2 below.

Nurr1 gene - PCR primer sequence Primer sequence (5'-3') order
number Nurr1 74bp forward GGACCTCACCAACACTGAAA 13 reverse CCTGTGCTTGTAGTTGTCCAT 14 Nurr1 85bp forward CAGAGCTACAGTTACCACTC 15 reverse TGGTGAGGTCCATGCTAAAC 16 Nurr1 243bp forward GGACCTCACCAACACTGAAA 17 reverse GAGGGCTTTGTAGTAAACCGA 18 GAPDH forward TGGCCTTCCGTGTTCCTACC 19 reverse GAGTTGCTGTTGAAGTCGCA 20

As a result, as shown in Figure 11, 2 days after transfection of the polybrene-plasmid DNA complex, it was confirmed that the Nurr1 (=NR4A2) gene was expressed at a higher level compared to the base level in BV-2 cells. This means that the human Nurr1-HA gene was successfully introduced into BV-2 cells through plasmid DNA.

In addition, 2 days after transfection, it was confirmed that Nurr1 expression was high in the experimental group with a high concentration of polybrene transfection reagent, but the results 3 days after transfection showed that Nurr1 mRNA was evenly 2 to 8 times more than that of the comparison group in which Nurr1 was expressed at a low level. It was confirmed that was expressed.

5-3: Confirmation of Nurr1 protein expression level

In order to confirm whether Nurr1 mRNA is translated into actual protein in microglial cells overexpressing Nurr1 mRNA, protein was isolated from the cells in the same manner as in Example 3-2, and then the Nurr1 protein expression level was measured by Western blot. Confirmed.

As a result of Western blot analysis, as shown in Figure 13, significant protein bands were identified at ~170, ~70, and ~43 kDa, and as a result of measurement using the Compute pI/Mw tool (Expasy, Switzerland), Nurr1 (UniProtKB The theoretical MW (molecular weight) size of ID: P43354) is 66590.87 Da, and it was confirmed to be consistent with the band found at the position of ~70 kDa in this experiment.

On the other hand, a protein band was consistently observed at ~43 kDa, and it was confirmed that most of the Nurr1 protein expressed in control BV-2 cells (first lane of Figure 13) exists in the ~43 kDa form. This is believed to be an isoform of Nurr1.

Confirmation of neuroinflammation modulating efficacy of piperine metabolites and piperine analogues in Nurr1-overexpressing microglial cells

In the present invention, we sought to confirm the efficacy of the piperine metabolite PM37 and its analogues PM61 and PM72 in regulating Nurr1 expression and neuroinflammation in microglial cells overexpressing the Nurr1 gene.

6-1: Confirmation of Nurr1 mRNA, TNF-αmRNA, and TNF-R1 mRNA expression levels

First, the microglial cells (tgBV-2 group) overexpressing the Nurr1 gene prepared in Example 5-1 were treated so that the concentrations of PM37, PM61, and PM72 were 10 μM and 20 μM, respectively, and then treated in Example 3-1 and PCR was performed in the same manner as in 5-2.

As a result, as shown in Figure 13, it was confirmed that Nurr1 mRNA expression increased more at 20 μM than at 10 μM in the group treated with the piperine metabolite PM37, and its analogues PM61 and PM72, and in the group treated with the piperine metabolite PM37 and its analogs PM61 and PM72, Nurr1 mRNA expression was confirmed to be higher at 20 μM than at 10 μM. Higher Nurr1 mRNA expression was found in glial cells.

In addition, when Nurr1 expression was increased by treatment with the piperine metabolite PM37 and its analogues PM61 and PM72, and in microglial cells overexpressing the Nurr1 gene, TNF-α expression was not significantly increased or decreased, but TNF-α receptor A significant decrease in TNF-R1 expression was confirmed.

6-2: Confirmation of Nurr1 protein expression level

First, the microglial cells (tgBV-2 group) overexpressing the Nurr1 gene prepared in Example 5-1 were treated so that the concentrations of PM37, PM61, and PM72 were 10 μM and 20 μM, respectively, and then followed by the same method as in 5-3 above. Western blot was performed.

As a result, as shown in Figure 14, Nurr1 protein expression was increased by treatment with piperine metabolite PM37 and its analogues PM61 and PM72 compared to the control group, and most of them were found to exist in the form of ~43 kDa.

In addition, the C-terminus of the human Nurr1 (accession number: BC009288) protein introduced into microglial cells overexpressing the Nurr1 gene contains an HA-tag, which was then used as an HA-tag specific binding mAb (Sigma-Aldrich). , USA), it was confirmed that the gene of the introduced plasmid DNA was stably expressed as a protein.

In microglial cells overexpressing the Nurr1 gene, most of the Nurr1 protein was found to exist in the form of ~70 kDa, which is the size predicted in the protein database (UniProt ID: P43354).

Confirmation of correlation between increased Nurr1 activity and TH protein expression

In the present invention, in Example 4-3, the expression of tyrosine hydroxylase (TH) is increased in the striatum and SNpc of the mouse brain by administration of the piperine metabolite PM37 and its analogues PM61 and PM72. The purpose of this study was to determine whether there was a correlation between increased Nurr1 activity and the expression of protein TH, which is associated with dopamine activity.

First, plasmid DNA (cmv-Nurr1-HA Plasmid DNA; abm, USA) into which the Nurr1 (=NR4A2) gene was inserted was transfected into HEK293T cells in the same manner as in Example 5, and the transfection reagent was polybrene ( polybrene; Merk, USA) and Lipofectamine were used.

Proteins were isolated from Nurr1-overexpressing HEK293T cells (tg HEK293T) in the same manner as in Example 3-2, and the expression levels of Nurr1 protein and TH protein were confirmed by Western blot.

As a result of Western blot analysis, as shown in Figure 15, it was experimentally confirmed that there was a correlation between Nurr1 overexpression and TH protein expression in HEK 293T cells overexpressing Nurr1 using a genetic engineering method.

Claims (10)

A piperine metabolite represented by the following formula (2) or a pharmaceutically acceptable salt thereof;
A piperine analog represented by the following formula (3) or a pharmaceutically acceptable salt thereof; and
A pharmaceutical composition for the prevention or treatment of degenerative diseases, comprising as an active ingredient at least one compound selected from the group consisting of a piperine analog represented by the following formula (4) or a pharmaceutically acceptable salt thereof:
[Formula 2]

[Formula 3]

[Formula 4]
.
According to paragraph 1,
The piperine metabolites or piperine analogs are
(1) Increased Nurr1 activity;
(2) Inhibition of production of inflammatory mediators including NO, iNOS and COX-2;
(3) inhibiting the production of inflammatory cytokines selected from the group consisting of TNF-α and IL-6; or
(4) A pharmaceutical composition for preventing or treating degenerative diseases, characterized in that it regulates neuroinflammation through inhibiting TNF receptor-1 (TNF-R1) expression.
According to paragraph 1,
A pharmaceutical composition for preventing or treating degenerative diseases, wherein the piperine metabolite or piperine analog protects dopaminergic neurons by increasing the expression of tyrosine hydroxylase (TH).
According to paragraph 1,
A pharmaceutical composition for preventing or treating degenerative diseases, wherein the degenerative neurodegenerative disease is a degenerative neurodegenerative brain disease caused by dysfunction of the Nurr1 protein.
According to paragraph 1,
The neurodegenerative disease is selected from the group consisting of multiple sclerosis, neuroblastoma, ischemic stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, or amyotrophic lateral sclerosis. A pharmaceutical composition for preventing or treating degenerative diseases, characterized in that it is one of the following.
A piperine metabolite represented by the following formula (2) or a pharmaceutically acceptable salt thereof;
A piperine analog represented by the following formula (3) or a pharmaceutically acceptable salt thereof; and
A health functional food composition for preventing or improving degenerative diseases, comprising as an active ingredient one or more compounds selected from the group consisting of piperine analogs or pharmaceutically acceptable salts thereof represented by the following formula (4):
[Formula 2]

[Formula 3]

[Formula 4]
.
According to clause 6,
The piperine metabolites or piperine analogs are
(1) Increased Nurr1 activity;
(2) Inhibition of production of inflammatory mediators including NO, iNOS and COX-2;
(3) inhibiting the production of inflammatory cytokines selected from the group consisting of TNF-α and IL-6; or
(4) A health functional food composition for preventing or improving degenerative diseases, characterized in that it regulates neuroinflammation through inhibition of TNF-R1 (TNF receptor-1) expression.
According to clause 6,
A health functional food composition for preventing or improving degenerative diseases, wherein the piperine metabolite or piperine analog protects dopaminergic neurons by increasing the expression of tyrosine hydroxylase (TH).
According to clause 6,
A health functional food composition for preventing or improving degenerative diseases, wherein the degenerative neurodegenerative disease is a degenerative neurodegenerative brain disease caused by dysfunction of the Nurr1 proteome.
According to clause 6,
The neurodegenerative disease is selected from the group consisting of multiple sclerosis, neuroblastoma, ischemic stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, or amyotrophic lateral sclerosis. A health functional food composition for preventing or improving degenerative diseases, characterized in that it is one of the following.