KR20230139388A - Pyrazolo[3,4-d]pyrimidine-based p21-activated kinase 4 (PAK4) inhibitor and pharmaceutical composition comprising the same - Google Patents

Abstract

The present invention relates to a pyrazolo[3,4-d]pyrimidine series p21-activated kinase 4 (PAK4) inhibitor and a pharmaceutical composition containing the same, which not only has excellent PAK4 inhibitory activity but also reduces oxidative stress and oxidative stress in liver cells. Because it has an excellent anti-inflammatory effect, it can be useful for preventing or treating various liver damage or liver inflammation, such as damage caused by ischemia-reperfusion, or to protect liver function. In addition, PAK4 can be used to protect liver function, such as cancer and degenerative brain disease. It can be effectively applied to diseases that overexpress it.

Description

Pyrazolo[3,4-d]pyrimidine-based p21-activated kinase 4 (PAK4) inhibitor and pharmaceutical composition containing the same {Pyrazolo[3,4-d]pyrimidine-based p21-activated kinase 4 (PAK4) inhibitor and pharmaceutical composition comprising the same}

The present invention relates to a pyrazolo[3,4-d]pyrimidine series p21-activated kinase 4 (PAK4) inhibitor and a pharmaceutical composition containing the same.

Hepatic ischemia/reperfusion (I/R) injury following surgical procedures such as liver tumor resection and liver transplantation is a major cause of functional impairment and liver failure. The main pathogenic mechanisms of liver I/R injury are apoptosis and inflammation, with initial hypoxic injury due to blood flow obstruction leading to substantial cell death. Restoration of blood flow during the reperfusion period further aggravates liver damage by being accompanied by inflammatory responses including macrophage and neutrophil infiltration and cytokine/chemokine production, which together with reoxygenation produce reactive oxygen species (ROS). This causes further cellular dysfunction and damage.

Hepatocytes suppress tissue damage caused by ROS through a defense mechanism that includes the induction of various antioxidant proteins, most notably NF-E2-related factor 2 (Nrf2). Under basic conditions, Nrf2 binds to the repressor Keap1 (Kelch-like ECH-associated protein 1) and is sequestered in the cytoplasm. Oxidative stress modifies the cysteine residue of Keap1, causing Nrf2 to dissociate from Keap1 and subsequently move from the cytoplasm to the nucleus. do. Nuclear Nrf2 encodes heme oxygenase-1 (HO-1), NAD(P)H quinone oxidoreductase 1 (NQO1), and glutathione peroxidase. , GPx) and binds to the antioxidant response element (ARE) present in the promoter region of antioxidant enzymes. In this process, several protein kinases participate in the intracellular localization and protein stability of Nrf2. For example, protein kinase C, casein kinase 2, and AMP-activated kinase phosphorylate different regions of Nrf2 and promote nuclear translocation of Nrf2, whereas glycogen synthase kinase 3β and Fyn-mediated phosphorylation direct the intracellular distribution of Nrf2 to the cytoplasm. It moves and induces decomposition through the ubiquitin-proteasome pathway.

Recently, the oncogenic protein p21-activated kinase 4 (PAK4) was reported to phosphorylate Nrf2 at T369 and export Nrf2 from the nucleus to the cytoplasm, and several PAK4 inhibitors have been reported. Through structure-based design combined with high-throughput screening, PF-3758309 was developed by Pfizer as the first pan-PAK inhibitor, and its antitumor effects were confirmed against several types of cancer. Additionally, Guo et al. recently developed a PAK4 inhibitor (CZh-226) in prodrug form and tested its improved pharmacokinetics, tissue distribution, and tolerability in a rat model of cancer. However, the use of the aforementioned PAK4 inhibitors was reported to be unsuitable for clinical use due to weak efficacy and/or low PAK4 selectivity.

Accordingly, the present inventors conducted research to discover new compounds applicable to liver damage treatment and liver protection and completed the present invention.

Republic of Korea Patent Registration No. 10-1706017

One object of the present invention is to provide a compound selected from the group consisting of a compound represented by the following formula (1), a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and an isomer thereof:

In Formula 1,

R ₁ and R ₂ are the same, different from each other, or are located on the same ring (A), and are C _1-6 alkyl, C _1-6 haloalkyl, -(CH ₂ ) _m -C _{1- 6} is a substituent selected from the group consisting of alkoxy (where m is an integer of 1 to 6), C _3-8 cycloalkyl, and C _6-12 aryl,

The ring (A) is a substituent selected from the group consisting of C _3-8 cycloalkyl and C _6-12 aryl,

R ₃ may be -CH ₂ -R ₇ R ₈ , or R ₃ may be located in the same aromatic ring (B) as R ₄ and R ₅ ,

The aromatic ring (B) is a substituent selected from the group consisting of C _6-12 aryl,

R ₅ and R ₆ are the same or different from each other and are C or N,

R ₇ is a substituent selected from the group consisting of H, C _1-6 alkyl, C _2-6 alkenyl, or C _2-6 alkynyl,

The R ₈ is a substituent selected from the group consisting of C _3-8 heterocyclic substituted C _1-6 alkyl containing 1 to 2 heteroatoms selected from H, O or N.

Another object of the present invention is 4-(3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutyn-2-ol; 3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenylethynylcyclohexan-1-ol; 4-(3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutynyl-1,2-diol; 4-(3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-phenylbutyn-2-ol; 3-[4-amino-3-(3-morpholin-1-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl]phenylethynyl)cyclohexanol; 3-[4-amino-3-(3-piperidin-1-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl]phenylethynyl)cyclohexanol; 4-(3-(1-aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyn-2-ol; 3-(1-aminopyrido[4,3- b ]indol-5-yl)phenylethynylcycloexan-1-ol; and 4-(3-(1-aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyne-1,2-diol. .

Another object of the present invention is to provide a compound that is 3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenylethynylcyclohexan-1-ol.

Another object of the present invention is to provide a pharmaceutical composition containing the above compound for preventing or treating diseases with increased PAK4 expression.

Another object of the present invention is to provide a composition for protecting liver function containing the above compound.

Another object of the present invention is to provide a health functional food for protecting liver function containing the above compound.

One aspect of the present invention provides a compound selected from the group consisting of a compound represented by the following formula (1), a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and an isomer thereof:

[Formula 1]

In Formula 1,

R ₁ and R ₂ are the same, different from each other, or are located on the same ring (A), and are C _1-6 alkyl, C _1-6 haloalkyl, -(CH ₂ ) _m -C _{1- 6} is a substituent selected from the group consisting of alkoxy (where m is an integer of 1 to 6), C _3-8 cycloalkyl, and C _6-12 aryl,

The ring (A) is a substituent selected from the group consisting of C _3-8 cycloalkyl and C _6-12 aryl,

R ₃ may be -CH ₂ -R ₇ R ₈ , or R ₃ may be located in the same aromatic ring (B) as R ₄ and R ₅ ,

The aromatic ring (B) is a substituent selected from the group consisting of C _6-12 aryl,

R ₅ and R ₆ are the same or different from each other and are C or N,

R ₇ is a substituent selected from the group consisting of H, C _1-6 alkyl, C _2-6 alkenyl, or C _2-6 alkynyl,

The R ₈ is a substituent selected from the group consisting of C _3-8 heterocyclic substituted C _1-6 alkyl containing 1 to 2 heteroatoms selected from H, O or N.

The compound represented by Formula 1 of the present invention acts as a PAK4 inhibitor and can significantly reduce serum levels of aminotransferases and pro-inflammatory cytokines, hepatocyte necrosis and apoptosis, and inflammatory cell infiltration in mice with ischemia-reperfusion injury. In addition, it can stabilize Nrf2 and reduce apoptotic cell death and inflammation of liver cells caused by hypoxia-reoxygenation, so it can be effectively applied to alleviating liver damage, especially liver damage caused by ischemic reperfusion. In addition, it can be effectively applied to diseases in which PAK4 is overexpressed, such as cancer and degenerative brain disease.

The compounds of the present invention can be synthesized by the following method (Figure 2). The enolether (1) synthesized from malononitrile (a) is treated with hydrazine (b) to obtain an aminopyrazole ring (11), and then cyclized with formamide (c) to form 4-aminopyrazolo [3 ,4-d]pyrimidine scaffold (12) is provided, and various compounds (14) represented by Formula 1 of the present invention can be synthesized through the subsequent Ullmann reaction (d) and Sonogashira coupling (e) reaction. there is. Additionally (Figure 3), a solvent-accessible moiety was introduced into the 4-aminopyrazolo[3,4-d]pyrimidine skeleton (a), and 3-iodopyrazolo[3,4-d]pyrimidine A solvent-accessible moiety is introduced and hydrogenated through Sonogashira coupling of mydine and substituted propyne (b), and then Ullmann-type coupling (c) and Sonogashira coupling (d) reactions are sequentially performed to obtain Formula 1 Various compounds (18) represented by can be further synthesized.

Another aspect of the invention is 4-(3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutyn-2-ol; 3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenylethynylcyclohexan-1-ol; 4-(3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutynyl-1,2-diol; 4-(3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-phenylbutyn-2-ol; 3-[4-amino-3-(3-morpholin-1-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl]phenylethynyl)cyclohexanol; and 3-[4-amino-3-(3-piperidin-1-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl]phenylethynyl)cyclohexanol; 4-(3-(1-aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyn-2-ol; 3-(1-aminopyrido[4,3- b ]indol-5-yl)phenylethynylcycloexan-1-ol; and 4-(3-(1-aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyn-1,2-diol.

Another aspect of the invention provides a compound that is 3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenylethynylcyclohexan-1-ol.

Another aspect of the present invention provides a pharmaceutical composition for preventing or treating diseases with increased PAK4 expression, comprising the above compound.

The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in the manufacture of drugs, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, and gelatin. , calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, etc. It is not limited. In addition to the above ingredients, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (22nd ed., 2013).

The pharmaceutical composition according to one embodiment of the present invention may be administered together with one or more substances exhibiting PAK4 inhibitory activity.

In addition, the pharmaceutical composition according to one embodiment of the present invention may be used alone or in combination with methods using surgery, hormone therapy, drug therapy, and/or biological response regulators for the prevention or treatment of diseases with increased PAK4 expression. You can.

The pharmaceutical composition of the present invention may contain various bases and/or additives necessary and appropriate for the formulation of the dosage form, and may include nonionic surfactants, silicone polymers, extenders, fragrances, and preservatives to the extent that they do not reduce the effectiveness. , disinfectants, oxidation stabilizers, organic solvents, ionic or non-ionic thickeners, softeners, antioxidants, free radical destroyers, opacifiers, stabilizers, emollients, silicones, α-hydroxy acids, anti-foaming agents, humectants. , vitamins, insect repellent, fragrance, preservative, surfactant, anti-inflammatory agent, substance P antagonist, filler, polymer, propellant, alkalinizing or acidifying agent, or colorant.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. It can be. The dosage of the pharmaceutical composition of the present invention may be 0.001 to 1000 mg/kg for adults.

The pharmaceutical composition of the present invention can be administered orally or parenterally.

The pharmaceutical composition of the present invention can be administered in various dosage forms when administered orally. It may be administered in the form of solid preparations such as pills, powders, granules, tablets, or capsules, and may be administered in the form of various excipients, such as wetting agents, It may further include sweeteners, aromatics, preservatives, etc. Specifically, when the composition of the present invention is formulated in the form of powder, granule, tablet or capsule, it may further include appropriate carriers, excipients and diluents commonly used in its production. The carriers, excipients and diluents include, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and/or mineral oil may be used, but are not limited thereto. In addition, it may be prepared including diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants commonly used in formulation, and may further include lubricants such as magnesium stearate or talc in addition to the above excipients. .

The pharmaceutical composition of the present invention can be administered in various dosage forms when administered parenterally. Solid preparations include tablets, pills, powders, granules, capsules, etc., and liquid preparations include suspensions, oral solutions, emulsions, and syrups. These include, in addition to the commonly used simple diluents such as water, liquid, and paraffin, various excipients such as humectants, sweeteners, fragrances, and preservatives may be included. Specifically, preparations for parenteral administration may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, and freeze-dried preparations. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. Additionally, calcium or vitamin D3 can be added to improve the efficacy of the treatment.

These compositions may be presented in unit-dose (single-dose) or multi-dose (several-dose) containers, such as sealed ampoules and vials, and may be immersed in a sterile liquid carrier, e.g., water for injection, immediately before use. Can be stored under freeze-drying conditions requiring only the addition of. Ready-to-use preparations and suspensions can be prepared from sterile powders, granules and tablets.

According to one embodiment of the present invention, the disease with increased PAK4 expression may be one or more diseases selected from the group consisting of cancer, neurological disease, liver damage, liver inflammation, and melanin pigmentation.

According to one embodiment of the present invention, the cancer includes stomach cancer, lung cancer, liver cancer, colon cancer, small intestine cancer, pancreatic cancer, brain cancer, bone cancer, melanoma, breast cancer, sclerosing gonadotropin, uterine cancer, cervical cancer, head and neck cancer, esophageal cancer, thyroid cancer, It may be one or more cancers selected from the group consisting of parathyroid cancer, kidney cancer, sarcoma, prostate cancer, urethral cancer, bladder cancer, hematological cancer, lymphoma, psoriasis, or fibroadenoma.

According to one embodiment of the present invention, the neurological disease may be a degenerative brain disease.

According to one embodiment of the present invention, the degenerative brain diseases include Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, multiple system atrophy, olivary nucleus-pontine-cerebellar atrophy (OPCA), Shay-Drager syndrome, and striatal-substantia nigra degeneration. , Huntington's disease, amyotrophic lateral sclerosis (ALS), essential tremor, cortico-basal gangrene, diffuse Lewy body disease), Parkinson-ALS-dementia complex, Pick's disease, cerebral ischemia, and cerebral infarction. It could be a disease.

According to one embodiment of the present invention, the liver damage may be one or more damage selected from the group consisting of inflammatory damage, oxidative damage, alcoholic damage, and ischemia-reperfusion damage.

Another aspect of the present invention provides a composition for protecting liver function containing the above compound.

Since the composition for protecting liver function of the present invention contains the compound represented by Formula 1 as an active ingredient, it can effectively protect liver function from various causes of liver damage such as various oxidative stress, inflammatory reaction, alcoholic damage, hypoxia and reoxygenation. .

Another aspect of the present invention provides a health functional food for protecting liver function containing the above compound.

The health functional food composition of the present invention may contain, in addition to the compound represented by Formula 1 as an active ingredient, ingredients commonly added when manufacturing health functional foods, such as proteins, carbohydrates, fats, nutrients, and seasonings. It may include agents and flavoring agents. Examples of carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, oligosaccharides, etc.; and polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a flavoring agent, natural flavoring agents (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

For example, when the health functional food of the present invention is manufactured as a drink, in addition to the compound represented by Formula 1 of the present invention, citric acid, high fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, eucommia extract, jujube extract and/or Licorice extract, etc. may be additionally included.

In addition, the health functional food of the present invention contains various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, and alginic acid. and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.

These ingredients can be used independently or in combination, and the ratio of these additives can be selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the health functional food of the present invention, but is not limited thereto.

According to the pyrazolo[3,4-d]pyrimidine series p21-activated kinase 4 (PAK4) inhibitor and a pharmaceutical composition containing the same, it not only has excellent PAK4 inhibitory activity, but also has an effect of suppressing oxidative stress and inflammation in liver cells. Because it is excellent, it can be usefully used to prevent or treat various liver damage or liver inflammation, such as damage caused by ischemia-reperfusion, or to protect liver function. It can also be used to treat diseases in which PAK4 is overexpressed, such as cancer and degenerative brain disease. It can be applied effectively.

Figure 1 is a diagram showing the design strategy for a new PAK4 selective inhibitor.
Figure 2 is a diagram showing the synthesis of 1-aminopyrido[4,3-b]indole derivatives: (a) trimethyl orthoacetate, 100°C, (b) DMF-DMA, MeOH, reflux, ( c) 48% HBr, AcOH, room temperature, (d) concentrated HCl, 160°C, (e) phenyl hydrazine, Ph ₂ O, 240°C, (f) POCl ₃ , reflux, (g) p-meth Toxybenzylamine (p-methoxybenzylamine), 200°C, (h) 1-bromo-3-iodobenzene, Cu, K ₂ CO ₃ , 18-Crown-6, 1, 2-dichlorobenzene (18-crown-6, 1,2-dichlorobenzene), 180℃, (i) TFA, 60℃, (j) R-prop-2-yn-1-ol, Pd(PPh ₃ ) ₂ Cl ₂ , TEA/DMSO (2:1), 70°C.
Figure 3 is a diagram showing the synthesis process of 4-aminopyrazolo[3,4-d]pyrimidine derivatives: (a) trimethyl orthoacetate, 100°C, (b) hydrazine monohydrate. , EtOH, 80℃, (c) formamide, 180℃, (d) 1-bromo-3-iodobenzene, CuI, K ₂ CO ₃ , DMEDA, DMF, 110°C, (e) R-prop-2-yn-1-ol, Pd(PPh ₃ ) ₂ Cl ₂ , TEA/DMSO (2:1), 70°C.
Figure 4 is a diagram showing the synthesis process of 4-aminopyrazolo[3,4-d]pyrimidine derivative introduced with a solvent-accessible group: (a) trimethyl orthoacetate, 100°C, (b) DMF- DMA, MeOH, reflux, (c) 48% HBr, AcOH, room temperature, (d) concentrated HCl, 160°C, (e) phenyl hydrazine, Ph ₂ O, 240°C, (f) POCl ₃ , reflux. , (g) p-methoxybenzylamine, 200°C, (h) 1-bromo-3-iodobenzene, Cu, K ₂ CO ₃ , 18 -Crown-6, 1,2-dichlorobenzene (18-crown-6, 1,2-dichlorobenzene), 180℃, (i) TFA, 60℃, (j) R-prop-2-yn-1-ol , Pd(PPh ₃ ) ₂ Cl ₂ , TEA/DMSO (2:1), 70°C.
Figure 5 is a graph showing enzyme IC ₅₀ curves for SPA7012, SPA7016, and SPA7017.
Figure 6 is a schematic diagram showing the SPA7012 treatment method for C57BL/6 mice.
Figure 7 is a graph showing serum levels of AST and ALT (n=5).
Figures 8 and 9 are photographs and graphs showing the overall shape of the liver, micrographs of liver cross-sections, and necrosis area measurements (n=5).
Figure 10 is a graph showing (a) immunofluorescence staining photos and (b) quantification (n=5) results of TUNEL-positive apoptotic cells in liver tissue.
Figure 11 is a graph showing the results of (a) Western blotting and (b) analysis (n=5) of apoptosis-related proteins in liver tissue: **, p<0.01. I/R (ischemia-reperfusion), HPF (high power field).
Figure 12 is a graph showing liver levels of malondialdehyde (MDA) (n=5).
Figure 13 is a graph showing liver levels of glutathione (GSH) (n=5).
Figure 14 is a graph showing (a) a photograph of immunohistochemical staining (n=5) and (b) the results for 4-hydroxynonenal (4-HNE) in liver tissue.
Figure 15 is a diagram showing the results of co-IP analysis of HEK293T cells after 24 hours of transfection.
Figure 16 is a photograph showing Nrf2 protein levels in nuclear (NE) and cytoplasmic extracts (CE) of I/R damaged liver tissue.
Figure 17 is a graph showing luciferase activity (n=5) in HEK293T cells after ARE transfection for 24 hours.
Figures 18 and 19 show the results showing the levels of Nrf2 and target genes in liver tissue (n=5): **, p<0.01. I/R (ischemia-reperfusion), HPF (high power field), V (vehicle), S (SPA7012 50 mg/kg).
Figure 20 is a graph showing (a) immunofluorescence staining photos of F4/80-positive macrophages and Ly6G-positive neutrophils in liver tissue and (b) (c) the results of quantifying them (n=5).
Figure 21 is a graph showing protein levels of pro-inflammatory cytokines/chemokines in serum and liver tissue.
Figure 22 is a graph showing mRNA levels of pro-inflammatory cytokines/chemokines in serum and liver tissue.
Figure 23 shows the results showing the protein level of the NF-κB signaling pathway: **, p<0.01. HPF (high power field).
Figure 24 is a schematic diagram showing the SPA7012 treatment method for primary hepatocytes.
Figure 25 is a graph showing the results of MTT analysis (n=5) for cell viability.
Figure 26 is a graph showing the results of lactate dehydrogenase (LDH) release (n=5) from primary hepatocytes after 12 hours of reoxygenation.
Figure 27 shows the results of cell death analysis (n=5) by Annexin-V staining.
Figure 28 shows the results of cell death analysis (n=5) by Western blotting.
Figure 29 is a graph showing protein levels of pro-inflammatory cytokines/chemokines (n=5) in culture medium and hepatocytes: *, p<0.05 and **, p<0.01. H/R (hypoxia-reoxygenation).
Figure 30 is a graph showing mRNA levels (n=5) of pro-inflammatory cytokines/chemokines in culture medium and hepatocytes: *, p<0.05 and **, p<0.01. H/R (hypoxia-reoxygenation).

Hereinafter, the present invention will be described in more detail through one or more examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1. Synthesis of PAK4 inhibitors and selection of SPA7012

<1-1> Reagents and analysis methods

Most reagents and solvents were purchased from commercial sources and used without further purification. All reactions were performed under nitrogen or argon using anhydrous solvents. To monitor reaction completion, thin layer chromatography (TLC) was performed using Kieselgel 60 F254 plates (Merk Millipore, MA, USA). Flash column chromatography was performed using silica gel 60 (230-400 mesh, Merck Millipore) with the indicated solvents. Medium pressure liquid chromatography (MPLC) was performed with a Combiflash®Rf 200 with a RediSep Rf column (Teledyne ISO, Hunt Valley, MD, USA). NMR spectra were obtained using a Varian YH 400 spectrometer (1H 400 MHz, 13C 100 MHz, Agilent, Palo Alto, CA, USA) and/or Avance III HD 500 spectrometer (1H 500 MHz, 13C 125 MHz, Bruker, Billerica, MA, USA). It was recorded using . Chemical shifts were expressed in δ units using tetramethylsilane as an external standard.

<1-2> Synthesis of SPA7001-7003, SPA7011-1017

To screen novel PAK4 selective inhibitors, structure-based drug design was performed. In other words, the crystal structure of PAK4 co-crystallized with the selective inhibitor GNE-2861 was defined targeting the specific back pocket of PAK4 caused by abnormal R-spine rearrangement.

To improve the pharmacokinetic properties, the adenine pocket-binding group was changed (Figure 1). That is, in order to form an improved logP value and a solvent-accessible moiety that is easy to add, scaffold hopping was performed to convert the adenine mimetic monomer into a binary or ternary form.

After changing the adenine pocket-binding group, the bicyclic linker was changed to a monocyclic linker to reduce the structural rigidity of the entire compound. In silico fragment screening provided structural novelty to the heterocyclic scaffold. Two structures, pyrido[4,3-b]indole (γcarboline) and pyrazolo[3,4-d]pyrimidine (pyrazolo[3,4-d) ]pyrimidine) was selected and designed as a type I 1/2 inhibitor. Afterwards, solvent-accessible parts were introduced to improve their properties.

That is, for the synthesis of a PAK4 inhibitor, starting from malononitrile and trimethyl orthoacetate, enol ether is synthesized and transformed into aminopyrazol through enamine. By cyclization, a 4-aminopyrazolo[3,4-d]pyrimidine derivative was synthesized. Thereafter, PAK4 inhibitor compounds SPA7001 to SPA7003 and SPA7011 to SPA1017 were finally obtained through Ullman-type reaction and Sonogashira coupling (FIGS. 2 to 4).

[Scheme 1]

Scheme 1. Synthesis of 1-aminopyrido[4,3-b]indole derivatives: Reagents and conditions; (a) trimethyl orthoacetate, 100℃; (b) DMF-DMA, MeOH, reflux; (c) 48% HBr, AcOH, rt; (d) conc. HCl, 160°C; (e) phenyl hydrazine, Ph2O, 240℃; (f) POCl3, reflux; (g) p-methoxybenzylamine, 200℃; (h) 1-bromo-3-iodobenzene, Cu, K2CO3, 18-crown-6, 1,2-dichlorobenzene, 180°C; (i) TFA, 60°C; (j) R-prop-2-yn-1-ol, Pd(PPh3)2Cl2, TEA/DMSO (2:1), 70°C.

[Scheme 2]

Scheme 2. Synthesis of the 4-aminopyrazolo[3,4-d]pyrimidine derivatives: Reagents and conditions; (a) trimethyl orthoacetate, 100℃; (b) hydrazine monohydrate, EtOH, 80°C; (c) formamide, 180℃; (d) 1-bromo-3-iodobenzene, CuI, K2CO3, DMEDA, DMF, 110°C; (e) R-prop-2-yn-1-ol, Pd(PPh3)2Cl2, TEA/DMSO (2:1), 70°C.

[Scheme 3]

Scheme 3. Synthesis of the 4-aminopyrazolo[3,4-d]pyrimidine derivatives with a solvent-accessible moiety: Reagents and conditions; (a) CuI, Pd(PPh ₃ ) ₄ , TEA, DMF, 70°C; (b) Pd/C, H ₂ , MeOH, rt; (c) 1-bromo-3-iodobenzene, CuI, K ₂ CO ₃ , DMEDA, DMF, 110°C; (d) 1-Ethynylcyclohexanol, Pd(PPh ₃ ) ₂ Cl ₂ , TEA/DMSO (2:1), 70°C.

compound SPA No. constitutional formula
[Compound name] Compound 1 SPA7001
[4-(3-(1-Aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyn-2-ol] compound 2 SPA7002
[3-(1-Aminopyrido[4,3- b ]indol-5-yl)phenylethynylcyclohexan-1-ol] Compound 3 SPA7003
[4-(3-(1-Aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyn-1,2-diol]

compound
SPA No. constitutional formula
[Compound name] Compound 4 SPA7011
[4-(3-(4-Amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutyn-2-ol] Compound 5 SPA7012
[3-(4-Amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenylethynylcyclohexan-1-ol] Compound 6 SPA7013
[4-(3-(4-Amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutyn-1,2-diol] Compound 7 SPA7014
[4-(3-(4-Amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-phenylbutyn-2-ol] Compound 8 SPA7016
[3-[4-Amino-3-(3-morpholin-1-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl]phenylethynyl)cyclohexanol] Compound 9 SPA7017
[3-[4-Amino-3-(3-piperidin-1-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl]phenylethynyl)cyclohexanol]

<Synthesis of Compound 1-18>

2-(1-Methoxyethylidene)malononitrile (1)

A mixture of malononitrile (5.0 ml, 78.60 mmol) and trimethyl orthoacetate (11.0 ml, 86.46 mmol) was heated to reflux for 4 hours. After cooling to room temperature, the reaction mixture was purified by MPLC with a gradient of 0-30% EtOAc in n-hexane to give 2 as a light yellow liquid (9.51 g, 99%): R _f = 0.30 ( n -hexane: EtOAc = 3:2); ¹ H NMR (400 MHz, CDCl ₃ ) δ 4.08 (s, 3H), 2.41 (s, 3H); ¹³ C NMR (100 MHz, CDCl ₃ ) δ 185.7, 113.2, 111.1, 66.3, 58.6, 17.4.

2-(3-Dimethylamino-1-methoxyallylidene)malononitrile (2)

To a mixture of 1 (9.51 g, 77.86 mmol) in MeOH (120 ml) was added DMF-DMA (11.7 ml, 85.65 mmol). The reaction mixture was heated to reflux for 1 hour. After cooling to room temperature, the reaction mixture was concentrated and diluted with water. The resulting mixture was extracted with DCM. The combined organic layers were washed with brine, dried over MgSO4, filtered and concentrated in vacuo. The residue was recrystallized (EtOH 100%) and purified by flash column chromatography to give 3 (14.60 g, 67%) as a brown solid: R _f = 0.19 ( n -hexane:EtOAc = 1:1); ^1H NMR (400 MHz, CDCl ₃ ) δ 7.55 (d, J = 12.3 Hz, 1H), 5.09 (d, J = 12.3 Hz, 1H), 4.10 (s, 3H), 3.21 (s, 3H), 2.95 (s, 3H); ¹³ C NMR (100 MHz, CDCl ₃ ) δ 181.7, 152.8, 117.4, 116.1, 87.4, 60.7, 45.8, 37.4.

2-Bromo-4-methoxynicotinonitrile (3)

To a mixture of 2 (2.30 g, 12.96 mmol) in 48% HBr (26 ml) was added acetic acid ice water (13 ml). After stirring at room temperature for 14 hours, the reaction mixture was neutralized with NaHCO3 (aq) and extracted with EtOAc. The combined organic layers were washed with brine, dried over MgSO4, filtered and concentrated in vacuo. The residue was purified by MPLC with a gradient of 0-40% EtOAc in n-hexane to give 3 (1.81 g, 66%) as a yellow solid: R _f = 0.30 ( n -hexane:EtOAc = 1:1); ¹ H NMR (400 MHz, CDCl ₃ ) δ 8.40 (d, J = 5.9 Hz, 1H), 6.92 (d, J = 5.9 Hz, 1H), 4.03 (s, 3H); ¹³ C NMR (100 MHz, CDCl ₃ ) δ 168.7, 153.5, 145.3, 113.3, 106.1, 103.8, 57.0.

4-Hydroxy-1 H -pyridin-2-one (4)

The reaction tube was filled with the concentrate. To the HCl (6ml) solution was added 3 (1.38g, 6.48mmol). The tube was sealed and the mixture was heated at 160°C for 15 hours. After cooling to room temperature, the reaction mixture was diluted with water and neutralized with 2 N NaOH (aq). The resulting mixture was dried under reduced pressure and dissolved in MeOH. The resulting suspension was filtered and the filtrate was purified by MPLC with a gradient of 0-20% MeOH in CHCl ₃ to give 4 (676 mg, 94%) as a white solid: R _f = 0.22 (CHCl ₃ :MeOH = 8 :One); ^1H NMR (400 MHz, DMSO- d6 ) δ 11.07 (s, 1H), _7.26 (d, J = 7.2 Hz, 1H), 5.88 (d, J = 7.2 Hz, 1H), 5.60 (s, 1H) , 3.12 (s, 1H); ¹³ C NMR (100 MHz, DMSO- d ₆ ) δ 168.5, 164.9, 136.2, 100.5, 99.1.

2,5-Dihydropyrid[4,3- b ]indolone (5)

To a mixture of 4 (312 mg, 2.81 mmol) in diphenyl ether (28 ml) was added phenylhydrazine (0.34 ml, 3.37 mmol). The reaction mixture was heated to reflux in a preheated sand bath and stirred for 18 hours. After cooling to room temperature, the reaction mixture was poured into n-hexane (300 ml). The precipitate was filtered and rinsed with THF. The combined filtrates were purified by flash column chromatography to provide 5 (101 mg, 20%) as a brown solid: R _f = 0.33 (CHCl ₃ :MeOH = 8:1); ¹ H NMR (400 MHz, CD ₃ OD) δ 8.22 (d, J = 7.8 Hz, 1H), 7.47 (d, J = 8.1 Hz, 1H), 7.36 (d, J = 7.1 Hz), 7.34 (t, J = 8.1 Hz, 1H), 7.24 (t, J = 7.8 Hz, 1H), 6.68 (d, J = 7.1 Hz, 1H).

1-Chloro-5 H -pyrido[4,3- b ]indole (6)

A mixture of 5 (648 mg, 3.52 mmol) and phosphorus oxychloride (10 ml) was heated to reflux for 14 hours. After cooling to room temperature, the reaction mixture was concentrated, neutralized with NaHCO3 (aq) and extracted with DCM. The combined organic layers were washed with brine, dried over MgSO4, filtered and concentrated in vacuo. The residue was purified by flash column chromatography to give 6 (376 mg, 53%) as a pale yellow solid: R _f = 0.51 (CHCl ₃ :MeOH = 10:1); ^1H NMR (500 MHz, DMSO- d6 ) δ 12.15 (s, 1H), 8.38 ( _d , J = 7.9 Hz, 1H), 8.24 (d, J = 5.6 Hz, 1H), 7.65 (d, J = 7.5 Hz, 1H), 7.57 (t, J = 7.5 Hz, 1H), 7.54 (d, J = 5.6 Hz, 1H), 7.37 (t, J = 7.9 Hz, 1H); ¹³ C NMR (125 MHz, DMSO- d ₆ ) δ 145.9, 144.2, 144.1, 140.1, 127.7, 122.4, 121.1, 120.0, 116.7, 112.3, 107.0.

4-Methoxybenzyl(5 H -pyrido[4,3- b ]indol-1-yl)amine (7)

6 (407 mg, 2.01 mmol) and 4-methoxybenzylamine (5.3 ml, 40.12 mmol) were charged into the reaction tube. The tube was sealed and the mixture was heated at 200° C. for 4 hours. After cooling to room temperature, the reaction mixture was diluted with water and extracted with EtOAc. The combined organic layers were washed with brine, dried over MgSO4, filtered and concentrated in vacuo. The residue was purified by flash column chromatography to give 7 (760 mg, quantitative) as a pale yellow solid: R _f = 0.32 ( n -hexane:EtOAc = 1:1); ^1H NMR (400 MHz, CDCl ₃ ) δ 8.76 (s, 1H), 8.12 (dd, J = 5.6, 2.0 Hz, 1H), 7.76 (d, J = 8.0 Hz, 1H) 7.49-7.33 (m, 3H) ), 7.30-7.20 (m, 2H), 6.96-6.84 (m, 2H), 6.78 (dd, J = 5.6, 2.0 Hz, 1H), 5.13 (s, 1H), 4.87(d, J = 3.2 Hz, 2H), 3.80 (s, 3H).

(5-(3-Bromophenyl)-5 H -pyrido[4,3- b ]indolyl)(4-methoxybenzyl)amine (8)

1,2-dichlorobenzene (10 ml) in a mixture of 7 (674 mg, 2.22 mmol), copper powder (283 mg, 4.45 mmol), potassium carbonate (922 mg, 6.67 mmol), and 18-crown-6 (178 mg, 0.67 mmol). was added to 3-bromo-1-iodobenzene (434㎕, 3.33mmol). The reaction mixture was heated at 180°C for 5 hours. The hot reaction mixture was filtered through a pad of Celite and rinsed with hot EtOAc. The combined filtrates were washed with brine, dried over MgSO4, filtered and concentrated in vacuo. The residue was purified by flash column chromatography to give 8 (436 mg, 43%) as a yellow solid: R _f = 0.63 ( n -hexane:EtOAc = 2:1); ^1H NMR (400 MHz, CDCl ₃ ) δ 8.12 (s, 1H), 7.81 (s, 1H) 7.72-7.58 (m, 2H), 7.52-7.27 (m, 7H), 6.92 (d, J = 6.8 Hz , 2H), 6.70 (s, 1H), 5.19 (s, 1H), 4.87(s, 2H), 3.81 (s, 3H).

5-(3-Bromophenyl)-5 H -pyrido[4,3- b ]indolylamine (9)

A mixture of 8 (391 mg, 0.85 mmol) and trifluoroacetic acid (3.3 ml) was heated to 60° C. for 30 min. After cooling to room temperature, the reaction mixture was poured into ice-water, neutralized with NaHCO ₃ (aq.) and extracted with EtOAc. The combined organic layers were washed with brine, dried over MgSO ₄ , filtered and concentrated in vacuo. The residue was purified by flash column chromatography to give 9 (336 mg, quantitative) as a pale yellow solid: R _f = 0.11 ( n -hexane:EtOAc = 1:1); ^1H NMR (400 MHz, CDCl ₃ ) δ 8.00 (d, J = 5.6 Hz, 1H), 7.92 (d, J = 7.2 Hz, 1H), 7.67 (s, 1H), 7.63 (d, J = 7.2 Hz) , 1H), 7.53-7.28 (m, 5H), 6.72 (t, J = 5.2 Hz, 1H), 5.47 (s, 2H).

General procedure for synthesis of compounds 10a-c, 14a-d and 18a-b

To a mixture of compounds 9, 13 or 17 (1.0 equiv) in TEA/DMSO (2:1) was added bis(triphenylphosphine)palladium(II) dichloride (1.0 equiv) under nitrogen atmosphere. After stirring at room temperature for 10 minutes, alkyl acetylene (10.0 equiv) was added. The reaction mixture was heated at 70° C. for 1 hour. After cooling to room temperature, the mixture was filtered through a pad of Celite and rinsed with EtOAc. Water was added to the filtrate and the mixture was extracted with EtOAc. The combined organic layers were dried over MgSO ₄ , filtered and concentrated in vacuo. The residue was purified by flash column chromatography (CHCl3:EtOAc or EtOAc:MeOH) to give 10, 14 or 18.

4-(3-(1-Aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyn-2-ol (10a)

Off-white solid (71%): R _f = 0.31 (EtOAc 100%); ^1H NMR (400 MHz, CDCl ₃ ) δ 7.97 (d, J = 5.8 Hz, 1H), 7.87 (d, J = 7.9 Hz, 1H), 7.54-7.48 (m, 3H), 7.40-7.31 (m, 4H), 6.67 (d, J = 5.8 Hz, 1H), 5.35 (s, 2H), 3.56 (s, 1H), 1.65 (s, 6H); ¹³ C NMR (100 MHz, CDCl ₃ ) δ 153.9, 146.4, 143.5, 139.8, 136.6, 131.3, 130.0, 129.9, 126.8, 125.2, 125.0, 121.8, 121.4, 120.3, 110 .0, 104.2, 97.8, 96.0, 80.6, 65.2 , 31.4.

3-(1-Aminopyrido[4,3- b ]indol-5-yl)phenylethynylcyclohexan-1-ol (10b)

Yellow solid (49%): R _f = 0.38 (EtOAc 100%); ^1H NMR (500 MHz, CDCl ₃ ) δ 7.99 (d, J = 5.9 Hz, 1H), 7.90 (d, J = 7.6 Hz, 1H), 7.60-7.51 (m, 3H), 7.46-7.33 (m, 4H), 6.71 (d, J = 5.9 Hz, 1H), 5.42 (s, 2H), 4.01 (s, 1H), 2.07-1.99 (m, 2H), 1.80-1.53 (m, 7H), 1.35-1.24 (m, 1H); ¹³ C NMR (125 MHz, CDCl ₃ ) δ 153.9, 146.5, 143.3, 139.9, 136.7, 131.5, 130.1, 130.0, 127.0, 125.3, 125.2, 121.8, 121.6, 120.4, 110 .1, 104.3, 98.0, 94.9, 82.9, 68.9 , 40.0, 25.2, 23.4.

4-(3-(1-Aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyn-1,2-diol (10c)

Off-white solid (10%): R _f = 0.16 (EtOAc 100%); ^1H NMR (500 MHz, CD ₃ OD) δ 8.24 (d, J = 7.5 Hz, 1H), 7.88 (d, J = 6.1 Hz, 1H), 7.70-7.63 (m, 3H), 7.55 (dt, J = 7.0, 2.1 Hz, 1H), 7.49-7.36 (m, 3H), 6.73 (d, J = 6.1 Hz, 1H), 3.61 (s, 2H); ¹³ C NMR (125 MHz, CD ₃ OD) δ 154.1, 146.5, 141.9, 139.8, 136.6, 131.3, 130.1, 129.8, 126.9, 125.2, 125.1, 121.8, 121.5, 120.6, 10 9.5, 103.8, 97.0, 93.3, 81.7, 69.6, 68.2, 24.7.

5-Amino-3-methyl-1 H -pyrazole-4-carbonitrile (11)

To a solution of 1 (1.64 g, 13.42 mmol) in EtOH (25 ml) was added hydrazine monohydrate (1.3 ml, 26.84 mmol). The reaction mixture was heated at 80° C. for 1 hour. After cooling to room temperature, the reaction mixture was concentrated. The residue was purified by flash column chromatography to provide 11 (1.60 g, 98%) as an off-white solid: R _f = 0.31 ( n -hexane:EtOAc = 1:2); ¹ H NMR (500 MHz, CD ₃ OD) δ 2.25 (s, 3H).

3-Methyl-1 H -pyrazolo[3,4- d ]pyrimidin-4-ylamine (12)

A mixture of 11 (1.37 g, 11.22 mmol) and formamide (9 ml) was heated to 180° C. for 18 hours. After cooling to room temperature, the reaction mixture was poured into water and cooled in an ice bath. The solid was filtered and rinsed with water and MeOH to give 12 (1.10 g, 65%) as a yellow solid without further purification: R _f = 0.26 (EtOAc:MeOH = 10:1); ¹ H NMR (500 MHz, CD ₃ OD) δ 8.15 (s, 1H), 2.62 (s, 3H); ¹³ C NMR (125 MHz, CD ₃ OD) δ 164.7, 159.0, 155.5, 152.0, 98.6, 12.9.

General procedure for synthesis of compounds 13 and 17a-b

To a mixture of 12 or 16 (1.0 equivalents), copper iodide (0.2 equivalents), and potassium carbonate (2.0 equivalents) in DMF, add DMEDA (0.4 equivalents) and 3-bromo-1-iodobenzene (1.2 equivalents); The reaction mixture was heated at 110°C for 3-23 hours. After cooling to room temperature, the reaction mixture was filtered through a pad of Celite and rinsed with EtOAc. The combined filtrates were washed with brine, dried over MgSO ₄ , filtered and concentrated in vacuo. The residue was purified by flash column chromatography (EtOAc:MeOH) to provide 13 or 17.

(3-Bromophenyl)-3-methyl-1 H -pyrazolo[3,4- d ]pyrimidin-4-ylamine (13)

Off-white solid (25%): R _f = 0.67 (EtOAc:MeOH = 10:1); ¹ H NMR (500 MHz, CD ₃ OD) δ 8.40 (s, 1H), 8.28 (s, 1H), 8.18 (d, J = 8.0 Hz, 1H), 7.49-7.40 (m, 2H), 2.69 (s) , 3H); ¹³ C NMR (125 MHz, CD ₃ OD) δ 158.9, 156.2, 154.4, 143.8, 142.2, 140.0, 130.2, 128.6, 123.5, 122.0, 119.4, 13.1.

4-(3-(4-Amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutyn-2-ol (14a).

Pale yellow solid (58%): R _f = 0.29 (CHCl ₃ :EtOAc = 1:3); ¹ H NMR (500 MHz, CD ₃ OD) δ 8.26 (s, 1H), 8.18 (s, 1H), 8.08 (d, J = 8.2 Hz, 1H), 7.48 (t, J = 8.0 Hz, 1H), 7.36 (d, J = 7.7 Hz, 1H), 2.69 (s, 3H), 1.61 (s, 6H); ¹³ C NMR (125 MHz, CD ₃ OD) δ 158.9, 156.1, 154.1, 143.5, 138.8, 128.8, 123.9, 123.8, 120.9, 100.5, 94.5, 80.5, 64.5, 30.3, 13.1.

3-(4-Amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenylethynylcyclohexan-1-ol (14b)

Pale yellow solid (85%): R _f = 0.33 (CHCl ₃ :EtOAc = 1:3); ^1H NMR (500 MHz, CD ₃ OD) δ 8.14 (s, 1H), 8.06 (s, 1H), 7.98 (d, J = 8.0 Hz, 1H), 7.37 (dd, J = 8.0, 7.7 Hz, 1H ), 7.26 (d, J = 7.7 Hz, 1H), 2.57 (s, 3H), 1.96-1.84 (m, 2H), 1.71-1.45 (m, 7H), 1.29-1.16 (m, 1H); ¹³ C NMR (125 MHz, CD ₃ OD) δ 158.9, 156.1, 154.2, 143.5, 138.8, 128.9, 128.8, 124.0, 123.8, 120.9, 100.5, 93.6, 68.0, 39.5, 25.0, 23.0, 13.1.

4-(3-(4-Amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutyn-1,2-diol (14c)

Yellow solid (82%): R _f = 0.13 (CHCl ₃ :EtOAc = 1:3); ^1H NMR (500 MHz, CD ₃ OD) δ 8.26 (s, 1H), 8.21 (s, 1H), 8.09 (d, J = 8.0 Hz, 1H), 7.48 (dd, J = 8.0, 7.8 Hz, 1H ), 7.40 (d, J = 7.8 Hz, 1H), 3.63 (s, 2H), 2.69 (s, 3H), 1.56 (s, 3H); ¹³ C NMR (125 MHz, CD ₃ OD) δ 156.1, 143.5, 138.8, 129.0, 128.8, 123.9, 123.8, 121.0, 92.2, 82.4, 69.7, 68.2, 60.1, 24.8, 19.4, 13 .1.

4-(3-(4-Amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-phenylbutyn-2-ol (14d)

Pale yellow solid (46%): R _f = 0.33 (CHCl ₃ :EtOAc = 1:5); ^1H NMR (500 MHz, CD ₃ OD) δ 8.26 (s, 1H), 8.24 (t, J = 1.6 Hz, 1H), 8.12 (dd, J = 8.2, 1.0 Hz, 1H), 7.76-7.71 (m , 2H), 7.51 (t, J = 7.9 Hz, 1H), 7.46-7.37 (m, 3H), 7.31 (d, J = 7.4 Hz, 1H), 2.70 (s, 3H), 1.85 (s, 3H) ; ¹³ C NMR (125 MHz, CD ₃ OD) δ 158.9, 156.1, 154.1, 146.0, 143.6, 138.9, 128.9, 128.8, 127.8, 127.1, 124.7, 123.8, 123.7, 121.1, 10 0.5, 93.6, 83.0, 69.3, 32.5, 13.1.

General procedure for synthesis of compounds 15a-b

Step 1. Propargyl alcohol (1.0 equiv) and triethylamine (1.2 equiv) were slowly added simultaneously to a mixture of methanesulfonyl chloride (1.2 equiv) in DCM. The reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was washed with water, dried over MgSO ₄ , filtered and concentrated to provide methanesulfonic acid prop-2-ynyl ester as a yellow liquid without further purification.

Step 2. Morpholine or piperidine (2.0 equiv) was added to the mixture of methanesulfonic acid prop-2-ynyl ester in DCM. After stirring at room temperature for 4-12 hours, the reaction mixture was filtered. The combined filtrates were washed with NaHCO ₃ (aq), dried over MgSO ₄ , filtered and concentrated in vacuo. The crude intermediate was used in the next step without further purification.

Step 3. Add tetramethylamine to a mixture of 3-iodo-1H-pyrazolo[3,4-d]pyrimidin-4-amine (1.0 equiv) and copper(I) iodide (0.2 equiv) in DMF under nitrogen atmosphere. Kiss(triphenylphosphine)palladium(0) (0.1 equivalent) was added. After stirring at room temperature for 10 minutes, triethylamine (2.0 equiv) and propargyl morpholine or propargyl piperidine (10.0 equiv) were added. The reaction mixture was heated at 70° C. for 1.5 hours. After cooling to room temperature, the mixture was filtered through a pad of Celite and rinsed with EtOAc. Water was added to the filtrate and the mixture was extracted with EtOAc. The combined organic layers were dried over MgSO ₄ , filtered and concentrated in vacuo. The residue was purified by flash column chromatography (EtOAc:MeOH) to provide 15.

3-(3-Morpholin-4-ylprop-1-ynyl)-1 H -pyrazolo[3,4- d ]pyrimidin-4-ylamine (15a).

Pale yellow solid (47%): R _f = 0.22 (DCM:MeOH = 6:1); ¹ H NMR (500 MHz, CD ₃ OD) δ 8.10 (s, 1H), 3.72-3.60 (m, 4H), 3.54 (s, 2H), 2.59 (br s, 4H).

3-(3-Piperidin-1-ylprop-1-ynyl)-1 H -pyrazolo[3,4- d ]pyrimidin-4-ylamine (15b)

Pale yellow solid (47%): R _f = 0.22 (EtOAc:MeOH = 4:1); ¹ H NMR (500 MHz, CD ₃ OD) δ 8.21 (s, 1H), 3.61 (s, 2H), 2.68 (br s, 4H), 1.74-1.65 (m, 4H), 1.53 (br s, 2H) .

General procedure for synthesis of compounds 16a-b

To a mixture of 15 (1.0 equiv) in MeOH was added Pd/C (50% by weight) and the reaction mixture was stirred under hydrogen atmosphere for 1.5 hours. The mixture was filtered through a pad of Celite, rinsed with MeOH and concentrated in vacuo. The residue was purified by flash column chromatography (EtOAc:MeOH) to provide 16.

3-(3-Morpholin-4-ylpropyl)-1 H -pyrazolo[3,4- d ]pyrimidin-4-ylamine (16a)

White solid (61%): R _f = 0.15 (EtOAc:MeOH = 4:1); ^1H NMR (500 MHz, CD ₃ OD) δ 8.18 (s, 1H), 3.70 (t, J = 4.6 Hz, 4H), 3.03 (t, J = 7.1 Hz, 2H), 2.53-2.40 (m, 6H) ), 1.98 (quint., J = 7.1 Hz, 2H).

3-(3-Piperidin-1-ylpropyl)-1 H -pyrazolo[3,4- d ]pyrimidin-4-ylamine (16b)

Yellow solid (97%): R _f = 0.04 (EtOAc:MeOH = 4:1); ¹ H NMR (500 MHz, CD ₃ OD) δ 8.16 (s, 1H), 3.02 (t, J = 7.2 Hz, 2H), 2.58-2.27 (m, 6H), 1.98 (quint., J = 7.2 Hz, 2H), 1.68-1.59 (m, 4H), 1.50 (br s, 2H).

1-(3-Bromophenyl)-3-(3-morpholin-4-ylpropyl)-1 H -pyrazolo[3,4- d ]pyrimidin-4-ylamine (17a)

White solid (57%): R _f = 0.30 (EtOAc:MeOH = 4:1); ¹ H NMR (500 MHz, CD ₃ OD) δ 8.30 (t, J = 1.9 Hz, 1H), 8.18 (s, 1H), 8.09 (dt, J = 8.1, 1.9 Hz, 1H), 7.37-7.29 (m , 2H), 3.61 (t, J = 5.0 Hz, 4H), 3.00 (t, J = 7.1 Hz, 2H), 2.50-2.38 (m, 6H), 1.98 (quint., J = 7.1 Hz, 2H).

1-(3-Bromophenyl)-3-(3-piperidin-1-ylpropyl)-1 H -pyrazolo[3,4- d ]pyrimidin-4-ylamine (17b)

(52%): R _f = 0.14 (EtOAc:MeOH = 4:1); ¹ H NMR (500 MHz, CD ₃ OD) δ 8.43 (t, J = 1.9 Hz, 1H), 8.30 (s, 1H), 8.24-8.20 (m, 1H), 7.51-7.42 (m, 2H), 3.10 (t, J = 7.2 Hz, 2H), 2.59-2.44 (m, 6H), 2.09 (quint., J = 7.2 Hz, 2H), 1.70-1.61 (m, 4H), 1.52 (br s, 2H).

(3-(4-Amino-3-(3-morpholin-4-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl)phenylethynyl)cyclohexanol (18a)

Off-white solid (66%): R _f = 0.33 (EtOAc:MeOH = 4:1); ¹ H NMR (500 MHz, CD ₃ OD) δ 8.28 (s, 1H), 8.20 (t, J = 2.0 Hz, 1H), 8.14 (ddd, J = 8.0, 2.0, 1.0 Hz, 1H), 7.50 (t , J = 8.0 Hz, 1H), 7.38 (dt, J = 8.0, 1.0 Hz, 1H), 3.72 (t, J = 4.6 Hz, 4H), 3.12 (t, J = 7.1 Hz, 2H), 2.58-2.43 (m, 6H), 2.13-1.98 (m, 4H), 1.83-1.59 (m, 7H), 1.35 (br s, 1H); ¹³ C NMR (125 MHz, CD ₃ OD) δ 156.0, 154.1, 146.9, 138.9, 128.8, 124.0, 123.7, 120.8, 100.4, 93.7, 82.9, 68.0, 66.2, 57.0, 53.3, 3 9.5, 39.0, 25.2, 25.0, 24.9, 23.0, 13.1.

(3-[4-Amino-3-(3-piperidin-1-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl]phenylethynyl)cyclohexanol (18b)

Off-white solid (40%): R _f = 0.36 (EtOAc:MeOH = 4:1); ^1H NMR (500 MHz, CD ₃ OD) δ 8.22 (s, 1H), 8.17 (s, 1H), 8.10 (d, J = 8.0 Hz, 1H), 7.43 (dd, J = 8.0, 7.6 Hz, 1H ), 7.32 (d, J = 7.6 Hz, 1H), 3.00 (t, J = 7.0 Hz, 2H), 2.48-2.30 (m, 5H), 2.04-1.93 (m, 4H), 1.80-1.37 (m, 14H), 1.28 (s, 1H).

<1-3> Confirmation of excellent PAK4 enzyme inhibitory activity of SPA7012 according to kinase activity analysis

To synthesize a series of pyrido[4,3-b]indole derivatives and pyrazolo[3,4-d]pyrimidine derivatives and to evaluate the in vitro PAK4 enzyme inhibitory activity of the synthesized compounds at a single concentration (20 μM), ), an in vitro kinase assay was performed using the HotSpot kinase assay for relative enzyme inhibitory activity, and IC ₅₀ evaluation at an ATP concentration of 10 μM.

Specifically, to investigate enzyme activity, HotSpot kinase assay was performed by Reaction Biology Corporation (Malvern, PA, USA). Kinase and substrate pairs were prepared in reaction buffer: 20mM HEPES, 10mM MgCl2, 1mM EGTA, 0.02% Brij 35, 0.02mg/mL BSA, 0.1mM Na3VO4, 2mM DTT and 1% DMSO at pH 7.5. Each compound prepared in Example 1 was added to the kinase reaction mixture and incubated for 20 minutes. Afterwards, 33P-ATP was transferred to the reaction mixture to initiate the reaction at an ATP concentration of 10 μM. After 2 hours at room temperature, the reaction mixture was spotted on P81 ion exchange paper, and the kinase activity was detected by filter-binding method. A single dose enzyme inhibition test was performed on the compound at a concentration of 20 μM. The control compound, staurosporine, was tested in 10 dose IC ₅₀ mode. To determine IC ₅₀ values, compounds were analyzed for 10 doses in 3-fold serial dilutions starting at 100 μM.

Results of a HotSpot Kinase Assay for relative enzyme inhibitory activity at a single concentration (20 μM), and IC ₅₀ evaluation at an ATP concentration of 10 μM for the bicyclic pyrazolo[3,4-d]pyrimidine derivatives (compounds 4 to 9). was confirmed to exhibit better PAK4 enzyme inhibitory activity than tricyclic pyrido[4,3-b]indole derivatives (compounds 1 to 3) (Table 3).

compound PAK4 enzyme inhibition clogP Inhibitory activity (%) IC ₅₀ (μM) Compound 1 32 N.D. 3.79 compound 2 54 34.0 5.10 Compound 3 29 N.D. 2.66 Compound 4 60 N.D. 1.25 Compound 5 97 0.77 2.57 Compound 6 36 N.D. 0.12 Compound 7 65 N.D. 2.59 Compound 8 88 9.92 2.57 Compound 9 90 4.41 3.78

Additionally, for the allosteric pocket binder, the cyclohexyl group (SPA7012) was found to be preferred over the smaller dimethyl (SPA7011) or hydroxymethyl group (SPA7013), and the aromatic ring (SPA7014) was found to be preferred over the saturated ring (SPA7012). It was confirmed that activity was reduced compared to . In vitro enzyme IC ₅₀ values appeared in the following order: SPA7012, SPA7017, and SPA7016 (Figure 5).

Compound SPA7012 was selected to evaluate the subtype selectivity with submicromolar IC ₅₀ values (Table S3) and PAK4 (81% inhibition) compared to PAK1 (16% inhibition) and PAK2 (36% inhibition, > 100 μM of IC ₅₀ ). , IC ₅₀ of 0.77 μM) was confirmed to exhibit excellent selectivity (Table 4).

Subtype Inhibitory activity (%) IC ₅₀ (μM) PAK1 16 N.D. PAK2 36 - PAK3 5 N.D. PAK4 81 0.77 PAK5 52 >100 PAK6 36 -

<1-4> Confirmation of excellent PAK4 selectivity of SPA7012 according to molecular docking analysis

Molecular docking analysis of SPA7012 was performed on the structure of the human PAK4 catalytic domain in complex with GNE-2861 (PDB code: 4O0V).

Specifically, molecular docking was performed using Cresset Flare V.5.0 (Litlington, Cambridgeshire, UK). The 3D coordinates of the active site were taken from the reported crystal structure of human PAK4 in complex with its ligand (PDB code 4O0V) from the RCSB Protein Data Bank. After preparing and minimizing the protein structure, a grid box of the binding site was defined according to the clustered ligands. Docking calculations of the synthesized compounds were performed using Flare V.5.0 in normal docking mode.

As a result, the binding pose of SPA7012 was shown to overlap with the crystal structure of GNE-2861 with the allosteric binder appropriately located in a specific back pocket. The oxygen atom of the tertiary alcohol of the hydrophobic allosteric binder formed a hydrogen bond with the backbone of Phe459 and the side chain of Glu366. The amine group and nitrogen atom of the pyrazolo[3,4-d]pyrimidine core scaffold also formed hydrogen bonds with Lue398 in the hinge region. Therefore, SPA7012 was selected as the main compound and subsequent experiments were performed.

Example 2. Experimental method to confirm the effect of SPA7012 on improving liver ischemia-reperfusion damage by targeting PAK4

<2-1> Inter-part I/R damage model

Pathogen-free 8- to 10-week-old C57BL/6 male mice (Orient Bio, Seoul, Korea) were maintained in a 12-h light/dark environment controlled at 22°C and 50% humidity with free access to food and water. Hepatic I/R injury was created by occlusion of the portal vein, hepatic artery, and bile duct immediately above the right branch.

Specifically, mice were anesthetized by intraperitoneal injection with ketamine (100 mg/kg) and xylazine (10 mg/kg), then dissected, and atraumatic clips were inserted across the portal vein, hepatic artery, and bile duct just above the right branch into the liver. Blood flow to the left and median lobes, which account for about 70% of the total blood supply, was blocked. The liver was kept moist with saline-soaked gauze, and body temperature was maintained at 37°C with a warm blanket during the ischemic period. After 60 minutes of partial liver ischemia, the clip was removed and reperfusion was initiated. The same surgery was performed on control mice without vascular occlusion. After a sufficient reperfusion period, mice were sacrificed by exsanguination under anesthesia and serum samples were collected. The right and median lobes of the liver were collected and stored at -80°C until further analysis or immediately fixed in 10% formalin. All animal experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publication No. 85-23, revised 2011). The research protocol was approved by the Chonbuk National University Animal Care and Use Committee (permit number: JBNU-2019-00122).

<2-2> Isolation of primary hepatocytes

Primary hepatocytes were prepared by perfusion from 8-10 week old C57BL/6 male mice. After cannulation of the inferior vena cava, the liver was perfused with calcium-free HEPES buffer (10mM, pH7.4) for 5 minutes at a flow rate of 0.35ml/min, and collagenase IV (Sigma-Aldrich, St. Louis, MO, USA) perfused with HEPES buffer containing 5 μg for 5 minutes. Hepatocytes were resuspended in DMEM/F12 supplemented with 10% FBS mixed with 42% Percoll, 10 units/ml penicillin, 10 μg/ml streptomycin, and 10 nM dexamethasone and centrifuged at 1,300 rpm for 5 min. Cells were plated at 1×106 cells/well in a 6-well culture dish.

<2-3> Hypoxia-reoxygenation protocol

Primary hepatocytes were cultured in anaerobic bottles (Oxoid, Basingstoke, Hampshire, UK) at 37°C with oxygen absorption packs (AnaeroGen, Oxoid). This method has been shown to achieve bottle oxygen levels of less than 1%. After various periods of hypoxia, the chamber was opened and the hypoxic medium was replaced with oxygenated medium to initiate reoxygenation of the cells.

<2-4> Cell culture and transient transfection

The human embryonic kidney cell line HEK293T was obtained from the American Type Culture Collection (Manassas, VA, USA). For Nrf2 reporter gene analysis, 1 μg of plasmid containing a promoter with ARE-driven luciferase expression was used. HEK293T cells were transduced with 1 μg of Nrf2 and PAK4 with Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) to express exogenous proteins. Luciferase activity was measured using the Dual-Luciferase Reporter Assay (Promega, Madison, WI, USA) on Lumat LB 9507 (Berthold, Bad Wildbad, Germany).

<2-5> MTT assay for cell viability

Cell viability was determined by analyzing the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to formazan.

<2-6> Flow cytometry analysis of apoptosis

Cell death induced by hypoxia-reoxygenation (H/R) was monitored using Annexin V-propidium iodide (PI) double staining kit (BD Biosciences, San Jose, CA, USA) according to the manufacturer's instructions. and quantified by flow cytometry (BD Biosciences). The proportion of apoptotic cells was defined as the percentage of Annexin V-positive cells to PI-positive cells.

<2-7> Biochemical analysis

Alanine aminotransferase (aminotransferase) in liver tissue serum (Asan Pharm, Seoul, Korea), glutathione (GSH, Arbor Assays, Ann Arbor, MI, USA) and malondialdehyde (MDA, ab118970, Abcam, Cambridge, UK). Alanine aminotransferase (ALT) and aspartate aminotransferase (AST), and lactate dehydrogenase (LDH, Biovision, Milpitas, CA, USA) in the culture medium were analyzed using kits used for their analysis. analyzed. Serum levels of IL-1βIL-6, TNF-α, and CCL-2 were determined using ELISA kits (all from Invitrogen).

<2-8> RNA isolation and qPCR

Total RNA was extracted from frozen liver tissue or primary hepatocytes treated with TRIzol reagent (Invitrogen). RNA was precipitated with isopropanol, dried with 70% ethanol, and then dissolved in distilled water treated with diethyl pyrocarbonate. First-strand cDNA was generated using random hexamer primers provided in a first-strand cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA). Primers were designed using PrimerBank (https://pga.mgh.harvard.edu/primerbank, Table 5). qPCR reactions were performed with a final volume of 10 ml reagent containing 10 ng of reverse transcribed total RNA, 200 nM forward and reverse primers, and PCR master mixture.

gene Nucleic acid sequence (5'→3') Accession No. sequence number tnfa forward AGGGTCTGGGCCATAGAACT NM_013693 SEQ ID NO: 1 reverse CCACCACGCTCTTCTGTCTAC SEQ ID NO: 2 Il1b forward GGTCAAAGGTTTGGAAGCAG NM_008361 SEQ ID NO: 3 reverse TGTGAAATGCCACCTTTTGA SEQ ID NO: 4 IL6 forward AGGGTCTGGGCCATAGAACT NM_013693 SEQ ID NO: 5 reverse CCACCACGCTCTTCTGTCTAC SEQ ID NO: 6 Icam1 forward AACAGTTCACCTGCACGGAC NM_010493 SEQ ID NO: 7 reverse GTCACCGTTTGTGATCCCTG SEQ ID NO: 8 Cxcl1 forward AATGAGCTGCGCTGTCAGTG NM_008176 SEQ ID NO: 9 reverse TGAGGGCAACACCTTCAAGC SEQ ID NO: 10 Ccl2 forward ACCGACAACAGGAAGTGGAG NM_009140 SEQ ID NO: 11 reverse TGGACGTTTCACACAGTGGT SEQ ID NO: 12 Ho1 forward AGGTACACATCCAAGCCGAGA NM_010442 SEQ ID NO: 13 reverse CATCACCAGCTTAAAGCCTTCT SEQ ID NO: 14 Nqo1 forward AGGATGGGAGGTACTCGAATC NM_008706 SEQ ID NO: 15 reverse TGCTAGAGATGACTCGGAAGG SEQ ID NO: 16 Nrf2 forward CTTTAGTCAGCGACAGAAGGAC NM_010902 SEQ ID NO: 17 reverse AGGCATCTTGTTTGGGAATGTG SEQ ID NO: 18 Gapdh forward CGTCCCGTAGACAAAATGGT NM_008084 SEQ ID NO: 19 reverse TTGATGGCAACAATCTCCAC SEQ ID NO: 20

<2-9> Subcellular fractionation, Western blotting and co-immunoprecipitation (Co-IP)

Nuclear and cytoplasmic fractions were prepared using the NE-PER nuclear and cytoplasmic extraction kit (Thermo Fisher Scientific, Waltham, MA, USA). Tissue homogenate suspensions or cell lysates (15 μg) were separated by 6 to 14% SDS-PAGE and transferred to PVDF membranes. After blocking with 5% skim milk, PAK4 (G222), p-PAK4 (S474), p-IKKβ (S176/180), p-IKBα (S32), p-p65 (S536), cleaved caspase -3 (Asp175), Bax (Cell Signaling Technology, Beverly, MA, USA), GAPDH (A531), lamin B1 (L75), Bcl2 (P65), NQO1 (F252) (Bioworld Technology, St Louis Park, MN, USA ), NF-κp65 (C-20), IKBα (H-4), IKKβ(10A9B6) (Santa Cruz Biotechnology, Dallas, TX, USA), Nrf2 (Proteintech, Rosemont, IL, USA), HO-1 (Enzo Blots were probed using primary antibodies against p-Thr (Merck KGaA, Darmstadt, Germany) (Life Sciences, Farmingdale, New York, USA). For co-immunoprecipitation reactions, 600 μg protein was incubated with anti-Nrf2 antibody (Proteintech, Sankt Leon-Rot, Germany) overnight at 4°C, then incubated with protein G agarose for 2 h at 4°C, and PAK4 , blots were probed with antibodies against Nrf2 or p-Thr. Immunoreactive bands were detected with a Las-4000 imager (GE Healthcare Life Science, Pittsburgh, PA, USA).

<2-10> Histology

Paraffin sections of liver tissue (5 μm) were stained with hematoxylin and eosin (H&E) and detected by light microscopy. Five random sections per slide were examined to measure necrotic areas and determine the percentage of apoptotic cells. To measure the necrotic area, sections were observed with an Axiovert 40 CFL microscope (Carl Zeiss, Oberkochen, Germany) and measured using iSolution DT 36 software (Carl Zeiss). For immunofluorescence staining, after deparaffinization, sections were immunostained with antibodies against F4/80 (ab6640), Ly6G (ab25377), and 4-hydroxynonenal (4-HNE, ab46545) (all provided by Abcam). . TUNEL staining was performed with a commercial kit (Promega). After washing with PBS, the sections were incubated with secondary antibodies (Alexa Fluor 488-conjugated goat anti-mouse IgG1 and Alexa Fluor 594-conjugated goat anti-rabbit IgM, Thermo Fisher Scientific) at 37°C for 1 hour, and the sections were incubated with DAPI. were counterstained.

<2-11> Statistical analysis

Data were expressed as mean ± standard deviation of the mean (SD). Statistical comparisons were made using one-way analysis of variance followed by Tukey's post hoc test, the significance of differences between two groups was determined using Student's unpaired t-test, and a p-value of less than 0.05 was considered significant.

Example 3. Confirmation of the protective effect of SPA7012 on liver ischemia-reperfusion damage by targeting PAK4

<3-1> Confirmation of liver I/R damage protection effect in mice following intraperitoneal administration of SPA7012

We investigated whether SPA7012 affected liver damage in mice subjected to 1 hour of ischemia and 6 or 24 hours of reperfusion (Figure 6).

As a result, liver damage assessed by serum levels of AST and ALT was confirmed to be evident in mice receiving I/R compared to control mice (FIG. 7). However, when SPA7012 was administered at a dose of 50 mg/kg before and during I/R injury, both AST and ALT levels were found to be significantly reduced in I/R injured mice, and the liver composite findings were significantly different from those of AST and ALT levels. It was confirmed that they matched (Figure 8). In addition, extensive hepatocyte necrosis was confirmed in the I/R damaged liver tissue compared to the control group through H&E staining (Figures 8 and 9), but the necrotic area in SPA7012-treated mice was significantly smaller than that in the I/R group, and there was significant hepatocyte necrosis in the I/R damaged liver tissue. The area was confirmed to have normal liver structure.

In addition, the main cause of cell death during liver I/R injury is necrosis, but cell death due to apoptosis is observed during the injury process. The number of TUNEL-positive apoptotic cells was significantly increased in I/R damaged liver tissue, whereas TUNEL-positive cells were rarely observed in the control group (Figure 10). According to Western blotting analysis, it was confirmed that the I/R damaged liver showed an increase in pro-apoptotic Bax and cleaved caspase-3 and a decrease in anti-apoptotic Bcl-2 (Figure 11). However, when mice were treated with SPA7012, a significant decrease in TUNEL-positive cells and changes in the expression of apoptotic proteins were confirmed.

Through these results, it was confirmed that SPA7012 can exert a protective effect against hepatocyte damage during I/R injury.

<3-2> Confirmation of oxidative stress reduction effect of SPA7012 in mice with I/R injury

To determine whether SPA7012 exerts a protective effect against I/R damage through reducing oxidative stress, oxidative stress markers were measured in liver tissue.

As a result, the level of MDA (an indicator of lipid peroxidation) was found to be significantly increased in I/R damaged liver tissue compared to the control group (FIG. 12). On the other hand, I/R caused significant inhibition of antioxidant GSH levels in liver tissue (Figure 13). An increase in lipid peroxidation due to I/R injury was confirmed through immunostaining of liver tissue using 4-HNE (Figure 14). However, treatment of mice with SPA7012 appeared to reverse these I/R-induced changes, with serum levels of MDA being significantly lower, liver GSH levels being significantly higher, and 4-HNE-positive cells increasing significantly after I/R. It was confirmed to be significantly lower in the SPA7012 group than in the group.

Meanwhile, it was recently reported that PAK4 phosphorylates Nrf2 at Thr369, causing nuclear export from the cytoplasm and subsequent proteasome degradation. Therefore, we investigated whether SPA7012 could affect the subcellular localization, protein stability, and transcriptional activity of Nrf2.

As a result, Co-IP analysis after overexpression of Nrf2 and PAK4 in HEK293T cells showed that SPA7012 effectively inhibited PAK4-mediated phosphorylation of Nrf2 at the threonine residue (FIG. 15). Consistently, the nuclear level of Nrf2 was increased in I/R injured liver tissue by SPA7012 treatment (Figure 16), and Nrf2 transcriptional activity was increased in HEK293T cells (Figure 17). According to qPCR and Western blotting analysis, enhanced transcriptional activity of Nrf2 was further confirmed by SPA7012 treatment in I/R damaged liver tissue (Figures 18 and 19).

Through these results, it was confirmed that SPA7012 exhibits a hepatoprotective effect against I/R damage by stabilizing Nrf2 protein and improving antioxidant protein expression.

<3-3> Confirmation of the inflammation-inhibiting effect of SPA7012 in mice with I/R injury

Hepatic I/R is also characterized by sterile inflammation with activation of intrahepatic Kupffer cells or recruitment of immune cells (monocytes and neutrophils) into liver tissue in response to hepatocyte death. Therefore, liver tissue was immunostained to evaluate the degree of inflammation 24 hours after reperfusion.

As a result, the numbers of both F4/80-positive macrophages and Ly6G-positive neutrophils increased significantly during liver I/R (FIG. 20), confirming obvious inflammation in the liver. The levels of pro-inflammatory cytokines/chemokines (TNF-α, IL-1βIL-6, and CCL-2) of the corresponding mRNAs in serum and liver were also significantly increased by I/R injury (Figures 21 and 22). However, treatment of mice with SPA7012 showed a significant reduction in inflammatory cell infiltration and cytokine production in mice.

In addition, because NF-κ is closely related to the production of inflammatory cytokines, we analyzed the NF-κ signaling pathway through Western blotting and found that SPA7012 treatment significantly reduced the phosphorylation levels of IKKβ and p65 compared to the control group and increased the level of Iκα. It was found that the protein level was increased (Figure 23).

Through these results, it was confirmed that inhibition of inflammation by SPA7012 additionally contributes to protection against I/R damage.

<3-4> Confirmation of H/R-induced cell death and inflammation inhibition effects of SPA7012 in hepatocytes

To simulate liver I/R injury, an in vitro H/R-induced hepatocyte injury model was further established (Figure 24), and the cell death and inflammation inhibition effects were analyzed.

As a result, SPA7012 at a concentration of less than 1 μM had little effect on cell viability (Figure 25). Meanwhile, exposure to H/R significantly increased LDH release from primary hepatocytes compared to the normoxic group. However, when cells were incubated with SPA7012 at 1 μM rather than 0.5 μM before exposure to reoxygenation damage, cell damage appeared to be significantly reduced compared to H/R alone (Figure 26).

Based on these results, 1 μM of SPA7012 was selected and an experiment was performed. As a result, similar to I/R injury, H/R injury also resulted in apoptotic cell death (Figures 27 and 28) and cytokine release in primary hepatocytes. However, it was confirmed that this response was decreased upon treatment with SPA7012 (Figures 29 and 30).

Example 4. Confirmation of cancer cell line inhibition effect according to anti-proliferation experiment

It was confirmed whether compounds 1 to 9, which exhibit PAk4 inhibitory activity, exhibit an inhibitory effect on cancer cell lines.

Specifically, through antiproliferative activity experiments, the GI ₅₀ value of each compound was evaluated against MDA-MB-231, U-87MG, PC-3, BxPC-3, NCI-H23, and HCT-15 cancer cell lines.

compound MDA-MB-231 U-87MG PC-3 BxPC-3 NCI-H23 HCT-15 Compound 1 18.6 16.8 16.3 14.7 19.1 17.0 compound 2 13.5 10.6 13.4 13.0 11.7 15.2 Compound 3 >50 >50 >50 >50 >50 >50 Compound 4 >50 >50 >50 >50 >50 >50 Compound 5 >50 >50 >50 >50 >50 >50 Compound 6 >50 >50 >50 >50 >50 >50 Compound 7 19.6 18.4 20.7 17.3 15.5 17.1 Compound 8 41.6 38.1 38.8 40.4 37.2 42.4 Compound 9 20.3 14.9 19.2 19.0 13.6 17.5 GNE-2861 18.0 17.6 19.4 15.5 16.9 18.7

As a result, the cancer cell growth inhibitory activity of compounds 1 to 9 was confirmed in all cancer cell lines (Table 6), and the inhibitory activity appeared to be closely related to the logP value of the compounds. In particular, Compound 2 and Compound 7 were confirmed to have similar or improved GI ₅₀ values compared to GNE-2861.

So far, the present invention has been examined focusing on its embodiments. A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.

<110> INDUSTRIAL COOPERATION FOUNDATION JEONBUK NATIONAL UNIVERSITY <120> Pyrazolo[3,4-d]pyrimidine Derivative, and Composition for Preventing or Treating Liver Injury and Composition for Protecting Liver comprising the same <130>DHP22-132 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tnfa_forward <400> 1 agggtctggg ccatagaact 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Tnfa_reverse <400> 2 ccaccacgct cttctgtcta c 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Il1b_forward <400> 3 ggtcaaaggt ttggaagcag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Il1b_reverse <400> 4 tgtgaaatgc caccttttga 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Il6_forward <400> 5 agggtctggg ccatagaact 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Il6_reverse <400> 6 ccaccacgct cttctgtcta c 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Icam1_forward <400> 7 aacagttcac ctgcacggac 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Icam1_reverse <400> 8 gtcaccgttg tgatccctg 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cxcl1_forward <400> 9 aatgagctgc gctgtcagtg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cxcl1_reverse <400> 10 tgagggcaac accttcaagc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ccl2_forward <400> 11 accgacaaca ggaagtggag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ccl2_reverse <400> 12 tggacgtttc acacagtggt 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Ho1_forward <400> 13 aggtacacat ccaagccgag a 21 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Ho1_reverse <400> 14 catcaccagc ttaaagcctt ct 22 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223>Nqo1_forward <400> 15 aggatggggag gtactcgaat c 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Nqo1_reverse <400> 16 tgctagagat gactcggaag g 21 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Nrf2_forward <400> 17 ctttagtcag cgacagaagg ac 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Nrf2_reverse <400> 18 aggcatcttg tttgggaatg tg 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gapdh_forward <400> 19 cgtcccgtag acaaaatggt 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gapdh_reverse <400> 20 ttgatggcaa caatctccac 20

Claims (11)

A compound selected from the group consisting of a compound represented by the following formula (1), a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and an isomer thereof:
[Formula 1]

In Formula 1,
R ₁ and R ₂ are the same, different from each other, or are located on the same ring (A), and are C _1-6 alkyl, C _1-6 haloalkyl, -(CH ₂ ) _m -C _{1- 6} is a substituent selected from the group consisting of alkoxy (where m is an integer of 1 to 6), C _3-8 cycloalkyl, and C _6-12 aryl,
The ring (A) is a substituent selected from the group consisting of C _3-8 cycloalkyl and C _6-12 aryl,
R ₃ may be -CH ₂ -R ₇ R ₈ , or R ₃ may be located in the same aromatic ring (B) as R ₄ and R ₅ ,
The aromatic ring (B) is a substituent selected from the group consisting of C _6-12 aryl,
R ₅ and R ₆ are the same or different from each other and are C or N,
R ₇ is a substituent selected from the group consisting of H, C _1-6 alkyl, C _2-6 alkenyl, or C _2-6 alkynyl,
The R ₈ is a substituent selected from the group consisting of C _3-8 heterocyclic substituted C _1-6 alkyl containing 1 to 2 heteroatoms selected from H, O or N.
According to claim 1,
4-(3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutyn-2-ol;
3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenylethynylcyclohexan-1-ol;
4-(3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-methylbutynyl-1,2-diol;
4-(3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenyl)-2-phenylbutyn-2-ol;
3-[4-amino-3-(3-morpholin-1-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl]phenylethynyl)cyclohexanol;
3-[4-amino-3-(3-piperidin-1-ylpropyl)pyrazolo[3,4- d ]pyrimidin-1-yl]phenylethynyl)cyclohexanol;
4-(3-(1-aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyn-2-ol;
3-(1-aminopyrido[4,3- b ]indol-5-yl)phenylethynylcycloexan-1-ol; and
4-(3-(1-aminopyrido[4,3- b ]indol-5-yl)phenyl)-2-methylbutyne-1,2-diol
A compound selected from the group consisting of.
According to claim 1,
A compound that is 3-(4-amino-3-methylpyrazolo[3,4- d ]pyrimidin-1-yl)phenylethynylcyclohexan-1-ol.
A pharmaceutical composition for preventing or treating diseases with increased PAK4 expression, comprising the compound of claim 1.
The pharmaceutical composition according to claim 4, wherein the disease with increased PAK4 expression is one or more diseases selected from the group consisting of cancer, neurological disease, liver damage, liver inflammation, and melanin pigmentation.
The method of claim 5, wherein the cancer is stomach cancer, lung cancer, liver cancer, colon cancer, small intestine cancer, pancreatic cancer, brain cancer, bone cancer, melanoma, breast cancer, sclerosing gonadosis, uterine cancer, cervical cancer, head and neck cancer, esophageal cancer, thyroid cancer, parathyroid cancer, A pharmaceutical composition, wherein the pharmaceutical composition is one or more cancers selected from the group consisting of kidney cancer, sarcoma, prostate cancer, urethral cancer, bladder cancer, hematological cancer, lymphoma, psoriasis, or fibroadenoma.
The pharmaceutical composition according to claim 5, wherein the neurological disease is a degenerative brain disease.
The method of claim 7, wherein the degenerative brain disease is Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, multiple system atrophy, olive nucleus-pontine-cerebellar atrophy (OPCA), Shay-Drager syndrome, striatal-substantia nigra degeneration, and Huntington's disease. , amyotrophic lateral sclerosis (ALS), essential tremor, cortico-basal gangrene, diffuse Lewy body disease), Parkinson-ALS-dementia complex, Pick's disease, cerebral ischemia, and cerebral infarction. Phosphorus pharmaceutical composition.
The pharmaceutical composition according to claim 5, wherein the liver damage is at least one damage selected from the group consisting of inflammatory damage, oxidative damage, alcoholic damage, and ischemia-reperfusion damage.
A composition for protecting liver function comprising the compound of claim 1.
A health functional food for protecting liver function containing the compound of claim 1.