KR20230111626A - Anti-inflammatory composition comprising Ammodytes personatus lipid extract as an active ingredient - Google Patents

Abstract

The present invention relates to an anti-inflammatory composition comprising a canary egg lipid extract as an active ingredient, and it was confirmed that the canary egg lipid extract of the present invention inhibits the production of inflammation-related NO and significantly inhibits the expression of inflammation-related factors IL-1β, IL-6, COX-2, iNOS, and TNF-α in the LPS-stimulated RAW264.7 cell line. In addition, it was confirmed that the expression of CD86 and CD14, which are inflammation-related surface factors, was inhibited in the cell line stimulated with LPS, and phosphorylation of NF-κB and MAPK pathways related to inflammation were inhibited.

Description

Anti-inflammatory composition comprising Ammodytes personatus lipid extract as an active ingredient}

The present invention relates to an anti-inflammatory composition comprising canary lipid extract as an active ingredient.

Inflammation refers to a tissue response to damage when external antigens such as bacteria or viruses invade the body from the outside or when cells or tissues are damaged by any cause. Inflammatory cells release various pro-inflammatory mediators such as reactive nitrogen and oxygen species that cause DNA damage in tumor initiation and promotion. Inflammation is largely divided into acute inflammatory and chronic inflammatory, and when chronic inflammatory reactions occur, pro-inflammatory cytokines and chemokines are excessively released, which helps tumor growth by promoting tumor cell invasion, metastasis, migration, and angiogenesis along with damage to surrounding tissues.

As such, with the recent development of molecular biology, attempts have been made to understand inflammatory diseases at the molecular level, such as cytokines, and factors affecting these diseases are being identified one by one. Among these factors, nitric oxide (NO), as an inflammatory mediator, plays a role in maintaining homeostasis by acting as a defense against damaging pathogenic DNA (Kou and Schroder, Ann Sur 221, 220-235, 1995). NO is produced from L-arginine by three major NOSs: neuronal NOS (nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS), which are isomers of nitrogen oxide synthase (NOS). Among them, NO excessively produced by iNOS reacts with superoxide to form peroxynitrite, which acts as a strong oxidant and damages cells, thereby activating macrophages by inflammatory stimuli. Macrophages activated by various stimuli and inflammatory mediators produce other inflammation-related factors such as tumor necrosis factor-alpha (TNF-α), interleukin-1β (IL-1β), and prostaglandin E2 (PGE2), induce other immune cells to the site of inflammation, and activate NF-κB to be involved in inflammatory reactions, cancer, and chronic diseases such as arteriosclerosis (Lawrence et al., Nat Med., 7, 129 1-1297, 2001).

Studies to treat inflammatory diseases by controlling the intracellular levels of factors involved in the inflammatory response are being actively conducted. At first, attempts were made to control the intracellular levels of the factors using chemical substances, but there is a disadvantage that side effects are severe. Recently, studies to control the intracellular levels of the factors using substances derived from natural products that have no side effects or appear at very low levels have been actively conducted.

On the other hand, canary is distributed all over the coast of Korea, Japan, and Alaska, and lives in groups on the sandy bottom of the coast. It is active during the day and spends in the sand at night. Small red meat fish, including canary, are representative fish that have been used since ancient times among aquatic foods in Korea. They are rich in calcium, essential amino acids, and n-3 series polyunsaturated fatty acids (EPA, DHA, etc.), and contain various useful vitamins and flavoring ingredients. However, it causes deterioration of flavor, discoloration, loss of nutritional value, etc. as well as appearance damage of quality change that occurs during processing and storage of small red meat fish, and lower carbonyl compounds produced by lipid oxidation cause off-flavor, and cause browning by generating browning reactants by reacting with volatile base nitrogen of fish meat or nitrogen compounds of amino acids. Therefore, small red meat fish are easily degraded when fresh fish are used for food, and not only have a strong fishy smell, but also have very low palatability due to the large number of small bones in the meat.

Accordingly, the present inventors confirmed that the lipid component of canary has an anti-inflammatory effect, and completed the present invention.

An object of the present invention is to provide a food composition for anti-inflammatory, containing a canary (Ammodytes personatus) lipid extract as an active ingredient.

Another object of the present invention is to provide an anti-inflammatory cosmetic composition comprising an extract of canary (Ammodytes personatus) lipid as an active ingredient.

Another object of the present invention is to provide an anti-inflammatory pharmaceutical composition comprising an extract of canary (Ammodytes personatus) lipid (Lipid) as an active ingredient.

Another object of the present invention is to provide a quasi-drug composition for anti-inflammatory, containing a canary (Ammodytes personatus) lipid extract as an active ingredient.

Another object of the present invention is to provide a method for inhibiting NO production stimulated by external substances and expression of inflammation-related factors IL-1β, IL-6, COX-2, iNOS and TNF-α, inhibiting inflammation-related surface factors CD86 and CD14, and inhibiting phosphorylation of inflammatory pathways p38, JNK, ERK1/2 and NF-κB by treating cells with a canary lipid extract in vitro.

In order to achieve the above object, the present invention provides an anti-inflammatory food composition comprising an extract of canary (Ammodytes personatus) lipid (Lipid) as an active ingredient.

In addition, the present invention provides a cosmetic composition for anti-inflammatory, comprising the canary (Ammodytes personatus) lipid extract as an active ingredient.

In addition, the present invention provides an anti-inflammatory pharmaceutical composition comprising an extract of canary (Ammodytes personatus) lipid as an active ingredient.

In addition, the present invention provides a quasi-drug composition for anti-inflammatory, comprising a canary (Ammodytes personatus) lipid extract as an active ingredient.

In addition, the present invention provides a method for inhibiting NO production stimulated by external substances and the expression of inflammation-related factors IL-1β, IL-6, COX-2, iNOS and TNF-α, inhibiting inflammation-related surface factors CD86 and CD14, and inhibiting phosphorylation of inflammatory pathways p38, JNK, ERK1/2 and NF-κB by treating cells with a canary lipid extract in vitro.

It was confirmed that the canary egg lipid extract of the present invention inhibits the production of inflammation-related NO and significantly inhibits the expression of inflammation-related factors IL-1β, IL-6, COX-2, iNOS and TNF-α in the LPS-stimulated RAW264.7 cell line. In addition, it was confirmed that the expression of CD86 and CD14, inflammation-related surface factors, and phosphorylation of NF-κB and MAPK pathways related to inflammation were inhibited in the cell line stimulated with LPS, and thus it can be usefully used in related industries.

1 shows the analysis of the composition of the canary egg lipid extract of the present invention by GC-FID (Gas chromatography-flame ionization detection).
Figure 2 is a diagram confirming the cell viability and NO production inhibition according to the treatment of canary egg lipid extract in the LPS-treated RAW264.7 cell line (A: cell viability confirmation, B: NO production inhibition confirmation).
Figure 3 is a diagram confirming the inhibition of inflammation-related factor expression according to the treatment of canary egg lipid extract in the LPS-treated RAW264.7 cell line by RT-PCR (real-time PCR).
Figure 4 is a diagram confirming the expression of CD86 and CD14, which are inflammation-related surface factors, according to the treatment of canary egg lipid extract in the LPS-treated RAW264.7 cell line (A: CD86 expression confirmation, B: CD86 expression quantification, C: CD14 expression confirmation, D: CD14 expression quantification).
Figure 5 is a diagram showing the phosphorylation inhibition of the inflammatory pathway according to the treatment of the canary egg lipid extract in the LPS-treated RAW264.7 cell line by western blot analysis (A: western blot result, B: quantification of the analysis result).

The present invention provides an anti-inflammatory food composition comprising an extract of canary (Ammodytes personatus) lipid as an active ingredient.

As used herein, the term "prevention" refers to any action that suppresses symptoms or delays the progression of a specific disease by administering the composition of the present invention.

The term "treatment" used in the present invention refers to all activities that improve or beneficially change the symptoms of a specific disease by administering the composition of the present invention.

As used herein, the term "improvement" refers to any action that at least reduces the severity of a parameter related to the condition being treated, for example, a symptom.

In addition to containing the active ingredient of the present invention, the food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional food compositions.

Examples of the aforementioned natural carbohydrates include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agents described above, natural flavoring agents (thaumatin), stevia extracts (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can advantageously be used. The food composition of the present invention can be formulated in the same way as the pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements.

In addition to the active ingredient extract, the food composition may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like. In addition, the food composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages.

The functional food composition of the present invention may be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. for the purpose of preventing or treating inflammation. In the present invention, 'health functional food composition' refers to a food manufactured and processed using raw materials or ingredients having useful functionalities for the human body in accordance with Act No. 6727 on Health Functional Foods, and nutrients for the structure and function of the human body. The health functional food of the present invention may contain ordinary food additives, and its suitability as a food additive is determined by the standards and standards for the item in accordance with the General Rules and General Test Methods of Food Additives approved by the Korea Food and Drug Administration, unless otherwise specified. Examples of the items listed in the 'Food Additive Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, kaoliang pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations. For example, a health functional food in the form of a tablet is a mixture obtained by mixing the active ingredient of the present invention with excipients, binders, disintegrants, and other additives, granulated in a conventional manner, and then compression-molded by adding a lubricant or the like, or the mixture can be directly compressed. In addition, the health functional food in the form of a tablet may contain a flavoring agent and the like as needed. Among health functional foods in the form of capsules, hard capsules can be prepared by filling ordinary hard capsules with a mixture of the active ingredient of the present invention mixed with additives such as excipients, and soft capsules can be prepared by filling a mixture of the active ingredient of the present invention mixed with additives such as excipients into a capsule base such as gelatin. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary. The health functional food in the form of a pill can be prepared by molding a mixture of the active ingredient of the present invention mixed with an excipient, a binder, a disintegrant, etc. by a conventionally known method, and, if necessary, can be coated with sucrose or other coating agent, or the surface can be coated with a material such as starch or talc. A health functional food in the form of granules may be prepared in a granular form by a conventionally known method of mixing an excipient, a binder, a disintegrant, etc. of the active ingredient of the present invention, and may contain a flavoring agent, a flavoring agent, etc., if necessary.

According to one embodiment of the present invention, the canary lipid extract may contain polyunsaturated fatty acids, monounsaturated fatty acids and saturated fatty acids, and the polyunsaturated fatty acids are linoleic acid (C18: 2n6), alpha linolenic acid, alpha linolenic acid (C18: 3n3), eicosapentaenoic acid (C20: 5n3) and It may be one selected from the group consisting of docosahexaenoic acid (C22:6n3).

In addition, the monounsaturated fatty acid may be palmitoleic acid (C16: 1n7), oleic acid (C18: 1n9) or vaccenic acid (C18: 1n7), and the monounsaturated fatty acid may be palmitoleic acid (C16: 1n7), oleic acid (C18: 1n9) or vaccenic acid. It may be vaccenic acid (C18: 1n7), and the saturated fatty acid may be palmitic acid (C16: 0) or stearic acid (C18: 0).

According to one embodiment of the present invention, the canary lipid extract may inhibit NO production stimulated by external substances.

According to one embodiment of the present invention, the canary lipid extract may inhibit the expression of inflammation-related factors stimulated by external substances, and the inflammation-related factors may be selected from the group consisting of IL-1β, IL-6, COX-2, iNOS and TNF-α.

According to one embodiment of the present invention, the canary lipid extract may inhibit the expression of CD86 or CD14, which are inflammation-related surface factors stimulated by external substances.

According to one embodiment of the present invention, the canary lipid extract may inhibit phosphorylation of factors consisting of p38, JNK, ERK1/2 and NF-κB in the inflammatory pathway stimulated by external substances.

In addition, the present invention provides a cosmetic composition for anti-inflammatory, comprising the canary (Ammodytes personatus) lipid extract as an active ingredient.

Compositions containing the active ingredient of the present invention can be used in various ways for anti-inflammatory purposes. Products to which this composition can be added include, for example, cosmetics such as various creams, lotions, toners, and essences, shampoos, rinses, cleansing products, face wash products, soaps, treatments, packs, beauty essences, and the like.

The cosmetic composition of the present invention includes a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, sphingolipids, and seaweed extracts.

Any water-soluble vitamin can be used as long as it can be incorporated into cosmetics, but preferably vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, vitamin H, etc., their salts (thiamine hydrochloride, ascorbic acid sodium salt, etc.) or derivatives (ascorbic acid-2-phosphate sodium salt, ascorbic acid-2-phosphate magnesium salt, etc.) are also included in the water-soluble vitamins that can be used in the present invention. Water-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microbial culture, an enzymatic method, or a chemical synthesis method.

Any useful vitamin may be used as long as it can be formulated into cosmetics, but preferably vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol) and the like, and their derivatives (ascorbine palmitate, ascorbine stearate, ascorbine dipalmitate, dl-alpha tocopherol acetate, dl-nicotinate Far tocopherol vitamin E, DL-pantothenyl alcohol, D-pantothenyl alcohol, pantothenyl ethyl ether, etc.) are also included in the useful vitamins used in the present invention. The useful vitamins can be obtained by conventional methods such as microbial transformation, purification from microbial culture, enzymatic or chemical synthesis.

Any polymeric peptide may be used as long as it can be formulated into cosmetics, but preferably collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, keratin and the like are mentioned. Polymer peptides can be purified and obtained by conventional methods such as a purification method from a culture medium of microorganisms, an enzyme method, or a chemical synthesis method, or can be used after being purified from natural products such as pig or cow dermis or silkworm silk fibers.

Any polymeric polysaccharide may be used as long as it can be incorporated into cosmetics, but hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate or a salt thereof (sodium salt or the like) is preferable. For example, chondroitin sulfate or a salt thereof can be used after being purified from mammals or fish.

Any sphingolipid can be used as long as it can be incorporated into cosmetics, but ceramide, phytosphingosine, sphingoglycolipid and the like are preferred. Sphingolipids can be purified by conventional methods or obtained by chemical synthesis from mammals, fish, shellfish, yeast, or plants.

Any seaweed extract can be used as long as it can be formulated into cosmetics, but brown algae extract, red algae extract, green algae extract and the like are preferable, and calrageenan, arginic acid, sodium alginate, potassium alginate and the like purified from these seaweed extracts are also included in the seaweed extract used in the present invention. Seaweed extract can be obtained by purifying from seaweed by a conventional method.

In addition to the above essential components, the cosmetic composition of the present invention may also contain other ingredients commonly used in cosmetics, if necessary. Other ingredients that may be added include fats and oils, humectants, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, bactericides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, blood circulation promoters, cooling agents, antiperspirants, and purified water. Examples of the oil and fat component include ester oils, hydrocarbon oils, silicone oils, fluorine oils, animal fats and vegetable oils.

As ester-based fats and oils, tri-2-ethylhexanoate glyceryl, 2-ethylhexanoate, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isosteyl isostearate, butyl stearate, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl myristate, isostearyl myristate, isostearyl palmitate, octyl myristate Dodecyl, isostearate isocetyl, diethyl sebacate, diisopropyl adipate, isoalkyl neopentanoate, tri(capryl, capric acid) glyceryl, trimethylolpropane tri2-ethylhexanoate, trimethylolpropane triisostearate, pentaelislitol tetra2-ethylhexanoate, cetyl caprylate, decyl laurate, hexyl laurate, decyl myristate, myristate Listyl, cetyl myristate, stearyl stearate, decyl oleate, cetyl ricinooleate, isostearyl laurate, isotridecyl myristate, isocetyl palmitate, octyl stearate, isocetyl stearate, isodecyl oleate, octyldodecyl oleate, octyldodecyl linoleate, isopropyl isostearate, 2-ethylhexanoate, setostearyl, 2-ethyl Stearyl hexanoate, hexyl isostearate, ethylene glycol dioctanoate, ethylene glycol dioleate, propylene glycol dicaprate, propylene glycol di(capryl, capric acid), propylene glycol dicaprylate, neopentyl glycol dicaprate, neopentyl glycol dioctanoate, glyceryl tricaprylate, glyceryl triundecylate, glyceryl triisopalmitate, glyceryl triisostearate, neopentane Octyldodecyl acid, isostearyl octanoate, octyl isononanoate, hexyldecyl neodecanoate, octyldodecyl neodecanoate, isocetyl isostearate, isostearyl isostearate, octyldecyl isostearate, polyglycerin oleate, polyglycerin isostearate, triisocetyl citrate, triisoalkyl citrate, triisooctyl citrate, lauryl lactate , myristyl lactate, cetyl lactate, octyldecyl lactate, triethyl citrate, acetyltriethyl citrate, tributyl citrate, trioctyl citrate, diisostearyl malate, 2-ethylhexyl hydroxystearate, di2-ethylhexyl succinate, diisobutyl adipate, diisopropyl sebacate, dioctyl sebacate, cholesteryl stearate, cholesteryl isostearate , cholesteryl hydroxystearate, cholesteryl oleate, dihydrocholesteryl oleate, phytosteryl isostearate, physteryl oleate, esters such as 12-stealoylhydroxystearate isocetyl, 12-stealoylhydroxysteaaryl, and 12-stealoylhydroxystearate isostearyl; and the like.

Examples of the hydrocarbon-based fats and oils include hydrocarbon-based fats and oils such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybuden, microcrystalline wax, and vaseline.

Examples of silicone-based fats and oils include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane and methylcetyloxysiloxane copolymers, dimethylsiloxane and methylstealoxysiloxane copolymers, alkyl-modified silicone oils, and amino-modified silicone oils.

Examples of fluorine-based fats and oils include perfluoropolyether and the like.

Examples of animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, birdflower oil, soybean oil, corn oil, rapeseed oil, algae oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil, cottonseed oil, coconut oil, kukui nut oil, wheat germ oil, rice germ oil, shea butter, sesame seed oil, marker damian nut oil, meadowsweet oil, orchid. and animal or vegetable oils such as sulfur oil, beef tallow, horse oil, mink oil, orange raffia oil, jojoba oil, candelilla wax, carnaba wax, liquid lanolin, and hydrogenated castor oil.

Examples of the moisturizer include water-soluble low-molecular moisturizers, fat-soluble molecular moisturizers, water-soluble polymers, and oil-soluble polymers.

Examples of water-soluble low-molecular moisturizers include serine, glutamine, sorbitol, mannitol, pyrrolidone-sodium carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B (degree of polymerization n = 2 or more), polypropylene glycol (degree of polymerization n = 2 or more), polyglycerol B (degree of polymerization n = 2 or more), lactic acid, lactate, and the like.

Cholesterol, cholesterol ester, etc. are mentioned as a fat-soluble low-molecular moisturizer.

Examples of water-soluble polymers include carboxyvinyl polymer, polyaspartate, tragacanth, xanthan gum, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, water-soluble chitin, chitosan, and dextrin.

Examples of the fat-soluble polymers include polyvinylpyrrolidone and eicosene copolymers, polyvinylpyrrolidone and hexadecene copolymers, nitrocellulose, dextrin fatty acid esters, and high-molecular silicones. Examples of the emollient agent include long-chain acyl glutamic acid cholesteryl ester, hydroxystearic acid cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid, and lanolin fatty acid cholesteryl ester.

Examples of the surfactant include nonionic surfactants, anionic surfactants, cationic surfactants, and amphoteric surfactants.

Nonionic surfactants include self-emulsifying glycerin monostearate, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerin fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbitan fatty acid ester, POE glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE and POP (polyoxyethylene and polyoxypropylene) copolymers, POE and POP alkyl ethers, polyether-modified silicones, lauric acid alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.

Anionic surfactants include fatty acid soaps, alpha-acyl sulfonates, alkyl sulfonates, alkyl allyl sulfonates, alkyl naphthalene sulfonates, alkyl sulfates, POE alkyl ether sulfates, alkyl amide sulfates, alkyl phosphates, POE alkyl phosphates, alkyl amide phosphates, alkyloylalkyl taurine salts, N-acyl amino acid salts, POE alkyl ether carboxylates, alkyl sulfosuccinates, sodium alkyl sulfoacetate, acylated hydrolyzed collagen peptide salts, perfluoro Roalkyl phosphoric acid ester etc. are mentioned.

Examples of the cationic surfactant include alkyltrimethylammonium chloride, stearyltrimethylammonium chloride, stearyltrimethylammonium bromide, cetostearyltrimethylammonium chloride, distearyldimethylammonium chloride, stearyldimethylbenzylammonium chloride, behenyltrimethylammonium bromide, benzalkonium chloride, diethylaminoethyl stearate, dimethylaminopropylamide stearate, and quaternary ammonium salts of lanolin derivatives. Examples of amphoteric surfactants include amphoteric surfactants such as carboxybetaine type, amidebetaine type, sulfobetaine type, hydroxysulfobetaine type, amide sulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, and amideamine type.

Organic and inorganic pigments include silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium-coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide, calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine blue, chromium oxide , inorganic pigments such as chromium hydroxide, calamine and complexes thereof; organic pigments such as polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenolic resin, fluorine resin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene and styrene copolymer, silk powder, cellulose, CI pigment yellow, and CI pigment orange; and composite pigments of these inorganic pigments and organic pigments.

Examples of the organic powder include metal soaps such as calcium stearate; Alkyl phosphate metal salts, such as zinc sodium cetylrate, zinc laurylate, and calcium laurylate; polyvalent metal salts of acyl amino acids such as N-lauroyl-beta-alanine calcium, N-lauroyl-beta-alanine zinc, and N-lauroyl glycine calcium; polyvalent metal salts of amide sulfonic acids such as N-lauroyl-taurine calcium and N-palmitoyl-taurine calcium; N-acyl basic amino acids such as N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoylizine, N-alpha-paritoylolnithine, N-alpha-lauroylarginine, and N-alpha-hardened tallow fatty acid acylarginine; N-acyl polypeptides such as N-lauroyl glycyl glycine; alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid; polyethylene, polypropylene, nylon, polymethyl methacrylate, polystyrene, divinylbenzene and styrene copolymers, tetrafluoroethylene, and the like.

As the ultraviolet absorber, para-aminobenzoic acid, ethyl para-aminobenzoate, amyl para-aminobenzoate, octyl para-aminobenzoate, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butylphenyl salicylate, homomenthyl salicylate, benzyl cinnamate, paramethoxycinnamic acid-2-ethoxyethyl, paramethoxycinnamic acid octyl, diparamethoxycinnamic acid mono-2-ethylhexane glyceryl paramethoxycinnamon Acid isopropyl, diisopropyl and diisopropylcinnamic acid ester mixture, urocanic acid, ethyl urocanate, hydroxymethoxybenzophenone, hydroxymethoxybenzophenonesulfonic acid and its salts, dihydroxymethoxybenzophenone, dihydroxymethoxybenzophenone disulfonate sodium, dihydroxybenzophenone, tetrahydroxybenzophenone, 4-tert-butyl-4'-methoxydibenzoylmethane, 2,4, 6-trianilino-p-(carbo-2'-ethylhexyl-1'-oxy)-1,3,5-triazine, 2-(2-hydroxy-5-methylphenyl)benzotriazole, and the like.

Examples of the fungicide include hinokitiol, triclosan, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, zincophylthione, benzalkonium chloride, photosensitive No. 301, mononitrowirecol sodium, and undecyrenic acid.

Examples of antioxidants include butylhydroxyanisole, propyl gallic acid, and elisorbic acid.

Examples of the pH adjuster include citric acid, sodium citrate, malic acid, sodium malate, fumaric acid, sodium fumalate, succinic acid, sodium succinate, sodium hydroxide, and sodium monohydrogenphosphate.

Examples of alcohol include higher alcohols such as cetyl alcohol.

In addition, the blending components that may be added other than these are not limited thereto, and any of the above components can be blended within a range not impairing the objects and effects of the present invention.

The cosmetic composition of the present invention may take the form of a solution, emulsion, viscous mixture or the like.

Ingredients included in the cosmetic composition of the present invention may include ingredients commonly used in cosmetic compositions as active ingredients, and include, for example, stabilizers, solubilizers, conventional adjuvants and carriers such as vitamins, pigments, and fragrances.

The anti-inflammatory cosmetic composition of the present invention can be prepared in any formulation commonly prepared in the art, and examples thereof include emulsion, cream, lotion, pack, foundation, lotion, beauty essence, hair cosmetics, and the like.

Specifically, the cosmetic composition of the present invention is skin lotion, skin softener, skin toner, milk lotion, astringent, lotion, moisture lotion, nutrient lotion, massage cream, nutrient cream, moisture cream, hand cream, foundation, essence, nutrient essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, hair lotion, hair tonic, hair essence, hair shampoo, hair rinse, hair treatment, body lotion and body cleanser contains the formulation.

When the formulation of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component.

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, it may additionally contain a propellant such as chlorofluorohydrocarbon, propane/butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan.

When the formulation of the present invention is a suspension, water, a liquid diluent such as ethanol or propylene glycol, a suspension agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used as carrier components.

When the formulation of the present invention is surfactant-containing cleansing, fatty alcohol sulfate, fatty alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolin derivative, or ethoxylated glycerol fatty acid ester may be used as carrier components. can

In addition, another object of the present invention is to provide a pharmaceutical composition for anti-inflammatory, comprising the canary (Ammodytes personatus) lipid extract as an active ingredient.

The pharmaceutical composition of the present invention may further include an adjuvant in addition to the active ingredient. As long as the adjuvant is known in the art, any one may be used without limitation, but, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase the effect.

The pharmaceutical composition according to the present invention may be prepared in the form of incorporating the active ingredient into a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers usable in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories or sterile injection solutions according to conventional methods.

When formulated, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations may be prepared by mixing active ingredients with at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweeteners, aromatics, preservatives, etc. may be included in addition to commonly used diluents such as water and liquid paraffin. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for suppositories, witepsol, tween 61, cacao paper, laurin paper, glycerogelatin, and the like may be used.

The pharmaceutical composition according to the present invention can be administered to a subject by various routes. All modes of administration are contemplated, eg oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.

The dosage of the pharmaceutical composition according to the present invention is selected in consideration of the age, weight, sex, and physical condition of the subject. It is obvious that the concentration of the active ingredient included in the pharmaceutical composition can be variously selected according to the subject, and is preferably included in the pharmaceutical composition at a concentration of 0.01 to 5,000 μg/ml. If the concentration is less than 0.01 μg/ml, pharmacological activity may not appear, and if the concentration exceeds 5,000 μg/ml, toxicity to the human body may be exhibited.

In addition, the present invention provides a quasi-drug composition for anti-inflammatory, comprising a canary (Ammodytes personatus) lipid extract as an active ingredient.

The quasi-drug composition of the present invention may further include a pharmaceutically acceptable carrier, excipient or diluent as needed in addition to the above components. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effects of the present invention, and may include, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, aromatics, preservatives, and the like.

The quasi-drug composition of the present invention may include, but is not limited to, a disinfectant cleanser, shower foam, ointment, wet tissue, coating agent, etc., and the formulation method, dosage, usage method, and components of the quasi-drug may be appropriately selected from conventional techniques known in the art.

In addition, the present invention provides a method for inhibiting NO production stimulated by external substances and the expression of inflammation-related factors IL-1β, IL-6, COX-2, iNOS and TNF-α, inhibiting inflammation-related surface factors CD86 and CD14, and inhibiting phosphorylation of inflammatory pathways p38, JNK, ERK1/2 and NF-κB by treating cells with a canary lipid extract in vitro.

Hereinafter, the present invention will be described in more detail by examples. These examples are merely for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

<Example 1> Canary egg lipid extract preparation and component analysis

<1-1> Preparation of canary egg lipid extract

To prepare the canary egg lipid extract of the present invention, canary ( Ammodytes personatus Jumunjin, Gangwon Province, South Korea) was purchased and eggs were collected. The collected canary eggs were frozen at -80 ° C for 1 day, and the frozen canary eggs were lyophilized. 4.5 g of freeze-dried canary eggs were homogenized for 2 minutes by adding 30 ml of extract (chloroform: methanol = 1:2 volume ratio). Thereafter, 10 ml of fresh extract was added and homogenized secondly. After homogenization by adding 10 ml of distilled water, the layers were separated by centrifugation at 3000 rpm for 10 minutes, and the lipid layer at the bottom of the separated layer was transferred to a new tube and filtered into a 250 ml flask using filter paper. The filtered liquid was further filtered through a 0.2 μm PTFE membrane filter, and the remaining solvent was removed using a rotary evaporator. Thereafter, 5 ml of hexane was added to the remaining pellet to dissolve it, and the lipid solution was evaporated. The yield of the extracted lipid was 1.08±0.04 g (23.93±0.90% of dry matter), and the dried lipid was dissolved in DMSO to obtain canary egg lipid extract (TL) at a concentration of 20 mg/ml.

<1-2> Canary roe lipid extract component analysis

In order to confirm the composition of the canary egg lipid extract of the present invention, the method of Garces and Mancha was modified to separate fatty acids from canary egg lipids, and fatty acid methyl esters (FAMEs) were prepared using the lipid extraction method. The composition of fatty acids was analyzed using gas chromatography (GC)-flame ionization detection (FID). Purified C17:0 (margaric acid) was used as an internal standard for FAME.

As a result, as shown in FIG. 1, it was confirmed that the canary egg lipid extract contained 52.22% of polyunsaturated fatty acids (PUFAs) and 29.04% of omega-3 (DHA) PUFAs among the PUFAs. In addition, it was confirmed that 25.27% of saturated fatty acids (SFAs) and 22.51% of monounsaturated fatty acids (MUFA) were included. The composition ratio of specific fatty acids is shown in Table 1 below.

<Example 2> Evaluation of cytotoxicity and NO production of canary egg lipid extract

<2-1> Cell culture

In order to confirm the anti-inflammatory effect of the canary egg lipid extract of the present invention, a mouse macrophage cell line, RAW264.7 cell line, was used. The RAW264.7 cell line was purchased from the Korean Cell Line Bank (South Korea), and the cells were cultured in RPMI-1640 medium (Gibco, USA) containing 10% fetal bovine serum (FBS; Welgene, South Korea) and 1% penicillin/streptomycin (Gibco, USA) under conditions of 5% CO ₂ and 37°C.

<2-2> Evaluation of cytotoxicity and NO production

In order to confirm the anti-inflammatory effect of the canary egg lipid extract of the present invention, NO production was evaluated. Specifically, the RAW264.7 cells of Example 2-1 were inoculated in a 96-well plate at a cell concentration of 1 × 10 ⁵ , and cultured for 24 hours at 37° C. and 5% CO ₂ conditions. The cultured cells were pretreated with canary egg lipid extract (0.5, 1.0, 1.5, 2.0 volume% concentration of the culture medium), stimulated with 1 μg/ml LPS after 1 hour, and cultured for 24 hours. In order to measure NO production after completion of the culture, the culture supernatant was obtained, and the absorbance of the supernatant was measured at a wavelength of 540 nm using Griess reagent (Promega, USA). In order to measure cell viability, cell proliferation was measured, and cultured cells were obtained, and absorbance was measured at a wavelength of 450 nm using an EZ-Cytox Cell Viability Assay kit (DaeilLabservice, South Korea). The absorbance for each wavelength was measured using a micro enzyme-linked immunosorbent assay (BioTek, USA), and NO production and cell proliferation rate (cell viability) were measured using the formula of Equation 1 below. As a control group, an untreated control group (RPMI group) and a positive control group (LPS group) treated with LPS alone were used.

As a result, it was confirmed that the canary egg lipid extract of the present invention increased cell viability in a concentration-dependent manner (FIG. 2A).

In addition, NO production was increased in the LPS-treated group compared to the untreated control group (RPMI group), but when the canary egg lipid extract of the present invention was treated, the increased NO production was decreased in a concentration-dependent manner (FIG. 2B).

<Example 3> Confirmation of suppression of inflammation-related gene expression by canary egg lipid extract

In order to confirm the anti-inflammatory effect of the canary egg lipid extract of the present invention, the expression of inflammation-related genes was examined. Specifically, total RNA was extracted from cells cultured in the same manner as in Example 2-2 using TRI reagent® (Molecular Research Center, Inc., USA). More specifically, the cultured cells were disrupted, and the lysate was dispensed into a 1.5 ml microtube, homogenized by adding 200 μL of chloroform, and then centrifuged at 13,000 rpm at 4° C. for 10 minutes. After centrifugation, the supernatant was transferred to a new microtube, and isopropanol was added and stored at 4° C. for 10 minutes. Thereafter, RNA pellets were obtained by centrifugation at 13,000 rpm at 4° C. for 10 minutes, and total RNA was washed three times with 70% ethanol. After washing, the cam of the microtube was opened and dried, and the total RNA was dissolved in nuclease-free distilled water and stored at -20°C. The concentration of total RNA was measured using a Nanophotometer (Implen, Germany), and 1000 ng of RNA was synthesized into cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems, USA). QuantStudio™ 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) was performed using 10 ng of the synthesized cDNA and SYBR Premix EX Taq II (Takara Bio Inc., Kusatsu, Shiga) to measure the expression of immune-related genes. Primer sets for measuring the expression of immune-related genes are shown in Table 2 below, and were analyzed with the QuantStudio™ 3 FlexReal-Time PCR system.

Gene Accession no. Sequence(5` to 3`) iNOS BC062378.1 F: TTCCAGAATCCCTGGACAAG R: TGGTCAAACTCTTGGGGTTC IL-1β NM_008361.4 F: GGGCCTCAAAGGAAAGAATC R: TACCAGTTGGGGAACTCTGC IL-6 NM_031168.2 F: AGTTGCCTTCTTGGGACTGA R: CAGAATTGCCATTGCACAAC COX-2 NM_011198.4 F: AGAAGGAAAATGGCTGCAGAA R: GCTCGGCTTCCAGTATTGAG TNF-α D84199.2 F: ATGAGCACAGAAAGCATGATC R: TACAGGCTTGTCACTCGAATT β-actin NM_007393.5 F: CCACAGCTGAGAGGGAAATC R: AAGGAAGGCTGGAAAAGAGC

As a result, as shown in FIG. 3, in the LPS-treated group, compared to the untreated control group (RPMI), the expression of inflammation-related factors IL-1β, IL-6, COX-2, iNOS and TNF-α was significantly increased, but it was confirmed that the canary egg lipid extract of the present invention reduced the inflammation-related factors increased by LPS in a concentration-dependent manner.

<Example 4> Confirmation of inflammatory cell surface molecule expression of canary egg lipid extract

In order to confirm the anti-inflammatory effect of the canary egg lipid extract of the present invention, the expression of CD86 involved in acquired immunity and CD14 involved in innate immunity, as cell surface molecules related to inflammation, were examined. Specifically, RAW264.7 cells were inoculated into a 96 well plate at a concentration of 2 × 10 ⁶ cells and cultured for 24 hours. The cultured cells were treated with canary egg lipid extract at concentrations of 0.5, 1.0, 1.5 and 2.0% by volume of the culture medium volume, and cultured for 1 hour. The cultured cells were treated with 1 μg/ml of LPS and cultured for 24 hours. After incubation, cells were collected in 1.5 ml tubes and washed with cold FACS buffer. Washed cells were blocked with 600 μg/ml of mouse IgG for 10 minutes. CD86-APC (eBioscience, Inc., San Diego, CA, USA) or CD14-FITC (eBioscience, Inc., San Diego, CA, USA) antibodies were added to the blocked cells and stained with an isotype control for 10 minutes. They were then washed with cold FACS buffer, and during each treatment, 100,000 cells were analyzed using the CytoFLEX Flow Cytometer and CytExpert program (Beckman Coulter, Inc., Brea, CA, USA). As a control group, an untreated control group (RPMI) treated with nothing and an LPS-treated group treated with only LPS were used.

As a result, in the LPS-treated RAW264.7 cells, the inflammation-related cell surface factors CD86 and CD14 were significantly increased compared to the untreated control group (RPMI), but when the canary egg lipid extract was treated, the LPS-induced expression of CD86 and CD14 decreased in a concentration-dependent manner, confirming that the canary egg lipid extract of the present invention inhibited the expression of inflammation-related surface factors (FIG. 4).

<Example 5> Confirmation of Inhibition of Phosphorylation of Inflammatory Pathway by Canary Al Lipid Extract

It was investigated whether canary egg lipid extract inhibits the phosphorylation of factors related to NF-κB and MAPK (mitogen-activated protein kinase), which are inflammation-related pathways. Specifically, the cultured cells were collected in the same manner as in Example 4, and proteins were isolated using a radioimmunoprecipitation assay buffer (Tech & Innovation, Zhangjiakou, China) containing 0.1% protease and phosphatase inhibitor cocktail and 0.5 mM EDTA solution (Thermofisher, Waltham, MA, USA). Extracted proteins were quantified using Pierce™ BCA Protein Assay (Thermo Scientific, Waltha, MA, USA). 30 μg of the separated protein was separated through SDS-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane (Merck, Kenilworth, NJ, USA). Membranes were blocked with 1x Tris-buffer saline (TBS) containing 5% skim milk and 0.1% Tween 20 for 1 hour. The blocked membrane was reacted with phospho (p)-nuclear factor (NF)-κB p65 (Cell Signaling Technology, Danvers, MA, USA), p-ERK1/2 (Cell Signaling Technology, USA), p-JNK (Cell Signaling Technology, Danvers, MA, USA), p-p38 (Cell Signaling Technology, Danvers, MA, USA), and α-tubulin (Abcam, Cambridge, UK) antibodies, followed by Pierce® ECL Plus Western B Each protein was detected using a lotting substrate (Thermo Scientific, Waltha, MA, USA). After that, it was imaged with ChemiDoc XRS+ imaging system (Bio-Rad, Hercules, CA, USA) and quantified with ImageLab software (version 4.1, Bio-Rad, Hercules, CA, USA).

As a result, it was confirmed that phosphorylation of p38, JNK, ERK1/2 and NK-κB increased in the LPS-treated RAW264.7 cell line compared to the untreated control group (RPMI). However, when the canary egg lipid extract of the present invention was treated, the phosphorylation of p38, JNK, ERK1/2, and NK-κB, which was increased by treatment with LPS, was suppressed in a concentration-dependent manner (FIG. 5).

<Example 6> Statistical analysis

Statistix 8.1 software was used for the statistical analysis of the present invention, and differences between treatment groups were analyzed with Turkey's pairwise comparison at p < 0.5 with one-way ANOVA.

Therefore, it was confirmed that the canary egg lipid extract of the present invention inhibits the production of inflammation-related NO and significantly inhibits the expression of inflammation-related factors IL-1β, IL-6, COX-2, iNOS and TNF-α in the LPS-stimulated RAW264.7 cell line. In addition, it was confirmed that the expression of CD86 and CD14, which are inflammation-related surface factors, was inhibited in the cell line stimulated with LPS, and phosphorylation of NF-κB and MAPK pathways related to inflammation were inhibited.

Claims (15)

Canary (Ammodytes personatus) A food composition for anti-inflammatory, containing a lipid extract as an active ingredient. According to claim 1,
The lipid extract is, anti-inflammatory food composition that is extracted from a region selected from the group consisting of canary eggs, fish meat, internal organs, heads, bones and shells. According to claim 1,
The canary lipid extract is an anti-inflammatory food composition comprising polyunsaturated fatty acids, monounsaturated fatty acids and saturated fatty acids. According to claim 3,
The polyunsaturated fatty acid is anti-inflammatory, which is one selected from the group consisting of Linoleic acid (C18: 2n6), alpha linolenic acid, eicosatrienoic acid (C18: 3n3), eicosapentaenoic acid (C20: 5n3) and docosahexaenoic acid (C22: 6n3) food composition for use. According to claim 3,
The monounsaturated fatty acid is palmitoleic acid (palmitoleic acid; C16: 1n7), oleic acid (Oleic acid; C18: 1n9) or basenic acid (vaccenic acid; C18: 1n7), anti-inflammatory food composition. According to claim 3,
The saturated fatty acid is palmitic acid (palmitic acid; C16: 0) or stearic acid (stearic acid; C18: 0), anti-inflammatory food composition. According to claim 1,
The canary lipid extract is to inhibit NO production stimulated by external substances, anti-inflammatory food composition. According to claim 1,
The canary lipid extract is to suppress the expression of inflammation-related factors stimulated by external substances, anti-inflammatory food composition. According to claim 8,
The inflammation-related factor is selected from the group consisting of IL-1β, IL-6, COX-2, iNOS and TNF-α, anti-inflammatory food composition. According to claim 1,
The canary lipid extract, to suppress the expression of CD86 or CD14, an inflammation-related surface factor stimulated by external substances, anti-inflammatory food composition. According to claim 1,
The canary lipid extract inhibits the phosphorylation of factors consisting of p38, JNK, ERK1/2 and NF-κB, which are inflammatory pathways stimulated by external substances, anti-inflammatory composition. An anti-inflammatory cosmetic composition comprising a canary (Ammodytes personatus) lipid extract as an active ingredient. Canary (Ammodytes personatus) lipid (Lipid) extract as an active ingredient, anti-inflammatory pharmaceutical composition for inflammatory diseases. An anti-inflammatory quasi-drug composition comprising an extract of canary (Ammodytes personatus) lipid as an active ingredient. A method of treating cells with a canary lipid extract in vitro to suppress NO production stimulated by external substances and expression of inflammation-related factors IL-1β, IL-6, COX-2, iNOS and TNF-α, inflammation-related surface factors, CD86 and CD14, and phosphorylation of p38, JNK, ERK1/2 and NF-κB, which are inflammatory pathways.