KR20230110141A - Fab fragment specifically binding to PD-L1 protein and uses thereof - Google Patents

Abstract

The present invention relates to a recombinant Fab fragment (Anti-PD-L1 Fab) that specifically binds to the PD-L1 protein, which can bind to both human or mouse cancer cell lines expressing PD-L1 and inhibits the growth of cancer cells by inducing cancer cell antigen-specific immune activity in tumor-transplanted mice. This recombinant Fab fragment (Anti-PD-L1 Fab) has been confirmed to exhibit similar or superior anti-cancer effects to existing anti-PD-L1 antibodies, and can be used as a replacement for existing antibodies. can

Description

Fab fragment specifically binding to PD-L1 protein and uses thereof {Fab fragment specifically binding to PD-L1 protein and uses thereof}

The present invention provides a Fab fragment that specifically binds to PD-L1 protein and uses thereof.

Cancer is a disease that occurs in our body and means that normal cells are changed into cells that proliferate indefinitely and do not die. Cancer preferentially absorbs the nutrients of our body for growth, so it grows rapidly and destroys the function of tissues. Our body's immune system can find and kill cancer cells through a general immune response. According to this, we are being treated without even knowing that cancer has occurred in the body. However, cancer or tumors have mechanisms to evade the body's immunity. When we evade immunity in this way, the defense system against the growth of cancer is lost in our body, and cancer grows smoothly, leading to our death.

Cancer immune evasion mechanisms are determined by checkpoint receptors and their ligands. Various immune checkpoint proteins are being discovered, and antibody drugs to inhibit them are being developed. The most representative proteins among these are PD-1, PD-L1 and CTLA-4. Cancer cells overexpress PD-L1, which binds to PD-1 of T lymphocytes, which are immune cells. Their combination makes T lymphocytes lose their aggressiveness, allowing cancer cells to grow freely from immune cells.

The binding of PD-1 to PD-L1 can be blocked using a monoclonal antibody. Anti-PD-1 antibodies can bind to T lymphocytes and induce their activity, and anti-PD-L1 antibodies can bind to cancer cells and block immune evasion. There are two immune checkpoint inhibitors that neutralize PD-1: Keytruda (ingredient name: pembrolizumab) and Opdivo (ingredient name: Nivolumab), and antibodies that block immune evasion by binding to PD-L1 include Tecentriq (ingredient name: atezolizumab) and Imfinzi (ingredient name: durvalumab). These antibody drugs have been approved by the FDA and are used as various cancer treatments such as non-small cell lung cancer, urothelial cancer, small cell lung cancer, triple negative breast cancer, bladder cancer, melanoma, and renal cell cancer.

An antibody is a substance that specifically binds to an antigen and induces an antigen-antibody reaction. Antibodies are composed of proteins and exist in the shape of a Y. The Y-shaped antibody is attached to two heavy chains and two light chains and has a constant region and a variable region. The split portion of the antibody (branch portion of Y) is called a Fab fragment (fragment antigen binding fragment), which has one constant region and one variable region, and the N-terminus binds to the antigen.

Therefore, the Fab fragment of an antibody can be a region that determines binding to a specific antigen as a variable region, and studies for using such a Fab fragment for anticancer purposes are ongoing.

1. Republic of Korea Patent Publication No. 10-2021-0141539.

An object of the present invention is to provide a Fab fragment that specifically binds to the PD-L1 protein.

Another object of the present invention is to provide a nucleic acid molecule encoding the Fab fragment.

Another object of the present invention is to provide a recombinant vector containing the nucleic acid molecule.

Another object of the present invention is to provide a transformant transformed with the recombinant vector.

Another object of the present invention is to provide a pharmaceutical composition for treating or preventing cancer disease comprising the Fab fragment and a pharmaceutically acceptable carrier.

Another object of the present invention is to provide a composition for immune checkpoint inhibition comprising the Fab fragment.

Another object of the present invention is to provide a composition for diagnosing cancer disease comprising the Fab fragment.

In order to achieve the above object, the present invention provides a Fab fragment that specifically binds to the PD-L1 protein, wherein the Fab fragment has a light chain variable region having the amino acid sequence represented by SEQ ID NO: 1 (V _L ); And it may include a heavy chain variable region (V _H ) having an amino acid sequence represented by SEQ ID NO: 2.

In addition, the present invention provides a nucleic acid molecule encoding the Fab fragment.

In addition, the present invention provides a recombinant vector containing the nucleic acid molecule.

In addition, the present invention provides a transformant transformed with the recombinant vector.

In addition, the present invention provides a pharmaceutical composition for treating or preventing cancer disease comprising the Fab fragment and a pharmaceutically acceptable carrier.

In addition, the present invention provides a composition for immune checkpoint inhibition comprising the Fab fragment.

In addition, the present invention provides a composition for diagnosing cancer disease comprising the Fab fragment.

The present invention relates to a Fab fragment that specifically binds to the PD-L1 protein, which has been confirmed to be capable of binding to both human and mouse cancer cell lines expressing PD-L1, and has been confirmed to inhibit the growth of cancer cells by inducing cancer cell antigen-specific immune activity in tumor-transplanted mice, which can be usefully used in the diagnosis, prevention, or treatment of cancer.

1 shows the results of extraction of the recombinant Fab fragment (Anti-PD-L1 Fab) used in the present invention.
Figure 2 shows the result of confirming the ability of the recombinant Fab fragment (Anti-PD-L1 Fab) to bind to cancer cells expressing PD-L1.
3 shows the result of confirming whether the recombinant Fab fragment (Anti-PD-L1 Fab) competitively binds to an existing anti-PD-L1 antibody.
Figure 4 shows the results of confirming the anticancer effect by the recombinant Fab fragment (Anti-PD-L1 Fab).
5 shows the result of confirming the activity of cytotoxic T lymphocytes by the recombinant Fab fragment (Anti-PD-L1 Fab).

Hereinafter, the present invention will be described in more detail.

The immune evasion mechanism of cancer is determined by the checkpoint receptor and its ligand, and the present invention capable of specifically binding to the PD-L1 protein was completed to prevent or treat cancer diseases by preventing the overexpression of PD-L1, one of the immune checkpoint proteins.

The present invention provides a Fab fragment specifically binding to the PD-L1 protein, wherein the Fab fragment comprises a light chain variable region (V _L ) having the amino acid sequence represented by SEQ ID NO: 1; And it may include a heavy chain variable region (V _H ) having an amino acid sequence represented by SEQ ID NO: 2.

SEQ ID NO: 1
light chain length=214, MW=23360.8, pI=7.33 DIQMTQSPSS LSASVGDRVT ITCRASQDVS TAVAWYQQKP GKAPKLLIYS ASFLYSGVPS RFSGSGSGTD FTLTISSLQP EDFATYYCQQ YLYHPATFGQ GTKVEIKRTV AAPSVFIFPP SDEQLKSGTA SVVCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSST LT LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC SEQ ID NO: 2
Heavy Chain Length=216, MW=23014.3 pI=8.33 EVQLVESGGG LVQPGGSLRL SCAASGFTFS DSWIHWVRQA PGKGLEWVAW ISPYGGSTYY ADSVKGRFTI SADTSKNTAY LQMNSLRAED TAVYYCARRH WPGGFDYWGQ GTLVTVSSAS TKGPSVFPLA PSSKSTSGGT AALGCLVKDY FPEPVTVSWN SGALTSGVHT FPAVLQSSGL YSL SSVVTVP SSSLGTQTYI CNVNHKPSNT HHHHHH

As used herein, the term "Fab fragment" refers to a fragment having an antigen-binding function, and has a structure having a heavy chain variable region (V _H ) and a light chain variable region (V _L ) and has one antigen-binding site. Such a Fab fragment can be obtained using a proteolytic enzyme, and preferably can be produced through genetic recombination technology.

As used herein, the term "heavy chain" includes a variable region domain V _H and three constant region domains C _H1 , C _H2 and C _H3 comprising an amino acid sequence having a variable region sequence sufficient for conferring specificity to an antigen. Refers to both full-length heavy chains and fragments thereof.

As used herein, the term "light chain" refers to both a full-length light chain and a fragment thereof comprising a variable region domain V _L and a constant region domain _CL comprising an amino acid sequence having sufficient variable region sequence to impart specificity to an antigen.

In addition, the present invention provides a nucleic acid molecule encoding the Fab fragment, wherein the nucleic acid molecule comprises a light chain variable region (V _L ) having the nucleotide sequence represented by SEQ ID NO: 3; And it may include a heavy chain variable region (V _H ) having the nucleotide sequence represented by SEQ ID NO: 4.

SEQ ID NO: 3 GACATCCAGATGACCCAGAGCCCTAGCAGCCTGAGCGCTAGCGTGGGAGATAGAGTGACCATCACTTGCAGGGCCAGCCAGGACGTGTCTACAGCCGTGGCTTGGTACCAGCAGAAGCCAGGAAAGGCCCCCAAGCTGCTGATCTACAGCGCTAGCTTCCTGTACAGCGGAGTGCCTAGCAGATTCAGCGGAAGCGGAAGCGGCACAGACTTCACCCTGACCATCAGCAGCCTGCAGCCA GAGGACTTCGCCACCTACTACTGCCAGCAGTACCTGTACCACCCCGCTACATTCGGCCAGGGCACCAAGGTGGAGATCAAGAGGACCGTGGCCGCTCCTAGCGTGTTCATCTTCCCTCCTAGCGACGAGCAGCTGAAGAGCGGAACAGCTAGCGTCGTCTGCCTGCTGAACAACTTCTACCCCAGGGAGGCCAAAGTCCAGTGGAAAGTGGACAACGCCCTGCAGAGCGGAAACTCTCAGGA GAGCGTGACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTGAGCAGCACACTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCTTGCGAGGTCACCCATCAGGGACTGAGCAGCCCCGTGACCAAGAGCTTCAACCGCGGCGAGTGT SEQ ID NO: 4 GAGGTGCAGCTGGTGGAATCAGGAGGAGGACTGGTGCAGCCAGGAGGATCTCTGAGACTGTCTTGTGCCGCCAGCGGATTCACCTTCAGCGACTCTTGGATCCATTGGGTCCGCCAGGCTCCAGGAAAAGGACTCGAGTGGGGTGGCTTGGATCAGCCCTTACGGCGGCAGCACCTACTACGCAGACAGCGTGAAGGGCAGGTTCACCATCAGCGCCGATACCAGCAAGAACACCGCCTAC CTGCAGATGAACAGCCTGAGGGCCGAGGATACCGCCGTGTACTATTGCGCCAGGAGGCATTGGCCAGGAGGATTCGACTATTGGGGCCAGGGAACACTGGTGACGTGTCTAGCGCTAGCACCAAGGGACCTAGCGTGTTCCCTCTGGCTCCTAGCAGCAAGAGCACAAGCGGCGGAACAGCAGCCCTGGGTTGTCTGGTGAAGGACTACTTCCCCGAGCCAGTGACCGTGTCTTGGAACAG CGGAGCTCTGACAAGCGGAGTGCACACATTTCCAGCCGTGCTGCAGAGCTCAGGACTGTACAGCCTGTCCAGCGTGGTGACAGTGCCTTCTAGCAGCCTGGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCCAGCAACACCCACCACCACCACCATCAC

As used herein, the term "nucleic acid molecule" is meant to comprehensively include DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are basic structural units in nucleic acid molecules, include not only natural nucleotides, but also sugar or base site modified analogs (analogues).

In addition, the present invention provides a recombinant vector containing the nucleic acid molecule.

The vector system of the present invention can be constructed through various methods known in the art. Vectors of the present invention may typically be constructed as vectors for cloning or vectors for expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell as a host. Vectors of the present invention may typically be constructed as vectors for cloning or vectors for expression.

For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (e.g., T7 promoter, tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, and trp promoter, etc.), a ribosome binding site for initiation of translation, and a transcription/translation termination sequence (terminator, e.g., T7 terminator, ADH1 terminator, T3 terminator and TonB terminator, etc.) are common. When E. coli is used as the host cell, the promoter and operator regions of the E. coli tryptophan biosynthetic pathway and the leftward promoter of phage λ (pL λ promoter) can be used as regulatory regions.

Vectors that can be used in the present invention can be constructed by manipulating plasmids (eg, pACYCDuet-1, pSC101, ColE1, pBR322, pUC8/9, pHC79, pUC19, pET, etc.), phages (eg, λgt4λB, λ-Charon, λΔz1 and M13, etc.) or viruses (eg, SV40, etc.) that are often used in the art.

Any host cell capable of stably and continuously cloning and expressing the vector of the present invention can be used as any host cell known in the art. strains of the same Bacillus genus, and enterobacteriaceae and strains such as Salmonella typhimurium, Serratia marcessons and various Pseudomonas species.

In addition, the present invention provides a transformant transformed with the recombinant vector.

As used herein, the term "transformation" refers to a phenomenon in which the genetic character of a host cell (prokaryotic and eukaryotic, animal cell and plant cell) is changed by a plasmid or genome containing a nucleic acid introduced from the outside using a genetic engineering technique, and the term "transformant" refers to a cell that stably retains a gene and stably maintains gene expression even when a plasmid gene or genomic DNA introduced from the outside undergoes repeated cell division. In order to carry out the transformation, any method of introducing a nucleic acid into an organism, cell, tissue, organ or nucleic acid may be used, and preferably, as known in the art, it may be performed by selecting a suitable standard technique according to the host cell.

In addition, the present invention provides a pharmaceutical composition for treating or preventing cancer disease comprising the Fab fragment and a pharmaceutically acceptable carrier.

In another embodiment of the present invention, the pharmaceutical composition may further include one or more additives selected from the group consisting of suitable carriers, excipients, disintegrants, sweeteners, coating agents, bulking agents, lubricants, lubricants, flavoring agents, antioxidants, buffers, bacteriostatic agents, diluents, dispersing agents, surfactants, binders, and lubricants commonly used in the preparation of pharmaceutical compositions.

Specifically, carriers, excipients and diluents are lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium Stearate and mineral oil may be used, and solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations may be prepared by mixing the composition with at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions for oral use, emulsions, syrups, and the like, and various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included in addition to commonly used simple diluents such as water and liquid paraffin. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, and the like. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspensions. As a base material of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogeratin and the like may be used.

According to one embodiment of the present invention, the pharmaceutical composition can be administered to a subject in a conventional manner through intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, transdermal, intranasal, inhalation, topical, rectal, oral, intraocular or intradermal routes.

The dose of the active ingredient according to the present invention may vary depending on the condition and weight of the subject, the type and severity of the disease, the drug form, the route and duration of administration, and may be appropriately selected by a person skilled in the art, and the daily dose may be 0.01 mg/kg to 200 mg/kg, preferably 0.1 mg/kg to 200 mg/kg, and more preferably 0.1 mg/kg to 100 mg/kg. Administration may be administered once a day or divided into several times, and the scope of the present invention is not limited thereby.

In addition, the present invention provides a composition for immune checkpoint inhibition comprising the Fab fragment.

In the present invention, the term “immune checkpoint inhibitory composition” refers to any nucleic acid or protein that prevents suppression of any component in the immune system, such as MHC class presentation, T cell presentation and/or differentiation, B cell presentation and/or differentiation, and cytokine, chemokine, or immune cell proliferation and/or differentiation, and refers to signaling for immune cell proliferation and/or differentiation.

In one embodiment of the present invention, the immune checkpoint inhibitory composition may be an antibody, a fusion protein, an aptamer, or an immune checkpoint protein-binding fragment thereof. For example, the immune checkpoint inhibitory composition is an anti-immune checkpoint protein antibody or an antigen-binding fragment thereof. In certain instances, an anti-CTLA4 antibody, derivative thereof or antigen-binding fragment thereof; an anti-PD-L1 antibody, derivative thereof or antigen-binding fragment thereof; and an anti-PD-1 antibody, derivative thereof or antigen-binding fragment thereof. For example, the composition for inhibiting immune checkpoints may include ipilimumab, a derivative thereof or an antigen-binding fragment thereof; atezolizumab, a derivative thereof or an antigen-binding fragment thereof; Nivolumab, a derivative thereof or an antigen-binding fragment thereof; and pembrolizumab, a derivative thereof, or an antigen-binding fragment thereof, and any antibody or other type of immune checkpoint inhibitor that can be used as an immune checkpoint inhibitor may be used without limitation.

In one embodiment of the present invention, the immune checkpoint inhibitor is preferably any one or more selected from anti-CTLA4 antibody, anti-PD-1 antibody and anti-PD-L1 antibody. The antibody may be purchased and used from, for example, a conventional antibody manufacturer or the like, or may be prepared and used according to a known antibody production method.

In addition, the present invention provides a composition for diagnosing cancer disease comprising the Fab fragment.

In the present invention, the "diagnosis" refers to determining the susceptibility of a subject to a specific disease or disorder, determining whether a subject currently has a specific disease or disorder, determining the prognosis of a subject suffering from a specific disease or disorder (eg, identification of a pre-metastatic or metastatic cancer state, determining the stage of a cancer or determining the responsiveness of a cancer to treatment), or terrametrics (eg, determining the efficacy of a treatment to provide information on a subject). status monitoring). For the purposes of the present invention, the diagnosis is to determine whether or not the disease has occurred or is likely to develop (risk).

Hereinafter, examples and the like will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples. Examples of the present invention and the like are provided to more completely explain the present invention to those skilled in the art.

[Example 1] Extraction of recombinant PD-1 protein

For the expression of the recombinant Fab fragment (Anti-PD-L1 Fab), the gene codons of anti-PD-L1 heavy chain and light chain were respectively inserted into the P35 vector. In addition, 6 consecutive histidine molecules were inserted at the heavy chain C-terminal end. ^MaxCodonTM The optimal Fab fragment sequence was identified as shown in Table 1 using Optimization Program (V13) software.

E. coli DH5α containing a plasmid containing a recombinant Fab fragment (Anti-PD-L1 Fab) gene was transformed using heat shot. After stabilization by culturing for 30 minutes in a shaking incubator at 37 ° C. and 200 rpm, 50 μg / mL kanamycin sulfate, 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride were dissolved. E. coli cells were aliquoted into LB plates, and incubated overnight at 37 ° C. A single colony was obtained from the cultured E. coli, and cultured while shaking at 200 rpm for 8 hours into 2 to 5 ml of kanamycin-containing LB culture medium. Take 1 ml of the culture medium and put it in a flask containing 200 ml of the new culture medium, shake at 200 rpm at 37 ° C for 16 hours, and culture the mass. Plasmids from the cultured cells were extracted using the Qiagen plasmid extraction kit, and the plasmids were identified on a 1% agarose gel. The test was confirmed by repeating twice. As a result, according to Figure 1A, it was confirmed that a uniform plasmid could be secured in E. coli.

After securing a sufficient amount of a plasmid containing the recombinant Fab fragment (Anti-PD-L1 Fab), the plasmid was transformed into HEK293 cells. One day before transfection, 1 L of 1×10 ⁶ cells/mL of HEK293 cells was prepared and heated at 110 rpm at 37 °C and 5% carbon dioxide (CO ₂ ). cultured under the condition. The number of cells at the time of transformation was prepared as 1 to 1.5×10 ⁶ cells/mL. The prepared plasmid was previously prepared in a solution for transformation together with a transformation reagent (Mirus, TransIT-293; #MIR2706) and stabilized at 37°C. The prepared transformation solution and the cells were slowly mixed, and at 110 rpm at 37 °C and 5% carbon dioxide (CO ₂ ). cultured under the condition. After 5 days of culture, the culture medium and cells were separated by centrifugation.

The culture solution of the transformed HEK293 cells cultured for 5 days was harvested and filtered through 0.22 μm. Then, the culture solution was dialyzed with 1X PBS pH 7.4 at 4 ° C. Finally, the recombinant Fab fragment (Anti-PD-L1 Fab) was extracted as shown in Figure 1B by chromatography using a Ni-IDA column (line 1 is the result obtained after culturing HEK293 cells and centrifuging the supernatant, line 2 is the result obtained by binding the culture medium to a Ni-IDA column, and lines 3 and 4 are Ni-NTA bonds removed). Shows the results of confirming the recombinant Fab fragments that were separated when 100 mM of Sigma's imidazole was added, and lines 5 to 12 showed the results of confirming the recombinant Fab fragments that were separated when 300 mM of imidazole was added).

To confirm the properties of the recombinant Fab fragment (Anti-PD-L1 Fab), 1) Dissolve 10 mg of the extracted recombinant Fab fragment in 1 ml of distilled water and check with Microdigital's UV-Vis spectrophotometer, 2) Check the degree of endotoxin contamination in the recombinant Fab fragment (Anti-PD-L1 Fab) with Invivogen's Endotoxin detection kit, and 3) 10 mg of the recombinant Fab fragment (Anti-PD-L1 Fab) to evaluate bacterial contamination ) was dissolved in 1 ml of distilled water and observed by spreading on an agar plate for bacterial culture. As a result, according to Table 3, the A260 / A280 value indicating the purity of the protein was 1.90, confirming that the high-purity protein was isolated, there was no contamination of endotoxins, and the growth of bacteria was not confirmed.

Contents Standard Results A260/A280 1.8-2.0 1.90 Endotoxins <50EU/mg <50EU/mg Sterility testing sterility LB plate, no colony

Meanwhile, the recombinant Fab fragment (Anti-PD-L1 Fab) extracted by the above experiment was stored after being lyophilized. According to FIG. 1C, the lyophilized recombinant Fab fragment (Anti-PD-L1 Fab) was confirmed to be soluble in water and to bind to the anti-histidine antibody.

[Example 2] Confirmation of PD-L1 expressing cancer cell binding ability by recombinant Fab fragment

(A) mouse colon epithelial carcinoma CT-26 cells and (B) human lung cancer cell line A549, which express PD-L1 on the cell surface, were treated with a recombinant Fab fragment (Anti-PD-L1 Fab), and cell adhesion of the protein was confirmed with an anti-histidine antibody (clone: J095G46). At this time, the cells were each given at 1 X 10 ⁵ cells/100 μl and prepared in a 1.5 ml tube. 1, 2, and 5 μg of the recombinant Fab fragment (Anti-PD-L1 Fab) was treated, and after incubation at 4° C. for 15 minutes, 500 μl of PBS was added and centrifuged to remove non-attached recombinant Fab fragments (Anti-PD-L1 Fab). After adding 100 μl of PBS to the pellet to suspend the cells, the degree of cell attachment of the recombinant Fab fragment (Anti-PD-L1 Fab) was confirmed using a green fluorescent anti-histidine antibody.

As a result, according to FIG. 2, it was confirmed that the recombinant Fab fragment (Anti-PD-L1 Fab) binds to PD-L1 expressing cells in a concentration-dependent manner.

[Example 3] Confirmation of competitive binding ability of anti-PD-L1 antibody and recombinant Fab fragment

(A) CT-26 cells and (B) A549 cells were treated with anti-PD-L1 antibody (clone: 29E.2A3) for 30 minutes, and then treated with a recombinant Fab fragment (Anti-PD-L1 Fab).

As a result, according to FIG. 3 , it was confirmed that the binding of the recombinant Fab fragment (Anti-PD-L1 Fab) was inhibited by the anti-PD-L1 antibody. Accordingly, it was found that the recombinant Fab fragment (Anti-PD-L1 Fab) binds to the same binding site as the anti-PD-L1 antibody, and the two substances competitively bind to PD-L1.

<Example 4> Confirmation of inhibition of tumor growth by administration of a recombinant Fab fragment

To confirm the anticancer effect of the recombinant Fab fragment (Anti-PD-L1 Fab), CT-26 tumor cells were administered to mice (BALB/c; 6 weeks old, female). Seven days after CT-26 tumor administration, negative control antibody (IgG), recombinant Fab fragment (Anti-PD-L1 Fab), and BioXcell's anti-PD-L1 antibody (clone: 10F.9G2) were administered every 3 days.

First, 24 days after tumor administration, the tumor was removed and the size was confirmed. As a result, according to FIG. 4A, when the recombinant Fab fragment (Anti-PD-L1 Fab) was administered compared to the negative control group, it could be seen that the size of the tumor was significantly reduced.

Next, changes in tumor growth size during the drug administration period were confirmed. As a result, according to FIG. 4B, it was confirmed that tumor growth was inhibited by the recombinant Fab fragment (Anti-PD-L1 Fab).

Finally, after cancer cell administration, the survival rate of mice was confirmed. As a result, as shown in FIG. 4C, in the case of the negative control group, all mice died 27 days after tumor transplantation, but mice administered with the recombinant Fab fragment (Anti-PD-L1 Fab) survived up to 39 days.

Therefore, it was confirmed that the recombinant Fab fragment (Anti-PD-L1 Fab) had an anti-cancer effect, and the effect was also proved to be superior to that of the existing anti-PD-L1 antibody.

[Example 5] Confirmation of the activity of cytotoxic T lymphocytes by administration of a recombinant Fab fragment

According to the experimental method described in Example 4, saline, a negative control antibody, an anti-PD-L1 antibody, and a recombinant Fab fragment (Anti-PD-L1 Fab) were administered to CT-26 tumor-transplanted mice every 3 days. Twenty-four days after tumor administration, tumor lymph nodes were removed. After tumor lymph nodes were removed, they were pulverized using a tissue grinder, and tumor lymph node cells were prepared by making single floating cells with an aqueous solution containing digestive enzymes.

First, the ratio of cells binding to SPSYVHQF, a CT-26 specific antigen epitope, to tumor lymph node cells was confirmed. As a result, according to FIG. 5A , when the anti-PD-L1 antibody or the recombinant Fab fragment (Anti-PD-L1 Fab) was treated, the ratio of cells binding to SPSYVHQF, a CT-26 specific antigen epitope, was confirmed to increase.

Next, specific interferon-gamma production by specific immune activity against SPSYVHQF, a CT-26 specific antigen epitope, was confirmed. As a result, according to Figure 5B, it was confirmed that the expression was high when the recombinant Fab fragment (Anti-PD-L1 Fab) was treated.

Finally, in order to confirm whether immune cells are required for the anticancer effect induced by the recombinant Fab fragment (Anti-PD-L1 Fab), anticancer effects were tested in CD4 and CD8 deficient mice. As a result, according to FIG. 5B, it was confirmed that the anti-cancer effect of the recombinant Fab fragment (Anti-PD-L1 Fab) was not observed in the absence of CD4 and CD8 cells, indicating that the recombinant Fab fragment (Anti-PD-L1 Fab) kills cancer cells by activating immune cells.

The above description of the present invention is for illustrative purposes, and those skilled in the art will understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting.

The scope of the present invention is indicated by the following claims, and all changes or modifications derived from the meaning and scope of the claims and equivalent concepts should be interpreted as being included in the scope of the present invention.

<110> Research Cooperation Foundation of Yeungnam University <120> Fab fragment specifically binds to PD-L1 protein and uses its <130> ADP-2022-0025 <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 214 <212> PRT <213> artificial sequence <220> <223> Anti-PD-L1 Fab <400> 1 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Val Ser Thr Ala 20 25 30 Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Leu Tyr His Pro Ala 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205 Phe Asn Arg Gly Glu Cys 210 <210> 2 <211> 216 <212> PRT <213> artificial sequence <220> <223> Anti-PD-L1 Fab <400> 2 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ser 20 25 30 Trp Ile His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Trp Ile Ser Pro Tyr Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg His Trp Pro Gly Gly Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser 195 200 205 Asn Thr His His His His His His 210 215 <210> 3 <211> 642 <212> DNA <213> artificial sequence <220> <223> Anti-PD-L1 Fab <400> 3 gacatccaga tgacccagag ccctagcagc ctgagcgcta gcgtgggaga tagagtgacc 60 atcacttgca gggccagcca ggacgtgtct acagccgtgg cttggtacca gcagaagcca 120 ggaaaggccc ccaagctgct gatctacagc gctagcttcc tgtacagcgg agtgcctagc 180 agattcagcg gaagcggaag cggcacagac ttcaccctga ccatcagcag cctgcagcca 240 gaggacttcg ccacctacta ctgccagcag tacctgtacc accccgctac attcggccag 300 gccaccaagg tggagatcaa gaggaccgtg gccgctccta gcgtgttcat cttccctcct 360 agcgacgagc agctgaagag cggaacagct agcgtcgtct gcctgctgaa caacttctac 420 cccagggagg ccaaagtcca gtggaaagtg gacaacgccc tgcagagcgg aaactctcag 480 gagagcgtga cagagcagga cagcaaggac agcacctaca gcctgagcag cacactgacc 540 ctgagcaagg ccgactacga gaagcacaag gtgtacgctt gcgaggtcac ccatcaggga 600 ctgagcagcc ccgtgaccaa gagcttcaac cgcggcgagt gt 642 <210> 4 <211> 648 <212> DNA <213> artificial sequence <220> <223> Anti-PD-L1 Fab <400> 4 gaggtgcagc tggtggaatc aggaggagga ctggtgcagc caggaggatc tctgagactg 60 tcttgtgccg ccagcggatt caccttcagc gactcttgga tccattgggt ccgccaggct 120 ccaggaaaag gactcgagtg ggtggcttgg atcagccctt acggcggcag cacctactac 180 gcagcagcg tgaagggcag gttcaccatc agcgccgata ccagcaagaa caccgcctac 240 ctgcagatga acagcctgag ggccgaggat accgccgtgt actattgcgc caggaggcat 300 tggccaggag gattcgacta ttggggccag ggaacactgg tgaccgtgtc tagcgctagc 360 accaagggac ctagcgtgtt ccctctggct cctagcagca agagcacaag cggcggaaca 420 gcagccctgg gttgtctggt gaaggactac ttccccgagc cagtgaccgt gtcttggaac 480 agcggagctc tgacaagcgg agtgcacaca tttccagccg tgctgcagag ctcaggactg 540 tacagcctgt ccagcgtggt gacagtgcct tctagcagcc tgggcaccca gacctacatc 600 tgcaacgtga accacaagcc cagcaacacc caccaccacc accatcac 648

Claims (13)

A Fab fragment characterized in that it binds specifically to the PD-L1 protein and comprises the following region:
A light chain variable region having the amino acid sequence represented by SEQ ID NO: 1 (V _L ); and
A heavy chain variable region having the amino acid sequence represented by SEQ ID NO: 2 (V _H ). A nucleic acid molecule encoding the Fab fragment of claim 1. The nucleic acid molecule according to claim 2, wherein the nucleic acid molecule comprises the following regions:
A light chain variable region (V _L ) having the nucleotide sequence represented by SEQ ID NO: 3; and
A heavy chain variable region having the nucleotide sequence represented by SEQ ID NO: 4 (V _H ). A recombinant vector comprising the nucleic acid molecule according to claim 2. A transformant transformed with the recombinant vector according to claim 4. A pharmaceutical composition for treating or preventing cancer disease comprising the Fab fragment according to claim 1 and a pharmaceutically acceptable carrier. The pharmaceutical composition according to claim 6, wherein the cancer disease is a cancer disease caused by PD-L1 overexpression. The method according to claim 7, wherein the cancer disease is bladder cancer, breast cancer, colon cancer, kidney cancer, liver cancer, lung cancer, ovarian cancer, prostate cancer, pancreatic cancer, stomach cancer, cervical cancer, thyroid cancer, squamous cell cancer, epithelial cancer, skin cancer, leukemia, acute lymphocytic leukemia, B-cell lymphoma, T-cell lymphoma, Hodgkins lymphoma, non-Hodgkins lymphoma, hairy cell lymphoma, Burkett's lymphoma, acute or chronic myelogenous leukemia, whole bone marrow Hydrocele leukemia, fibrosarcoma, rhabdomyosarcoma, melanoma, seminoma, teratocarcinoma, neuroblastoma, glioma, astrocytoma, neuroblastoma, schwannoma, osteosarcoma, xenoderma pigmentosum, keratoacanthoma, seminoma, thyroid follicular cancer and teratocarcinoma, characterized in that any one selected from the group consisting of, a pharmaceutical composition. The pharmaceutical composition according to claim 6, wherein the pharmaceutical composition is an immuno-anticancer agent that induces the activity of cytotoxic T lymphocytes. A pharmaceutical composition for immunotherapy comprising the Fab fragment according to claim 1 and a pharmaceutically acceptable carrier. A composition for inhibiting immune checkpoints comprising the Fab fragment according to claim 1. A composition for diagnosing cancer disease comprising the Fab fragment according to claim 1. The composition according to claim 12, wherein the cancer disease is a cancer disease caused by PD-L1 overexpression.