KR20180129585A - MAGE-1 specific aptamer and use thereof - Google Patents

Abstract

The present invention relates to an aptamer specifically binding to liver cancer-associated MAGE-1, cancer treatment related to a MAGE-1 protein using the same, and to a composition for inhibiting cancer or a composition for diagnosing cancer comprising the same as an effective ingredient. The MAGE-1 specific aptamer contains a deoxyuridin1e (dU), which specifically binds to MAGE-1 and is modified by substitution of a 5^th position with a hydrophobic functional group.

Description

An abtamer specifically binding to MAGE-1 and its use {MAGE-1 specific aptamer and use thereof}

The present invention relates to a DNA tamtamer specifically binding to liver cancer-associated melanoma-associated antigen-1 (MAGE-1), and a method for treating cancer associated with MAGE-1 using the same, A composition for inhibiting cancer and a composition for diagnosing cancer.

Hepatocellular carcinoma (HCC) is the seventh most common cancer worldwide, with more than one million deaths annually from liver cancer. In Korea, the incidence of hepatitis B is high due to the high prevalence of hepatitis B, and the death rate of hepatocellular carcinoma in Korea is 22.5 per 100,000, the second highest among all cancers. In particular, the death rate of liver cancer is high in the 30-50s whose economic activity is intense, and the loss income is 2, 531.1 billion won, which is the first among the cancer, which is superior to gastric cancer (1.257 trillion won) or lung cancer (1.132 trillion won) It is a high loss. The 5-year survival rate of domestic liver cancer is 23.3%, which is the third worst after pancreatic cancer and lung cancer.

In patients with early-stage HCC less than 3 cm, surgical resection, as well as percutaneous alcohol injection and radiofrequency ablation, can safely be performed safely and have a long-term survival rate. Therefore, early diagnosis is essential to improve the prognosis of patients with HCC. However, current CT / MRI imaging studies are limited by the difficulty of early diagnosis of atypical liver cancer. In order to increase the diagnostic accuracy and sensitivity / specificity of hepatocellular carcinoma including atypical hepatocellular carcinoma, the necessity of hepatocarcinoma-specific contrast agent which can be displayed on CT or MRI radiographic examinations by attaching to proteins that are characteristically expressed on liver cancer surface .

Currently, the standard treatment for advanced HCC is sorafenib, an oral anticancer drug, but the increase in survival time is only about 2-3 months, which is not enough. In addition, even if it is a target treatment for liver cancer, it acts on mucous membrane cells of skin cells and gastrointestinal tract and causes various serious side effects such as hand-foot syndrome, painful diarrhea, abdominal pain and the like, Typical limitations are not high drug tolerance. It is interpreted that the protein targeted by sorafenib exists in other normal cells. Therefore, there is a need for a more elaborate, specific and stable target therapeutic agent capable of acting on a protein specifically present in liver cancer cells, but a target therapeutic agent superior to sorapenib has not been developed until now.

In the present invention, a platamer specifically binding to liver cancer-associated melanoma associated antigen-1 (MAGE-1) was developed. Previous studies have shown that MAGE-1 is a highly expressed protein with high frequency in liver cancer patients, but it is not known precisely about the biological mechanism. Recently, it has been reported that the detection of MAGE-1 in peripheral blood can predispose to hematogenous or early recurrence of liver cancer. Therefore, a monoclonal antibody against MAGE-1 has been developed. The aptamer selectively binding to MAGE-1 developed through the present invention is expected to be more effectively used for the treatment and diagnosis of liver cancer.

The present invention aims to provide an abatumer that specifically binds to MAGE-1, a pharmaceutical composition containing the same, and a diagnostic composition, and a method of using the same to provide information on the diagnosis of liver cancer or liver cancer metastasis.

Accordingly, the inventors of the present invention have developed a MAGE-1 specific binding capacity tamer that specifically binds to MAGE-1.

Can be more effectively applied to the treatment and diagnosis of liver cancer by the papillomas specifically binding to MAGE-1 of the present invention.

Hereinafter, the present invention will be described in more detail.

One example of the present invention is directed to a MAGE-1 specific tyramarin that specifically binds to MAGE-1 and includes a modified deoxyuridine (dU) wherein the 5-position is substituted with a hydrophobic functional group . The modification may be that a hydrophobic functional group is introduced at the 5-position of the pyrimidine group of the dioxyindoline, and preferably the hydrophobic functional group may be a benzyl group or a naphthyl group.

Another example of the present invention relates to a MAGE-1-specific platemer comprising a core sequence of at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 11 to SEQ ID NO: 20 in Table 1 below.

SEQ ID NO: designation order 11 Bz # 1 core sequence Gt; 12 Bz # 2 core sequence Gt; 13 Bz # 3 core sequence lt; 14 Bz # 4 core sequence Lt; 15 Bz # 5 core sequence gt; 16 Nap # 1 core sequence Gt 17 Nap # 2 core sequence An2ACGGCAn2AAn2n2GGGn2ACn2ACGAn2n2GGCAn2n2GGn2CAAn2n2 18 Nap # 3 core sequence Gt; 19 Nap # 4 core sequence gt; 20 Nap # 5 core sequence An2GCGAn2n2GGGn2ACn2ACCGGn2n2GGAGn2GGn2AAAACGn2GGG

In Table 1, the base represented by n1 is represented by Formula (1) as a base (BzdU) into which a benzyl group is introduced at the 5-position of the pyrimidine group of the dioxyuridine, and the base represented by the n2 is a deoxyuridine (NapdU) in which a naphthyl group is introduced at the 5-position of the pyrimidine group, and is represented by the following formula (2).

The aptamer may further comprise a primer sequence at the 5 'end, the 3' end, or both ends of the core sequence. The primer sequence may be at least one selected from the group consisting of SEQ ID NO: 21 and SEQ ID NO: 22. Preferably, the aptamer may comprise a primer comprising the nucleic acid sequence of SEQ ID NO: 21 at the 5 'end and / or a primer comprising the nucleic acid sequence of SEQ ID NO: 22 at the 3' end.

As an example of the present invention, the aptamer may be an aptamer having at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 10 in Table 2 below.

SEQ ID NO: Abtamer name order One Bz # 1 (S035-A1-12-M13-20R_D02) ≪ RTI ID = 0.0 > 2 Bz # 2 (S035-A1-13-M13-20R_E02) ≪ RTI ID = 0.0 > 3 Bz # 3 (S035-A1-15-M13-20R_G02) CGAGCGTCCTGCCTTTGn1GGCn1Gn1n1AAn1An1CGn1Gn1n1AAACCGGCn1n1n1AGGGCn1GACn1CACCGACAGCCACCCAG 4 Bz # 4 (S035-A1-18-M13-20R_B03) ≪ 5 Bz # 5 (S035-A1-20-M13-20R_D03) ≪ RTI ID = 0.0 > 6 Nap # 1 (S035-B1-03-M13-20R_C08) ≪ 7 Nap # 2 (S035-B1-06-M13-20R_F08) ≪ RTI ID = 0.0 > 8 Nap # 3 (S035-B1-13-M13-20R_E09) CGAGCGTCCTGCCTTTGCn2GCCGn2GGCGAACn2GGn2GAGAn2GGGn2ACn2GCGGn2n2GGGCCACCGACAGCCACCCAG 9 Nap # 4 (S035-B1-05-M13-20R_E08) CGAGCGTCCTGCCTTTGn2GACn2GCn2CCAGGACn2ACCACCCCAACCGn2GAGn2ACCCAACACCGACAGCCACCCAG 10 Nap # 5 (S035-B1-22-M13-20R_F10) ≪

MAGE-1 is a protein that is expressed at high concentration and high frequency in the cell membrane of liver cancer cells.) The aptamer of the present invention is selective for MAGE-1 and has a high binding capacity to inhibit proliferation of liver cancer cells. Therefore, the aptamer of the present invention is effective for inhibiting the proliferation of hepatocellular carcinoma distributed at a high level, for example, hepatocellular carcinoma, and more preferably for preventing or treating hepatocellular carcinoma.

As used herein, the term " hypovascular liver cancer " refers to hepatocellular carcinoma in which blood vessels are relatively less developed, unlike typical hepatocellular carcinomas, which have hypervascularity due to the development of blood vessels that deliver oxygen and nutrients to tumor tissues. In the case of low-grade vascular hepatocellular carcinoma, the known clinical course of hepatocellular carcinoma is poor and the clinical course is not good.

The aptamer of the present invention may have a dissociation constant (Kd) value in the range of 0.1 to 20 nM, preferably 0.1 to 5 nM, more preferably 0.1 to 1 nM when bound to the MAGE-1 protein.

Further, the aptamer is characterized by decreasing the expression of the PFKFB4 gene. The PFKFB4 gene encodes a 6-phosphofructo-2-kinase / fructose-2,6-biphosphatase 4 enzyme. Recent studies have shown that the PFKFB4 enzyme encoded by the PFKFB4 gene can be used to fine- And it is known that when it is blocked, the growth of prostate cancer cells is delayed and that free radicals accumulate rapidly to cause cell death. For example, the expression rate of PFKFB4 gene of uterus of the present invention, as measured by real-time PCR analysis, is 50 to 80% based on 100% expression of the PFKFB4 gene of a control platamer having a random sequence, 60 to 75%.

The aptamer can modify both the 5 'end, the 3' end, the middle or both ends to enhance serum stability or control renal clearance. Such modifications include, but are not limited to, PEG (polyethylene glycol), inverted deoxythymidine (idT), LNA (Locked Nucleic Acid), 2'-methoxy nucleoside, 2'- A linker, a thiol linker, a cholesterol, and the like may be combined and modified. The 'idT (inverted deoxythymidine)' is one of the molecules used to prevent degradation by a neclease of uterus, which is generally resistant to nuclease. The nucleic acid unit has 3'-OH of the former unit and the following OHT binds 3'-OH of the following unit to the 3'-OH of the former unit to form an artificial change so that 5'-OH other than 3'-OH is exposed. (3 'exonuclease), which is a kind of nuclease.

The aptamer according to the present invention may further comprise a fluorescent molecule, a toxin or a control reagent. In a preferred embodiment, the aptamer may be one labeled with F18 or P32 as a radioactive isotope.

DNA aptamers are composed of short nucleic acids and have a molecular size smaller than that of antibody drugs and can be chemically synthesized. They are easy to transform for in vivo application and have excellent ability to penetrate into tumor tissues and thus have various advantages as anticancer molecules.

Since natural oligonucleotides are sensitive to hydrolysis by Nucleic acid, stabilization of the phosphate backbone in biomedicine applications is the main focus. Modification of DNA plasmids with neutral groups such as methylphosphonate and phosphoramidate increases resistance to nucleoli, but these DNA platemeric analogues exhibit lower binding affinities as compared to unmodified oligonucleotides . To increase binding affinity and reduce slow off-rate, SELEX was performed using modified nucleotides with various functional groups. The resulting data show that the DNA aptamer modified with the benzyl group exhibits high affinity with MAGE-1 and minimizes cross-reactivity. Because of the potential morphological differences between the purified protein and the endogenous protein, the separated extramammers for the purified protein are not always able to bind to the target protein when applied in vivo. Therefore, it is necessary to integrate in vivo related conditions into the screening process in order to identify the tympanic membrane that can exhibit activity in vivo.

The DNA aptamers of the present invention exhibit faster tumor uptake, faster blood removal and more sustained tumor retention, thereby enabling significant imaging with higher tumor to tumor ratios. In addition, aptamers have the advantage of being able to make aptamers for toxins, complex protein complexes or sugar-protein complexes that are difficult to make with antibodies.

In particular, aptamers are highly stable and can be stored or transported at room temperature. They can maintain their function even after sterilization and can be regenerated within a short time even if they are denatured. Therefore, if the platemer is used as a diagnostic marker or a drug for which prolonged or repeated use is required, the platemaker is more likely to be used as an antibody. In addition, there is almost no batch-to-batch variation due to high homogeneity, and purification with high purity is easy, so that production is easy, and in vivo immune rejection hardly occurs.

Another example of the present invention is directed to a MAGE-1 specific < RTI ID = 0.0 > amtamer < / RTI > (SEQ ID NO: 1), which specifically binds to a MAGE-1 protein and contains a modified deoxyuridine For the treatment of liver cancer, the prevention of liver cancer and / or the inhibition of hepatoma metastasis, or the use of said MAGE-1-specific hydromorphone for the treatment of liver cancer, prevention of liver cancer and / . ≪ / RTI >

The indications for the platemaster can equally be applied to the treatment, prophylaxis and / or inhibition of metastasis of the composition or liver cancer.

The aptamer according to the present invention specifically binds to the MAGE-1 protein overexpressed in the liver cancer cell membrane and specifically or selectively inhibits the treatment, prevention and / or metastasis of liver cancer without adverse effect caused by the action of aptamer on normal cells Can be used.

The aptamer according to the present invention is characterized by inhibiting the growth, adhesion, migration and invasion of liver cancer cells, and preferably exhibits a remarkable effect in inhibiting the growth of liver cancer cells.

The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier.

The MAGE-1-specific platemater or the pharmaceutical composition containing the same may be formulated into various oral administration forms or parenteral administration forms. For example, it can be any oral dosage form such as tablets, pills, soft and soft capsules, liquids, suspensions, emulsions, syrups, granules, elixirs and the like. Such formulations for oral administration may contain, in addition to the above-mentioned active ingredients, diluents such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine, , Stearic acid and its magnesium or calcium salt and / or lubricants such as polyethylene glycol, and the like.

In addition, when the formulation for oral administration is a tablet, it may include a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methyl cellulose, sodium carboxymethyl cellulose and / or polyvinyl pyrrolidine, A disintegrating agent such as starch, agar, alginic acid or a sodium salt thereof, a boiling mixture and / or an absorbent, a coloring agent, a flavoring agent or a sweetening agent and the like.

When the MAGE-1-specific platemer or a pharmaceutical composition containing the same is formulated into a parenteral administration form, it is administered by a parenteral administration route such as subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection . In order to formulate the pharmaceutical composition for parenteral administration, the pharmaceutical composition is prepared by mixing the active ingredient, that is, the aptamer together with a stabilizer or a buffer in water to prepare a solution or suspension, and the solution or suspension is mixed with an ampule or vial ≪ / RTI >

In addition, the pharmaceutical composition may be sterilized or may further contain adjuvants such as preservatives, stabilizers, wettable or emulsifying accelerators, salts for controlling osmotic pressure and / or buffers, and may further comprise other therapeutically useful substances , Mixing, granulating, or coating.

The term "pharmaceutically effective amount" as used herein means the amount of active ingredient capable of exhibiting a desired effect, that is, prevention and / or treatment of liver cancer, or hepatocarcinoma transfer inhibiting effect. The active ingredient, i.e., MAGE-1 specific aptamer, may be included in the pharmaceutical composition in an effective amount of 0.1 to 500 mg / kg body weight per day, preferably 0.5 to 100 mg / kg body weight, The composition may be administered via the oral or parenteral route once or twice a day divided.

The subject to be administered with the MAGE-1-specific platemer of the present invention or the pharmaceutical composition containing the same may be a mammal including a human, preferably a rodent or a human.

As another example of the present invention, there is provided a pharmaceutical composition comprising a deoxyuridine derivative (deU) bound specifically to MAGE-1 (melanoma-associated antigen-1) and modified at position 5 by a hydrophobic functional group A MAGE-1 protein expression inhibitor or a PFKFB4 gene expression inhibitor comprising a MAGE-1-specific tympanic membrane. The above-mentioned abatumer can be equally applied to MAGE-1 protein or PFKFB4 gene expression inhibitor.

As another example of the present invention, MAGE-1 protein is overexpressed in liver cancer and cancer metastasis, so that MAGE-1 specific aptamer can be used as a composition for diagnosing liver cancer and / or liver cancer metastasis.

Another example provides a method of inhibiting cancer therapy and / or cancer metastasis comprising administering a pharmaceutically effective amount of the MAGE-1 specific inhibitor to a patient in need thereof and / or inhibiting cancer metastasis. The method may further comprise identifying a patient in need of cancer treatment and / or cancer metastasis inhibition prior to the administering step.

The above-mentioned abatumer can be equally applied to a composition for diagnosing liver cancer and / or liver cancer metastasis or a method for inhibiting cancer treatment and / or cancer metastasis.

In another aspect, the present invention provides a method of treating a patient, comprising: reacting a biological sample of a patient with the MAGE-1 specific tympanic membrane; Measuring the degree of binding of the platemaker and the MAGE-1 protein in the sample; And determining that the patient is a liver cancer patient when the degree of binding of the squamatum and MAGE-1 protein in the sample is higher than that of the normal sample.

The above-described method can be equally applied to the plummeter.

In addition, the method may further comprise the step of measuring the degree of binding of the MAGE-1 specific platemaker in a normal sample

The patient may be a mammal including a human, preferably a rodent or a human, and refers to an object to judge whether cancer has developed or cancer has metastasized.

The normal sample may be a mammal including a human, preferably a rodent, or a biological sample obtained from a human, which is obtained from a subject who does not have a liver cancer or liver cancer metastasis to be informed of diagnosis.

 The biological sample may be a mammalian organism other than a human, a cell, tissue, blood, body fluids, saliva, etc. isolated from a mammal including a human.

The step of measuring the degree of binding of the MAGE-1 specific platemer in the biological sample can be carried out using a DNA platamer binding assay technique commonly used in the related art. For example, Or a method of labeling a radioactive material or binding biotin to measure fluorescence or radioactive intensity, or imaging and observing the fluorescence or radioactive intensity, but the present invention is not limited thereto.

As described above, when the presence or overexpression of MAGE-1 protein in the sample is confirmed using the platemer, the sensitivity is significantly superior to that of the conventional monoclonal antibody.

Accordingly, one example of the present invention is a fusion protein comprising MAGE-1 (melanoma-associated antigen-1) specifically bound to MAGE-1 (melanoma-associated antigen-1) and modified at position 5 by a hydrophobic functional group to include deoxyuridine -1 specific < / RTI > The hydrophobic functional group may be a benzyl or naphthyl group.

The aptamer may comprise a core sequence of at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 11 to 20, and the nucleotide sequences of SEQ ID NOs: 21 and 22 at the 5'-end, the 3'- Lt; RTI ID = 0.0 > 1, < / RTI > For example, the aptamer may have at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 10.

The aptamer may have a dissociation constant (Kd) value in the range of 0.1 to 20 nM when bound to melanoma-associated antigen-1, and may be characterized by decreasing the expression of the PFKFB4 gene.

In addition, the aptamer may further comprise at least one selected from the group consisting of PEG (polyethylene glycol), inverted deoxythymidine (idT), LNA (Locked Nucleic Acid), 2'-methoxy nucleoside, At least one member selected from the group consisting of a nucleoside, a nucleoside, a cleavage site, a cleavage site, a cleavage site, a cleavage site, a cleavage site, a cleavage site, a cleavage site, a cleavage site,

The aptamer may further comprise a radioactive isotope, a fluorescent molecule, a toxin or a control reagent.

As another example of the present invention, there is provided a pharmaceutical composition for treating liver cancer, preventing hepatoma, or inhibiting hepatoma metastasis, comprising the hepatoma as an active ingredient.

The liver cancer may be hypovascular liver cancer.

As another example of the present invention, there is provided a composition for diagnosing liver cancer or liver cancer metastasis, which comprises the above-mentioned platemaster as an active ingredient.

As another example of the present invention, there is provided a method of treating a patient, comprising: reacting a biological sample of a patient with the MAGE-1 specific platemer; Measuring the degree of binding between the platemaker and MAGE-1 in the sample; And determining that the patient is a liver cancer patient when the degree of binding of the squamatum and MAGE-1 in the sample is higher than that of the normal sample, to provide a method for diagnosing liver cancer or liver cancer metastasis.

The platemater, platemaker core sequence and primer sequence used herein are shown in the following table.

order
number designation order One Bz # 1 (S035-A1-12-M13-20R_D02) ≪ RTI ID = 0.0 > 2 Bz # 2 (S035-A1-13-M13-20R_E02) ≪ RTI ID = 0.0 > 3 Bz # 3 (S035-A1-15-M13-20R_G02) CGAGCGTCCTGCCTTTGn1GGCn1Gn1n1AAn1An1CGn1Gn1n1AAACCGGCn1n1n1AGGGCn1GACn1CACCGACAGCCACCCAG 4 Bz # 4 (S035-A1-18-M13-20R_B03) ≪ 5 Bz # 5 (S035-A1-20-M13-20R_D03) ≪ RTI ID = 0.0 > 6 Nap # 1 (S035-B1-03-M13-20R_C08) ≪ 7 Nap # 2 (S035-B1-06-M13-20R_F08) ≪ RTI ID = 0.0 > 8 Nap # 3 (S035-B1-13-M13-20R_E09) CGAGCGTCCTGCCTTTGCn2GCCGn2GGCGAACn2GGn2GAGAn2GGGn2ACn2GCGGn2n2GGGCCACCGACAGCCACCCAG 9 Nap # 4 (S035-B1-05-M13-20R_E08) CGAGCGTCCTGCCTTTGn2GACn2GCn2CCAGGACn2ACCACCCCAACCGn2GAGn2ACCCAACACCGACAGCCACCCAG 10 Nap # 5 (S035-B1-22-M13-20R_F10) ≪ 11 Bz # 1 core sequence Gt; 12 Bz # 2 core sequence Gt; 13 Bz # 3 core sequence lt; 14 Bz # 4 core sequence Lt; 15 Bz # 5 core sequence gt; 16 Nap # 1 core sequence Gt 17 Nap # 2 core sequence An2ACGGCAn2AAn2n2GGGn2ACn2ACGAn2n2GGCAn2n2GGn2CAAn2n2 18 Nap # 3 core sequence Gt; 19 Nap # 4 core sequence gt; 20 Nap # 5 core sequence An2GCGAn2n2GGGn2ACn2ACCGGn2n2GGAGn2GGn2AAAACGn2GGG 21 Primer CGAGCGTCCTGCCTTTG 22 primer CACCGACAGCCACCCAG

The MAGE-1 specific aptamer of the present invention can be usefully used as an anticancer agent and / or cancer diagnosis by inhibiting adhesion, proliferation, migration, and invasion of liver cancer cells.

FIG. 1 is a schematic illustration of an extracellular digestion process that specifically binds to MAGE-1 protein using SELEX.
2 shows the dissociation constant (Kd) value of the MAGE-1 aptamer discovered after SELEX.
FIG. 3 shows the results of analysis of MAGE-1 expression on liver cell surface in 4 kinds of liver cancer cell lines.
FIG. 4 shows the results of verifying the binding force and selectivity of 10 kinds of MAGE-1 aptamers to liver cancer cell lines.
FIG. 5A is a result of analyzing the binding ability of MAGE-1 aptamer Bz # 1 and Bz # 5 to SNU-3058 and SNU-761 cells.
5B shows the results of analysis of the binding ability of MAGE-1 aptamer Bz # 1 and Bz # 5 to Huh7 and SNU-475 cells.
FIG. 6A shows the results of verifying the inhibitory effect of MAGE-1 aptamer Bz # 1 and Bz # 5 on NU-3058 and SNU-761 liver cancer cell proliferation.
FIG. 6B shows the results of verifying the inhibitory effect of MAGE-1 aptamer Bz # 1 and Bz # 5 on Huh7 and SNU-475 liver cancer cell proliferation.
FIG. 7A shows the results of analysis of signal transduction expression after treatment with MAGE-1 aptamer in SNU-3058 cell line.
FIG. 7B shows the results of analysis of signal transduction expression after treatment with MAGE-1 aptamer in SNU-475 cell line.
Figure 8 shows the result of cDNA microarray analysis after treatment with MAGE-1 aptamer.
FIG. 9 shows the results of verifying the decrease of expression of PFKFB4 gene in SNU-3058 and SNU-475 cell lines when treated with MAGE-1 aptamer # 1.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1. Detection of melanoma associated antigen-1 (MAGE-1) specific binding potamer through SELEX

10 ¹⁴ new BzdU library and NapdU library were synthesized and a new MAGE-1-specific Aptamer with selective binding capacity to MAGE-1 protein was identified using SELEX (Tube Amplification Selection) technique (Fig. 1). The nucleotide sequences of the candidate typing tumors were analyzed by selection and classified into multi-copy, family, and 10 kinds of tympanomas with high binding ability to MAGE-1 were selected. The sequences of the selected platamers are shown in the table below.

SEQ ID NO: Abtamer name order One Bz # 1 (S035-A1-12-M13-20R_D02) ≪ RTI ID = 0.0 > 3 Bz # 2 (S035-A1-13-M13-20R_E02) ≪ RTI ID = 0.0 > 4 Bz # 3 (S035-A1-15-M13-20R_G02) CGAGCGTCCTGCCTTTGn1GGCn1Gn1n1AAn1An1CGn1Gn1n1AAACCGGCn1n1n1AGGGCn1GACn1CACCGACAGCCACCCAG 2 Bz # 4 (S035-A1-18-M13-20R_B03) ≪ 5 Bz # 5 (S035-A1-20-M13-20R_D03) ≪ RTI ID = 0.0 > 6 Nap # 1 (S035-B1-03-M13-20R_C08) ≪ 7 Nap # 2 (S035-B1-06-M13-20R_F08) ≪ RTI ID = 0.0 > 8 Nap # 3 (S035-B1-13-M13-20R_E09) CGAGCGTCCTGCCTTTGCn2GCCGn2GGCGAACn2GGn2GAGAn2GGGn2ACn2GCGGn2n2GGGCCACCGACAGCCACCCAG 9 Nap # 4 (S035-B1-05-M13-20R_E08) CGAGCGTCCTGCCTTTGn2GACn2GCn2CCAGGACn2ACCACCCCAACCGn2GAGn2ACCCAACACCGACAGCCACCCAG 10 Nap # 5 (S035-B1-22-M13-20R_F10) ≪

In Table 1, the base represented by n1 is represented by Formula (1) as a base (BzdU) into which a benzyl group is introduced at the 5-position of the pyrimidine group of the dioxyuridine, and the base represented by the n2 is a deoxyuridine (NapdU) in which a naphthyl group is introduced at the 5-position of the pyrimidine group, and is represented by the following formula (2).

[Chemical Formula 1]

(2)

Example 2 Evaluation of Binding Capacity of Melanoma Associated Antigen-1 (MAGE-1)

The binding force between the squid and the target protein MAGE-1 protein was measured. The amount of MAGE-1 aptamer conjugated to protein by mixing MAGE-1 protein with various concentrations (100, 21, 54, 4.64, 0.999, 0.2154, 0.0464, 0.00999 nM) and mixing radioactivity labeled with radioactive isotope (P32) (MAGE-1), and the radiation intensity of the tympanic membrane combined with the concentration of the target protein (MAGE-1) was analyzed to determine the platelet dissociation constant (Kd).

SEQ ID NO: Abtamer name Bmax (%) Kd (nM) 6 Nap # 1 0.24 0.46 7 Nap # 2 0.40 16.15 8 Nap # 3 0.24 1.48 9 Nap # 4 0.17 0.88 10 Nap # 5 0.28 0.19 One Bz # 1 0.45 0.70 2 Bz # 2 0.59 17.31 3 Bz # 3 0.54 3.14 4 Bz # 4 0.42 5.62 5 Bz # 5 0.23 3.67

As shown in the above results, all of the aptamers selected by SELEX showed excellent binding ability to MAGE-1 protein, and the highest binding MAGE-1 aptamer was Nap # 5 with 0.19 nM (Bmax = 0.2809) Kd values.

Example 3. Evaluation of in vitro potency of melanoma associated antigen-1 (MAGE-1) specific binding platamer

3.1 Expression of melanoma associated antigen-1 (MAGE-1) expression on the surface of liver cancer cell line

SNU-765, SNU-475, SNU-3058, and Huh7, which were established from hepatocarcinoma tissues obtained from hepatocellular carcinoma tissues in liver cancer patients at Seoul National University Hospital, were investigated using immunofluorescence staining Respectively. Specifically, the cultured liver cancer cell line was fixed, treated with MAGE-1 specific binding antibody, and the antibody was fluorescently labeled and observed with a confocal microscope.

The results are shown in FIG. 3. The MAGE-1 overexpression was observed on the surface of the SNU-3058 cell line, and MAGE-1 expression was also observed in the Huh7 and SNU-761 cell lines. The SNU-3058 cell line is a cell line registered in the Korean Cell Line Bank collected from liver cancer tissues obtained from hepatocellular carcinoma in patients with hepatocellular carcinoma, which is different from hypervascularity, which is a characteristic of liver cancer, and MAGE-1 expression level It was predicted that the aptamers of the present invention having particularly high binding affinity for the MAGE-1 protein would be particularly effective for low-vessel liver cancer.

3.2 Determination of the Selective Binding Capacity of Liver Cancer Cells to MAGE-1 by FACS Method

FITC was labeled on the squamometer having the nucleic acid sequence of SEQ ID NO: 23 having the MAGE-1 platamer (10 species) and the scrambled sequence as the control group in Example 1 using the FACS method, and MAGE-1 The binding ability of Huh7, SNU-761, SNU-475, and SNU-3058 of the hepatocellular carcinoma cells confirmed to be expressed to MAGE-1 was confirmed, and the results are shown in Fig. The FACS results for each cell line of Bz # 1, Bz # 5 and control platemer are shown in FIGS. 5A and 5B.

The control pad tamer Bz # 1 Bz # 5 SNU-3058 4.0 34.6 5.0 SNU-761 20.1 88.3 89.5 Huh7 16.5 87.6 87.1 SNU-475 8.3 30.0 14.7

It was confirmed that Bz # 1 exhibited particularly good binding ability even in SNU-761 cells including SNU-3058, which showed relatively low binding capacity for cell lines with low MAGE-1 expression on liver cancer cell surface, but overexpression of MAGE-1 on liver cancer cell surface Thus, it was confirmed that the aptamer of the present invention had an excellent selective binding ability to the MAGE-1 protein.

3.3 Evaluation of inhibitory effect of MAGE-1 aptamer on liver cancer proliferation using MTS assay

The cell viability assay, MTS assay, was used to examine the inhibitory effect of MAGE-1 aptamer # 1, # 5 on liver cancer cell proliferation and the results are shown in FIGS. 6A and 6B. Specifically, in a 96-well plate under normoxia (20% O ₂ and 5% CO ₂ at 37 ° C) and hypoxia (1% O ₂ , 5% CO2, and 94% N ₂ at 37 ° C) Were cultured in a liver cancer cell line, and each platelet sample was treated. After addition of MTS reagent, the absorbance was measured with an ELISA plate reader and the viable cells were quantitatively measured.

The inhibitory effect of MAGE-1 aptamer Bz # 1 on SNU-3058 cell line inhibited hepatoma cell proliferation in normoxia and hypoxia conditions. Were found to be very excellent.

Example 4 Gene Expression by Melanoma Associated Antigen-1 (MAGE-1) Specific Binding Pressure Tumor

4.1 Identification of expression of signaling substance

To investigate the mechanism of inhibition of liver cancer cell proliferation by MAGE-1 aptamer, Western blotting was performed to investigate the effect of MAGE-1 aptamer Bz # 1 and MAGE-1 aptamer Bz # p21, puma, P'Akt, P'erk1 / 2, Casp9, Casp7, and actin.

Specifically, SNU-3058 and SNU-475 cells were cultured under normoxic conditions (20% O ₂ and 5% CO _{2 at} 37 ° C), and then replaced with cell culture medium except for FBS before treatment with an overnight serum starvation Respectively. Cells were harvested and lysed at 0, 24, and 48 hours after treatment with hepatocarcinoma cells after heating for 5 minutes with control platamater, MAGE-1 aptamer Bz # 1 and 40 nM Bz # 5. Cell lysate samples were analyzed by immunoblotting for the expression level of signal transduction materials involved in cancer cell survival such as p21 and puma, and the results are shown in FIGS. 7a and 7b. As can be seen from the results, among the signal transduction substances involved in the known hepatocarcinoma cell proliferation, no substance that clearly changed expression after treatment with MAGE-1 aptamer was found.

4.2 Expression of PFKFB4 gene by cDNA microarray analysis

MAGE-1 aptamer Bz # 1 and MAGE-1 aptamer Bz # 5 cDNA microarray analyzes were performed to confirm the mechanism of action of MAGE-1 aptamer. Specifically, SNU-3058 and SNU-475 cell lines were cultured under normoxic conditions (20% O ₂ and 5% CO ₂ , 37 ° C temperature) and replaced with cell culture medium except FBS before treatment with overnight serum starvation Respectively. Control aptamer, MAGE-1 aptamer Bz # 1 and Bz # 5 40 nM were heated for 5 minutes and then hepatocarcinoma cells were cultured for 48 hours. Total RNA was extracted and purified. Microarray analysis was performed using the Illumina RatRef-12 Expression Bead Chip (Illumina, Inc., San Diego, Calif., USA). Biotin-conjugated cRNA was obtained from total RNA using the Illumina Total Prep RNA Amplification Kit (Ambion, Austin, TX, USA), hybridized to the Illumina RatRef-12 Expression Bead Chip, and then the array was scanned with the Illumina Bead Array Reader Confocal Scanner The results are shown in Fig.

cDNA microarray analysis revealed that the expression of PFKFB4 gene was significantly reduced in the SNU-3058 cell line treated with MAGE-1 aptamer Bz # 1 compared to control aptamer. Specifically, the expression level of PFKFB4 gene in SNU-3058 cell line was decreased to -1.77 fold change when MAGE-1 aptamer # 1 was treated, compared with the control group.

4.3 Expression of PFKFB4 gene by Real-time PCR

The SNT-3058 cell line was treated with the MAGE-1 aptamer Bz # 1 and the scrambled sequence as the control, with the amino acid sequence of SEQ ID NO: 23 using real-time PCR, and the expression level of the PFKFB4 gene was determined Respectively. Specifically, SNU-3058 and SNU-475 cell lines were cultured under normoxic conditions (20% O2 and 5% CO 2 at 37 ° C), and then replaced with cell culture medium except for FBS before the platemaster treatment and overnight serum starvation was performed. Control aptamer, MAGE-1 aptamer Bz # 1 and 40 nM Bz # 5 were heated for 5 minutes and then incubated for 48 hours in liver cancer cells. Total RNA was extracted and purified using Trizol Reagent (Invitrogen, Carlsbad, CA, USA). The cDNA template synthesized by PCR using Taq polymerase (Invitrogen, Carlsbad, Calif., USA) was amplified. PFKB4 gene expression was quantitatively analyzed by real-time PCR (LightCycler; Roche Molecular Biochemicals, Mannheim, Germany). The results are shown in FIG.

As can be seen from the above results, it is confirmed that the expression of PFKFB4 gene is decreased, and it can be predicted that the MAGE-1 specific binding aptamer of the present invention is involved in the action mechanism of PFKFB4 gene to inhibit liver cancer cell proliferation. Specifically, the expression of PFKB4 gene was decreased by about 33% (0.67) in SNU-3058 cell line and decreased by about 41% (0.59) in SNU-475 cell line when MAGE-1 plastomer Bz # 1 was treated.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION          SEOUL NATIONAL UNIVERSITY HOSPITAL <120> MAGE-1 specific aptamer and use thereof <130> DPP20172992KR <150> KR 10-2017-0065470 <151> 2017-05-26 <160> 23 <170> KoPatentin 3.0 <210> 1 <211> 91 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bz # 1 (S035-A1-12-M13-20R_D02) <220> <221> misc_feature <222> (19) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (21) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (24) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (26) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 > (29) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 > (34) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (38) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <43> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 > (51) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <54> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 1 cgagcgtcct gcctttggng nagnangann nnanncgnca aancggcnag nngngaccac 60 cgacagccac ccagcaccga cagccaccca g 91 <210> 2 <211> 73 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bz # 2 (S035-A1-13-M13-20R_E02) <220> <221> misc_feature <222> (19) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (22) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (25) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (29) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 &gt; (32) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 &gt; (36) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (44) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (46) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <51> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (56) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 2 cgagcgtcct gcctttggnc cngcnaaana annagnnagg gagnangccc nggacncacc 60 gacagccacc cag 73 <210> 3 <211> 74 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bz # 3 (S035-A1-15-M13-20R_G02) <220> <221> misc_feature <222> (18) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (22) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (24) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <30> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <33> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 &gt; (35) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 &gt; (45) .. (47) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <53> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <57> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 3 cgagcgtcct gcctttgngg cngnnaanan cgngnnaaac cggcnnnagg gcngacncac 60 cgacagccac ccag 74 <210> 4 <211> 74 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bz # 4 (S035-A1-18-M13-20R_B03) <220> <221> misc_feature <20> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (26) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 &gt; (33) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (37). (38) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <43> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (46) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (49) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <57> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 4 cgagcgtcct gcctttgaan ggggcnaagg ganngcnnaa aangcnggng agacnancac 60 cgacagccac ccag 74 <210> 5 <211> 76 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bz # 5 (S035-A1-20-M13-20R_D03) <220> <221> misc_feature <222> (18). (19) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 &gt; (21) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (25) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (29) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 &gt; (34) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (38) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <40> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 &gt; (43) .. (46) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (48). (49) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <52> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <59> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 5 gncgcccnc accgacagcc acccag 76 <210> 6 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> Nap # 1 (S035-B1-03-M13-20R_C08) <220> <221> misc_feature <222> (24) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (30) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <35> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (38) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (44) .. (45) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (50) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <54> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 6 cgagcgtcct gcctttgaga aggngaggan ngggnacnaa cggnnggacn nggnaaccac 60 cgacagccac ccag 74 <210> 7 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> Nap # 2 (S035-B1-06-M13-20R_F08) <220> <221> misc_feature <222> (19) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature (26) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (29) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <34> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (37) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (42) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (48). (49) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <52> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (56) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 7 cgagcgtcct gcctttgana cggcanaann gggnacnacg annggcanng gncaanncac 60 cgacagccac ccag 74 <210> 8 <211> 74 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Nap # 3 (S035-B1-13-M13-20R_E09) <220> <221> misc_feature <222> (19) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (24) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <32> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <35> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <40> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (44) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <47> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (52) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 8 cgagcgtcct gcctttgcng ccgnggcgaa cnggngagan gggnacngcg gnngggccac 60 cgacagccac ccag 74 <210> 9 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> Nap # 4 (S035-B1-05-M13-20R_E08) <220> <221> misc_feature <222> (18) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature (22) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (25) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <33> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <47> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <51> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 9 cgagcgtcct gcctttgnga cngcnccagg acnaccaccc caaccgngag nacccaacac 60 cgacagccac ccag 74 <210> 10 <211> 74 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Nap # 5 (S035-B1-22-M13-20R_F10) <220> <221> misc_feature <222> (19) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (24) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature (29) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <32> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (38). (39) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (44) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <47> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <54> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 10 cgagcgtcct gcctttgang cganngggna cnaccggnng gagnggnaaa acgngggcac 60 cgacagccac ccag 74 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Bz # 1 core sequence <220> <221> misc_feature <222> (2) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (4) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (7) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (9) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 > (12) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (17). (18) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (21) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (26) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <31> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 > (34) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (37) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 11 gngnagnang annnnanncg ncaaancggc nagnngngac 40 <210> 12 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Bz # 2 core sequence <220> <221> misc_feature <222> (2) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (5) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (8) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <12> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 > (15) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (19) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (27) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (29) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <34> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <39> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 12 gnccngcnaa anaannagnn agggagnang cccnggacn 39 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Bz # 3 core sequence <220> <221> misc_feature <222> (1) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (5) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (7) (8) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (11) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (13) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (16) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (18). (19) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 > (28) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <40> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 13 nggcngnnaa nancgngnna aaccggcnnn agggcngacn 40 <210> 14 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Bz # 4 core sequence <220> <221> misc_feature <222> (3) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (9) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (16). (17) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 > (20) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (26) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature (29) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <32> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (38) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <40> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 14 aanggggcna aggganngcn naaaangcng gngagacnan 40 <210> 15 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Bz # 5 core sequence <220> <221> misc_feature <222> (1) (2) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (4) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (8) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <12> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (17). (18) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (21) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (23) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (26). (29) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature &Lt; 222 &gt; (31) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <35> <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <220> <221> misc_feature <222> (42) <223> BzdU, 5- (N-Benzylaminocarbonylamide) -2'-deoxyuridine <400> 15 nnannagnga angggannag nangannnna nnggncagcc cn 42 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Nap # 1 core sequence <220> <221> misc_feature <222> (7) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (13) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (18) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (21) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (27) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (33) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (37) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 16 agaaggngag ganngggnac naacggnngg acnnggnaac 40 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Nap # 2 core sequence <220> <221> misc_feature <222> (2) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (9) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 > (12) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (17) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <20> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (25) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (31) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <35> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (39) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 17 anacggcana anngggnacn acgannggca nnggncaann 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Nap # 3 core sequence <220> <221> misc_feature <222> (2) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (7) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 > (15) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (18) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (23) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (27) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <30> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (35) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 18 cngccgnggc gaacnggnga gangggnacn gcggnngggc 40 <210> 19 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Nap # 4 core sequence <220> <221> misc_feature <222> (1) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (5) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (8) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (16) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <30> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <34> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 19 ngacngcncc aggacnacca ccccaaccgn gagnacccaa 40 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Nap # 5 core sequence <220> <221> misc_feature <222> (2) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (7) (8) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <12> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (15) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature &Lt; 222 &gt; (21) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (27) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <30> <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <220> <221> misc_feature <222> (37) <223> NapU, 5- (N-naphthylcarboxyamide) -2'-uridine <400> 20 angcganngg gnacnaccgg nnggagnggn aaaacgnggg 40 <210> 21 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer <400> 21 cgagcgtcct gcctttg 17 <210> 22 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer <400> 22 caccgacagc cacccag 17 <210> 23 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> scrambled aptamer <400> 23 agttcaaact ggacgccctc gactcaccca tgctaggatt gaacggacca 50

Claims (13)

MAGE-1-specific tympanic membrane, which specifically binds to MAGE-1 (melanoma-associated antigen-1), and which is substituted with a hydrophobic functional group at position 5 and contains a modified deoxyuridine1e (dU). The abatumer of claim 1, wherein the hydrophobic functional group is a benzyl or naphthyl group. 3. The platemaker according to claim 2, wherein the aptamer comprises a core sequence of at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 11 to SEQ ID NO: 20. 3. The plasmid according to claim 1, further comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 21 and 22 at the 5'-end, the 3'-end or both ends of the core sequence. 2. The platemaker according to claim 1, wherein the aptamer has at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 10. 2. The platemaker according to claim 1, wherein the dissociation constant (Kd) value when bound to the melanoma-associated antigen-1 is in the range of 0.1 to 20 nM. 3. The platemaker according to claim 1, wherein the aptamer reduces the expression of the PFKFB4 gene. 2. The composition of claim 1, wherein the aptamer is selected from the group consisting of PEG (polyethylene glycol), inverted deoxythymidine (ipt), LNA (Locked Nucleic Acid), 2'-methoxy nucleoside, Wherein at least one member selected from the group consisting of '-aminonucleoside, 2'F-nucleoside, amine linker, thiol linker, and cholesterol is further combined and modified. 2. The platemaker of claim 1, wherein the aptamer further comprises a radioactive isotope, a fluorescent molecule, a toxin or a control reagent. 9. A pharmaceutical composition for inhibiting liver cancer, preventing liver cancer or inhibiting liver metastasis, comprising the depressant according to any one of claims 1 to 9 as an active ingredient. 11. The pharmaceutical composition according to claim 10, wherein the liver cancer is hypovascular liver cancer. A composition for diagnosing liver cancer or metastasis of liver cancer, which comprises the platemer according to any one of claims 1 to 9 as an active ingredient. Reacting a biological sample of a patient with a MAGE-1 specific platemer of any one of claims 1 to 5;
Measuring the degree of binding between the platemaker and MAGE-1 in the sample; And
And judging the patient as a liver cancer patient if the degree of binding of the platemaker and MAGE-1 in the sample is higher than that of the normal sample
A method for providing information to a liver cancer or liver cancer metastasis diagnosis.

Images