KR20230103907A - A composition for improving and treating liver-related diseases comprising p-kumaric acid as an active ingredient - Google Patents

Abstract

An object of the present invention is to provide a composition for the improvement and treatment of obesity or liver-related diseases comprising p-coumaric acid as an active ingredient, in order to confirm that p-coumaric acid (PCA) is used to treat liver inflammation or liver fibrosis, A mouse model fed a high fat and high sucrose (HFHS) diet was treated with p-coumaric acid of the present invention. As a result, 1) reduction of total cholesterol and inhibition of free cholesterol accumulation, increase of glucose tolerance and insulin sensitivity, 2) suppression of liver tissue inflammatory genes and proteins, 3) fibrosis-related genes or The effect of inhibiting the protein was confirmed. In addition, the role of p-coumaric acid (PCA) in down-regulating NLRP3 activation and caspase-1 cleavage was first identified, and it is effective in treating liver fibrosis and liver inflammation, so it can be usefully used in related projects.

Description

A composition for improving and treating liver-related diseases comprising p-coumaric acid as an active ingredient {A composition for improving and treating liver-related diseases comprising p-kumaric acid as an active ingredient}

An object of the present invention is to provide a composition for improving and treating liver-related diseases comprising p-coumaric acid as an active ingredient.

Non-alcoholic fatty liver disease (NAFLD), the most common liver disease worldwide, is characterized by abnormal fat accumulation in hepatocytes that is not due to alcohol overload, and approximately 20% of NAFLD patients suffer from chronic inflammation and cellular damage. Accompanying progressive steatosis, non-alcoholic steatohepatitis (NASH), may develop. Additionally, approximately 9-25% of individuals with NASH may develop fibrosis that may develop into cirrhosis or hepatocellular carcinoma. Hepatocytes (HSCs) are the dominant enzymes in the process of hepatic fibrosis, which transform into myofibroblasts upon activation. While HSCs maintain a non-proliferative and quiescent phenotype in the normal liver, HSCs convert to a proliferative, migratory, and fibrotic phenotype in response to liver damage such as chronic exposure to high-fat and sucrose diets. To prevent the progression of hepatic fibrosis, an effective treatment for the management of HSC activation is urgently needed.

NOD-like receptor protein 3 (NLRP3) senses pathogen-associated molecular patterns (PAMPs) or endogenous damage-associated molecular patterns (DAMPs) and activates cleaved caspase-1 (caspase-1) to regulate inflammatory responses. 1) is a multi-protein complex that activates NLRP3 inflammation is activated through two signals. The priming signal (signal 1) is generated by microbial/viral stimuli such as lipopolysaccharide (LPS), and induces activation of NF-γB and regulation of prointerleukin (IL)-1γ levels. The activation signal (Signal 2) is provided by endogenous danger signals such as saturated fatty acids, reactive oxygen species (ROS), or cholesterol crystals, leading to oligomerization of NLRP3 and assembly of inflammasomes, and NLRP3 inflammation activates HSCs. And it suggests that it is directly involved in liver fibrosis. Inflammation-stimulated HSCs showed fibrotic characteristics, but NLRP3-/-HSCs did not. On the other hand, in mice transfected with the HSC-specific NLRP3L351PneoR gene, which is an overactive NLRP3, NLRP3 inflammasome activation markedly increases the number of α-SMA-positive cells in the liver. These results suggest that NLRP3 inflammation is closely related to hepatic fibrosis through HSC activation. However, it is still unclear which types of bioactive compounds with low or no side effects attenuate liver fibrosis through regulation of the NLRP3 inflammasome.

In addition, chronic dietary overload including saturated fat and cholesterol induces excessive influx of chylomicrons and inflammation-mediated lipolysis, increasing circulating free fatty acids and lipotoxicity, and high-fat (HF) diet Together, increased sugar intake has been reported to increase the risk of developing NAFLD via lipogenic transcription factors, which are associated with the development of hepatitis and fibrosis.

4-hydroxycinnamic acid (PCA) is one of the isomers of hydroxycinnamic acid (m-, o-, p-coumaric acid) found in free or conjugated form in plants, peanuts, and mushrooms. Previous reports showed that peanut sprouts inhibited high-fat diet-induced obesity and reversed adipocyte browning loss in response to LPS-induced inflammation. We identified p-coumaric acid (PCA) as the polyphenol most responsible for exerting the metabolic benefits of PS. Recent studies have shown that p-coumaric acid (PCA) has various pharmacological activities, including antioxidant and anticancer agents. Among the many health-promoting effects of p-coumaric acid (PCA), anti-inflammatory action is reported by inhibiting 1) pattern recognition receptors activated by free fatty acids and 2) downstream targets of nuclear factor-KB (NF-γB). .

Therefore, considering that TLR4/NF-γB signaling is one of the key priming steps for NLRP3 inflammatory activation, we found that p-coumaric acid (PCA) was effective against NLRP3 inflammation and additional liver fibrosis in the high fat and high sucrose (HFHS) diet. was found to be effective. To prove this, p-coumaric acid (PCA), an active ingredient of the present invention, was administered to in vivo (HFHS-fed C57BL/6 mice) and in vitro (TGF-β-treated HSC LX-2 cells) models of liver fibrosis. As a result, it was found that liver inflammation and the occurrence of fibrosis were effectively reduced partially through the regulation of NLRP3 inflammation, thereby completing the present invention.

An object of the present invention is p-Coumaric acid, PCA) to provide a pharmaceutical composition for preventing and treating liver fibrosis containing an active ingredient.

In addition, an object of the present invention is p-Coumaric acid, PCA) to provide a food composition for preventing and improving liver fibrosis containing an active ingredient.

In addition, an object of the present invention is p-Coumaric acid, PCA) to provide a pharmaceutical composition for preventing and treating liver inflammation containing an active ingredient.

In addition, an object of the present invention is p-Coumaric acid (p-Coumaric acid, PCA) to provide a food composition for preventing and improving liver inflammation containing an active ingredient.

The present invention p-Coumaric acid (p-Coumaric acid, PCA) provides a pharmaceutical composition for preventing and treating liver fibrosis containing an active ingredient.

In addition, the present invention p-Coumaric acid (p-Coumaric acid, PCA) provides a food composition for preventing and improving liver fibrosis containing an active ingredient.

In addition, the present invention p-Coumaric acid (p-Coumaric acid, PCA) provides a pharmaceutical composition for preventing and treating liver inflammation containing an active ingredient.

In addition, the present invention p- Coumaric acid (p-Coumaric acid, PCA) provides a food composition for preventing and improving liver inflammation containing an active ingredient.

In order to confirm that p-coumaric acid (PCA) treats liver inflammation or liver fibrosis, a mouse model fed a high-fat and high-sucrose sugar (HFHS) diet was treated with p-coumaric acid of the present invention. As a result, 1) reduction of total cholesterol and inhibition of free cholesterol accumulation, increase of glucose tolerance and insulin sensitivity, 2) suppression of liver tissue inflammatory genes and proteins, 3) fibrosis-related genes or The effect of inhibiting the protein was confirmed. In addition, the role of p-coumaric acid (PCA) in down-regulating NLRP3 activation and caspase-1 cleavage was first identified, and it is effective in treating liver fibrosis and liver inflammation, so it can be usefully used in related projects.

1 is a diagram showing the chemical structure of P-coumaric acid (PCA).
Figure 2 is a diagram showing the weight change of the LF group, HFHS group and HFHS + PCA group.
(LF group: LF (low-fat) diet, rats fed a low-fat diet, HF group: HF (high-fat diet, rats fed a high-fat diet, HFHS group: HFHS (high fat and high sucrose, 20% sucrose) ) Rats fed high sucrose drink, HFHS+PCA group: HFHS (high fat and high sucrose) high sucrose drink + PCA ( p -coumaric acid, PCA), 50 mg/kg intraperitoneally injected rats)
Figure 3 is a diagram showing the fasting glucose of the LF group, HFHS group, HFHS + PCA group.
Figure 4 is a diagram showing the liver fasting insulin level of the HFHS group and HFHS + PCA group.
5 is a diagram showing the insulin resistance index (HOMA-IR) of the HFHS group and the HFHS+PCA group.
6 is a diagram showing glucose levels in the glucose tolerance test (GTT) of the LF group, the HFHS group, and the HFHS+PCA group.
Figure 7 is a diagram showing AUG (Area Under Curve) values in the glucose tolerance test (GTT) of the LF group, the HFHS group, and the HFHS+PCA group.
8 is a diagram showing glucose levels in the insulin tolerance test of the LF group, the HFHS group, and the HFHS+PCA group.
9 is a diagram showing glucose disposal rates of the LF group, the HFHS group, and the HFHS+PCA group.
10 is a diagram showing the levels of aspartate transaminase (AST) in the serum of the LF group, the HFHS group, and the HFHS+PCA group.
11 is a diagram showing the levels of alanine transaminase (ALT) in the serum of the LF group, the HFHS group, and the HFHS+PCA group.
12 is a diagram showing the mRNA expression levels of Tlr2 (toll like receptor 2) and Tlr4 (toll like receptor 4) in liver tissues of the HFHS group and the HFHS+PCA group.
13 is a diagram showing inhibition of NF kappa B alpha (IkBα) in the HFHS group and the HFHS+PCA group.
14 is a diagram showing mRNA expression levels of inflammatory genes (Cox2, Cd11c, Il-1β, Tnfα, and Mcp1) in liver tissues of the LF group, the HFHS group, and the HFHS+PCA group.
15 is a diagram showing the expression levels of p-JNK, p-ERK, BiP, and CHOP in liver tissues of the HFHS group and the HFHS+PCA group.
16 is a diagram showing the levels of hepatic malondialdehyde (MDA) in the HFHS group and the HFHS+PCA group.
17 is a diagram showing liver free cholesterol in the LF group, the HFHS muscle group, and the HFHS+PCA group.
18 is a diagram showing IL-1β levels in plasma of the LF group, the HFHS group, and the HFHS+PCA group.
19 is a diagram showing liver tissues of the LF group, the HFHS group, and the HFHS+PCA group stained with Masson's trichrome (20×Magnication).
20 is a diagram showing liver tissues of the LF group, the HFHS group, and the HFHS+PCA group stained with Sirius Red staining (20×Magnication).
21 is a diagram showing the quantitative collagen volume fraction in liver tissues of the LF group, the HFHS group, and the HFHS+PCA group.
22 is a diagram showing the quantitative collagen area of the LF group, the HFHS group, and the HFHS+PCA group by Sirius Red staining.
23 is a diagram showing the mRNA expression level of α-smooth muscle actin (αSMA) in liver tissues of the LF group, the HFHS group, and the HFHS+PCA group.
24 is a diagram showing the expression of α-smooth muscle actin (αSMA) in liver tissues of the HFHS group and the HFHS+PCA group.
(β-actin is used as a loading control)
25 is a diagram showing the mRNA expression levels of Tgfβ, Col1a1, Col1a2, Col3a1, and Col4a1, which are inflammatory genes, and MMP 1 (Timp1), which is a tissue inhibitor, in liver tissues of the HFHS group and the HFHS+PCA group.
26 is a diagram showing mRNA expression of interleukin-6 (Interleukin 6, Il-6), α-smooth muscle actin (α-Sma), Tgfβ, Col1a, and Timp1 when cultured with PCA in LX-2 HSC.
27 is a diagram showing the expression levels of IkBa, α-smooth muscle actin (α-Sma), Collagen I, and GAPDH proteins.
28 is a diagram showing the relative protein expression of IkBα, αSMA and collagen I quantified by Image Lab.
29 is a diagram showing the expression of NLR Family Pyrin Domain Containing 3 (Nlrp3), Il-1β, and Il18 when lipopolysaccharide (LPS)-induced bone marrow-derived macrophages (BMDM) were treated with niacin (Ng).
30 is a diagram showing the expression of NLR Family Pyrin Domain Containing 3 (Nlrp3), Il-1β, and Il18 when palmitate (PA) is treated with lipopolysaccharide (LPS)-derived bone marrow-derived macrophages (BMDM).
31 is a diagram showing the measurement of Il- 1β secretion in bone marrow-derived macrophage BMDMs in a culture medium after inducing inflammation with LPS and then stimulating with Ng.
32 is a diagram showing the protein levels of NLRP3 and Caspase-1 in Ng is LPS-primed BMDM.
33 is a diagram illustrating the measurement of Il- 1β secretion in bone marrow-derived macrophage BMDMs in a culture medium after inducing inflammation with LPS and then stimulating with PA.
34 is a diagram showing the protein levels of NLRP3 and Caspase-1 in PA and LPS-primed BMDM.
35 is a diagram showing that p-coumaric acid (PCA) is related to NLRP3 priming (signal 1) through attenuation and activation (signal 2) of TLR4/NF-γB-related inflammation in the liver.

Hereinafter, the present invention will be described in detail as an embodiment of the present invention with reference to the accompanying drawings. However, the following embodiments are presented as examples of the present invention, and if it is determined that detailed descriptions of well-known techniques or configurations may unnecessarily obscure the gist of the present invention, the detailed descriptions may be omitted. , The present invention is not limited thereby, and the present invention is capable of various modifications and applications within the description of the claims described later and equivalent scopes interpreted therefrom.

In addition, the terms (terminology) used in this specification are terms used to appropriately express preferred embodiments of the present invention, which may vary according to the intention of a user or operator or customs in the field to which the present invention belongs. Therefore, definitions of these terms will have to be made based on the content throughout this specification. Throughout the specification, when a certain component is said to "include", it means that it may further include other components without excluding other components unless otherwise stated.

All technical terms used in the present invention, unless defined otherwise, are used with the same meaning as commonly understood by one of ordinary skill in the art related to the present invention. Also, although preferred methods or feeds are described herein, those similar or equivalent thereto are also included in the scope of the present invention. The contents of all publications incorporated herein by reference are incorporated herein by reference.

As used herein, the term "prevention" refers to all activities that suppress or delay the onset of liver fibrosis or liver inflammation by administering the pharmaceutical composition for preventing or treating liver fibrosis or liver inflammation according to the present invention to a subject. can

As used herein, the term "treatment" may refer to any action that improves or benefits the symptoms of liver fibrosis or liver inflammatory disease by administering the composition of the present invention to a subject suspected of having liver fibrosis or liver inflammation. there is.

As used herein, the term "improvement" may refer to any activity that at least reduces a parameter associated with a condition to be treated, for example, the severity of a symptom.

The present invention p-Coumaric acid (p-Coumaric acid, PCA) provides a pharmaceutical composition for preventing and treating liver fibrosis containing an active ingredient.

In one embodiment, the composition may inhibit the activation of NLRP3 inflammasome (NOD-like receptor protein 3 inflammasome).

Activation of the NLRP3 inflammasome is related to mitogen-activated protein kinase (MAPK) signaling, ROS production, and unfolded protein response (UPR).

In one embodiment, the composition reduces total cholesterol and inhibits accumulation of free cholesterol, but is not limited thereto.

In one embodiment, the composition reduces fasting glucose and insulin resistance index (Homeostatic model assessment for insulin resistance, HOMA-IR), but is not limited thereto.

In one embodiment, the composition improves glucose tolerance and insulin sensitivity, but is not limited thereto.

In one embodiment, the composition reduces aspartate transaminase (AST) and alanine transaminase (ALT), but is not limited thereto.

In one embodiment, the composition reduces Tlr2 (Toll like receptor 2) mRNA expression and Tlr4 (Toll like receptor 4) mRNA expression, but is not limited thereto.

Reduction of the expression of Toll like receptor 4 (Tlr4) mRNA may be inhibiting degradation of IkBa (ihibitor of kappa B).

In one embodiment, the composition reduces liver tissue inflammation-related gene expression, but is not limited thereto.

The liver tissue inflammatory-related genes are target genes of NF-kB, including Cox2, intergrin subunit alpha x (Cd11c), interleukin 1 beta (Il-1β), and Il-6, , but not limited thereto.

In one embodiment, the composition reduces hepatic malondialdehyde (MDA) to reduce endoplasmic reticulum (ER) stress, but is not limited thereto.

In one embodiment, the composition reduces α-SMA (α smooth muscle) gene and protein expression, but is not limited thereto.

In one embodiment, the composition reduces fibrosis-related genes or proteins, but is not limited thereto.

The fibrosis-related gene or protein is transforming growth factor beta (Tgfβ), procollagen type I procollagen type I, a2 (Col1a2), procollagen type III (procollagen type III, a1 ( Col3a1 )) , procollagen type IV (procollagen type IV, a1 (Col4a1)) And it may be a tissue inhibitor of metalloproteinase-1 (Timp1), caspase-1 (caspase-1).

The liver fibrosis is at least one selected from the group consisting of alcoholic cirrhosis, non-alcoholic cirrhosis, Wilson's disease-related cirrhosis, hemochromatosis-related cirrhosis, portal cirrhosis, post-necrotic cirrhosis, nutritional deficiency-related cirrhosis, and cardiac cirrhosis. Not limited.

The liver fibrosis is caused by a high-fat and high-sucrose diet, but is not limited thereto.

The pharmaceutical composition of the present invention may further include an adjuvant in addition to the active ingredient. As long as the adjuvant is known in the art, any one may be used without limitation, but, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase immunity.

The pharmaceutical composition according to the present invention may be prepared in the form of incorporating the active ingredient into a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers usable in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories or sterile injection solutions according to conventional methods, respectively. .

When formulated, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations contain at least one or more excipients such as starch, calcium carbonate, sucrose, lactose, and gelatin in addition to active ingredients. It can be prepared by mixing etc. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to commonly used diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. can Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for suppositories, witepsol, tween 61, cacao paper, laurin paper, glycerogelatin, and the like may be used.

The pharmaceutical composition according to the present invention can be administered to a subject by various routes. All modes of administration are contemplated, eg oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.

The pharmaceutical composition may be formulated into various oral or parenteral dosage forms.

Formulations for oral administration include, for example, tablets, pills, hard and soft capsules, solutions, suspensions, emulsifiers, syrups, granules, etc. chlorose, mannitol, sorbitol, cellulose and/or glycine), lubricants such as silica, talc, stearic acid and magnesium or calcium salts thereof and/or polyethylene glycol. In addition, the tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and in some cases starch, agar, alginic acid or a disintegrant or effervescent mixture, such as its sodium salt, and/or absorbents, colorants, flavors, and sweeteners. The formulation may be prepared by conventional mixing, granulating or coating methods.

In addition, a typical formulation for parenteral administration is an injection formulation, and water, Ringer's solution, isotonic physiological saline or suspension may be used as a solvent for the injection formulation. Sterile fixed oils of the above injectable preparations may be used as a solvent or suspension medium, and any bland fixed oil may be used for this purpose, including mono- and di-glycerides.

In addition, the formulation for injection may use a fatty acid such as oleic acid.

The present invention p-Coumaric acid (p-Coumaric acid, PCA) provides a food composition for preventing and improving liver fibrosis containing an active ingredient.

The food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional food compositions, in addition to containing an extract as an active ingredient.

Examples of the aforementioned natural carbohydrates include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agents described above, natural flavoring agents (thaumatin), stevia extracts (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can advantageously be used. The food composition of the present invention can be formulated in the same way as the pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements, etc. there is

In addition, the food composition, in addition to the active ingredient extract, various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, Alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like may be contained. In addition, the food composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages.

The functional food composition of the present invention can be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills and the like. In the present invention, 'health functional food composition' refers to a food manufactured and processed using raw materials or ingredients having useful functionality for the human body according to Health Functional Food Act No. 6727, and the structure and function of the human body It refers to intake for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological functions. The health functional food of the present invention may contain ordinary food additives, and the suitability as a food additive is determined according to the general rules of the Food Additive Code and General Test Methods approved by the Food and Drug Administration, unless otherwise specified. It is judged according to standards and standards. Examples of the items listed in the 'Food Additive Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, kaoliang pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations. For example, a health functional food in the form of a tablet is obtained by granulating a mixture obtained by mixing the active ingredient of the present invention with an excipient, a binder, a disintegrant, and other additives in a conventional manner, and then adding a lubricant or the like to compression molding, or as described above. The mixture can be directly compression molded. In addition, the health functional food in the form of a tablet may contain a flavoring agent and the like as needed. Among health functional foods in the form of capsules, hard capsules can be prepared by filling a mixture in which the active ingredient of the present invention is mixed with additives such as excipients in a normal hard capsule. It can be prepared by filling the mixture mixed with gelatin in a capsule base. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary. The health functional food in the form of a pill can be prepared by molding a mixture of the active ingredient of the present invention mixed with an excipient, a binder, a disintegrant, etc. by a conventionally known method, and can be coated with sucrose or other coating agent if necessary, Alternatively, the surface may be coated with a material such as starch or talc. Health functional food in the form of granules can be prepared in granular form by a conventionally known method of mixing the active ingredient of the present invention with excipients, binders, disintegrants, etc., and, if necessary, flavoring agents, flavoring agents, etc. can

Throughout this specification, '%' used to indicate the concentration of a particular substance is solid/solid (w/w) %, solid/liquid (w/v) %, and Liquid/liquid is (v/v) %.

The present invention p-Coumaric acid (p-Coumaric acid, PCA) to provide a pharmaceutical composition for preventing and treating liver inflammation-related diseases comprising an active ingredient.

The present invention p-Coumaric acid (p-Coumaric acid, PCA) to provide a food composition for preventing and improving liver inflammation-related diseases containing an active ingredient.

Hereinafter, the present invention will be described in more detail through the following examples. However, the following examples are only examples for easily explaining the content and scope of the technical idea of the present invention, and thereby the technical scope of the present invention is not limited or changed. In addition, based on these examples, it can be easily determined by those skilled in the art that various modifications and changes are possible within the scope of the technical spirit of the present invention.

Example 1. Materials and Methods

Example 1-1. Experiment materials and sample preparation

All cell culture dishes were purchased from SPL Life Sciences (Seoul, Korea) unless otherwise specified. Dulbecco's Modified Eagle's Medium (DMEM) glucose, fetal bovine serum (FBS) and penicillin/streptomycin were purchased from Gibco (Grand Island, NY, USA). All other chemicals and reagents were purchased from Sigma Chemical Co, St. Louis, MO, USA, unless otherwise specified.

p-Coumaric acid (PCA) was purchased from Sigma Chemical Co., St. Louis, MO, USA (FIG. 1). In the present invention, the freshly aliquoted 400 mg/mL PCA stock was diluted with phosphate buffered saline (PBS) before use in animal experiments, and the 200 mM PCA stock was diluted with DMSO (dimethyl sulfoxide) for cell culture.

Example 1-2. animals and diet

All protocols and procedures were approved by the Animal Care Committee of Jeju National University Animal Hospital (approval number 2020-0015). C57BL/6J 6-week-old mice were purchased from the ORIENT BIO Animal Center (Seongnam-si, Korea) and bred in a light/dark cycle at Jeju National University. An animal experiment was prepared to investigate the efficacy of p-coumaric acid (PCA), and C57BL/6 mice were randomly assigned to one of three experimental groups fed different diets after 1 week to adapt to the new environment. (PCA) was administered. Low-fat diet (11% kcal from fat, LF group, n=6) , or high-fat diet (61% kcal from fat, HF), high-sucrose beverage (20% sucrose, HFHS group, n=6) or PCA intraperitoneal ( i.p.) HFHS with injection (HFHS+PCA group, 50 mg/kg BW, n=6) for 13 weeks. The AIN-93G diet was used as the LF control diet and, as previously described, the HF diet consisted of AIN-93G and the general HF group with some changes to the HF diet (60% kcal from fat) (Table 1). Body weight was measured weekly until the 13th week. Food intake and beverage intake were measured three times a week from the 5th week to the end of the experiment.

Dietary composition of low-fat (LF) diet, high-fat (HF) diet Ingredients LF HF g/kg g/kg Casein 200 200 L-Cysteine 3 3 Sucrose 0 69 Corn starch 600 0 Maltodextrin 10 50 125 Lard 10 245 Cholesterol 0 2 Soybean oil 39 39 Cellulose 50 50 Mineral mix 35 35 Calcium phosphate 4 4 Vitamin mix 10 10 Choline bitartrate 2 2 Total 1003 784 kcal (%) kcal (%) Carbohydrates 67.8 19.4 Protein 20.9 19.5 Fat 11.3 61.1 The AIN-93G diet was modified

Example 1-3. Measurement of serum biochemical parameters

After the experiment, the experimental animals were fasted for 12 hours and sacrificed under carbon dioxide anesthesia. Blood was collected by puncture of the heart and serum samples were taken. Serum total cholesterol (TC, mg/dL) and triglyceride (TG, mg/dL) levels were measured using an enzyme assay kit (Asan Pharmaceutical, Seoul, Korea) following the manufacturing protocol for absorbance at 550 nm and 500 nm, respectively. were analyzed repeatedly. Serum aspartate aminotransferase (AST, IU/L) or serum alanine aminotransferase (ALT, IU/L) was performed at 505 nm absorbance using a protocol (Asan Pharmaceutical, Seoul, Korea). EZ-HDL, LDL/VLDL Assay Kit (Dogen Bio Co. , Ltd., Seoul, Korea). Quantitative insulin in mouse serum was measured with an ultra-sensitive mouse insulin ELISA kit according to the manufacturer's protocol (Crystal Chem, Elk Grove Village, IL 60007, USA). Plasma IL-1β was measured according to the protocol of the Mouse IL-1 beta/IL-1F2 quantikine ELISA Kit (MLB00C, R&D Systems, Inc., Minneapolis, MN 55413, USA).

Example 1-4. Glucose and insulin tolerance test

For glucose tolerance test (GTT) and insulin tolerance test (ITT), mice were fasted (12 h) and intraperitoneally injected with 10% D-glucose solution (0.5 g/kg BW) or insulin (0.75 mU/kg BW). did The blood glucose meter was measured using a medium blood glucose analyzer (Medium Blood Glucose Analyzer, Kia Ace Co., Ltd., Gyeonggi-do, Korea) before injection and 15 minutes, 30 minutes, 60 minutes, and 120 minutes after injection. Homeostasis model estimates for insulin resistance (HOMA-IR) were measured as [(fasting plasma glucose) x (fasting plasma insulin)]/22.5 (mmol/L).

Example 1-5. Tissue preparation and histological examination of liver fibrosis

Adipose tissue and liver tissue were collected at necropsy of mice and flash-fixed in 10% buffered formalin. 5-7 μm sections of paraffin-embedded adipose tissue were cut according to the prior art [Seo SH, Int J Environ Res Public Health,. 2021;18] hematoxylin and eosin (H&E) staining. As described above, bright field images were imaged with an Invitrogen Microscope (Invitrogen™ EVOS™ FL Digital Inverted Fluorescence Microscope, Invitrogen, CA, USA) at 10X magnification, and H&E-stained sections of epididymal adipose tissue were imaged according to the previous literature [Seo SH, Int J Environ Res Public Health,. 2021;18] protocol was used for sizing.

In addition, adipocyte size was investigated by Image J software (NIH, USA). Liver tissues were dissected from mice and immediately fixed in 10% buffered formalin. Tissues were fixed in paraffin, sectioned at 4 μm thickness and stained with Masson's trichrome stain for the detection of collagen fibers. All imaging of the slides was performed using a LEICA DM 2500 microscope (Leica Microsystems, Wetzlar, Germany). Blue-stained collagen deposition over the entire tissue area reflecting liver fibrosis was calculated as a percentage by MIPAR software (MIPARTM, Worthington, OH, USA). Paraffin-embedded liver tissue was also stained with Sirius red stain. Images were taken at 20X magnification using a LEICA DM 2500 microscope (Leica Microsystems, Wetzlar, Germany) and liver collagen was quantified with ImageJ software.

Example 1-6. liver lipid accumulation

Total liver lipids were extracted from 200 mg of liver tissue in methanol/chloroform (1:2 volume for volume [v/v]). Samples were then incubated at 60 °C for 3 hours followed by overnight incubation at room temperature. The next day, the obtained extract was filtered using Whatman® filter paper. The sample was washed several times with chloroform and the mixture was dried at room temperature. After that, the obtained sample was resuspended in deionized water. To measure the contents of TG and TC in the liver, TG and TC (Asan Pharmaceutical Co., Seoul, Korea) enzyme assay kits were used for absorbance at 550 nm and 500 nm, respectively. Liver free cholesterol was measured according to the protocol of a cholesterol assay kit (ab65390, Abcam, Cambridge, MA, USA) with fluorescence at 535 nm excitation and emission at 587 nm.

Example 1-7. Liver oxidative stress measurement

For the measurement of hepatic oxidative stress, malondialdehyde (MDA) is one of the most common consequences of lipid peroxidation measured. Briefly, total liver protein was isolated from 25 mg of liver tissue in RIPA buffer containing protease and phosphatase inhibitors. The MDA procedure followed the protocol of the TBARS assay kit (Item No. 10009055, Cayman Chemical, Ann Arbor, MI, USA).

Example 1-8. Cell culture and processing

LX-2 human hepatic stellate cell line was purchased from Sigma (St. Louis, MO, USA). LX-2 cells were cultured in 2% FBS, DMEM (1000 mg/L D-glucose, L-glutamine, 110 mg/L sodium pyruvate, 100 units/mL penicillin and 100 g/mL streptomycin) basal medium. LX-2 cells were seeded at 1.2 x 10 ⁶ cells cm ⁻² in 35 mm culture plates and pre-incubated with 1000X DMSO (vehicle) or 200 μM PCA for 48 hours. After 48 hours, LX-2 cells were starved for 2 hours in DMEM with or without 200 μM PCA. Then, LX-2 cells with or without 200 μM PCA for 24 hours were stimulated with 5ng/mL TGFβ for 24 hours. Protein, RNA and media were collected at the end of the experiment.

Primary bone marrow cells were isolated from the femurs of C57BL/6 mice and stimulated to differentiate for 7-10 days in L-cell conditioned media (CM) as previously described. Differentiated bone marrow-derived macrophages (BMDM) were pretreated with 200 μM PCA or vehicle (1000X DMSO) for 24 hours, then primed with lipopolysaccharide (LPS) (100 ng/ml) for 1 hour and nigericin (Ng; 6.5 μM, K+/H+ ionophore) or 12 h or palmitate (PA; 400 μM complexed with BSA).

Example 1-9. mRNA analysis by real-time polymerase chain reaction (real-time PCR)

Gene expression levels were measured using real-time PCR. RNA was extracted from 0.2 g of liver rapidly stored in a freezer using Trizol reagent (Invitrogen Co., Carlsbad, CA, USA). After measuring the concentration of extracted RNA using a nanodrop (Nano-200 Micro-Spectrophotometer, Hangzhou City, China), cDNA was synthesized using a high-capacity cDNA reverse transcription kit (Applied Biosystem, USA). Gene expression was measured by Real-Time PCR (CFX96™ Real-Time PCR Detection System, Bio-Rad, USA) at Jeju National University Bio-Health Materials Core-Facility. All primer sequences are shown in Table 2 below. Relative gene expression was normalized ribosomal protein lateral stem subunit P0 (RPLP0, 36B4), β actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or hypoxanthine-guanine phosphoribosyltransferase (HPRT) (Cosmo Genetec).

Primer sequences for real-time PCR Gene Forward Reverse mAcc TGGACAGACTGATCGCAGAGAAAG TGGAGAGCCCCACACACA mCd11c CTGGATAGCCTTTCTTCTGCTG GCACACTGTGTCCGAACTC mCol1a1 CAAGAACAGCAACGAGTACCG GTCACTGGTCAACTCCAGCAC mCol1a2 GTAACTTCGTGCCTAGCAACA CCTTGTCAGAATACTGAGCAGC mCol3a1 CAGGTCCTAGAGGAAACAGA TCACCTCCAACTCCAGCAATG mCol4a1 CTGGCACAAAAGGGACGAG ACGTGGCCGAGAATTTCACC mCox2 AAAGGTTCTTCTACGGAGAGAGTTCA TGGGCAAAGAATGCAAACATC mDgat2 CCGCAAAGGCTTGTGAAG GGAATAAGTGGGAACCAGATCA mIL-18 GACAGCCTGTGTTCGAGGAT TGGATCCATTTCCTCAAAGG mIL-1β AAATACCTGTGGCCTGGGC CTTGGGATCCACACTCTCCAG mLpl CATCTCATTCCTGGATTAGCAGAC CCGATACAACCAGTCTACTACAATG mMcp1 AGGTCCCTGTCATGCTTCTG GCTGCTGGTGATCCTCTTGT mNlrp3 ATGCTGCTTCGACATCTCCT AACCAATGCGAGATCCTGAC mScd1 GGGACAGATATGGTGTGAAACTATG TTACAGACACTGCCCCTCAAC mSrebp1c GTGAGCCTGACAAGCAATCA GGTGCCTACAGAGAGCAAGAGG mTgfβ TTGCCCTCTACAACCAACACAA GGCTTGCGACCCACGTAGTA mTimp1 GATATGCCCACAAGTCCCAGAACC GCACACCCCACAGCCAGCACTAT mTnfα GGCTGCCCCGACTACGT ACTTTCTCCTGGTATGAGATAGCAAAT mTlr2 CAAACTGGAGACTCTGGAAGC GCACCTACGAGCAAGATCAACA mTlr4 AGTGGGTCAAGGAACAGAAGCA CTTACCAGCTCATTTCTCACC m36B4 GGATCTGCTGCATCTGCTTG GGCGACCTGGAAGTCCAACT mβ-actin GATTACTGCTCTGGCTCCTAGC ACTCATCGTACTCCTGCTTGCT hCol1a CCCTGGAAAGAATGGAGATGAT ACTGAAACCTCTGTGTCCCTTCA hIl-6 CTTCTCCACAAGCGCCTTC CAGGCAACACCAGGAGCA hTgfβ CAACAATTCCTGGCGATACC GAACCCGTTGATGTCCACTT hTipm1 GGGGACACCAGAAGTCAACC GGGTGTAGACGAACCGGATG haSma TGGCCGAGATCTCACTGACTA CTTCTCAAGGGAGGATGAGGA h36B4 GAAGGCTGTGGTGCTGATG GTGAGGTCCTCCTTGGTGAA

Example 1-10. Protein isolation and western blotting

Tissue samples taken were homogenized in radioimmunoprecipitation assay (RIPA) lysis buffer (Thermo Fisher Scientific, MA, USA) with protease and phosphatase inhibitor cocktail (Sigma, St.Louis, MO, USA). The supernatant was collected by homogenization and centrifugation. 10-12 μg of protein was separated using 10% SDS-PAGE, transferred to a polyvinylidene difluoride (PVDF) membrane (Thermo Fisher Scientific, MA, USA) with Trisbuffered saline/Tween 20, and blocked for 1 hour at room temperature. .

-actin, GAPDH, phosphor 또는 total of extracellular signal-regulated kinases (ERK), stress-activated protein kinase/Jun-amino-terminal kinase (SAPK/JNK), 및 p38 (Cell signaling Technology, Danvers, MA, USA). Anti-alpha smooth muscle Actin (αSMA), anti-Collagen I (Collagen I) (Abcam, Cambridge, MA, USA), 및 human/mouse NLRP3/NALP3 antibody (NLRP3) (R&D Systems, Inc., Minneapolis, MN 55413, USA) 들을 사용 하였다. 다음날, 막은 1X TBST로 여러 번 세척한 후 2차 항체, 염소 항토끼, 항랫트 IgG, HRP 연결 항체(Cell signaling Technology, Danvers, MA, USA), 염소 항쥐 IgG-HRP(Santa Cruz biotechnology, CA, USA)로 1시간 동안 배양 하였다. 막은 세척 후, 강화된 화학 발광(ECL) 시약(PerkinElmer, Waltham, MA, USA)과 반응했다. 밴드를 식별하기 위해 ChemiDoc(Bio-Rad, CA, USA, at Bio-Health Materials Core-Facility at Jeju National University)을 사용하고 ImageLab(Bio-Rad, CA, USA) 또는 ImageJ(NIH, MD, USA)를 사용하여 표현 수준을 계산하였다.After washing several times using a 20 (TBST) solution with Tris-Buffered Saline (TBS) buffered saline, the cells were reacted overnight with a primary antibody against Caspase-1 at 4°C. Kappa light polypeptide gene enhancer of B-cell inhibitor, alpha (IkBα), Binding immunoglobulin protein (BiP), C/EBP homologous protein (CHOP),

-actin, GAPDH, phosphor or total of extracellular signal-regulated kinases (ERK), stress-activated protein kinase/Jun-amino-terminal kinase (SAPK/JNK), and p38 (Cell signaling Technology, Danvers, MA, USA). Anti-alpha smooth muscle Actin (αSMA), anti-Collagen I (Collagen I) (Abcam, Cambridge, MA, USA), and human/mouse NLRP3/NALP3 antibody (NLRP3) (R&D Systems, Inc., Minneapolis, MN 55413 , USA) were used. The next day, the membrane was washed several times with 1X TBST, followed by secondary antibody, goat anti-rabbit, anti-rat IgG, HRP-linked antibody (Cell signaling Technology, Danvers, MA, USA), goat anti-mouse IgG-HRP (Santa Cruz biotechnology, CA, USA). USA) for 1 hour. After washing, the membrane was reacted with enhanced chemiluminescence (ECL) reagent (PerkinElmer, Waltham, MA, USA). To identify bands, ChemiDoc (Bio-Rad, CA, USA, at Bio-Health Materials Core-Facility at Jeju National University) was used and ImageLab (Bio-Rad, CA, USA) or ImageJ (NIH, MD, USA) was used. was used to calculate the expression level.

Example 1-11. statistical analysis

Experimental results were expressed as mean ± standard error of the mean (SEM). Statistical calculations were performed using ANOVA (one-way analysis of variance) with Bonferroni's multiple comparison test or student's t -test. A p-value <0.05 was considered statistically significant. All analyzes were performed with GraphPad Prism 8.02.263 (La Jolla, California., USA).

Example 2. Invention p-Coumaric acid (p-Coumaric acid, Improvement of abnormal glucose metabolism in PCA)

In C57BL/6 mice fed a PCA (50 mg/kg BW) and high-sucrose sugar drink (HFHS) diet together with a low-fat (LF) control group, changes were confirmed during diet/drink intake.

The HFHS group became obese, and body weight, weight gain, and liver and epididymal fat weight increased compared to the LF group (Fig. 2, Table 3). It was confirmed that the total cholesterol (TC) level was lower than that of the HFHS group without a change in food and beverage intake in the HFHS + PCA group (Table 3).

In addition, to confirm that the p-coumaric acid (PCA) of the present invention improves glucose metabolism, the HFHS group continued to consume the diet for 13 weeks, resulting in a significant increase in fasting glucose, while the HFHS + PCA group continued to consume the diet As a result, fasting glucose was reduced (Fig. 3). There was no difference in fasting insulin levels between the HFHS group and the HFHS + PCA group (FIG. 4), and the HFHS + PCA group showed a higher insulin resistance index than the HFHS group (Homeostatic model assessment for insulin resistance, HOMA-IR) (γ50%, p=0.06 ) was confirmed to decrease (FIG. 5).

In addition, in order to confirm that the p-coumaric acid (PCA) of the present invention improves insulin sensitivity, as a result of the glucose tolerance test (GTT) and insulin tolerance test (ITT) of the HFHS group and the HFHS + PCA group, the glucose tolerance test In the test (GTT), it was confirmed that the glucose disposal rate of the HFHS+PCA group was faster than that of the HFHS alone group (FIGS. 6 and 7). Consistently, the HFHS + PCA group showed a low glucose level, and it was confirmed that the glucose loss rate (kITT) was similar between the HFHS group and the LF group (FIGS. 8 and 9).

As a result, it was confirmed that p-coumaric acid (PCA) reduced total cholesterol (TC) levels and improved glucose tolerance and insulin sensitivity.

Example 3. p-coumaric acid (PCA) of the present invention confirms liver damage improvement effect

In order to confirm that the p-coumaric acid (PCA) of the present invention improves liver damage, aspartate transaminase (AST) and alanine transaminase, which are well-known biomarkers for determining the severity of liver damage The effect of PCA was confirmed through the level of alanine transaminase (ALT).

As a result, the HFHS group had higher serum aspartate transaminase (AST) and alanine transaminase (ALT) levels than the LF group, and the HFHS+PCA group showed higher levels of aspartate transaminase (AST) and alanine transaminase (ALT) than the HFHS group. It was confirmed that the levels of aspartate transaminase (AST) and alanine transaminase (ALT) were low (FIGS. 10 and 11).

Therefore, as shown in Figures 10 and 11, it was confirmed that the AST and ALT levels were reduced in the HFHS + PCA group compared to the HFHS group, and p-coumaric acid (PCA) of the present invention improved liver damage It was confirmed .

Characteristic of diet intake and metabolic parameters Group LF HFHS HFHS+PCA p-value Diet intake Food intake (g/mouse/day) 5.69± ^1.19b 2.38±0.57 ^a 2.26±0.43 ^a <0.01 Drink intake (g/mouse/day) 9.13±1.89 8.95±2.70 n.s. Total kcal intake (kcal/mouse/day) 22.08±4.60 19.83±4.17 18.57±3.78 n.s. Blood Chemistry Total Cholesterol (mg/dL) 91.28±4.70 130.64±18.28 99.14±12.58 n.s. LDL/VLDL (mg/dL) 0.71±0.23 0.67±0.14 0.64±0.17 n.s. * Values are mean ±SEM All groups n= 6/group.

Example 4. PCA inhibits TLR4/NFB, ER and oxidative stress, thereby inhibiting NLRP3 inflammasome priming and activation.

To confirm that p-coumaric acid (PCA) inhibits inflammation by HFHS diet in the liver containing NLRP3 inflammasome, p-coumaric acid (PCA) treatment inhibited Tlr2 (Toll like receptor 2) expression was reduced, and Tlr4 (Toll like receptor 4) expression was significantly reduced (FIG. 12).

According to the reduced Tlr4 mRNA level, IkBα degradation was significantly inhibited by p-coumaric acid (PCA) treatment (FIG. 13), and Cox2, an inflammatory-related gene in liver tissue, integrin subunit alpha x , Cd11c), and interleukin 1 beta (Il-1β), it was confirmed that the mRNA expression of NF-γB target genes was reduced (FIG. 14).

In addition, in addition to the TLR4/NFbB signaling axis, p-coumaric acid (PCA) is involved in mitogen-activated protein kinase (MAPK) signaling, ROS production and unfolded protein involved in NLRP3 inflammatory activation in the liver. The unfolded protein response (UPR) was confirmed as an interaction between different signaling pathways.

It was confirmed that the protein levels of ERK and JNK phosphorylation decreased in the liver of the HFHS+PCA group, and there was no difference in the level of phosphorylated p38 (FIG. 15). In addition, it was confirmed that the protein expression of BiP and CHAP in the liver of the HFHS+PCA group was lower than that of BiiP and CHAP in the liver of the HFHS group (FIG. 15).

Since endoplasmic reticulum (ER) stress can induce oxidative damage, to determine whether p-coumaric acid (PCA) of the present invention inhibits HFHS diet-induced oxidative stress in the liver, MDA was used as an endpoint marker of tissue oxidative stress. was used as the measured lipid peroxidation product, and was significantly reduced in the p-coumaric acid (PCA) treated HFHS + PCA group compared to the HFHS group (FIG. 16).

Free cholesterol accumulation in the liver plays an important role in accelerating liver fibrosis by hepatocytes and hematopoietic stem cells (HSCs). Treatment with p-coumaric acid (PCA) significantly inhibited the accumulation of free cholesterol induced in the liver of the HFHS group (FIG. 17), and the plasma level of IL-1β was significantly higher in the HFHS group compared to the LF group (~4.3 times). ). In parallel with the decrease in NLRP3 priming signal by p-coumaric acid (PCA), the plasma IL-1β level was about 3.1 times lower in the combined treatment with p-coumaric acid (PCA) than in the HFHS group (FIG. 18).

Thus, different pathways in which p-coumaric acid (PCA) not only inhibits hepatic inflammation depending on priming signals (TLR4/NFbB axis) but also promotes NLRP3 assemblies (i.e., oxidative stress, cholesterol and ER stress) on a chronic HFHS diet. also suggests that it is attenuated.

Example 5. PCA Alleviates HFHS-Mediated Liver Fibrosis in the Liver and Improves Fibrosis Characteristics in Hepatic Stellate LX-2 Cells Stimulated with TGFβ

To confirm PCA treatment for the development of liver fibrosis, liver tissue was stained using Masson's trichrome and Sirius red to visualize collagen accumulation in blue and red, respectively. In the HFHS group fed the HFHS diet for 13 weeks, the collagen volume fraction was worse than that of the LF group, and the collagen volume fraction was reduced by p-coumaric acid (PCA) (FIGS. 19 and 21). Consistently, histological examination of collagen accumulation by Sirius red staining showed excessive deposition of collagen fibers in the HFHS group, which, similar to the LF group, was prevented by p-coumaric acid (PCA) treatment. It was confirmed that it was (FIGS. 20 and 22). In addition, the upregulated αSMA gene and protein expression by the HFHS diet was significantly reduced by p-coumaric acid (PCA) ( FIGS. 23 and 24 ).

p-coumaric acid (PCA) is an HFHS diet-mediated induced fibrosis-related gene, transforming growth factor beta (Tgfβ), procollagen type I (procollagen type I, a2, Col1a2), procollagen type III, a1, (Col3a1), procollagen type IV, a1 (Col4a1) and tissue inhibitor of metalloproteinase-1, Timp1 Expression was normalized (FIG. 25).

To confirm the inhibitory efficacy of p-coumaric acid (PCA) on liver fibrosis in vitro, TGFβ (5 ng/mL) was treated with LX-2 as TGFβ acts as a central mediator in activating HSCs into myofibroblasts during fibrogenesis. Fibrogenesis was performed by treating HSC cells. It was confirmed that p-coumaric acid (PCA) reduced TGFβ-induced inflammation and fibrosis through the downregulation of the inflammatory marker Il-6 and the expression of fibrosis-related genes such as α-Sma, Tgfβ, Col1a, and Timp1 in LX-2 HSC ( Figure 26).

In addition, PCA treatment inhibited TGFβ-induced IkBα degradation, a signal for reduced NFκ activation and collagen I protein expression, in LX-2 hepatic stellate cells.

In addition, it was confirmed that there was no significant change in α-SMA protein expression between the single TGFβ group and the TGFβ+PCA group in LX-2 HSC (FIGS. 27 and 28).

These results indicate that TGFβ was incorporated in vitro in induced LX-2 HSCs, and p-coumaric acid (PCA) alleviated liver fibrosis in the HFHS-fed HFHS group in the liver and in TGFβ-stimulated LX-2 cells. Fibrosis characteristics were improved.

Example 6. PCA inhibits NLRP3 inflammasome activation in LPS-primed bone marrow-derived macrophages.

To further confirm the role of PCA in NLRP3 inflammasome regulation, LPS-primed BMDMs were used and stimulated with nigericin (Ng) or palmitate (PA).

Upon LPS+Ng treatment, p-coumaric acid (PCA) treatment significantly reduced the mRNA levels of Nlrp3, Il-1β and Il18 and the secretion of IL-1β into the medium (FIGS. 29 and 31). Similar to these results, caspase-1 cleavage and secretion to the medium were significantly reduced by p-coumaric acid (PCA) treatment (FIG. 32). In addition, it was confirmed that PCA treatment greatly suppressed the mRNA levels of Nlrp3, Il-1β, Il-18, IL-1β secretion, and caspase-1 in LPS + PA-treated BMDM cells (FIG. 30, FIG. 33, FIG. 34 ).

These data suggest that the observed improvement in liver inflammation/stress and fibrosis by p-coumaric acid (PCA) may be related to inhibition of NLRP3 inflammasome activation.

Accordingly, p-coumaric acid (PCA) inhibited nisericin (Ng) and palmitate (PA)-induced NLRP3 inflammation in lipopolysaccharide (LPS)-induced bone marrow-derived macrophages (BMDM).

In conclusion, the p-coumaric acid (PCA) of the present invention identified the mechanism related to NLRP3-induced fibrosis and its inflammation. To determine if p-coumaric acid (PCA) inhibits hepatic fibrosis through reduction of the NLRP3 inflammasome, a chronically excessive diet containing saturated fat and cholesterol induces excessive influx of chylomicrons and inflammation-mediated lipolysis. thus increasing circulating free fatty acids and lipotoxicity. In addition, increased sugar intake, along with a high-fat (HF) diet, has been reported to increase the risk of developing NAFLD via lipogenic transcription factors, which are associated with the development of hepatitis and fibrosis.

NLRP3 inflammatory cells have been reported to be involved in HSC activation, a key feature of hepatic fibrosis, and consequently alter matrix degradation and inflammatory signal transduction in the liver.

Accordingly, p-coumaric acid (PCA) of the present invention contributes to both NLRP3 priming (signal 1) through attenuation and activation of liver TLR4/NF-γB-related inflammation (signal 2), thereby reducing liver fibrosis/HSC activation in the HFHS group. As a result, it was confirmed that the maturation of case-1 and IL-1 was lowered.

Therefore, p-coumaric acid (PCA) of the present invention has the effect of reducing liver fibrosis induced by the HFHS diet by alleviating the NLRP3 inflammasome (FIG. 35).

As described above, the specific embodiments of the present invention have been described in detail, but those skilled in the art who understand the spirit of the present invention may add, change, delete, etc. other components within the scope of the same idea, and other degenerate inventions. However, other embodiments included within the scope of the present invention can be easily suggested. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting. The scope of the present invention is indicated by the claims to be described later rather than the above detailed description, and all changes or modifications derived from the meaning and scope of the claims and equivalent concepts thereof are included in the scope of the present invention. should be interpreted as

Claims (20)

p-Coumaric acid, A pharmaceutical composition for preventing and treating liver fibrosis comprising PCA) as an active ingredient. According to claim 1,
The composition is to inhibit the activation of NLRP3 inflammasome (NOD-like receptor protein 3 inflammasome), the composition. According to claim 2,
Activation of the NLRP3 inflammasome is related to mitogen-activated protein kinase (MAPK) signaling, ROS production, and unfolded protein response (UPR) , composition. According to claim 1,
The composition is to inhibit the accumulation of total cholesterol (Total Cholesterol) reduction and free cholesterol (free cholesterol), the composition. According to claim 1,
Wherein the composition reduces fasting glucose and insulin resistance index (Homeostatic model assessment for insulin resistance, HOMA-IR). According to claim 1,
Wherein the composition improves glucose tolerance and insulin sensitivity. According to claim 1,
Wherein the composition reduces aspartate transaminase (AST) and alanine transaminase (ALT). According to claim 1,
The composition is to reduce the expression of Tlr2 (Toll like receptor 2) mRNA and Tlr4 (Toll like receptor 4) mRNA expression, the composition. According to claim 8,
The decrease in the expression of Toll like receptor 4 (Tlr4) mRNA inhibits IkBa (ihibitor of kappa B) degradation, the composition. According to claim 1,
Wherein the composition reduces liver tissue inflammation-related gene expression. According to claim 10,
The liver tissue inflammatory-related genes are target genes of NF-kB, including Cox2, intergrin subunit alpha x (Cd11c), interleukin 1 beta (Il-1β), and Il-6 phosphorus, composition. According to claim 1,
The composition is to reduce hepatic malondialdehyde (Hepatic malondialdehyde, MDA) to reduce endoplasmic reticulum (ER) stress, the composition. According to claim 1,
The composition is to reduce the gene and protein expression of α-SMA (α smooth muscle), the composition. According to claim 1,
Wherein the composition reduces fibrosis-related genes or proteins. According to claim 14,
The fibrosis-related gene or protein is transforming growth factor beta (Tgfβ), procollagen type I procollagen type I, a2 (Col1a2), procollagen type III (procollagen type III, a1 (Col3a1)), procollagen type IV (procollagen type IV, a1 (Col4a1)) And metalloproteinase-1 tissue inhibitor (tissue inhibitor of metalloproteinase-1, Timp1), caspase-1 (caspase-1) of the composition. According to claim 1,
The liver fibrosis is at least one selected from the group consisting of alcoholic cirrhosis, non-alcoholic cirrhosis, Wilson's disease-related cirrhosis, hemochromatosis-related cirrhosis, portal cirrhosis, post-necrotic cirrhosis, nutritional deficiency-related cirrhosis, and cardiac cirrhosis, composition. According to claim 16
Wherein the liver fibrosis is caused by a high-fat and high-sucrose diet. p-Coumaric acid, A food composition for preventing and improving liver fibrosis comprising PCA) as an active ingredient. p-Coumaric acid, A pharmaceutical composition for the prevention and treatment of liver inflammation-related diseases comprising PCA) as an active ingredient. p-Coumaric acid, A food composition for preventing and improving liver inflammation-related diseases comprising PCA) as an active ingredient.

Images