KR20230072377A - Multi-target detection method in single cell based on rolling circle amplification - Google Patents

Abstract

One aspect relates to a method for detecting multiple targets in a single cell based on rolling circle amplification. According to the method according to one aspect, a complementary sequence of padlock DNA bound to an antibody to the target protein to which oligonucleic acid is bound to a target protein is amplified through rolling circle amplification, and the padlock bound to the target nucleic acid is amplified. It was confirmed that simultaneous analysis of target protein and target nucleic acid is possible by amplifying the complementary sequence of (padlock) DNA. In addition, the method binds a fluorescent probe to which an oligonucleic acid is linked to a complementary sequence of amplified padlock DNA, and the ratio of fluorescence intensity of the amplified product varies according to the ratio of the fluorescent probe to cell surface protein. And it was confirmed that multiple detection of the target nucleic acid inside the cell is possible. Furthermore, as it was confirmed that multiplex detection of multiple target proteins and target nucleic acids is possible through one-time rolling circle amplification in a single cell, the method can contribute to the molecular diagnostics market/industry.

Description

Multi-target detection method in single cell based on rolling circle amplification}

It relates to a method for detecting multiple targets in a single cell based on rolling circle amplification.

Existing single cell analysis consists of three types: flow cytometry for cell immunophenotyping, single cell RNA sequencing to analyze cell transcripts, and fluorescence microscopy through fluorescence in situ hybridization (FISH). Several methods have been developed and used. Fluorescent-antibody complexes used in flow cytometry cannot analyze single antigens/antibodies due to weak fluorescence intensity, so the average fluorescence intensity of antigen/antibody complexes stained across the cell surface is measured. analysis is impossible. Single-cell RNA sequencing technology is capable of multiple analysis of the genome in a single cell, but it requires sequencing equipment and has limitations in that it needs to separate into single cells and then break the cells to analyze the transcripts inside the cells. FISH technology is a method of obtaining information on the spatial location of proteins and genomes of cells in the cell's original environment. It is analyzed in fixed cells, and target nucleic acids are detected by hybridizing target nucleic acids and complementary fluorescent-DNA complexes. However, there are limitations in that only a small number of target nucleic acids can be detected at the same time, and sensitivity is reduced due to high background signal.

Recently, rolling circle amplification (RCA) has been used in various research fields. Because nucleic acids are amplified on a linear function scale under isothermal (37°C) conditions, thermal cycling of traditional PCR (Polymerase chain reaction) and expensive temperature control equipment are not required. Since detection is performed after amplification, information on the spatial location of the target molecule can also be obtained. In addition, conventional fluorescence-antibody complexes cannot analyze a single antigen/antibody due to weak fluorescence intensity, and thus inevitably measure the fluorescence intensity of the entire surface of the cell. A fluorescence-DNA complex may hybridize to DNA to form a fluorescence amplification body. Rolling circle amplification enables the detection of a single molecule target on the cell surface due to high fluorescence intensity, and a very strong signal can be obtained compared to single fluorescence-DNA complexes in conventional FISH. Therefore, it is a technique that can solve the problem caused by the high background signal of FISH.

This RCA technique is used as immunoRCA through amplification of an antibody-DNA complex or used for detection of intracellular mRNA. The present inventors propose a single cell multi-target analysis method capable of simultaneously performing analysis of cellular protein and mRNA through amplification of an antibody-DNA complex. Furthermore, the present invention goes beyond the limitations of single-omics-based diagnostic methods and enables simultaneous multiplex analysis of intracellular nucleic acids and cellular proteins with a multi-omics analysis technique capable of simultaneous transcriptome and proteomics, enabling the multi-omics-based molecular diagnosis market /Can contribute to the industry.

Korean Patent Publication No. 10-2021-0130612

One aspect includes providing a sample isolated from a subject containing a target protein and a target nucleic acid;

binding an antibody against the target protein to which the oligo nucleic acid is bound to the target protein;

binding oligo nucleic acid linked to the antibody and padlock DNA to the target nucleic acid;

amplifying a sequence complementary to the padlock DNA;

Obtaining a fluorescent amplification product by combining the complementary sequence of the padlock DNA with a fluorescent probe to which an oligo nucleic acid is bound; and

It is to provide a method for detecting multiple targets in a single cell, including the step of detecting the fluorescent amplifier.

One aspect includes providing a sample isolated from a subject containing a target protein and a target nucleic acid;

binding an antibody against the target protein to which the oligo nucleic acid is bound to the target protein;

binding oligo nucleic acid linked to the antibody and padlock DNA to the target nucleic acid;

amplifying a sequence complementary to the padlock DNA;

Obtaining a fluorescent amplification product by combining the complementary sequence of the padlock DNA with a fluorescent probe to which an oligo nucleic acid is linked; and

Provided is a method for detecting multiple targets in a single cell, comprising detecting the fluorescent amplifier.

The term "target protein" means any protein to be detected.

In one aspect, the target proteins are n different, the target nucleic acids are m different, n and m may each independently be a natural number, the n different target proteins and the m different different target proteins. A target nucleic acid may be present in a single cell.

The term “single cell” refers to a single cell or a single cell, for example, a very rare cell in which only a few to several tens exist in a sample. For example, , when n is 1, m may be 1, 2, 3, 4 or 5; When n is 2, m may be 1, 2, 3, 4 or 5; When n is 3, m may be a natural number independently of 1, 2, 3, 4 or 5.

When using the detection method, it is possible to simultaneously detect and quantify multiple target proteins and multiple target nucleic acids in a single cell.

In one aspect, the target protein may be one or more selected from the group consisting of CD3, CD4, CD5, CD8, CD13, CD14, CD15, CD19, CD28, CD45 and CD56, specifically CD4, CD5, CD8 and It may be one or more selected from the group consisting of CD15, and more specifically, one or more selected from the group consisting of CD4 and CD8.

In one aspect, the oligonucleic acid bound to the antibody may be at least one selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4.

Also, in one aspect, the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 may bind to an antibody against CD4 or an antibody against CD8, and the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 may bind to an antibody against CD4 or It may bind to an antibody against CD8.

The term "antibody" refers to a substance that specifically binds to an antigen to cause an antigen-antibody reaction, and may be a chimeric antibody, a humanized antibody, a human antibody, a synthetic antibody, and/or an affinity matured antibody.

The term "oligonucleotide" refers to a short polynucleotide (eg, 100 linked nucleosides or less).

The term "polynucleotide" refers to deoxyribonucleotides (DNA) or ribonucleotides (RNA) in single or double-stranded form. Unless otherwise limited, known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides may also be included.

In one aspect, in the step of binding the antibody to the target protein, an antibody against the n-th target protein to which the n-th oligonucleic acid is bound may be bound to the n-th target protein.

For example, when n is 1, an antibody against the first target protein to which the first oligonucleic acid is bound may bind to the first target protein; When n is 2, an antibody against the first target protein to which the first oligonucleic acid is bound is bound to the first target protein, and an antibody to the second target protein to which the second oligonucleic acid is bound is bound to the second target protein. the antibody may be bound; When n is 3, an antibody against the first target protein to which the first oligonucleic acid is bound is bound to the first target protein, and an antibody to the second target protein to which the second oligonucleic acid is bound is bound to the second target protein. An antibody may be bound to the third target protein, and an antibody against the third target protein to which the third oligonucleic acid is bound may be bound to the third target protein.

That is, each of the antibodies against the target protein to which a plurality of oligonucleic acids are bound may be bound to each of the plurality of target proteins.

In one aspect, the target nucleic acid may be one or more selected from the group consisting of GAPDH mRNA, IL2 mRNA, IL4 mRNA, TNF-α mRNA, IFN-γ mRNA, STK15 mRNA, NOTCH mRNA and BCL2 mRNA, specifically It may be one or more selected from the group consisting of GAPDH mRNA, IL2 mRNA, IL4 mRNA, STK15 mRNA, NOTCH mRNA, and BCL2 mRNA, and more specifically, one or more selected from the group consisting of STK15 mRNA, NOTCH mRNA, and BCL2 mRNA. .

The term "target nucleic acid" refers to any kind of nucleic acid to be detected.

In one aspect, the padlock DNA may be n + m different from each other.

Specifically, the number of padlock DNAs may be equal to the sum of the number of target proteins (n) and the number of target nucleic acids (m).

The term "padlock DNA" is used as a template in rolling circle amplification and is used to form a primer binding site complementary to a hairpin primer, a target gene binding site, and/or a marker site for fluorescence detection. Complementary binding sites within the template may be included.

In one aspect, the padlock DNA comprises a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a nucleotide sequence of SEQ ID NO: 10. It may be one or more selected from the group consisting of polynucleotides consisting of polynucleotides and polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 11.

In one aspect, when the oligonucleic acid bound to the antibody is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, the padlock DNA bound to the oligonucleic acid may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; When the oligonucleic acid bound to the antibody is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, the padlock DNA binding to the oligonucleic acid may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2.

Further, in one aspect, when the target nucleic acid is STK15 mRNA, the padlock DNA binding to STK15 mRNA may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; When the target nucleic acid is NOTCH mRNA, the padlock DNA binding to NOTCH mRNA may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10; When the target nucleic acid is BCL2 mRNA, the padlock DNA binding to BCL2 mRNA may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11.

In one embodiment, for rolling circle amplification, padlock DNA is bound to an antibody (antibody-DNA complex) against the target protein to which oligonucleic acid is bound to the target protein, and binding of the padlock DNA to the target nucleic acid is confirmed. , It was confirmed that the padlock DNA bound to the target protein and the padlock DNA bound to the target nucleic acid were different, and the number of padlock DNAs was equal to the sum of the number of target proteins and the number of target nucleic acids (Example 1 and see 4).

The term "individual" refers to all organisms such as rats, mice, livestock, and the like, including humans. As a specific example, it may be mammals including humans.

In one aspect, the sample is blood, plasma, serum, tissue, cell, lymph, bone marrow, saliva, eye fluid, semen, brain extract, spinal fluid, joint fluid, thymus fluid, ascites fluid, amniotic fluid, urine, cell tissue fluid And it may be at least one selected from the group consisting of cell culture fluid, specifically, at least one selected from the group consisting of blood, plasma, serum, tissue, cells, lymph fluid, bone marrow fluid, cell tissue fluid, and cell culture fluid, and more specifically As may be at least one selected from the group consisting of blood, tissue, cells, cell tissue fluid and cell culture fluid.

In one aspect, the method may further include connecting both ends of the padlock DNA prior to amplifying the complementary sequence of the padlock DNA.

The term "complementary" means capable of hybridizing base pairs between nucleotides or nucleic acids, where the bases are A and T (or U), or C and G.

The term “amplification” refers to a reaction that occurs repeatedly to form multiple copies of at least one segment of a template molecule.

The term "end" means end to end, and in one aspect, linking both ends of the padlock DNA is between the 5'-phosphate end and the 3'-hydroxyl end of one padlock DNA. It may be that a phosphodiester bone is promoted and both ends are connected to form a circular DNA.

In one aspect, both ends of the padlock DNA may be connected using ligase, and the ligase may be, for example, T4 ligase or Splint R ligase. .

Specifically, in one embodiment, sequences complementary to the target nucleic acid present at both ends of the padlock DNA are hybridized to the target nucleic acid and ligase is used to bind the 5'-phosphate group of the padlock DNA to the 3'-phosphate terminal. It was confirmed that a phosphodiester bone was promoted between the '-hydroxyl terminals and both ends were connected to form circular DNA (see Examples 1 to 4).

The ligase is an enzyme that connects the 5'-phosphate end and the 3'-hydroxyl end of the padlock DNA, and the hydroxyl group (-OH group) present at the 5' end of the padlock DNA cannot be linked. , Ligation was performed by adding a phosphate group to the 5' end of the padlock DNA (see Examples 1 to 4).

In one aspect, the method may further include binding a primer to the padlock DNA bound to the target nucleic acid before amplifying the complementary sequence of the padlock DNA.

In one aspect, m different primers may be used, and the number of primers may be the same as the number of target nucleic acids.

The term "primer" refers to a nucleic acid sequence capable of forming complementary base pairs with the template strand and serving as a starting point for copying the template strand, and may be, for example, 5 to 50 nucleic acid sequences. there is. The primers are usually synthetic, but may be used with naturally occurring nucleic acids. The sequence of the primer does not necessarily have to be exactly the same as the sequence of the template, but is sufficiently complementary to allow hybridization with the template.

The primers are required because of the characteristics of DNA polymerase used for polymerization of complementary sequences of padlock DNA. Specifically, since DNA polymerase has a 3'-polymerase activity that binds new nucleotides to the hydroxyl group (-OH) present at the 3' end of the polynucleotide chain, DNA must be complementary to the template strand in order for DNA replication to occur in living organisms. A primer is a short nucleic acid strand that provides a hydroxyl group at the 3' end in a bound state. Accordingly, when the target nucleic acid is RNA, a step of binding a primer to padlock DNA bound to the target nucleic acid is further required to detect the target nucleic acid.

However, in order to detect the target protein, since amplification starts from the oligonucleic acid bound to the antibody, a step of binding the primer to the padlock DNA bound to the target protein is not required.

Specifically, in one embodiment, in order to perform rolling circle amplification of a target nucleic acid, primers are hybridized to padlock DNA bound to the target nucleic acid, reacted with phi29 DNA polymerase, and then rolling circle amplification is performed Thus, it was confirmed that the number of primers and the number of target nucleic acids were the same (see Example 3) by confirming that an amplification product in the form of long single-stranded DNA using circular padlock DNA as a template was generated.

In one aspect, the method binds a compaction oligonucleotide to the complementary sequence of the padlock DNA bound to the target protein before obtaining the fluorescent amplifier, and binds the padlock to the target protein. A step of condensing complementary sequences of DNA may be further included.

The term "condensation" means that materials are condensed and hardened to be reduced, or concentrated and piled up in one place.

In one aspect, the method further comprises condensing the complementary sequence of the padlock DNA bound to the target protein, so that the fluorescent probe is condensed to the complementary sequence of the padlock DNA bound to the target protein. , and signals generated from multiple target proteins adjacent to each other on the surface of a single cell can be distinguished, and thus detection performance for the target protein can be improved.

In one aspect, the sequence of the compaction oligonucleotide may be a sequence complementary to the padlock DNA bound to the target protein repeated 1 to 5 times.

When the sequence is repeated more than 5 times, the oligonucleic acid-linked fluorescent probe cannot bind to the complementary sequence of the padlock DNA bound to the target protein, and thus the detection ability may deteriorate.

In one embodiment, DNA folding/condensation is induced using a compaction oligonucleotide so that the amplified single-stranded DNA is formed in a dot shape suitable for single-molecule detection, and a sequence complementary to the target nucleic acid of the padlock DNA is By confirming that it consists of a sequence repeated twice, it was confirmed that the compaction oligo nucleic acid periodically binds to the amplified single-stranded DNA to induce compaction of the single-stranded DNA and form a dot-type DNA amplification body (Example see Example 2).

In the case of the compaction oligo nucleic acid, since it can be degraded due to the nuclease activity of phi29 polymerase, the base at the 3' end of the compaction oligo nucleic acid is 2'MOE (2'-O -(2-Methoxyethyl)) to prevent degradation of the compaction oligo nucleic acid (see Example 2).

In one aspect, in the step of obtaining the fluorescent amplifier, the k th fluorescent probe to which the k' th oligonucleic acid is coupled is coupled to the complementary sequence of the k th padlock DNA, wherein k is 1 to n + m can be one of

Also, in one aspect, k may be n + m, that is, it may be equal to the number of padlock DNAs, and it may be equal to the sum of the number (n) of target proteins and the number (m) of target nucleic acids. can

For example, when k is 1, the first fluorescent probe to which the 1' oligonucleic acid is linked may be bound to the complementary sequence of the first padlock DNA; When k is 2, the first fluorescent probe to which the 1' oligonucleic acid is bound is bound to the complementary sequence of the first padlock DNA, and the 2' oligonucleic acid is bound to the complementary sequence of the second padlock DNA. It may be to bind a second fluorescent probe; When k is 3, the first fluorescent probe to which the 1' oligonucleic acid is bound is bound to the complementary sequence of the first padlock DNA, and the complementary sequence of the second padlock DNA to which the 2' oligonucleic acid is bound. The second fluorescent probe may be bound, and the third fluorescent probe to which the 3′ oligonucleic acid is linked may be bound to a sequence complementary to the third padlock DNA.

In one aspect, the oligonucleic acid bound to the fluorescent probe is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13, and SEQ ID NO: 14 It may be one or more selected from the group consisting of polynucleotides consisting of the nucleotide sequence of.

In one aspect, the fluorescent probe may be at least one selected from the group consisting of ATTO488, ATTO647, ALEXA546 and ATTO425.

In one embodiment, in order to detect a target protein and a target nucleic acid, hybridization was performed with a fluorescent probe (fluorochrome-DNA complex) in which oligonucleic acids were coupled to complementary sequences of padlock DNA of each target protein and target nucleic acid, It was confirmed that multiple detection of target proteins and target nucleic acids in a single cell is possible by forming a fluorescent amplifier in which fluorescent probes (ATTO488, ATTO647, ALEXA546, and ATTO425) coupled with oligonucleic acids to complementary sequences of padlock DNA are coupled. It was confirmed that the oligonucleic acid bound to the fluorescent probe was different from the target protein and the oligonucleic acid bound to the target nucleic acid (see Examples 1 to 4).

In one aspect, the detection of the fluorescent amplifier may be performed through a maximum intensity projection (MIP) method.

The term "detection" refers to confirming the presence or absence of an object to be detected, and may include quantifying the concentration of the measured object.

The term “Maximum Intensity Projection (MIP)” is a “3D” data method that projects “voxels of maximum intensity falling on the visualization plane” in the manner of parallel rays traced from the viewpoint to the projection plane.

When the fluorescent amplification product is detected through the maximum intensity projection method, it can be confirmed that multiplex detection of target protein and target nucleic acid in a single cell is possible, and quantification is also possible.

In one embodiment, in order to measure the exact three-dimensional position of the digital dye expressed in the target protein and target nucleic acid, the maximum intensity projection (MIP) method was used, and the information in the x and y directions in the maximum intensity projection image After digital dye search, z-direction intensity information was acquired to analyze target proteins and target nucleic acids. Specifically, by analyzing the ratio of intensities obtained at each wavelength and obtaining quantitative information of digital pigments, classification of digital pigments is possible, and not only detection of target proteins and target nucleic acids in single cells, but also quantification is possible. was confirmed (see Example 4).

According to the method according to one aspect, a complementary sequence of padlock DNA bound to an antibody to the target protein to which oligonucleic acid is bound to a target protein is amplified through rolling circle amplification, and the padlock bound to the target nucleic acid is amplified. It was confirmed that simultaneous analysis of target protein and target nucleic acid is possible by amplifying the complementary sequence of (padlock) DNA. In addition, the method binds a fluorescent probe to which an oligonucleic acid is linked to a complementary sequence of amplified padlock DNA, and the ratio of fluorescence intensity of the amplified product varies according to the ratio of the fluorescent probe to cell surface protein. And it was confirmed that multiple detection of the target nucleic acid inside the cell is possible. Furthermore, as it was confirmed that multiplex detection of multiple target proteins and target nucleic acids is possible through one-time rolling circle amplification in a single cell, the method can contribute to the molecular diagnostics market/industry.

1 is a schematic diagram of rolling circle amplification-based cell surface protein analysis and rolling circle amplification-based intracellular nucleic acid analysis.
2 is a diagram showing images of fluorescence amplification detection and analysis.
3 is a diagram showing fluorescence images of cell surface protein detection based on rolling circle amplification using MOLT-4 model cells.
4 is a diagram showing fluorescence images of detecting nucleic acid inside cells based on rolling circle amplification using MOLT-4 model cells.
5 is a diagram showing a schematic view of multi-omics analysis of a single cell.
6 is a diagram showing fluorescence images of cell surface protein and mRNA simultaneous detection based on rolling circle amplification.
7 is a diagram illustrating a fluorescence analysis method for simultaneous detection of cell surface proteins and mRNA based on rolling circle amplification.
8 is a diagram showing the result of analyzing the ratio of intensity using a maximum intensity projection image.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are intended to illustrate the present invention by way of example, and the scope of the present invention is not limited to these examples.

Example

Example 1. Overview of cell multiplex analysis method using rolling circle amplification

(1) padlock hybridization step

A schematic diagram of the cell multiplex analysis method using rolling circle amplification is shown (FIG. 1). Specifically, cell surface proteins and antibody-DNA complexes were bound, and antibody-DNA complexes were hybridized with target nucleic acids inside cells and padlock DNA. In the antibody-DNA complex used in the labeling step, DNA of different sequences is bound to each antibody. The composition of padlock DNA used in the labeling step is as follows. Padlock DNAs for detecting cell surface proteins and nucleic acids inside cells commonly have sequences capable of complementarily binding to target nucleic acids at both ends. The sequence of the middle region of Padlock DNA was designed as a sequence capable of complementary binding with a combination of fluorochrome-DNA complexes by ratio. The padlock DNA for detecting nucleic acid inside the cell additionally has a sequence to which a primer can be complementaryly bound. When the target nucleic acid and complementary sequences present at both ends of the padlock DNA form hybridization with the target nucleic acid, a phosphodiester is formed between the 5'-phosphate end and the 3'-hydroxyl end of the padlock DNA by ligase. A phosphodiester bond is promoted, and both ends are connected to form circular DNA (DeoxyriboNucleic Acid). Thus, the padlock DNA becomes a state in which it hybridizes with the target nucleic acid in a circular form. In this case, the target nucleic acid may be mRNA (messenger RNA) present inside the cell or DNA of an antibody-DNA complex bound to a cell surface protein.

(2) nucleic acid amplification step

It was intended to amplify single-stranded nucleic acids from hybridized protein and nucleic acid targets. In the amplification step, when the target nucleic acid is RNA (Ribonucleic Acid), a step of hybridizing a DNA primer to circular padlock DNA is required, and rolling circle amplification starts from the 3' end of the DNA primer. When the target nucleic acid is antibody-DNA complex DNA, rolling circle amplification may be started from the 3' end of the antibody-DNA complex DNA without a DNA primer hybridization step. It reacts with phi29 DNA polymerase and performs rolling circle amplification to synthesize long single-stranded DNA using circular padlock DNA as a template. At this time, the synthesized DNA amplification product is repeatedly amplified with a sequence complementary to the padlock DNA. DNA folding/condensation was induced using a compaction oligonucleotide so that the amplified single-stranded DNA was formed in a dot shape suitable for single-molecule detection. The compaction oligo nucleic acid consisted of a sequence in which a sequence complementary to the target nucleic acid of the padlock DNA was repeated twice. The compaction oligo nucleic acid periodically binds to the amplified single-stranded DNA to induce compaction of the single-stranded DNA and form a dot-shaped DNA amplification body.

(3) Fluorescence visualization step

The amplified nucleic acid was visualized by binding a complementary fluorescent-DNA probe. In the fluorescence visualization step, the fluorescent dye-DNA was bound to a sequence designed to allow the amplified single-stranded DNA of the padlock DNA sequence to hybridize with the fluorescent dye-DNA complex to form a fluorescent amplified body. Since Padlock DNA is designed as a sequence capable of hybridizing to the target in a combination of different ratios of fluorochrome-DNA complexes, when the DNA amplification product and the fluorescent-DNA probe are hybridized, the fluorescent-DNA probe is performed according to the ratio designed for the padlock DNA. is combined Therefore, multiplex detection of target nucleic acids is possible by analyzing a fluorescence image because the brightness ratio for each wavelength of fluorescence emitted from a fluorescence amplifier varies depending on the fluorochrome of the fluorescence-DNA probe bound to the DNA amplifier.

(4) fluorescence signal detection and analysis step

Fluorescence imaging for detecting the visualized fluorescence amplification and fluorescence signal detection and analysis of the fluorescence image were intended. Specifically, as a result of analyzing cell surface proteins using MOLT-4 model cells (a cell line derived from human acute lymphoblastic leukemia), MOLT-4 are cells expressing CD4 and/or CD8, and CD4-expressing cells and CD8-expressing cells and CD4, CD8 were classified as co-expressing cells. The padlock DNA for CD8 detection is designed so that the ATTO488-DNA probe binds to the amplified single-stranded DNA, and the padlock DNA for CD4 detection is designed so that the ATTO488-DNA probe and the ATTO647-DNA probe bind in a 1:1 ratio. . Thereafter, in order to detect and analyze the visualized fluorescent amplifiers, 30 images were taken in the Z-axis direction, and fluorescent images were taken to include all fluorescent amplifiers formed in the cells (FIG. 2a). Then, the location of the fluorescence signal was found in the fluorescence images of all Z-layers taken from a single cell, and the location of the fluorescence amplification was confirmed by making dots on the 3-dimensional image of the cell (Fig. 2b, 2c). and 2d). In addition, the brightness ratio for each fluorescence wavelength of the fluorescence signal emitted from the fluorescence amplifier was quantified (FIG. 2e). Accordingly, it is possible to classify the corresponding fluorescence signal as a signal of a fluorescence amplifier generated from a padlock bound to a certain target.

Example 2. Analysis of cell surface proteins using rolling circle amplification

Cell surface protein analysis was attempted using MOLT-4 model cells (a cell line derived from human acute lymphoblastic leukemia). As a result of analyzing cell surface proteins using the MOLT-4 cell line, MOLT-4 was classified as a cell expressing CD4 and/or CD8, and classified into CD4-expressing cells, CD8-expressing cells, and cells co-expressing CD4 and CD8. The padlock DNA for CD8 detection is designed so that the ATTO488-DNA probe binds to the amplified single-stranded DNA, and the padlock DNA for CD4 detection is designed so that the ATTO488-DNA probe and the ATTO647-DNA probe bind in a 1:1 ratio. . The steps of the detection process are as follows:

(1) MOLT4 cells and CD4 oligo-antibody (BD, Oligo Mouse Anti-Human CD4 (Catalog No.: 94304)) and CD8 oligo-antibody (BD, Oligo Mouse Anti-Human CD8 (Catalog No.: 94003)) react The CD4 and CD8 antibodies used at this time were previously CD4 padlock DNA (SEQ ID NO: 1: 5'-[Phosphate]CTCGATCATACCCTAACCCTAACCCTAATTTTTCAGAACTCACCTGTTAGCAGGGCAGACGTTGGA-3'), CD8 padlock DNA (SEQ ID NO: 2: 5'-[Phosphate]ATATAAGCCATTTGGCCTGGTGCAATAGTTTTCCCTAACCCTAACCCTAACAG GGCAGACCCGACT-3') An antibody-DNA complex subjected to a ligation process with T4 ligase is used. The sequence of the oligo nucleic acid linked to the CD4 antibody is 5'-AATGTGCGGCGGTGTATGATCGAGTCCAACGTCT-3' (SEQ ID NO: 3), and the sequence of the oligo nucleic acid linked to the CD8 antibody is 5'-TGATTGGGTACGCGCTTGGCTTATATAGTCGGGTCT-3' (SEQ ID NO: 4).

(2) Rolling circle amplification is performed from the 3' end of the DNA of the antibody-DNA complex bound to the cell. Rolling circle amplification is performed by reacting with phi29 DNA polymerase to generate a nucleic acid amplification product in the form of long single-stranded DNA using circular padlock DNA as a template. At this time, the synthesized DNA amplification product is repeatedly amplified with a sequence complementary to the padlock DNA. DNA folding/condensation was induced using a compaction oligonucleotide so that the amplified single-stranded DNA was formed in a dot form suitable for single-molecule detection, and CD4 compaction oligonucleotide (SEQ ID NO: 5: 5'-CGTTGGACTCGATCAAAAACGTTGGACTCG [2 '-MOE(A)][2'-MOE(U)][2'-MOE 5-Methyl(C)]-3') and CD8 compaction oligo nucleic acid (SEQ ID NO: 6: 5'-CCCGACTATATAAGAAAAACCCGACTATAT[2' -MOE(A)][2'-MOE(A)][2'-MOE(G)]-3') respectively. The compaction oligo nucleic acid consisted of a sequence in which a sequence complementary to the target nucleic acid of the padlock DNA was repeated twice. The compaction oligo nucleic acid periodically binds to the amplified single-stranded DNA to induce compaction of the single-stranded DNA and form a dot-shaped DNA amplification body.

(3) The single-stranded DNA amplified in the fluorescence visualization step is subjected to hybridization with a fluorochrome-DNA complex. The ATTO488-DNA probe binds to the single-stranded DNA amplified using the CD8 padlock as a template, and the ATTO488-DNA probe and ATTO647-DNA probe bind to the single-stranded DNA amplified using the CD4 padlock as a template in a 1:1 ratio to form a fluorescent amplifier. form The sequence of DNA (oligo nucleic acid) bound to ATT0488 is 5'-CCCTAACCCTAACCCTAA-3' (SEQ ID NO: 7), and the sequence of DNA (oligo nucleic acid) bound to ATTO647 is 5'-TCAGAACTCACCTGTTAG-3' (SEQ ID NO: 7). 8) is.

Therefore, the CD8 antibody produces a fluorescent amplifier of ATTO 488 fluorescent dye at 488 nm, and the CD4 antibody produces a fluorescent amplifier having ATTO 488 and ATTO 647 fluorescent dye in a 1:1 ratio at 488 nm and 647 nm, so that CD4 and CD8 It was confirmed that multiple detection of proteins is possible (FIG. 3).

3. Intracellular mRNA analysis using rolling circle amplification

Intracellular mRNA was analyzed using the MOLT-4 cell line. Among mRNAs present in MOLT-4, STK15, NOTCH, and BCL2 were analyzed as target mRNAs. The padlock DNA for STK15 detection (SEQ ID NO: 9: 5'-[Phosphate]ACTGACCACCCAAAATTATACAACATACTACCTCCTCAATTCTGCTACTGTACTTATACAACATACTACCTCGGAAGATGGAGCATGT-3') is designed so that the ATTO546-DNA probe binds to the amplified single-stranded DNA, and the padlock DNA for NOTCH detection (SEQ ID NO: 10 : 5'-[Phosphate]GGGCAGGCACTGGCCATAGCCGTGACTATCGACTCTCAATTCTGCTACTGTACTTATACAACATACTACCTCTGTAGGAGGCCTCGAA-3') was designed to bind ATTO546-DNA probe and ATTO425-DNA probe in a 1:1 ratio, and padlock DNA for BCL2 detection (SEQ ID NO: 11: 5'-[Phosphate] CCAGCCTCCGTTATCCTTAGCCGTGACTATCGACTCTCAATTCTGCTACTGTACTTAGCCGTGACTATCGACTAGTTCCACAAAGGCATC-3') is designed so that the ATTO425-DNA probe binds to the amplified single-stranded DNA. In addition, the padlock for mRNA detection has a primer binding portion for the start of rolling circle amplification. The steps of the detection process are as follows:

(1) MOLT4 cells are hybridized with a padlock capable of binding to STK, NOTCH, and BCL2, and reacted with Splint R Ligase to link both ends of the padlock DNA to form circular DNA.

(2) A primer (SEQ ID NO: 12: 5'-AGTACAGTAGCAGAATTGAG- 3') is hybridized to padlock DNA, and rolling circle amplification is performed from the 3' end of the primer. By reacting with phi29 DNA polymerase and performing rolling circle amplification, an amplification product in the form of a long single-stranded DNA using circular padlock DNA as a template is generated. At this time, the synthesized DNA amplification product is repeatedly amplified with a sequence complementary to the padlock DNA.

(3) The single-stranded DNA amplified in the fluorescence visualization step is subjected to hybridization with a fluorochrome-DNA complex. Therefore, the ATTO546-DNA probe binds to the single-stranded DNA amplified using the STK15 padlock as a template, and the ATTO546-DNA and ATTO425-DNA probes bind to the single-stranded DNA using the NOTCH padlock as a template in a 1:1 ratio to form a fluorescent amplification product. form In the single-stranded DNA amplified using the BCL2 padlock as a template, a fluorescent amplification product to which the ATTO425-DNA probe is bound is generated. The sequence of DNA (oligo nucleic acid) bound to ATT0546 is 5'-TATACAACATACTACCTC-3' (SEQ ID NO: 13), and the sequence of DNA (oligo nucleic acid) bound to ATTO425 is 5'-TAGCCGTGACTATCGACT-3' (SEQ ID NO: 13). 14) is.

Therefore, STK15 mRNA produces a fluorescent amplification of ATTO 546 fluorescent dye at 546 nm, NOTCH mRNA produces a fluorescent amplification of ATTO 546 and ATTO 425 fluorescent dye in a 1:1 ratio at 546 nm and 425 nm, and BCL2 mRNA produced a fluorescent amplifier with ATTO 425 fluorescence at 425 nm and could detect STK15, NOTCH and BCL2 mRNA (FIG. 4).

4. Simultaneous detection of single cell surface proteins and mRNA using rolling circle amplification

(1) Outline of multi-omics analysis method of single cell

A schematic diagram of multi-omics analysis of a single cell (simultaneous detection of proteins and nucleic acids in a single cell) is shown (FIG. 5).

(2) Simultaneous detection of single cell surface protein and mRNA using multi-omics analysis method of single cell

We tried to confirm the simultaneous detection of surface proteins and mRNAs of single cells using the multi-omics analysis method of single cells. Specifically, as a result of analyzing cell surface proteins and mRNAs using the MOLT-4 cell line for simultaneous detection of surface proteins and mRNAs, MOLT-4 is a cell expressing CD4 and / or CD8 protein, and CD4 expressing cells , CD8 expressing cells and CD4, CD8 co-expressing cells were classified. In addition, among mRNAs present in MOLT-4, STK15, NOTCH, and BCL2 were analyzed as target mRNAs. The padlock DNA was ligated to the DNA of the antibody-DNA complex for protein detection using T4 ligase, and the antibody-DNA to which the padlock DNA already ligated was reacted with the cells. Thereafter, the cells were fixed and permeabilized, and padlock DNA for mRNA detection was reacted with the cells to detect intracellular mRNA, and ligation was performed with Splint R ligase. In addition, compaction oligonucleic acids were bound to proteins, primers were bound to mRNAs, and rolling circle amplification was performed, and cell surface proteins and mRNAs were detected based on rolling circle amplification using fluorescence of different colors for proteins and mRNAs, respectively. .

As a result, fluorescence images of various colors and intensities were detected, and it was confirmed that the simultaneous detection and quantification of cellular proteins and mRNAs based on rolling circle amplification were well achieved (FIG. 6).

(3) Quantification of detection targets using rolling circle amplification

A fluorescence analysis method for simultaneous detection of cell surface proteins and mRNA using rolling circle amplification is shown (FIG. 7).

It is impossible to accurately measure the position of digital pigments through 2-dimensional (x, y) fluorescence imaging, and even if imaging is performed using Z-stacking, the resolution in the discontinuous z-axis direction is higher than that of the continuous x, y 2-dimensional plane. Because of the low level, accurate analysis of digital pigment is impossible. Since the digital dye is distributed in three dimensions on the inside or surface of a single cell, it is essential to specify the three-dimensional location in order to accurately analyze the intensity of the fluorescence wavelength of the digital dye.

Therefore, as an analysis method for measuring the exact three-dimensional position of digital pigment expressed in cells, after searching for digital pigment with information in x and y directions in Maximum Intensity Projection (MIP) image, intensity information in z direction obtained and analyzed. First, the 3D image of the compartmentalized cells was converted into a 2D intensity image through maximum intensity projection (MIP) (FIG. 8a). In addition, the x and y positions of the digital pigment were found through a gradient-based x, y position search, and an intensity profile in the z direction was obtained from the found x and y positions (FIG. 8B).

In this way, by analyzing the ratio of intensities obtained at each wavelength and acquiring quantitative information of the digital colorant, it was confirmed that the classification of the digital colorant and the quantification of the detection target are possible.

<110> Industry-University Cooperation Foundation Hanyang University <120> Multi-target detection method in single cell based on rolling <130> PD21-387-P1 <150> KR 10-2021-0158915 <151> 2021-11-17 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 66 <212> DNA <213> artificial sequence <220> <223> padlock DNA for detecting CD4 <220> <221> misc_feature <222> (1) <223> modified by Phosphate <400> 1 ctcgatcata ccctaaccct aaccctaatt tttcagaact cacctgttag cagggcagac 60 gttgga 66 <210> 2 <211> 66 <212> DNA <213> artificial sequence <220> <223> padlock DNA for detecting CD8 <220> <221> misc_feature <222> (1) <223> modified by Phosphate <400> 2 atataagcca tttggcctgg tgcaatagtt ttccctaacc ctaaccctaa cagggcagac 60 ccgact 66 <210> 3 <211> 36 <212> DNA <213> artificial sequence <220> <223> oligonucleotide bound to Anti-CD4 antibody <400> 3 aatgtgcggc ggtgtatatg atcgagtcca acgtct 36 <210> 4 <211> 36 <212> DNA <213> artificial sequence <220> <223> oligonucleotide bound to Anti-CD8 antibody <400> 4 tgattgggta cgcgcttggc ttatatagtc gggtct 36 <210> 5 <211> 33 <212> DNA <213> artificial sequence <220> <223> compaction oligonucleotide for detecting CD4 <220> <221> misc_feature <222> (31)..(32) <223> modified by 2'-O-(2-Methoxyethyl) <220> <221> misc_feature <222> (33) <223> modified by 2'-O-(2-Methoxyethyl) 5-Methyl <400> 5 cgttggactc gatcaaaaac gttggactcg auc 33 <210> 6 <211> 33 <212> DNA <213> artificial sequence <220> <223> compaction oligonucleotide for detecting CD8 <220> <221> misc_feature <222> (31)..(33) <223> modified by 2'-O-(2-Methoxyethyl) <400> 6 cccgactata taagaaaaac ccgactatat aag 33 <210> 7 <211> 18 <212> DNA <213> artificial sequence <220> <223> DNA bound to ATT0488 <400> 7 ccctaaccct aaccctaa 18 <210> 8 <211> 18 <212> DNA <213> artificial sequence <220> <223> DNA bound to ATT0647 <400> 8 tcagaactca cctgttag 18 <210> 9 <211> 88 <212> DNA <213> artificial sequence <220> <223> padlock DNA for detecting STK15 mRNA <220> <221> misc_feature <222> (1) <223> modified by Phosphate <400> 9 actgaccacc caaaattata caacatacta cctcctcaat tctgctactg tacttataca 60 acataactacc tcggaagatg gagcatgt 88 <210> 10 <211> 88 <212> DNA <213> artificial sequence <220> <223> padlock DNA for detecting NOTCH mRNA <220> <221> misc_feature <222> (1) <223> modified by Phosphate <400> 10 gggcaggcac tggccatagc cgtgactatc gactctcaat tctgctactg tacttataca 60 acataactacc tctgtaggag gcctcgaa 88 <210> 11 <211> 90 <212> DNA <213> artificial sequence <220> <223> padlock DNA for detecting BCL2 mRNA <220> <221> misc_feature <222> (1) <223> modified by Phosphate <400> 11 ccagcctccg ttatccttag ccgtgactat cgactctcaa ttctgctact gtacttagcc 60 gtgactatcg actagttcca caaaggcatc 90 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer for detecting mRNA <400> 12 agtacagtag cagaattgag 20 <210> 13 <211> 18 <212> DNA <213> artificial sequence <220> <223> DNA bound to ATT0546 <400> 13 tatacaacat actacctc 18 <210> 14 <211> 18 <212> DNA <213> artificial sequence <220> <223> DNA bound to ATT0425 <400> 14 tagccgtgac tatcgact 18

Claims (18)

Providing a sample isolated from a subject containing a target protein and a target nucleic acid;
binding an antibody against the target protein to which the oligo nucleic acid is bound to the target protein;
binding oligo nucleic acid linked to the antibody and padlock DNA to the target nucleic acid;
amplifying a sequence complementary to the padlock DNA;
Obtaining a fluorescent amplification product by combining the complementary sequence of the padlock DNA with a fluorescent probe to which an oligo nucleic acid is bound; and
A method of detecting multiple targets in a single cell comprising detecting the fluorescent amplifier.
The method according to claim 1, wherein the target protein is n different, and the target nucleic acid is m different,
Wherein n and m are each independently a natural number.
The method according to claim 1, wherein the target protein is at least one selected from the group consisting of CD3, CD4, CD5, CD8, CD13, CD14, CD15, CD19, CD28, CD45 and CD56.
The method according to claim 1, wherein the oligonucleic acid bound to the antibody is at least one selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4.
The method according to claim 2, in the step of binding the antibody to the target protein,
An antibody against the n-th target protein to which the n-th oligonucleic acid is bound is bound to the n-th target protein.
The method according to claim 1, wherein the target nucleic acid is at least one selected from the group consisting of GAPDH mRNA, IL2 mRNA, IL4 mRNA, TNF-α mRNA, IFN-γ mRNA, STK15 mRNA, NOTCH mRNA, and BCL2 mRNA.
The method according to claim 2, wherein the padlock DNA is different n + m individuals.
The method according to claim 2, wherein the padlock DNA is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a nucleotide sequence of SEQ ID NO: 10 At least one selected from the group consisting of a polynucleotide consisting of and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11.
The method according to claim 1, wherein the sample is blood, plasma, serum, tissue, cell, lymph, bone marrow, saliva, eye fluid, semen, brain extract, spinal fluid, joint fluid, thymus fluid, ascites fluid, amniotic fluid, urine, cell tissue fluid And at least one selected from the group consisting of a cell culture medium, method.
The method according to claim 1, further comprising connecting both ends of the padlock DNA prior to amplifying the complementary sequence of the padlock DNA.
The method of claim 7 , further comprising binding a primer to the padlock DNA bound to the target nucleic acid prior to amplifying the complementary sequence of the padlock DNA.
The method of claim 11 , wherein the primers are m different from each other.
The method according to claim 1, before obtaining the fluorescent amplifier, by binding a compaction oligonucleotide to the complementary sequence of the padlock DNA bound to the target protein to complement the padlock DNA bound to the target protein. Further comprising the step of condensing the enemy sequence, the method.
The method according to claim 13, wherein the sequence of the compaction oligonucleotide is a complementary sequence of the padlock DNA bound to the target protein repeated 1 to 5 times.
The method according to claim 7, in the step of obtaining the fluorescent amplifier,
binding a k-th fluorescent probe to which the k'-th oligonucleic acid is coupled to the complementary sequence of the k-th padlock DNA;
Wherein k is one of 1 to n + m.
The method according to claim 15, wherein the k'th oligonucleic acid is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13, and a base sequence of SEQ ID NO: 14 At least one method selected from the group consisting of polynucleotides consisting of sequences.
The method according to claim 1, wherein the fluorescent probe is at least one selected from the group consisting of ATTO488, ATTO647, ATTO546 and ATTO425.
The method according to claim 1, wherein the detection of the fluorescent amplifier is performed through a maximum intensity projection (MIP) method.

Images