KR20230056961A - Novel Anticancer Strain for Secreting ClyA with Double Safety Control - Google Patents

Abstract

The present invention relates to a novel anti-cancer E. coli strain that can effectively secrete ClyA after targeting to cancer cells and has a locking device that can be used safely, and an anti-cancer composition using the same, and more specifically, to a recombinant strain in which a pCC1Bac plasmid containing a gene encoding the ClyA protein operably linked to an inducible promoter is transformed into an EPI300 strain.

Description

Novel Anticancer Strain for Secreting ClyA with Double Safety Control}

The present invention relates to a novel anticancer E. coli strain that can effectively secrete ClyA after being targeted to cancer cells and can be safely used with a locking device, and an anticancer composition using the same.

BACKGROUND OF THE INVENTION Cancer is a life-threatening disease in which the proliferative activity of cells does not stop, penetrates into surrounding tissues and destroys normal cells. As the human body's ability to regulate decreases with aging, it becomes vulnerable to cancer. In an aging society, cancer has been the undisputed number one cause of death for 10 years since 2007, exceeding twice the death rate from heart disease, which is the second highest. .

The most effective response system for the treatment of disease is to strengthen the immune system, but since cancer cells are not foreign invaders, they do not trigger the body's immune response and avoid it. Certain viruses or bacteria infect cancer cells more than normal cells, and the infected bacteria can become targets of attack by immune cells. Accordingly, anti-cancer treatment methods have been suggested in which a specific virus or bacterium is deliberately infected to stimulate the body's immune response to fight cancer cells. Leschner et al. (J. Mol. Med. 2010, 88, 763-773) infected mice with CT26 tumors with fluorescent Salmonella by intravenous injection, and followed the route of infection over time. As a result, immediately after infection, it was shown that the whole body was infected through the blood of the mouse, 20 minutes after infection, Salmonella bacteria accumulated in the spleen and liver, and 24 hours later, Salmonella bacteria accumulated only in the tumor tissue. Observed.

However, since Salmonella is a representative bacterium that causes food poisoning, it can cause sepsis by infection and threaten life, so its pathogenicity is too strong to be used directly for cancer treatment. A research team at Yale University in the United States announced that genetic manipulation of Salmonella can attenuate it by removing toxicity while maintaining its tumor-attacking properties, and suppressing tumors by inducing immune stimulation through injection of the attenuated Salmonella. However, attenuated Salmonella has low survivability and reduced immunogenicity, and there is a concern that the attenuated strain may be converted to wild-type Salmonella due to mutation and cause sepsis, which is a very important problem to be solved for actual use in cancer treatment. is recognized as

Strains such as Shigella , Vibrio cholera , E. coli , and Bifidobacterium , like Salmonella, penetrate cells of the intestinal tract and are targeted to cancer cells. These strains have a slightly lower systemic immunity-inducing effect than Salmonella, but have the advantage that they can be used safely without concern for sepsis because of their low pathogenicity. Accordingly, studies are being conducted to develop strains capable of diagnosing cancer or expressing or suppressing substances useful for cancer treatment by using cancer-targeting properties, and using them for anti-cancer treatment. Registered Patent No. 10-2110993 discloses a composition for diagnosing, preventing or treating cancer containing a Klebsiella aerogenes strain as an active ingredient, and Registered Patent No. 10-2252939 discloses DNA for diagnosing and treating cancer While posting about the construct, it is transformed into at least one strain selected from the group consisting of a Salmonella genus strain, a Clostridium genus strain, a Bifidobacterium genus strain, and an E. coli genus strain to treat cancer. It has been described that it can be targeted.

ClyA (Cytolysin A) protein is a 34 kDa cytolytic protein expressed by E.Coli, Salmonella and some intestinal bacteria, and kills target-cells by forming pores in the membrane. Attempts have been made to treat cancer by targeting ClyA to cancer cells using these apoptotic properties and then expressing it. For example, Patent Registration No. 10-2252939 discloses a DNA construct in which a reporter protein for diagnosis is operably linked by a first promoter and a second promoter, respectively, together with an anticancer protein such as ClyA in cancer cells, so that cancer cells are expressed. diagnosis and treatment were made possible at the same time. However, in order to be used safely and effectively as an actual anti-cancer composition, the expression of ClyA must be suppressed before targeting to cancer cells, and the expression must be effectively achieved after targeting, but specific implementations thereof have not been disclosed in the prior art.

Registered Patent No. 10-2110993 Registered Patent No. 10-2252939

Leschner et al., J. Mol. Med. 2010, 88, 763-773.

An object of the present invention is to provide a recombinant strain that can be used more safely as a recombinant strain capable of secreting a ClyA protein that is targeted to cancer and exhibits anticancer properties.

Another object of the present invention is to provide an anti-cancer composition using the recombinant strain.

The present invention for achieving the above object relates to a recombinant strain characterized in that the EPI300 strain is transformed with a pCC1Bac plasmid containing a gene encoding the ClyA protein operably linked to an inducible promoter.

The transformation method is a conventional method, and can be performed using a recombinant expression vector containing a genetic construct encoding the ClyA protein operably linked to the inducible promoter. Specifically, for example, a calcium chloride method, an electroporation method, etc. may be used, but are not limited thereto. A "vector" in the present invention is a DNA preparation that is operably linked to allow expression of a genetic construct in a suitable host, which may be a plasmid, phage particle or latent genomic insert. In the context of the present invention, plasmid and vector are sometimes used interchangeably. It goes without saying that the expression vector with high efficiency can be selected and used according to the sequence of the gene construct.

In the present invention, the gene encoding the ClyA protein is preferably bound to one or more tags. In order to facilitate detection when a tag is bound to the ClyA protein, for example, whether or not the ClyA protein is normally secreted after being targeted to a cancer site by labeling with a fluorescent material, and how long the secretion of the ClyA protein lasts in the body, it is easy. can be verified. In addition, using the characteristics of the strain targeting cancer, it can be used not only for cancer treatment but also for tracking the treatment process by simultaneously checking whether the size of the cancer is reduced. Tags that may be used include, for example, His tag, Flag tag, Myc tag, HA tag, and GST tag, but are not limited thereto.

The fact that copy number control is possible means that the copy number can be increased by administration of an inducer. The pcc1bac plasmid contained in EPI300 used in the following examples normally has a copy number of 1, but when arabinose as an inducer is administered, It is known to increase the number of copies to 20. In the present invention, only the use of the pcc1bac plasmid and the EPI300 strain was exemplified, but it is not limited thereto, and plasmids known to be capable of copy number control and strains containing them or plasmids capable of copy number control developed later and containing them Of course, strains prepared in the same way using strains are also included in the scope of the present invention. By using a plasmid capable of copy number control and a strain containing the plasmid, it is possible to suppress the expression of ClyA before targeting to cancer and increase the expression level of ClyA after targeting to cancer. As a result, it is possible to efficiently exhibit anticancer activity while primarily suppressing toxicity caused by ClyA in cells other than cancer. In the following examples, as a result of transforming ClyA into a strain capable of copy number control and treating the inducer, it was shown that a significant amount of ClyA was expressed even before treatment with the inducer. Therefore, it was shown that safety is not secured only by copy number control, and additional safety devices are needed.

Accordingly, in the present invention, a secondary safety device was introduced to switch the expression of ClyA by an inducible promoter. As used herein, "inducible promoter" is a promoter capable of switching the operation of a gene linked by an inducer, for example, tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, T7 promoter, pBAD promoter, Tet promoter, trc promoter, pepT promoter, sulA promoter, pol 11 (dinA) promoter, ruv promoter, uvrA promoter, uvrB promoter, uvrD promoter, umuDC promoter, lexA promoter, cea promoter, caa promoter, recN promoter, pagC promoter, hip promoter, ansB promoter or pflE promoter.

The following examples showed that switching by an inducible promoter was possible, but not 100% suppression of ClyA expression. Therefore, simply introducing an inducible promoter alone is insufficient to suppress ClyA expression and to effectively express ClyA to exhibit anticancer activity after targeting cancer. Solved.

The inducible promoter and copy number control may be controlled by the same inducer. When controlled by the same inducer, there is an advantage in that it can be used more conveniently because the expression of ClyA can be switched on with only one inducer and the number of copies can be increased at the same time. In the following examples, as an example of such a system, it is confirmed that pBAD (araC) - ClyA (C-flag) + pCC1Bac plasmid / EPI300 (E.coli) works effectively, and as of October 12, 2021, the Korea Research Institute of Bioscience and Biotechnology It was deposited with the Center for Biological Resources (accession number KCTC18924P).

Alternatively, the inducible promoter and copy number control may be controlled by different inducers. In this case, there is an advantage in that ClyA can be expressed more safely by treating the inducer in stages. For example, if ClyA is bound by a tag, after targeting to the cancer site, the inducible promoter is first switched to operate by the first inducer, and secreted ClyA is detected to confirm targeting to the cancer site. , Then, the second inducer may be treated to increase the number of copies, and the treatment may be performed in stages. It is natural that the processing order of the first inducing material and the second inducing material may be changed.

The recombinant strain of the present invention may be used as a strain for producing ClyA, but may be used as such to secrete ClyA in vivo, so that ClyA exhibits a therapeutic effect. For example, it can be used for the treatment of diseases including cancer there is. Therefore, the present invention provides an anti-cancer composition containing the recombinant strain. Since the recombinant strain of the present invention is prepared using a strain having cancer-targeting properties, the anti-cancer composition of the present invention is targeted to the tumor site and has the effect of secreting ClyA protein to kill cancer cells. In addition, since an immune response can be induced by bursting the cellular contents of tumor cells by the ClyA protein, it is expected to exhibit additional anticancer activity in vivo.

The anti-cancer composition of the present invention can be used by inducing secretion of the ClyA protein from the strain by administering a drug that induces the operation of the inducible promoter when the strain is targeted to a cancer tissue after administration of the recombinant strain. At this time, if the first inducer for inducing operation of the inducible promoter and the second inducer for copy number control are different, the first inducer and the second inducer may be administered simultaneously, or sequentially at predetermined intervals. may also be administered.

The composition of the present invention can be prepared by a method known in the pharmaceutical field to be used as an anti-cancer drug, by itself or by mixing with a pharmaceutically acceptable carrier, excipient, diluent, etc. can be used

The composition of the present invention may be formulated into a preparation for oral or parenteral administration. The dosage of the active ingredient according to the present invention may be appropriately selected depending on the degree of absorption of the active ingredient in the body, the form of the preparation, the age, sex and condition of the patient, the degree of symptoms, etc., administration may be administered once a day, , It may be administered in several divided doses. A typical dosage is 0.001 mg/kg·day to 10 g/kg·day.

As described above, the recombinant strain of the present invention is equipped with a double safety device of a first safety device that switches the expression of ClyA protein, a cytolytic protein, and a second safety device that controls copy number. can be effectively expressed, so it can be used more safely as well as having excellent efficacy.

In particular, the strain of the present invention is attenuated Escherichia coli and can be more usefully used as an anticancer composition because the risk is significantly lower than that of Salmonella.

Figure 1 is a nucleotide sequence of DNA designed for the construction of a plasmid for the secretion of his-tagged ClyA.
Figure 2 is a nucleotide sequence of DNA designed for the construction of a plasmid for the secretion of flag-tagged ClyA.
Figure 3 is an electrophoretic photograph showing the secretion of ClyA according to the presence or absence of arabinose in the EPI300 strain transformed with ClyA(C-his)-pcc1bac or ClyA(C-flag)-pcc1bac plasmid.
Figure 4 is an electrophoresis picture showing the secretion of ClyA according to the presence or absence of arabinose in the pBAD (araC) - ClyA (C-flag) + pCC1Bac plasmid /EPI300 strain.
Figure 5 is a microscope image showing the anticancer activity of ClyA secreted by pBAD (araC) - ClyA (C-flag) + pCC1Bac plasmid /EPI300 strain.
Figure 6 is a graph showing the apoptosis efficacy of ClyA secreted by pBAD (araC) - ClyA (C-flag) + pCC1Bac plasmid /EPI300 strain.

Hereinafter, the present invention will be described in more detail with reference to the attached examples. However, these embodiments are only examples for easily explaining the content and scope of the technical idea of the present invention, and thereby the technical scope of the present invention is not limited or changed. It will be obvious to those skilled in the art that various modifications and changes are possible within the scope of the technical spirit of the present invention based on these examples.

[Example]

Example 1: Synthesis of ClyA-his and Cly-flag genes

A tag was linked to ClyA to facilitate detection of the ClyA protein. Specifically, based on the nucleotide sequence (NCBI) of the ClyA gene of wild Escherichia coli MG1655 K-12, the ClyA-his and ClyA-flag genes with his tag and flag tag inserted at the C-terminus of the ClyA gene, respectively, were produced by Kos It was synthesized through the gene synthesis service of Mojintech (Seoul, Korea).

For cloning, an EcoRI site was inserted in front of the ClyA-his and ClyA-flag genes, and a HindIII site was inserted in the back. 1 and 2 show the sequences of ClyA-his (SEQ ID NO: 1) and ClyA-flag (SEQ ID NO: 2) plasmids into which a restriction enzyme site was introduced, respectively, and the part shown in red is hig-tag or flag-tag. sequence, and the underlined part indicates the restriction enzyme site. In addition, a Shine Dalgarno sequence (AGGAGGTTT) was introduced between the EcoRI site and the ClyA sequence to increase expression efficiency.

Example 2: Cloning of ClyA-his- or ClyA-flag-pcc1bac plasmids

The ClyA-his or ClyA-flag plasmid prepared in Example 1 was reacted at 37° C. for 2 hours using 10 U of each of EcoRI (Takara Co., Ltd.) and HindIII (Takara Co., Ltd.) enzymes. The reaction product was subjected to electrophoresis, and DNA of about 1,000 bp was extracted using a gel extraction kit (Qiagen) to obtain ClyA-his or ClyA-flag insert DNA.

pCC1BAC plasmid (distributed from the laboratory of Prof. Lim Heon-man, Chungnam National University) and EcoRI (Takara Co., Ltd.) and HindIII (Co., Ltd. Takara Co., Ltd.) enzymes were reacted at 37 ° C for 2 hours using 10U each, and the reaction product was prepared using a PCR purification kit (Qiagen ) to obtain vector DNA. The pCC1BAC DNA was ligated (Invitrogen) with a ClyA-his or ClyA-flag insert at 25° C. for 30 minutes, and then EPI300 (available from the laboratory of Professor Heon-Man Lim, Chungnam National University) was transformed into competent cells. Transformed cells were plated on LB CM (chloramphenicol) solid medium and cultured at 37° C. to select antibiotic-resistant colonies. Six candidates of the selected colony were selected and reacted with 10U each of EcoRI and HindIII at 37 ° C for 1 hour, and then the generation of a 1,000 bp band was confirmed through electrophoresis.

Cosmogenetech Co., Ltd. was commissioned to analyze the nucleotide sequence of the candidate, and the insertion of the ClyA-his (SEQ ID NO: 1) and ClyA-flag (SEQ ID NO: 2) genes was confirmed. It was established with the pcc1bac plasmid and the ClyA(C-flag)-pcc1bac plasmid.

Example 3: Confirmation of transformation of E. coli strain and secretion of ClyA protein

1) Transformation of EPI300 strain

The ClyA(C-his)-pcc1bac plasmid and the ClyA(C-flag)-pcc1bac plasmid prepared in Example 2 were transformed into EPI300 strains capable of copy control by arabinose, respectively.

A single colon of each transformed strain was inoculated into LB cm broth and cultured with shaking at 37°C for 12-16 hours. After diluting so that OD ₆₀₀ is 0.05 in fresh LB cm liquid medium, it was cultured with shaking at 37 ° C. for 2 hours. When the OD ₆₀₀ was 0.4 to 0.6 by shaking culture, arabinose was treated to a concentration of 0.2 wt%, and shaking culture was further performed at 37° C. for 5 hours. For comparison, the control group was shaken and cultured under the same conditions without treatment with arabinose. The culture solution was centrifuged at 3000 rpm to separate the supernatant, and the bacteria were completely removed by filtering with a 0.2 μm filter.

From the supernatant from which bacteria were removed, the amount of ClyA-his or ClyA-flag in the culture medium was confirmed by Western blotting. Figure 3 is an electrophoresis picture showing the result, ClyA-his is the result obtained from the culture medium of the EPI300 strain transformed with the ClyA (C-his) -pcc1bac plasmid, and ClyA-flag is ClyA (C-flag) -pcc1bac These are the results obtained from the culture solution of the EPI300 strain transformed with the plasmid. Lanes 1 and 3 are control groups not treated with arabinose, and lanes 2 and 4 show protein detection results in the culture medium of the experimental group treated with arabinose. Figure 3 shows (1) ClyA (C-his) -pCC1Bac plasmid /EPI300 does not secrete ClyA into the medium or is not effectively detected, and (2) ClyA (C-flag) -pCC1Bac plasmid /EPI300 produces a large amount of ClyA into the medium secretion, but (3) the copy number in the ClyA(C-flag)-pCC1Bac plasmid /EPI300 was not effectively controlled by arabinose.

2) Introduction of additional switching system

In the transformed strain of 1), since control of ClyA secretion is not effective only by copy number control, an additional switching system was introduced. Since copy number is controlled by arabinose in the transformed strain of 1), the additionally introduced system also allowed the expression of ClyA to be regulated by arabinose.

To this end, the araC gene and the operator were cloned by PCR using the following primers from the pBad33 plasmid (provided by Prof. Lim Heon-man, Chungnam National University).

pBad33-araC-Ecor1-F (SEQ ID NO: 3)

gatcgatgaattctgtgcctgtcaaatggacgaagcagggattctgca

pBad33-araC-Ecor1-R (SEQ ID NO: 4)

gagctcgaattcgctagcccaaaaaaacgggtatgga

Specifically, 10x buffer 5 μl, 5x Q solution 10 μl, 2 mM dNTPs 7.5 μl, 20 μM pBad33-araC-Ecor1-F primer 2.5 μl, 20 μM pBad33-araC-Ecor1-R primer 2.5 μl, Taq polymerase 1 μl , PCR was performed by mixing 1 μl of 100 ng/μl pbad33 plasmid and 20.5 μl of water. PCR conditions were as follows; 95°C 5 min, 30 cycles of 94°C 30 sec-49°C 30 sec-72°C 1 min repeated, 72°C 10 min. Electrophoresis was performed on the reaction product, and about 1300 bp of DNA (Gel extraction kit: Qiagen) was extracted from the gel to obtain PCR products up to the operator including the araC gene. The purified 1ug PCR fragment was reacted at 37℃ for 2 hours using 10U of EcoRI (Takara Co., Ltd.), and the reaction product was purified with a PCR purification kit (Qiagen Co., Ltd.) to prepare insert DNA.

Vector DNA was completed by reacting 1 ug of ClyA(C-flag)-pCC1Bac plasmid with 10U of EcoRI (Takara Co.) at 37°C for 2 hours, and purifying the reaction product with a PCR purification kit (Qiagen Co.).

The insert DNA and vector DNA obtained by the above method were ligated at 25°C for 30 minutes (Invitrogen), and then transformed into EPI300 competent cells. Transformed cells were plated on LB cm solid medium and cultured at 37° C. to select antibiotic-resistant colonies. Six candidates of the selected colony were selected and reacted with 10U of EcoRI (Takara Co., Ltd.) for 1 hour at 37° C., and the generation of a 1.3 kb band was confirmed through electrophoresis. Cosmogenetech Co., Ltd. was requested for nucleotide sequence analysis of the candidate, insertion of insert DNA was confirmed, and pBAD(araC) - ClyA(C-flag) + pCC1Bac plasmid /EPI300 was established. It was deposited at the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology on October 12, 2021 (Accession No. KCTC18924P).

For the established strain, secretion of ClyA-flag was confirmed by the same method as in 1) secretion test, and the results are shown in FIG. 4 . In FIG. 4, when arabinose was not treated, a small amount of ClyA was detected in the culture medium, but it can be seen that the secretion of ClyA greatly increased by treatment with arabinose.

Example 4: Evaluation of the activity of ClyA secreted by the strain

A single conlon of the pBAD(araC)-ClyA(C-flag) + pCC1Bac plasmid /EPI300 strain was inoculated into LB cm liquid medium and cultured with shaking at 37°C for 12-16 hours. After diluting so that OD ₆₀₀ is 0.05 in fresh LB cm liquid medium, it was cultured with shaking at 37 ° C. for 2 hours. When the OD ₆₀₀ was 0.4 to 0.6 by shaking culture, arabinose was treated to a concentration of 0.2 wt%, and shaking culture was further performed at 37° C. for 5 hours. For comparison, the control group was shaken and cultured under the same conditions without treatment with arabinose. The culture solution was centrifuged at 3000 rpm to separate the supernatant, and the bacteria were completely removed by filtering with a 0.2 μm filter.

A mouse colon cancer cell line, CT26, was purchased from ATCC (American Type Culture Collection), and the cells were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. grown up

The cells were inoculated into a well-plate at a concentration of 2 X 10 ⁵ cells/well, and then the supernatant obtained above was concentrated 100 times, treated with 200ul each, and cultured for 48 hours. 5 is a microscope image showing the results. It can be seen that the experimental group not treated with arabinose reduced the number of cancer cells by about 5% compared to the control group, whereas the experimental group treated with arabinose decreased the number of cancer cells by 30% or more. From this, it can be seen that the strain of the present invention exhibits anticancer efficacy, and the anticancer efficacy is greatly increased by arabinose.

Apoptosis is divided into apoptosis, in which proliferation stops or cells shrink and DNA is broken down into regular pieces, and cell necrosis, in which cell membranes rupture and internal components are released to the outside of the cell.

ClyA is known to cause cell necrosis, that is, to burst cells by forming pores in cell membranes. Accordingly, an LDH assay was performed to confirm whether the cancer cell proliferation inhibitory effect confirmed in FIG. 5 was caused by cell necrosis.

10 μl of the supernatant samples of the control group and the experimental group were each placed in a 96-well plate, 100 μl of EZ-LDH Cell cytotoxicity assay kit (DG-LDH500, DoGEN) was added, and reacted at room temperature for 30 minutes. Cell necrosis was confirmed by measuring absorbance at 450 nm using a microplate reader, and the results are shown in FIG. 6 . In FIG. 6, the control group and the experimental group without the addition of arabinose showed similar values, whereas the experimental group treated with arabinose showed a value of 250% or more compared to the control group, confirming that apoptosis was induced by ClyA. ClyA not only kills cancer cells by inducing apoptosis, but also induces secondary immuno-anticancer effects by stimulating immune cells with internal components of cancer cells.

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Novel Anticancer Strain for Secreting ClyA with Double Safety Control <130> P1021-462 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 909 <212> DNA <213> artificial sequence <220> <223> ClyA-his <400> 1 atgactgaaa tcgttgcaga taaaacggta gaagtagtta aaaacgcaat cgaaaccgca 60 gacggagcat tagatcttta taataaatat ctcgatcagg tcatcccctg gcagaccttt 120 gatgaaacca taaaagagtt aagtcgcttt aaacaggagt attcacaggc agcctccgtt 180 ttagtcggcg atattaaaac cttacttatg gatagccagg ataagtattt tgaagcaacc 240 caaacagtgt atgaatggtg tggtgttgcg acgcaattgc tcgcagcgta tattttgcta 300 tttgatgagt acaatgagaa gaaagcatcc gcccagaaag acattctcat taaggtactg 360 gatgacggca tcacgaagct gaatgaagcg caaaaatccc tgctggtaag ctcacaaagt 420 ttcaacaacg cttccgggaa actgctggcg ttagatagcc agttaaccaa tgatttttca 480 gaaaaaagca gctatttcca gtcacaggta gataaaatca ggaaggaagc atatgccggt 540 gccgcagccg gtgtcgtcgc cggtccattt ggattaatca tttcctattc tattgctgcg 600 ggcgtagttg aaggaaaact gattccagaa ttgaagaaca agttaaaatc tgtgcagaat 660 ttctttacca ccctgtctaa cacggttaaa caagcgaata aagatatcga tgccgccaaa 720 ttgaaattaa ccaccgaaat agccgccatc ggtgagataa aaacggaaac tgaaacaacc 780 agattctacg ttgattatga tgatttaatg ctttctttgc taaaagaagc ggccaaaaaa 840 atgattaaca cctgtaatga gtatcagaaa agacacggta aaaagacact ctttgaggta 900 cctgaagtc 909 <210> 2 <211> 909 <212> DNA <213> artificial sequence <220> <223> ClyA-flag <400> 2 atgactgaaa tcgttgcaga taaaacggta gaagtagtta aaaacgcaat cgaaaccgca 60 gatggagcat tagatcttta taataaatat ctcgatcagg tcatcccctg gcagaccttt 120 gatgaaacca taaaagagtt aagtcgcttt aaacaggagt attcacaggc agcctccgtt 180 ttagtcggcg atattaaaac cttacttatg gatagccagg ataagtattt tgaagcaacc 240 caaacagtgt atgaatggtg tggtgttgcg acgcaattgc tcgcagcgta tattttgcta 300 tttgatgagt acaatgagaa gaaagcatcc gcccagaaag acattctcat taaggtactg 360 gatgacggca tcacgaagct gaatgaagcg caaaaatccc tgctggtaag ctcacaaagt 420 ttcaacaacg cttccgggaa actgctggcg ttagatagcc agttaaccaa tgatttttca 480 gaaaaaagca gctatttcca gtcacaggta gataaaatca ggaaggaagc atatgccggt 540 gccgcagccg gtgtcgtcgc cggtccattt ggattaatca tttcctattc tattgctgcg 600 ggcgtagttg aaggaaaact gattccagaa ttgaagaaca agttaaaatc tgtgcagaat 660 ttctttacca ccctgtctaa cacggttaaa caagcgaata aagatatcga tgccgccaaa 720 ttgaaattaa ccaccgaaat agccgccatc ggtgagataa aaacggaaac tgaaacaacc 780 agattctacg ttgattatga tgatttaatg ctttctttgc taaaagaagc ggccaaaaaa 840 atgattaaca cctgtaatga gtatcagaaa agacacggta aaaagacact ctttgaggta 900 cctgaagtc 909 <210> 3 <211> 48 <212> DNA <213> artificial sequence <220> <223> primer <400> 3 gatcgatgaa ttctgtgcct gtcaaatgga cgaagcaggg attctgca 48 <210> 4 <211> 37 <212> DNA <213> artificial sequence <220> <223> primer <400> 4 gagctcgaat tcgctagccc aaaaaaacgg gtatgga 37

Claims (6)

A recombinant strain characterized in that a gene encoding a ClyA protein operably linked to an inducible promoter is transformed into a strain targeting cancer and capable of copy number control.
The method of claim 1,
The recombinant strain, characterized in that the gene encoding the ClyA protein is bound to one or more tags.
According to claim 1 or claim 2,
The recombinant E. coli strain, characterized in that the inducible promoter and copy number control are controlled by the same inducer.
The method of claim 3,
The strain is a recombinant E. coli strain, characterized in that accession number KCTC18924P.
According to claim 1 or claim 2,
The recombinant E. coli strain, characterized in that the inducible promoter and copy number control are controlled by different inducers.
An anti-cancer composition containing the recombinant strain of claim 1.

Images