KR20240015029A - Recombinant Expression Vector for Secretion of Catalase and Escherichia coli Transformed Therewith - Google Patents

Abstract

Relates to a recombinant expression vector for secretion of CAT protein and an E. coli strain transformed therewith, comprising: flgM gene; CAT gene; and a recombinant expression vector containing the flhDC gene, an E. coli strain transformed therewith, and a pharmaceutical composition for treating cancer containing the E. coli strain as an active ingredient.

Description

Recombinant expression vector for secretion of catalase and Escherichia coli transformed therewith {Recombinant Expression Vector for Secretion of Catalase and Escherichia coli Transformed Therewith}

It relates to a recombinant expression vector for secretion of catalase and an E. coli strain transformed therewith. This patent application claims priority to Korean Patent Application No. 10-2022-0092018 filed with the Korean Intellectual Property Office on July 25, 2022, the disclosure of which is incorporated herein by reference.

Cancer is a disease that ultimately threatens life as the proliferation of cells does not stop, burrows into surrounding tissues and destroys normal cells. As the human body's regulatory ability decreases due to aging, it becomes more vulnerable to cancer. In an aging society, cancer has consistently ranked first among all causes of death for 10 years since 2007, exceeding twice the death rate from heart disease, which ranked second. .

The most effective response system to treat disease is to strengthen immunity, but since cancer cells are not foreign invaders, they avoid the body's immune response without triggering it. Certain viruses or bacteria infect cancer cells more than normal cells, and infected bacteria can become targets of attack by immune cells. Accordingly, anticancer treatment methods have been proposed that intentionally infect specific viruses or bacteria to stimulate the body's immune response to fight against cancer cells. For example, facultative anaerobe bacteria such as Escherichia coli and Salmonella have been shown to selectively colonize and grow in tumors, especially in hypoxic and necrotic areas (Yu et al., 2004; Min et al., 2008; Jiang et al., 2010). Accordingly, technologies for delivering therapeutic substances to cancer cells using the above bacteria are being developed, and studies are being conducted to introduce the genes of therapeutic substances into the viruses or bacteria and deliver them to tumor tissues. However, to date, there is a problem that these substances are produced inside the bacteria and only a small amount is secreted to the outside of the bacteria, reducing the therapeutic effect. Accordingly, there is a need for a device that can not only express therapeutic substances inside bacteria, but also efficiently deliver them to the outside of bacteria.

Meanwhile, hypoxia is a common phenomenon in various types of solid cancers, myocardial infarction, chronic kidney disease, and glioma. In particular, the rapid proliferation of cancer tissue inhibits the formation of vascular tissue, causing hypoxia in solid tumors. It is known that hypoxia in the tumor area can cause resistance to anticancer drugs by increasing the expression of specific genes, and can cause cancer recurrence or metastasis. Meanwhile, catalase (CAT) is an enzyme that decomposes hydrogen peroxide into water and oxygen, and is known to contribute to alleviating hypoxia by generating oxygen in areas where hypoxia is a problem.

Accordingly, the present inventors proposed the flgM gene; CAT gene; And by preparing a recombinant expression vector containing the flhDC gene and an E. coli strain transformed with the recombinant expression vector, the present invention, which can improve and alleviate tumor hypoxia by inducing oxygen generation at the tumor site, was completed. Accordingly, in the treatment of cancer, the present invention has a cancer cell killing effect, an antibiotic resistance improvement effect, an effect of suppressing cancer recurrence or metastasis, and combination use with other treatment therapies (e.g., chemotherapy, nano drug therapy, radiation therapy, etc.). There can be a synergistic effect through

The above information described in this background section is only for improving the understanding of the background of the present invention, and therefore does not include information that constitutes prior art already known to those skilled in the art to which the present invention pertains. It may not be possible.

One aspect is the flgM gene; CAT gene; and a recombinant expression vector containing the flhDC gene, the flgM gene; CAT gene; and the flhDC gene is operably linked to an inducible promoter.

Another aspect is to provide an E. coli strain transformed with the recombinant expression vector.

Another aspect is to provide a pharmaceutical composition for treating cancer containing the E. coli strain as an active ingredient.

One aspect is the flgM gene; CAT gene; and a recombinant expression vector containing the flhDC gene, the flgM gene; CAT gene; and the flhDC gene is operably linked to an inducible promoter.

The present invention relates to a recombinant expression vector containing a gene encoding a fusion protein of flgM and CAT in which the flgM gene and the CAT gene are linked directly or through a linker. Hereinafter, in this specification, the fusion protein of flgM and CAT is referred to as “flgM-CAT.”

As used herein, the term “flgM” refers to a protein or a gene encoding such a protein that inhibits the σ factor responsible for recruiting the RNA polymerase required for late flagellar transcription in the bacterial type 3 secretion system.

The “type 3 secretion system” refers to a pathogenic substance delivery system developed in Gram-negative bacteria. This is a syringe-shaped device that injects pathogenic active proteins directly into the cytoplasm through the host's cell membrane (Mota LJ et al, Ann Med. (2005);37(4):234-249), and is a multi-protein complex structure. In the type 3 secretion system, while the hook-basal body, which is the basic structure capable of creating a flagellum in the cell membrane, is formed, the flgM protein remains in the cytoplasm, and class III genes, such as flagellin, are formed. It acts as an anti-σ ²⁸ factor that interferes with transcription of the subunit FliC or the stator protein MotAB. Afterwards, after completion of the hook-basal body structure, a change in substrate specificity occurs simultaneously within the flagella secretion system, which causes flgM to be secreted out of the cell through the central passage of the hook, and then σ ²⁸ -dependent transcription begins within the cell. . The secretion mechanism of flgM through the flagellum formation process in the type 3 secretion system is as shown in Figure 2.

In one embodiment, the present invention produces a recombinant expression vector containing the flgM gene and the CAT gene, a protein to be secreted, enabling the secretion of flgM through the type 3 secretion system of the strain and the secretion of CAT outside the strain. . The CAT genetic information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI).

As used herein, the term “flhDC” is a main regulator of the flagellin operon gene and can regulate the expression of the flgM gene. According to one embodiment, the recombinant expression vector may further include the flhDC gene along with the flgM gene and the CAT gene, thereby contributing to enhancing the expression or secretion ability of flgM-CAT.

As used herein, the term “gene” should be considered in its broadest sense and may encode a structural protein or a regulatory protein. At this time, the regulatory protein may include transcription factors, heat shock proteins, or proteins involved in DNA/RNA replication, transcription, and/or translation.

As used herein, the term “genetic structure” refers to an assembly, functional unit, or construct containing the genetic information of a protein of interest, and can be interpreted in the broadest sense. For the purposes of the present invention, the genetic construct is intended to enhance secretion of flgM-CAT from an E. coli strain, and may refer to, for example, a DNA insert in which the flgM gene, linker gene, and CAT gene are operably linked. there is.

As used herein, the term “vector” refers to a DNA preparation containing a base sequence encoding the target polynucleotide operably linked to a suitable control sequence to enable expression of the target polynucleotide in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence to regulate such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences that regulate the termination of transcription and translation. After being transformed into a suitable host, the vector can replicate or function independently of the host genome and can be integrated into the genome itself. The vector may be any that can replicate within the host cell. For example, the vector may be a plasmid, cosmid, virus, or bacteriophage in a natural or recombinant state. The vector may include a selection marker for selecting host cells containing the vector. The selection marker is used to select cells transformed with a vector, and markers that confer selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface proteins may be used. For example, the marker may be one or more selected from the group consisting of ampicillin, chloramphenicol, neomycin, puromycin, hygromycin, and zeocin. It may be a selection marker. The vector may include genes involved in replication and/or copy number control, such as an origin of replication and a promoter, and may include restriction enzyme sites, etc., but is not limited thereto. Additionally, appropriate restriction enzymes can be placed at the front and rear ends of the genetic construct of the present invention so that the genetic construct of the present invention can be introduced into a vector.

As used herein, the term “polynucleotide” may be in the form of RNA or DNA, including cDNA and synthetic DNA. DNA can be single-stranded or double-stranded. If single stranded, it may be the coding strand or the non-coding (antisense) strand, and the coding sequence may encode the same polypeptide, as a result of the degeneracy or redundancy of the genetic code. .

The polynucleotide may also include variants of the polynucleotides described herein, wherein the variants of the polynucleotide may be naturally occurring allelic variants of the polynucleotide or non-naturally occurring variants of the polynucleotide. You can. An allelic variant is an alternate form of a polynucleotide that may have a substitution, deletion, or addition of one or more nucleotides that does not substantially alter the function of the polynucleotide being encoded. It is well known in the art that a single amino acid can be encoded by more than one nucleotide codon and that the polynucleotide can be easily modified to produce alternating polynucleotides encoding the same peptide.

According to one embodiment, the recombinant expression vector includes the flgM gene; CAT gene; and flhDC genes, it can contribute to increasing the expression or secretion amount of flgM-CAT. For example, the recombinant expression vector includes the flgM gene; And by additionally including the flhDC gene in addition to the CAT gene, the expression or secretion ability of flgM-CAT may be improved.

As used herein, “inducible promoter” refers to a promoter capable of switching the operation of a linked gene by an inducer, for example, ara promoter, tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 Promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, T7 promoter, pBAD promoter, Tet promoter, trc promoter, pepT promoter, sulA promoter, pol 11(dinA) promoter, ruv promoter, uvrA promoter, uvrB promoter, uvrD promoter , umuDC promoter, lexA promoter, cea promoter, caa promoter, recN promoter, pagC promoter, hip promoter, ansB promoter or pflE promoter. In one embodiment, the promoter may be an ara promoter or a Tet promoter.

The recombinant expression vector according to one embodiment may have increased expression or secretion ability of the flgM-CAT as gene expression is regulated by the Tet promoter.

As used herein, “operably linked” may refer to nucleotide sequences being linked on a single nucleic acid fragment such that one function is affected by the other.

In one embodiment, the flgM gene; CAT gene; and flhDC genes may be regulated by the same inducible promoter. In one embodiment, the promoter may be a Tet promoter.

According to one embodiment, the recombinant vector includes the flgM gene; CAT gene; As the expression of the flhDC gene is regulated by the same inducible promoter, the expression or secretion ability of flgM-CAT may be improved.

In one embodiment, the recombinant expression vector includes the flgM gene consisting of the polynucleotide sequence of SEQ ID NO: 1, the CAT gene consisting of the polynucleotide sequence of SEQ ID NO: 4, and the flhDC gene consisting of the polynucleotide sequence of SEQ ID NO: 9. You can. In one embodiment, the recombinant expression vector may include the polynucleotide sequence of SEQ ID NO: 8.

In one embodiment, the flgM gene and the CAT gene may be connected through a linker.

As used herein, the term “linker” refers to a polypeptide chain or the gene encoding the same used to connect a heterologous domain to a protein of interest. The linker peptide may be 2 to 50 amino acids long, e.g., 2 to 40, 2 to 30, 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 50, It may be 5 to 40, 5 to 30, 5 to 20, 5 to 15, or 5 to 10 amino acids in length, but is not limited thereto. The linker peptide is, for example, (G _{lS m} ) _n (l, m and n are each ≥ 2), (G _{lS m} ) _{n- Hp-} (G _{lS m} ) _n (l, m and n is each ≥ 1, H ≥ 6), (G ₄ S) _a (EAAAK) _b (G ₄ S) _a (a, b are integers from 1 to 4), (G ₄ S) _p (EAAAK) _q ( p _, q are integers from _{1 to} 4 _{) , (} EAAAK) i is an integer from 1 to 4), KESGSVSSEQLAQFRSLD, EGKSSGSGSESKST, GSAGSAAGSGEF, (EAAAK) _k (k is an integer from 1 to 5), CRRRRRREAEAC, GGGGGGGG, GGGGGG, AEAAAKEAAAAKA, PAPAP, VSQTSKLTRAETVFPDV, PLGLWA, TRHRQPRGWE, AGNRVRRSVG, RR RRRRRR, GSHHHHHHSG , GGSSHHHHHHSSGG, GGSSHHHHHHSGGSHHHHHSSGG, and GGSSHHHHHHSSGLVPRGSHTS, but is not limited thereto. In one embodiment, the linker peptide may be GGSSHHHHHHSSGG.

In one embodiment, the flgM gene and the CAT gene may be connected through a linker consisting of the polynucleotide sequence of SEQ ID NO: 7.

The recombinant expression vector according to one embodiment may have improved expression or secretion ability of flgM-CAT by linking the flgM gene and the CAT gene through a gene (SEQ ID NO: 7) encoding the GGSSHHHHHHSSGG linker peptide.

Another aspect is to provide an E. coli strain transformed with the recombinant expression vector. In the above E. coli strain, among the terminological elements mentioned, those that are the same as those already mentioned are as described above.

In one embodiment, the E. coli strain may be Escherichia coli strain Nissle 1917 (EcN). According to one embodiment, the expression or secretion ability of flgM-CAT may be improved by using an E. coli strain, for example, an EcN strain, as the strain.

As used herein, the term “transformation” refers to introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed within the host cell. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, or may be introduced into the host cell in its own form and operably linked to the sequence required for expression in the host cell. It doesn't work.

As used herein, the term "attenuated" refers to artificially weakening the toxicity of a living pathogen. It means mutating the genes involved in the essential metabolism of the pathogen to prevent it from causing disease in the body and stimulating only the immune system to induce immunity. . Genes that cause attenuation of bacteria are well known in the art, and may be, for example, loss of function of one or more genes among aroA, aroC, aroD, aroE, asd, rcsB, or galE. When applied in vivo, the function of two or more of the above genes may be lost in order to prevent reduction to the wild type and further weaken toxicity.

The E. coli strain may be targeted to the tumor site and have anticancer activity or anticancer adjuvant activity by increasing oxygen production at the tumor site.

In one embodiment, the E. coli strain may be one deposited under the accession number KCTC15492BP.

Another aspect provides a pharmaceutical composition for preventing or treating cancer containing the E. coli strain as an active ingredient. In the pharmaceutical composition, among the terminological elements mentioned, those that are the same as those already mentioned are as described above.

“Cancer,” a disease to be prevented or treated by the composition of the present invention, has aggressive characteristics in which cells divide and grow in defiance of normal growth limits, invasive characteristics that infiltrate surrounding tissues, and It is a general term for diseases caused by cells with metastatic characteristics that spread to other parts of the body. The cancer may be, for example, a solid cancer, and preferably, if it is a tumor containing cancer tissue or cancer cells in which the cancer-targeting ability of the E. coli strain can be demonstrated, the application can be extended without limitation. For example, the type of cancer includes any one selected from the group consisting of head and neck cancer, skin cancer, pancreatic cancer, colon cancer, colon cancer, stomach cancer, liver cancer, colon cancer, brain cancer, breast cancer, thyroid cancer, bladder cancer, esophageal cancer, uterine cancer, and lung cancer. It may apply, but is not limited thereto.

In one embodiment, the composition may be a composition for adjuvant anticancer treatment. The term “anti-cancer treatment adjuvant” can be used interchangeably with “anti-cancer therapy adjuvant” or “anti-cancer adjuvant”, which refers to anti-cancer drug resistance or side effects of anti-cancer drugs. It may refer to an adjuvant used to suppress or improve. The term "inhibition" may refer to any action that reduces the side effects or resistance of an anticancer drug by the administration of an anticancer adjuvant, and the term "improvement" means a reduction in the side effects or resistance of an anticancer drug by the administration of an anticancer adjuvant, or a reduction in the side effects or resistance of an anticancer drug by the administration of an anticancer adjuvant. It can refer to any action that improves or changes the symptoms of cancer to a benefit due to a decrease in .

In one embodiment, the composition may be administered in combination with an anticancer agent simultaneously, separately, or sequentially to enhance the anticancer effect of the anticancer agent, such as an inhibitory effect on cancer cell growth or an inhibitory effect on cancer metastasis. This may mean that the effect produced when the composition is administered in combination with an anticancer agent is greater than the effect produced when the composition is administered alone. For example, when the composition is administered alone, it does not show a significant anti-cancer effect, but when administered in combination with an anti-cancer agent, it may enhance the anti-cancer effect of the anti-cancer agent. The term “enhancing the anticancer effect of an anticancer agent” may mean enhancing the sensitivity of the anticancer agent and increasing the sustainability of the anticancer effect upon repeated administration of the anticancer agent.

In one embodiment, the composition may be used to enhance the anticancer effect of an anticancer agent against anticancer drug resistant cancer. The term "anticancer drug-resistant cancer" refers to a condition in which cancer prevention, improvement, or treatment is not effectively achieved in anticancer treatment by administering anticancer drugs. Specifically, the sensitivity of cancer cells to anticancer drugs is lowered, resulting in cells induced by anticancer drugs. In addition to all types of cancer in which the mechanism of death and cytotoxicity is not effective, cancers that initially showed anticancer effects due to anticancer drug administration, but gradually decreased or lost the anticancer effect due to repeated anticancer drug administration. It may include everything.

The composition of the present invention can be prepared by methods known in the pharmaceutical field for use as a drug for preventing or treating cancer, and can be used as such or as a pharmaceutically acceptable carrier, forming agent, It can be used by mixing with a diluent, etc.

As used herein, “pharmaceutically acceptable carrier” may be determined in part depending on the particular composition being administered, as well as in part depending on the particular method used to administer the composition. Accordingly, suitable formulations of the compositions vary widely; for example, the compositions may be formulated for parenteral (i.e., intramuscular, intradermal, or subcutaneous) administration or nasopharyngeal (i.e., intranasal) administration. Generally, formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers can include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles may include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases.

The dosage of the active ingredient according to the present invention can be appropriately selected depending on the absorption of the active ingredient in the body, the form of the preparation, the patient's age, gender and condition, the severity of symptoms, etc., and the administration may be done once a day. , may be administered in several divided doses. The typical dosage is 0.001mg/kg·day to 10g/kg·day.

Another aspect provides a method for preventing or treating cancer, comprising administering to a subject an anti-cancer pharmaceutical composition containing the E. coli strain as an active ingredient in an amount effective for preventing or treating cancer. In the method for preventing or treating cancer, among the terms or elements mentioned, those that are the same as those already mentioned are as described above.

The subject may be a mammal. The mammal may be a human, dog, cat, cow, goat, or pig.

The administration may be administered through any common route as long as it can reach the target tissue. For example, it can be administered through routes such as eye drop administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, transdermal patch administration, oral administration, intranasal administration, intrapulmonary administration, and intrarectal administration. Specifically, it can be administered according to the purpose through a route of eye drop administration.

The terms “treatment” or “treating” or “palliative” or “ameliorative” are used interchangeably herein. These terms refer to methods of obtaining advantageous or desired results, including but not limited to therapeutic benefits and/or prophylactic benefits. Treatment benefit means any therapeutically significant improvement or effect on one or more diseases, conditions or symptoms under treatment. For prophylactic benefit, the composition may be administered to a subject at risk of developing a particular disease, condition or condition or to a subject who reports one or more physiological symptoms of the disease, even if the disease, condition or condition has not yet manifested.

As used herein, the term “effective amount” or “therapeutically effective amount” refers to an amount of agent sufficient to cause a beneficial or desired result. The therapeutically effective amount may vary depending on one or more of the subject and condition being treated, the subject's weight and age, the severity of the condition, the mode of administration, etc., and can be easily determined by a person skilled in the art. The term also applies to a capacity that will provide an image for detection by any of the imaging methods described herein. The specific dosage may vary depending on one or more of the specific agent selected, the dosage regimen followed, whether it is administered in combination with other compounds, the timing of administration, the tissue being imaged, and the bodily delivery system carrying it.

According to the recombinant expression vector according to one aspect, it was confirmed that in the case of the E. coli strain transformed with the recombinant expression vector, the expression and secretion of flgM-CAT was significantly enhanced.

In addition, according to the recombinant expression vector according to one aspect, it was confirmed that when a preparation containing an E. coli strain transformed with the recombinant expression vector was administered, it exhibited excellent anticancer effect and stability.

Figure 1 is a diagram schematically showing the extra-strain secretion process of flgM-CAT using a type 3 secretion system.
Figure 2 is a diagram briefly showing the secretion mechanism of flgM through the flagellum formation process in the type 3 secretion system.
Figure 3 is a diagram showing the cleavage map of the flgM-CAT-flhDC-pBAD33 plasmid.
Figure 4 shows the results of confirming the flgM-CAT protein secretion level of the strain according to Comparative Example 1 through Western blot.
Figure 5 shows the results of confirming the flgM-CAT protein secretion level of the strain according to Comparative Example 2 through Western blot.
Figure 6 shows the results of confirming the flgM-CAT protein secretion level of the strain according to Comparative Example 3 through Western blot.
Figure 7 shows the results of confirming the flgM-CAT protein secretion level of the strain according to Example 1 through Western blot.
Figures 8 and 9 show the results of confirming the oxygen generation effect of the strain according to one embodiment.
Figure 10 shows the results of confirming the cancer cell killing effect of a strain according to an example through LDH assay.

Below, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are provided only to make the present invention easier to understand, and the content of the present invention is not limited by the following examples.

Example 1. Preparation of plasmid for CAT secretion and strain transformed therewith

1-1. Preparation of insert DNA

To prepare a plasmid for CAT secretion, a genetic construct in which the flgM gene and the CAT gene were linked was prepared.

Specifically, the flgM DNA sequence of wild-type Salmonella (flgM anti-sigma-28 factor FlgM [Salmonella enterica subsp. enterica serovar Typhimurium str. LT2] Gene ID: 1252690, Locus tagSTM1172 NC_003197.2 (1257036..1257341, complement)) , DNA sequences obtained through codon optimization for CAT were linked through a linker to prepare a genetic construct. In order to increase the expression of the flgM gene, a shine-Dalgarno sequence was inserted in front of the flgM gene. Additionally, for cloning, an nheI site (GCTAGC) was inserted at the front, and a SacI site (GAGCTC) was inserted after the stop codon of CAT. ) was inserted. A genetic construct containing flgM, linker, and CAT was manufactured through Bionics Gene Synthesis Service, and the genetic construct was treated with 10U of nheI and SacI enzymes each and reacted at 37°C for 2 hours. Afterwards, after electrophoresis, approximately 2000 bp DNA was confirmed using a gel extraction kit (Qiagen Co., Ltd.) to obtain flgM-linker-CAT insert DNA.

Then, in order to obtain flhDC insert DNA, a PCR product containing the flhDC gene was obtained by PCR using the flhD-sac1-F and flhC-Sal1-r primers in Table 1 below using the genomic DNA of wild-type Salmonella LT2 as a template. . Specific PCR conditions are as follows; 5 μl of 10x buffer, 10 μl of 5xQ solution, 7.5 μl of 2 mM dNTPs, 2.5 μl of 20 μM flhD-sac1-f primer, 2.5 μl of 20 μM flhC-Sal1-r primer, 1 μl of Taq polymerase, 2 μl of 10 ng/μl genomic DNA, and water. 19.5 μl was mixed and PCR was performed using the Qiagen system at 95°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 49°C for 30 seconds, and 72°C for 1 minute, followed by 72°C for 10 minutes. 1 μg of the PCR fragment purified using a PCR purification kit and 10 U each of sacI and SalI were reacted at 37°C for 2 hours, and the reaction product was purified using a PCR purification kit to prepare flhDC insert DNA (SEQ ID NO: 9).

denomination sequence information sequence number flhD-SAC1-f gatcgatcgagctcaggaggtttgatcctatgggaacaatgcatacatccgagttgct 10 flhC-Sal1-r gatcgatcgtcgacttaaacagcctgttcgatctgttcatccagcagtt 11

1-2. Preparation of plasmids

1-2-1. Preparation of flgM-CAT-flhDC-pBAD18-asd+ plasmid

Afterwards, using the pBAD18 asd+ plasmid as a vector, 10U each of nheI and SacI enzymes were reacted at 37°C for 2 hours, and the reaction products were purified using a PCR purification kit to obtain each vector DNA. The asd gene inserted into the plasmid may consist of the base sequence of SEQ ID NO: 14. Afterwards, each vector DNA was ligated with the flgM-CAT insert DNA at 25°C for 30 minutes and transformed into DH5a competent cells. Thereafter, the transformed cells were spread on LB amp (ampicillin) solid medium and cultured at 37°C to select colonies with antibiotic resistance. Six candidate colonies were selected and reacted with 10 U each of nheⅠ and SacⅠ for 1 hour at 37°C, and the generation of a band of approximately 2000 bp was confirmed through electrophoresis. In addition, base sequence analysis of the candidate group was performed on the plasmid to confirm the insertion of the flgM, linker, and CAT genes.

1 μg of each of the above plasmids was reacted with 10U of sacⅠ and SalⅠ for 2 hours at 37°C, and then the reaction product was purified using a PCR purification kit to complete vector DNA. Afterwards, each vector DNA was ligated with the flhDC insert DNA for 30 minutes at 25°C, and then DH5a competent cells were transformed. Transformed cells were plated on LB amp solid medium and cultured at 37°C to select colonies with antibiotic resistance. Six candidate colonies were selected and reacted with 10U of sacⅠ and SalⅠ at 37°C for 1 hour, and then the generation of bands was confirmed through electrophoresis. Base sequence analysis of the candidate group was performed to confirm the insertion of the flhDC gene.

Through this, flgM-CAT-flhDC-pBAD18-asd+ plasmid according to an example and comparative example was prepared.

1-2-2. Preparation of flgM-CAT-flhDC-pBAD33 plasmid

The flhDC pBAD33 plasmid was purchased from Chungnam National University and used as a vector. After reacting 10U each of nheI and SacI enzymes at 37°C for 2 hours, the reaction product was subjected to electrophoresis, and approximately 6300bp of DNA was extracted using a Gel extraction kit (Qiagen). Through this, -flhDC-pBAD33 vector was obtained.

Afterwards, the flgM-CAT insert DNA of Example 1-1 and the -flhDC-pBAD33 vector obtained above were ligated at 25°C for 30 minutes, and then DH5a competent cells were transformed. The transformed cells were spread on LB cm (chloramphenicol) solid medium and cultured at 37°C for 16 to 24 hours to select colonies with antibiotic resistance. Six candidate groups from the selected colonies were selected and reacted with SacⅠ and SalⅠ 10U for 1 hour at 37°C. A band of approximately 2600 bp was confirmed through electrophoresis, and base sequence analysis of the candidates was performed. In this way, the flgM-CAT-flhDC-pBAD33 plasmid according to one example was prepared.

1-2-3. Preparation of pBAD33 plasmid into which Tet promoter was introduced

To introduce the Tet promoter into the plasmid of Example 1-2-2, a plasmid was prepared as follows.

Specifically, to obtain Tet insert DNA, the DNA was deposited at the Korea Research Institute of Bioscience and Biotechnology Biological Resources Center under the accession number KCTC8808P ( Salmonella typhimurium LT2 ΔgalE::tetRA, ΔflhDC::Tn10) (see Korean Patent No. 10-2246740). PCR was performed using the strain as a template and the primers shown in Table 2 below. Specific PCR conditions are as follows; 5 μl of 10x buffer, 10 μl of 5xQ solution, 7.5 μl of 2 mM dNTPs, 2.5 μl of 20 μM TetR-cla1-for primer, 2.5 μl of 20 μM TetR-nhe1-re primer, 1 μl of Taq polymerase, 2 μl of 10 ng/μl genomic DNA, and water. 19.5 μl was mixed and PCR was performed using the Qiagen system at 95°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 49°C for 30 seconds, and 72°C for 1 minute, followed by 72°C for 10 minutes. 1 μg of the PCR fragment purified using the PCR purification kit and 10 U each of cla1 and nhe1 were reacted at 37°C for 2 hours, and the reaction product was purified using the PCR purification kit to obtain Tet insert DNA.

denomination sequence information sequence number TetR-cla1-for gatcgatcatcgatttaagacccactttcacatttaagttgtttttcta 12 TetR-nhe1-re CATAGGATCAAACCTCCTGCTAGCACTTTTCTCTATCACTGATAG 13

Thereafter, the flgM-CAT-flhDC-pBAD33 plasmid of Example 1-2-2 was treated with 10 U each of claⅠ and nheⅠ, and reacted at 37°C for 2 hours. Afterwards, the reaction product was subjected to electrophoresis, and about 7500 bp of DNA was extracted from the gel using a gel extraction kit (Qiagen) to prepare the -flgM-CAT-flhDC-pBAD33 vector. The Tet insert DNA and -flgM-CAT-flhDC-pBAD33 vector were ligated at 25°C for 30 minutes and then transformed into DH5a competent cells. Thereafter, the transformed cells were plated on LB cm solid medium and cultured at 37°C to select colonies with antibiotic resistance. Six candidate groups of selected colonies were selected, treated with 10 U each of claⅠ and nheⅠ, and reacted at 37°C for 1 hour. Then, a band of about 600 bp was confirmed through electrophoresis, and the base sequences of the candidates were analyzed. In this way, Tet-flgM-CAT-flhDC-pBAD33 plasmid according to one example was prepared.

Meanwhile, the genetic information of the main structures in this example is shown in Table 3 below.

denomination sequence information sequence number flgM atgagcattgaccgtacctcacctttgaaacccgttagcactgtccagacgcgcgaaaccagcgacacgccggtacaaaaaacgcgtcaggaaaaaacgtccgccgcgacgagcgccagcgtaacgttaagcgacgcgcaagcgaagctcatgcagccaggcgtcagcgacattaatatggaacgcgtcgaagcatta aaaacggctatccgtaacggtgagttaaaaatggatacgggaaaaatagcagactcgctcattcgcgaggcgcagagctacttacagagtaaaaaa One CAT1 ATGGCTGATAGCCGTGACCCGGCGAGCGATCAGATGCAGCACTGGAAAGAACAGCGTGCAGCGCAGAAAGCGGATGTTCTGACCACCGGCGCGGGTAACCCGGTTGGTGATAAACTGAACGTTATCACCGTTGGCCCGCGTGGCCCGCTGCTGGTTCAGGATGTTGTTTTCACCGATGAAATGGCTCACTTCGATCGTGAACGTATCCCGGAACGTGTTGTTCACGCTAAAGGTGCAGGGCGCTTTCGGTTACTTC GAAGTTACCCACGATATTACCAAATACTCTAAAGCGAAAGTTTTCGAACACATCGGCAAGAAAACCCCGATCGCAGTTCGCTTTTCTACCGTTGCTGGTGAATCTGGTAGCGCTGATACCGTGCGTGATCCGCGTGGTTTCGCGGTTAAATTCTACACCGAAGATGGTAACTGGGATCTGGTTGGTAACAACACTCCGATTTTCTTCATCCGTGATCCGATCCTGTTCCCGTCTTTCATCCATTCTCAGAAACGTAAC CCGCAGACCCACCTGAAAGATCCGGACATGGTTTGGGACTTCTGGTCTCTGCGTCCGGAATCTCTGCACCAGGTTAGCTTCCTGTTTTCTGATCGCGGTATCCCGGATGGCCACCGCCATATGAACGGCTACGGTAGCCACACCTTTAAACTGGTTAACGCTAACGGTGAAGCGGTTTACTGCAAATTCCACTACAAAACCGATCAGGGTATTAAAAAACCTGTCTGTTGAAGATGCTGCACGTCTGAGCCAGGAAGATCCGG ATTACGGCATCCGTGACCTGTTTAACGCGATCGCGACCGGCAAATACCCGAGCTGGACCTTCTACATCCAGGTGATGACCTTCAACCAGGCAGAAACCTTCCCGTTCAACCCGTTCGATCTGACCAAAGTTTGGCCGCACAAAGACTACCCGCTGATTCCGGTTGGTAAACTGGTTCTGAACCGCAACCCGGTTAACTACTTCGCAGAAGTTGAACAGATCGCCTTCGATCCGTCCAACATGCCGCCGGGTATCGAAGCAAGCCCGG ATAAAATGCTGCAGGGCGGTCTGTTCGCATACCCGGATACCCACCGTCATCGTCTGGGCCCGAACTACCTGCACATCCCGGTTAACTGCCCGTACCGTGCACGTGTTGCCAACTACCAGCGTGACGGCCCGATGTGCATGCAGGATAACCAGGGCGGTGCGCCGAACTACTATCCGAACAGCTTCGGCGCACCGGAACAGCAGCCGAGCGCACTGGAACACAGCATCCAGTACAGCGGTGAAGTTCGCCGTTTCAACACCGCGC TAACGATGATAACGTTACCCAGGTTCGTGCTTTCTACGTTAACGTTCTGAACGAAGAACAGCGTAAACGTCTGTGCGAAAACATCGCTGGCCACCTGAAAGATGCACAGATCTTCATTCAGAAAAAAGCGGTTAAAAACTTCACCGAAGTTCACCCGGATTACGGTTTCCCACATCCAGGCACTGCTGGATAAATATAACGCGGAAAAACCGAAAAACGCGATCCACACCTTCGTTCAGTCTGGTTCTCACCTGGCGGCGCGTG AAAAAGCTAACCTGTAA 2 CAT2 atgagttcaaataaactgacaactagctggggcgctccggttggagataatcaaaactcaatgactgccggttctcgcggaccaactttaattcaagatgtacatttactcgaaaaattggcccatttcaaccgagaacgtgttcctgaacgtgttgttcacgccaaaggagcaggcgcacacggatattttgaagtgacaaacgacgtaacaaa atacacgaaagccgctttcctttctgaagtcggcaaacgcacaccgttgttcatccgtttctcaacagttgccggtgaacttggctctgctgacacagttcgcgacccgcgcggatttgctgttaaattttatactgaagaaggaaactacgacatcgtcggcaacaatacgcctgtattctttatccgcgatgcgattaagt tccctgatttcatccatacacaaaaaagagatccaaaaacacacctgaaaaaccctacggctgtatgggatttctggtcactttcaccagagtcactgcaccaagtgacaatcctgatgtctgaccgcggaattcctgcgaacacttcgccacatgcacggcttcggaagccatacattcaaatggacaaatgccgaaggcgaaggcgtatggattaaata tcactttaaaacagaacaaggcgtgaaaaaccttgatgtcaatacggcagcaaaaattgccggtgaaaaccctgattaccatacagaagacctttttcaacgcaatcgaaaacggtgattatcctgcatggaaactatatgtgcaaatcatgcctttagaagatgcaaatacgtaccgtttcgatccgtttgatgtcacaaaagtttggtct caaaaagactacccgttaatcgaggtcggacgcatggttctagacagaaatccggaaaactactttgcagaggtagaacaagcgacattttcacctggaaccctcgtgcctggtattgatgtttcaccggataaaatgcttcaaggtcgacttttttgcttatcatgatgcacaccgctaccgtgtcggtgcaaaccatcaagcgctg ccaatcaaccgcgcacgcaacaaagtaaacaattatcagcgtgatgggcaaatgcgttttgatgataacggcggcggatctgtgtattacgagcctaacagcttcggcggtccaaaagagtcacctgaggataagcaagcagcatatccggtacaaggtatcgctgacagcgtaagctacgatcactacgatcactacactcaagccgg cgatctgtatcgtttaatgagtgaagatgaacgtacccgccttgttgaaaatatcgttaatgccatgaagccggtagaaaaagaagaaatcaagctgcgccaaatcgagcacttctacaaagcggatcctgaatacggaaaacgcgtggcagaaggccttggattgccgattaaaaaagattctGGCGGCAGCAGCCATCACCATCACCATCACtaa 3 CAT3 atgagcacgaccgacgatacccataacacgttatccactggaaaatgtcctttccatcagggggggcatgaccgaagcgcaggcgcagggactgccagccgcgactggtggccgaaccagcttcgcgtggatcttttgaatcaacattccaaccgttctaacccgctgggtgaagactttgactaccgcaaagagtttagcaagttagactactcc gccctgaaaggggatctcaaggcgctgctgaccgattcacaaccgtggtggcccgctgactggggcagctatgtcggtttgtttattcgcatggcctggcatggcgctggcacctaccgttctattgatggtcgtggcggcgcgggtcgtggtcaacagcgttttgcgccgcttaactcctggccggataacgtcag cctggataaggcgcgtcgtttgttgtggccgattaagcagaaatatggccagaaaatttcctgggccgacctgtttattctggcgggtaacgtggcgctggaaaactccggcttccgtaccttcggtttcggcgccgggcgtgaagatgtctgggaaccggatctggatgtgaactggggcgatgaaaaagcctggtt gactcaccgacaccctgaagcgctggcaaaagcgccgctgggcgcgaccgagatgggccttatctacgttaacccggaagggccggatcacagcggcgaaccactttctgccgccgccgctattcgcgctacctttggcaatatggggatgaacgacgaagagaccgtggcgttgatcgctggcgggcataccctcggtaaaacccacggcgc ggcagcggcatcccatgtaggggccgatccggaagccgcgccgattgaagcgcagggcttaggttgggccagcagctatggtagtggcgttggcgcggatgctatcacctccgggctggaagtggtctctggacgcagacgccgacccagtggagcaactatttcttcgagaacctgttcaaatatgagtgggtacaaacccgtagtccgg ctggcgctatccagtttgaagcggtagacgcgccggacatcatcccggacccgttcgatccgtcgaaaaaacgtaagccaaccatgctggtcaccgacctgacgctgcgttttgatccggagttcgagaagatttcccgtcgtttccttaacgatccgcaggcctttaatgaagcctttgctcgtgcctggttcaa actgacgcacagagatatgggaccaaaagcgcgttacatcggaccggaagtgccgaaagaagatctgatctggcaggacccgttgccgcaaccgctctatcagccaacgcaggaagacattatcaacctgaaagcggcgatcgctgcatccgggctttctattagcgagatggtttcggttgcctgggcatccgcgtctactttccg cggcggcgataagcgtggcggcgctaacggcgcgcgtctggcattagcgcctcagcgcgactgggatgtcaacgccgttgcggctcgcgttctgccggtattagaagagatccagaaaacgacgaataaagcctcgctggccgatattattgtgctggcgggcgtggtcggtatcgagcaggcggccgctgctg cgggtgtcagcatcagcgtaccttttgcgccgggccgggtggatgcgcgtcaggatcagaccgacatcgagatgttctcgctgcttgaaccgattgctgatggattccgtaactatcgtgcgcgtctggatgtgtcgacgaccgaatcgctgttgattgataaagcgcagcagttaacgttgaccgc gccggaaatgacggtactggttggcgggatgcgtgtgctgggaaccaactttgacggcagccagaacggtgtctttaccgacagaccgggcgtgctcagcactgacttcttcgctaatctgctggatatgcgttacgagtggaagcccaccgacgacgctaatgagctgttcgaaggccgggatcgtctgactggcgaggta aaatacacggcgacccgcgccgatctggtgtttggttccaactccgtactgcgcgcgctggcggaagtttacgcgtgtagcgatgcgcacgagaagtttgtgaaggacttcgtcgcggcatgggtgaaagtgatgaacctggaccgtttcgatctgcaaGGCGGCAGCAGCCATCACCATCACCATCACCATCACT AA 4 linker1 GGCGGCAGCAGCCATCACCATCACCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATACTAGT 5 linker2 GGCGGCAGCAGCCATCACCATCACCATCACAGCGGCGGCAGCCATCACCATCACCATCACAGCAGCGGCGGC 6 linker3 GGCGGCAGCAGCCATCACCATCACCATCACAGCAGCGGCGGC 7 flhDC AGGAGGTTTGATCCTatgggaacaatgcatacatccgagttgctaaaacacatttatgacatcaatttgtcatatttactccttgcacagcgtttgatcgtccaggacaaagcatctgcgatgttccgcctcggtatcaacgaagagatggcaaacacactgggcgcgttgaccctgccgcagatggtcaaactggcggagacgaaccagt tagtttgtcatttccggtttgacgatcatcagacgatcacccgtttgactcaggattcgcgcgtcgatgacttacagcagattcacacaggtatcatgctttcaacgcgtctgctcaatgaagtggacgatacggcgcgtaagaaaagggcatgaaagggcatgataatgagtgaaaaaagcattgttcaggaagctcgcgata tccagttggcgatggagttgattaatcttggcgctcgtctacaaatgctggaaagcgaaacacagctcagccgtggtcgcctcatcaggctgtacaaagaattacgcggtagcccgccgcctaaaagggatgctgccattttcgacagactggtttatgacctgggagcaaaatattcatgcctccatgttctgcaacgcctggcaattttta ctgaagaccggcttatgcagcggtgtggatgcggtgattaaagcttatcggctttatcttgagcagtgtccgcaaccgcctgaagggccgttgttggcgctgactcgcgcatggacgctggtgcgttttgttgaaagtgggttgcttgaattgtcgagctgtaactgctgcggtgggaactttattacccatgc gcatcagcccgtaggcagctttgcgtgtagtttatgccagccgccatcccgcgcagtaaaaagacgtaaactttcccgagatgctgccgatattattccacaactgctggatgaacagatcgaacaggctgtttaa 9

1-3. Preparation of an E. coli strain secreting flgM-CAT

The plasmids of Example 1-2 were transformed into the following strains, respectively: BRD 509, BRD509 asd rcsB galE:tetRA-(#1323), and EcN ( E.coli Nissle 1917) strains. The BRD 509 and BRD509 asd rcsB galE:tetRA- (#1323) strains were distributed from Chungnam National University, and the EcN strain was distributed from Chonnam National University. The genes and strain information of the transformed strain are shown in Table 4 below.

Example 1 Comparative Example 1 Comparative example 2 Comparative Example 3 CAT-linker gene CAT3-linker3 CAT1-linker1 Cat2-linker2 Cat3-linker3 plasmid pBAD33 pBAD18 asd+ pBAD18 asd+ pBAD33 strain EcN #1323 #1323 BRD 509 promoter Tet ara ara ara

The present inventors deposited the flgM-CAT-flhDC-pBAD33/EcN strain according to an example to the Korea Research Institute of Bioscience and Biotechnology Biological Resources Center on June 29, 2023, and received accession number KCTC15492BP (flgM-CAT4-flhDC- pBAD33/EcN).

Experimental Example 1. Confirmation of protein expression and secretion ability

In order to confirm the expression and secretion ability of flgM-CAT in the E. coli strain transformed with the recombinant expression vector according to one example, the protein expression level was measured through Western blot in the following manner.

Specifically, a single colony of each transformed strain was inoculated into LB amp liquid medium (Comparative Example 1 and Comparative Example 2) or LB cm liquid medium (Comparative Example 3 and Example 1), and then incubated at 12 to 16 degrees Celsius at 37°C. Time shaking culture was performed. Afterwards, it was diluted to an OD600 of 0.05 in fresh LB amp liquid medium or LB cm liquid medium, and then cultured with shaking at 37°C for 2 hours. Thereafter, when the OD600 was 0.4 to 0.6, the group treated with arabinose (Comparative Examples 1 to 3, final concentration 0.2% (w/v)) or doxycycline (Example 1, final concentration 100 ng/ml) was divided into the test group ( +), and the untreated group was divided into the control group (-), which was cultured with shaking for an additional 5 hours at 37°C. Thereafter, the samples of the test group and control group were separated into whole cell culture, pellet, and supernatant. The pellet and supernatant were separated from the entire cell culture by centrifugation at 8000 rpm. Additionally, the supernatant was again filtered through a 0.2μm filter to completely remove bacteria, and concentrated using Pall's nanosep (OD010C35 3K omega).

Samples for Western blot were prepared by mixing 50 μl each of the total cell culture, pellet, and supernatant samples with SDS sample buffer. Each sample was denatured in a heating block at 100°C for 5 minutes, centrifuged at 13000 rpm at 4°C for 5 minutes, and electrophoresed on a 10% polyacrylamide gel. The gel was transferred using PVDF (polyvinylidene fluoride) to transfer proteins to a PVDF membrane, and the membrane was blocked for 1 hour at room temperature using blocking buffer. Afterwards, anti-his tag (SB194b, SouthernBiotech) was diluted 1/1000 as the primary antibody and reacted at 4°C for 16 hours. Afterwards, the membrane was washed three times at 10-minute intervals with TBST (Tris-buffered saline with 0.1% Tween-20), followed by mouse anti-mouse-IgG (#7076s, Cell signaling, Danvers, MA, USA) secondary antibody. and reacted at room temperature for 1 hour. After reaction, the cells were washed three times at 10-minute intervals with TBST, sensitized to X-ray film using ECL buffer, and developed to confirm the expression level of each protein.

Figure 4 is the result of processing the strain according to Comparative Example 1, Figure 5 is the result of processing the strain according to Comparative Example 2, Figure 6 is the result of processing the strain according to Comparative Example 3, and Figure 7 is the result of processing the strain according to Comparative Example 3. This is the result of processing the strain according to 1. Lanes 2, 4, and 6 in Figures 4 to 7 are test groups treated with arabinose or doxycycline, and lanes 1, 3, and 5 are control groups not treated with arabinose or doxycycline. In Figures 4 to 7, lanes 1 and 2 are for whole cells (W.C), lanes 3 and 4 are for pellets, and lanes 5 and 6 are for supernatants. Lanes 5 and 6 in Figures 4 and 5 are the results obtained by concentrating 30 ml of the supernatant.

As a result, as shown in Figure 7, in the case of the strain according to one example, secretion of flgM-CAT protein was confirmed even in the supernatant from which the strain was removed. In addition, it was confirmed that the protein was detected at a high level even in the strain culture medium at low concentration, confirming the excellent flgM-CAT expression and secretion ability of the strain according to one example. Through this, it was confirmed that the strain according to one example not only expressed flgM-CAT at a high level, but also secreted the protein at a high level outside the strain.

Experimental Example 2. Confirmation of oxygen generation effect of strain

To confirm the oxygen generation effect of the strain according to one example, an experiment was performed as follows.

2-1. Strain culture preparation

A single colony of the strain according to one example was inoculated into LB cm liquid medium and then cultured in a shaking incubator at 37°C for 12 to 16 hours. Afterwards, the cells were adjusted to an OD600 of 0.05 in fresh LB cm liquid medium, and then cultured with shaking at 37°C for 2 hours. Afterwards, when the OD600 was 0.4 to 0.6, the group treated with doxycycline (final concentration 100ng/ml) was divided into the test group (+), and the untreated group was divided into the control group (-), which were incubated at 37°C. Shaking culture was performed for an additional 5 hours. Afterwards, the culture was centrifuged at 3000 rpm, the supernatant was separated, and the supernatant was again filtered through a 0.2 μm filter to completely remove bacteria and concentrated 30-fold using Pall's nanosep (OD010C35 3K omega).

2-2. Confirmation of oxygen generation effect of strain culture medium

50 μl of the concentrated strain culture of Experimental Example 2-1 was added to 5 ml of 3% H ₂ O ₂ and oxygen generation was observed. As a result, as shown in Figure 8, it was confirmed that significantly more bubbles were generated in the group treated with doxycycline. Through this, it was confirmed that when the expression of flgM-CAT was induced by doxycycline treatment, oxygen generation was significantly increased.

Additionally, 200 μl of 3% H ₂ O ₂ was placed on a glass slide, treated with 20 μl of the concentrated strain culture of Experimental Example 2-1, and the generation of bubbles was observed over time. As a result, as shown in Figure 9, it was confirmed that bubble generation significantly increased over time. Through this, it was confirmed that oxygen generation significantly increased as flgM-CAT expression was induced by doxycycline treatment. In this way, it was confirmed that the strain according to one example can significantly increase oxygen generation by expressing and secreting flgM-CAT at a high level.

Experimental Example 3. Confirmation of anticancer effect

To confirm the cancer cell killing effect of the strain according to one example, an experiment was performed as follows.

3-1. Tumor cell line culture

Human colon cancer cell line SW480 was purchased from American Type Culture Collection. The cells were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. When the number of cells was 2 x 10 ⁵ , the cells were seeded in 6-wells. 24 hours after seeding, 50ul of the supernatant (flgM-CAT) obtained in Experimental Example 2-1 was treated and cultured for 48 hours.

3-2. Confirmation of tumor cell death effect

To measure the degree of cell death of tumor cells caused by the strain according to one example, an LDH assay was performed using DogenBio's EZ-LDH (DG-LDH500) assay kit as follows. Specifically, the culture medium of Experimental Example 3-1 was centrifuged at 1000 rpm for 3 minutes to remove cell debris, and then 100ul of LDH solution was mixed with 10ul of the supernatant treated in this way and incubated at room temperature for 30 minutes. Afterwards, LDH release was measured by measuring absorbance with a 450nm microreader. All experiments were repeated three times.

As a result, as shown in Figure 10, it was confirmed that when the expression of flgM-CAT was induced by doxycycline treatment (+), the amount of LDH released was significantly higher than that of the doxycycline untreated group (-). Through this, the excellent cancer cell killing effect of the strain according to one example was confirmed. In addition, it was confirmed that the above-mentioned cell death was caused by damage to the cell membrane, and it was confirmed that the internal components of the cells stimulate immune cells to induce a secondary anti-cancer immune effect, resulting in a better anti-cancer effect. .

In this way, it was confirmed that the strain according to one embodiment can reduce or improve hypoxia by secreting flgM-CAT at the tumor site, thereby generating oxygen at the tumor site. In addition, the cancer cell killing effect of the strain according to one example was confirmed. Through this, the strain kills cancer cells and reduces hypoxia in the tumor area, thereby increasing sensitivity to radiation therapy, reducing the expression of HIF-1α, reducing or improving resistance to various anticancer drugs, and reducing tumor growth. It was confirmed that it can have an effect of suppressing recurrence and metastasis.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. will be. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC) KCTC15492BP 20230629

Claims (10)

flgM gene; CAT gene; and a recombinant expression vector containing the flhDC gene, the flgM gene; CAT gene; and the flhDC gene is operably linked to an inducible promoter. The method according to claim 1, wherein the flgM gene; CAT gene; And the flhDC gene is a recombinant expression vector whose expression is controlled by the same inducible promoter. The recombinant expression vector of claim 1, wherein the promoter is a Tet promoter. The method according to claim 1, wherein the recombinant expression vector includes the flgM gene consisting of the polynucleotide sequence of SEQ ID NO: 1, the CAT gene consisting of the polynucleotide sequence of SEQ ID NO: 4, and the flhDC gene consisting of the polynucleotide sequence of SEQ ID NO: 9. , recombinant expression vector. The recombinant expression vector according to claim 1, wherein the flgM gene and the CAT gene are linked through a linker. The recombinant expression vector of claim 5, wherein the linker consists of the polynucleotide sequence of SEQ ID NO: 7. An E. coli strain transformed with the recombinant expression vector of claim 1. The method according to claim 7, wherein the E. coli strain has an improved secretion ability for CAT protein. The method according to claim 7, wherein the E. coli strain is deposited under the accession number KCTC15492BP. A pharmaceutical composition for treating cancer comprising the E. coli strain of claim 7 as an active ingredient.