KR20230055870A - Phamaceutical composition for preventing or treating chronic obstructive pulmonary disease comprising Octopus vulgaris extract as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing or treating chronic obstructive pulmonary disease, containing an Octopus vulgaris extract as an active ingredient. The composition containing the Octopus vulgaris extract as the active ingredient inhibits the expression of inflammatory cytokines TNF-α, IL-1β, and IL-6, and the inflammatory enzyme Nos2, and effectively prevents lung tissue damage and inflammatory reactions. Therefore, the composition is expected to be widely used in the treatment and prevention of chronic obstructive pulmonary disease, including pulmonary emphysema.

Description

Pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease comprising octopus extract as an active ingredient {Phamaceutical composition for preventing or treating chronic obstructive pulmonary disease comprising Octopus vulgaris extract as an active ingredient}

The present invention relates to a composition for preventing or treating chronic obstructive pulmonary disease comprising an extract of octopus as an active ingredient.

The octopus ( Octopus vulgaris ) is a cephalopod that lives in sandy intertidal zones and is widely distributed in temperate and tropical regions such as the Pacific, Indian, Mediterranean, and Atlantic Oceans, including Korea, Japan, Taiwan, and Indonesia. The body length is about 80cm, there are large and small humps on the surface of the body, and there is no sack on the leg sucker. The male's right third arm is the copulation arm. Depending on the environment, the body color usually changes from yellowish brown to blackish brown, and there is an irregular net-shaped speckled pattern. Cham octopus is edible, and is caught with octopus jars or traps. It is the most caught species in Korea, and the production in 1975 is said to have exceeded 10,000 tons, and recently it is being farmed. Chammuneo is also called Dolmeoneo, Pimuneo, and Wamuneo.

Chronic obstructive pulmonary disease (COPD) is characterized by an abnormal inflammatory response in the lungs caused by inhalation of harmful particles (such as cigarettes) or gases, accompanied by not completely reversible and progressive airflow limitation. I mean respiratory disease. These chronic obstructive pulmonary diseases include emphysema, chronic bronchitis, and the like.

Chronic obstructive pulmonary disease is one of the top 10 causes of death in Korea, with an increasing incidence and mortality rate due to an increase in smoking rate and an extension of average life expectancy. In emphysema, one of the chronic obstructive pulmonary diseases, damage to the alveoli in the peripheral airways and the walls of the interalveolar spaces in the terminal bronchioles lose their elasticity and are destroyed, resulting in abnormal and permanent expansion. is a disease that The main cause of emphysema is known to be smoking, but it can also be caused by air pollution or exposure to hazardous work environments, and it is known that the rate of progression is accelerated when accompanied by respiratory infections. In the main symptom of emphysema, alveolar enlargement due to tissue destruction, expression of proteolytic enzymes such as matrix metalloproteinase (MMP) and neutrophil elastase are activated, whereas proteolytic enzymes It is known that the expression of α1-antitrypsin, which inhibits it, is reduced. In addition, smoking induces the secretion of various cytokines and chemokines from macrophages and epithelium in the alveoli, activating the inflammatory response, and cytokines/chemokines (TNF-α, IL- 1β, IL-8, MCP-1, IFN-γ, etc.), reactive oxygen species (ROS), etc. are increased, which accelerates tissue damage due to increased expression and activation of proteolytic enzymes. is known to be Emphysema is a disease in which the lung structure is irreversibly damaged and cannot be fundamentally treated. As currently used therapeutic agents, only symptomatic treatment methods according to symptoms such as steroid preparations for relieving inflammatory reactions, bronchodilators for relieving respiratory distress, and expectorants are used.

Therefore, in order to effectively treat chronic obstructive pulmonary disease, there is an urgent need to develop a therapeutic agent capable of reducing the rate of damage to lung structures or inhibiting lung tissue damage.

Domestic registered patent 10-1647029

The present invention was made to solve the above problems in the prior art, and it was confirmed that a composition containing an octopus extract as an active ingredient effectively inhibits lung tissue damage and inflammatory reactions, thereby preventing or preventing chronic obstructive pulmonary disease. The therapeutic effect was confirmed, and based on this, the present invention was completed.

Accordingly, an object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of chronic obstructive pulmonary disease, comprising an octopus extract as an active ingredient.

Another object of the present invention is to provide a health functional food composition for preventing or improving chronic obstructive pulmonary disease, comprising an extract of octopus as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, comprising an octopus extract as an active ingredient.

In addition, the present invention provides a health functional food composition for preventing or improving chronic obstructive pulmonary disease, comprising an octopus extract as an active ingredient.

In addition, the present invention provides a method for preventing or treating chronic obstructive pulmonary disease, comprising the step of administering to a subject a composition containing an octopus extract as an active ingredient.

In addition, the present invention provides a use for preventing or treating chronic obstructive pulmonary disease of a composition comprising an octopus extract as an active ingredient.

In addition, the present invention provides the use of the octopus extract for the preparation of a drug for preventing or treating chronic obstructive pulmonary disease.

In one embodiment of the present invention, the chronic obstructive pulmonary disease may be emphysema, but is not limited thereto.

In another embodiment of the present invention, the octopus extract can inhibit or improve one or more of the following symptoms, but is not limited thereto:

i) increase in lung compliance; and

ii) a decrease in lung elasticity.

In another embodiment of the present invention, the octopus extract can inhibit the expression of one or more inflammatory cytokines selected from the group consisting of TNF-α, IL-1β, and IL-6, but is not limited thereto.

In another embodiment of the present invention, the octopus extract can inhibit the expression of Nos2, but is not limited thereto.

In another embodiment of the present invention, the octopus extract may be extracted with one or more solvents selected from the group consisting of water, C ₁ to C ₄ alcohol, ethyl acetate, chloroform, hexane, and mixed solvents thereof. It is not limited.

In another embodiment of the present invention, the octopus extract may be an octopus leg extract, but is not limited thereto.

The composition containing the octopus extract of the present invention as an active ingredient inhibits the expression of inflammatory cytokines TNF-α, IL-1β, and IL-6 and the expression of the inflammatory enzyme Nos2, and effectively reduces lung tissue damage and inflammatory response. As a result, it is expected to be widely used for the treatment and prevention of chronic obstructive pulmonary diseases including emphysema.

Figure 1 shows the result of NO production in terms of nitrite concentration according to the treatment of octopus extract (2-84) in mouse-derived macrophages according to an embodiment of the present invention.
Figure 2 shows the results of measuring reactive oxygen species (ROS) according to the treatment of the octopus extract in mouse-derived macrophages according to an embodiment of the present invention.
Figure 3 shows the cell viability according to the octopus extract treatment in mouse-derived macrophages according to an embodiment of the present invention.
Figure 4 isolates mRNA from mouse-derived macrophages according to an embodiment of the present invention, inflammatory enzyme Nos2 (nitric oxide synthase 2) and inflammatory cytokine TNF-α (tumor necrosis factor-α) according to octopus extract treatment It shows the result of confirming the expression inhibition effect of.
Figure 5 isolates mRNA from mouse-derived macrophages according to an embodiment of the present invention, the effect of inhibiting the expression of inflammatory cytokines IL-1β (interleukin 1 beta) and IL-6 (interleukin 6) according to the octopus extract treatment It shows the result of checking .
Figure 6 shows the results of confirming the effect of reducing lung compliance and increasing lung elasticity according to octopus extract treatment using FlexiVent RM in an emphysema mouse model according to an embodiment of the present invention.
Figure 7 shows the results of confirming the effect of inhibiting lung tissue damage according to the treatment of the octopus extract through H&E staining in an emphysema mouse model according to an embodiment of the present invention.
8 shows the effect of reducing lung compliance and increasing lung elasticity according to octopus extract treatment using FlexiVent RM in an emphysema mouse model according to an embodiment of the present invention, thereby showing a therapeutic effect on emphysema that has already been created. it is shown
Figure 9 shows the therapeutic effect on the already formed emphysema by confirming the effect of inhibiting lung tissue damage according to the treatment of the octopus extract through H&E staining in an emphysema mouse model according to an embodiment of the present invention.

In another embodiment of the present invention, after treating mouse-derived macrophages with the octopus extract, the anti-inflammatory effect of the octopus extract was confirmed by confirming the NO production inhibitory effect (see Example 2).

In another embodiment of the present invention, after treating mouse-derived macrophages with the octopus extract, the antioxidative effect of the octopus extract was confirmed by confirming the inhibition of ROS production (see Example 3).

In one embodiment of the present invention, RAW 264.7 cells were treated with the octopus extract, and the viability of the cells was analyzed to confirm that the cytotoxicity of the octopus extract was low (see Example 4).

In another embodiment of the present invention, mouse-derived macrophages were treated with octopus extract, and then the effect of inhibiting the expression of inflammatory cytokines and inflammatory enzymes was confirmed (see Example 5).

In another embodiment of the present invention, reduction in lung compliance, increase in lung elasticity, and inhibition of lung tissue damage were confirmed by treatment with octopus extract in a mouse model of emphysema (see Example 6).

In another embodiment of the present invention, in an emphysema mouse model, treatment effects on already formed emphysema were confirmed by confirming the effect of reducing lung compliance, increasing lung elasticity, and reducing lung tissue damage according to the treatment of octopus extract. confirmed (see Example 7).

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, comprising an extract of octopus as an active ingredient.

As used herein, “chronic obstructive pulmonary disease (COPD)” refers to an abnormal inflammatory response of the lungs caused by inhalation of harmful particles (such as cigarettes) or gases, accompanied by an abnormal inflammatory response that is not completely reversible and gradually progresses. It is a respiratory disease characterized by airflow limitation. The chronic obstructive pulmonary disease may include emphysema, chronic bronchitis, chronic obstructive bronchitis or chronic bronchiolitis, but is not limited thereto. Also, according to an embodiment of the present invention, it may be emphysema, but is not limited thereto.

As used herein, "emphysema" refers to damage of the alveoli in the peripheral airway and the walls of the interalveolar space of the terminal bronchioles lose their elasticity and are destroyed, resulting in abnormal and permanent expansion, thereby reducing the oxygen-carbon dioxide exchange capacity of the lungs and breathing. It is a disease that causes trouble. Emphysema progresses when the secretion of various cytokines and chemokines is induced in alveolar macrophages and epithelium due to smoking, etc., and an inflammatory response is activated. Emphysema is caused by cytokines/chemokines (TNF-α, IL-1β, IL-8, MCP-1, IFN-γ, etc.), reactive oxygen species (ROS), and nitric oxide synthase by inflammation-related cells. The production of back is increased, and as a result, the expression of proteolytic enzymes is increased and activated, thereby accelerating tissue damage.

In this specification, " Todarodes pacificus " lives in sandy places in the intertidal zone, and is widely distributed in temperate and tropical regions such as the Pacific, Indian, Mediterranean, and Atlantic Oceans, including Korea, Japan, Taiwan, and Indonesia. It is also the most caught species in Korea. The body length is about 80cm, there are large and small humps on the surface of the body, and there are no stalks on the suckers of the legs. The body color changes from yellowish brown to blackish brown depending on the environment, and irregular It has a net-shaped speckled pattern.The octopus is edible, caught in an octopus pot or trap, and recently farmed.The octopus extract is used for eyes, mouth, arms, legs, canal, stomach, liver, heart, kidney, ink It may be a pouch, gill, intestine, or whole seafood extract including all of them, and according to an embodiment of the present invention, it may be an octopus leg extract, but is not limited thereto. etc. can be used without restriction.

In the present invention, "extract" refers to an extract obtained by the extraction treatment of the octopus, a diluted or concentrated solution of the extract, a dried product obtained by drying the extract, a crude or purified product of the extract, or a mixture thereof, It includes the extract itself and extracts of all formulations that can be formed using the extract. In addition, “extract” may include a crude extract, a polar solvent-soluble extract, or a non-polar solvent-soluble extract.

In the present invention, the method of extracting the true octopus is not particularly limited, and can be extracted according to a method commonly used in the art. For example, a method using an extraction device such as supercritical extraction, subcritical extraction, high temperature extraction, high pressure extraction, ultrasonic extraction or sonication extraction, or a method using an adsorbent resin including XAD and HP-20 may be used. Non-limiting examples of the extraction method include a heating extraction method, a cold extraction method, a reflux cooling extraction method, a steam distillation method, an ultrasonic extraction method, a sonication extraction method, an elution method, a compression method, a solvent extraction method, and the like, which are performed alone or in two It can be performed using a combination of more than one method. According to one embodiment of the present invention, the octopus extract may use a solvent extraction method, but is not limited thereto.

In addition, depending on the purpose, the extract may be additionally subjected to a conventional fractionation process and may be purified according to a conventional purification method. For example, the extract included in the composition of the present invention may be prepared by pulverizing the primary extract extracted by the solvent extraction method through an additional process such as distillation under reduced pressure and freeze drying or spray drying. In addition, fractions may be obtained by concentrating the primary extract under reduced pressure and mixing with water. After that, various chromatography such as size exclusion chromatography, high-performance liquid chromatography, silica gel column chromatography, and thin layer chromatography are performed. Through this, an additional purified fraction can be obtained. Therefore, in the present invention, the extract may include all extracts, separated compounds, fractions and purified products obtained in each step of extraction, fractionation or purification, dilution, concentration, or drying thereof.

In the present invention, the type of extraction solvent used to extract the octopus is not particularly limited, and according to a conventional method known in the art for extracting an extract from natural products, that is, under normal temperature and pressure conditions. It can be extracted using a common solvent. For example, in the present invention, the octopus extract may be extracted with one or more solvents selected from the group consisting of water, C ₁ to C ₄ alcohol, ethyl acetate, chloroform, hexane, and mixed solvents thereof, According to one embodiment of the invention, extraction may be performed using ethanol as a solvent, but is not limited thereto.

In the present invention, when extracting the octopus using the ethanol as a solvent, for example, 1% to 100% ethanol, 1% to 80% ethanol, 1% to 60% ethanol, 1% to 40% ethanol , 1% to 25% ethanol, 5% to 100% ethanol, 5% to 80% ethanol, 5% to 60% ethanol, 5% to 40% ethanol, 5% to 25% ethanol, 10% to 100% ethanol, 10% to 80% Ethanol, 10% to 60% Ethanol, 10% to 40% Ethanol, 10% to 25% Ethanol, 15% to 100% Ethanol, 15% to 80% Ethanol, 15% to 60% Ethanol, 15 % to 40% ethanol, or 15% to 25% ethanol may be used, and according to one embodiment of the present invention, it may be 20% ethanol, but is not limited thereto.

The prepared extract may then be filtered or concentrated or dried to remove the solvent, and both filtration, concentration and drying may be performed. For example, filtration may use filter paper or a vacuum filter, concentration may use a vacuum vacuum concentrator or vacuum rotary evaporator, and drying may be performed by vacuum drying, vacuum drying, boiling drying, spray drying, freeze drying, and the like. It can be done, but is not limited thereto.

In the present specification, the octopus extract may suppress or improve symptoms of an increase in lung compliance or a decrease in lung elasticity, but is not limited thereto. Specifically, the octopus extract can restore the increase in lung compliance by elastase to a normal level, but is not limited thereto. The normal level means that the increase in lung compliance by elastase is reduced, so that there is no significant difference from the lung compliance of the control group not treated with elastase.

In addition, specifically, the octopus extract may restore the reduction in lung elasticity caused by elastase to a normal level, but is not limited thereto. The normal level means that the decrease in lung elasticity caused by elastase is increased so that there is no significant difference from the lung elasticity of the control group not treated with elastase.

In addition, the octopus extract may inhibit the expression of inflammation-related cytokines (TNF-α, IL-1β, IL-6, etc.) or inflammatory enzymes (Nos2, etc.), but is not limited thereto.

In the present specification, "lung compliance" means a change in volume according to a change in unit pressure in the lung. In the case of emphysema, the walls of the interalveolar space lose their elasticity and are destroyed, resulting in abnormal permanent dilatation, resulting in increased lung compliance.

In this specification, "tissue elastance" is the ability to breathe by muscle contraction of the diaphragm, and when lung elasticity is reduced, the airway collapses and airflow obstruction occurs. In the case of emphysema, the walls of the interalveolar space lose their elasticity and are destroyed, resulting in a decrease in lung elasticity.

Examples of suitable acids are hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid , benzoic acid, malonic acid, gluconic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid and the like. Acid addition salts can be prepared by conventional methods, for example, by dissolving a compound in an aqueous solution of excess acid and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It can also be prepared by heating equimolar amounts of the compound and an acid or alcohol in water and then evaporating the mixture to dryness, or suction filtering the precipitated salt.

Salts derived from suitable bases may include, but are not limited to, alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium. An alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving a compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. At this time, as the metal salt, it is particularly suitable for pharmaceutical purposes to prepare a sodium, potassium or calcium salt, and the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

The content of the octopus extract in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the progress of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 50% by weight based on the total weight of the composition. %, but is not limited thereto. The content ratio is a value based on the dry amount after removing the solvent.

The octopus extract in the composition of the present invention is 1 to 5000 μg / ml, 100 to 5000 μg / ml, 150 to 5000 μg / ml, 200 to 5000 μg / ml, 1 to 4000 μg / ml, 100 to 4000 μg / ml ml, 150 to 4000 μg/ml, 200 to 4000 μg/ml, 1 to 3000 μg/ml, 100 to 3000 μg/ml, 150 to 3000 μg/ml, 200 to 3000 μg/ml, 1 to 2000 μg/ml , 100 to 2000 μg/ml, 150 to 2000 μg/ml, 200 to 2000 μg/ml, 1 to 1500 μg/ml, 100 to 1500 μg/ml, 150 to 1500 μg/ml, or 200 to 1500 μg/ml It may be included at a concentration of, but is not limited thereto.

The pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions. The excipient may be, for example, one or more selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a moisturizer, a film-coating material, and a controlled release additive.

The pharmaceutical compositions according to the present invention are powders, granules, sustained-release granules, enteric granules, solutions, eye drops, elsilic agents, emulsions, suspensions, spirits, troches, perfumes, and limonadese, respectively, according to conventional methods. , tablets, sustained-release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusate, It can be formulated and used in the form of external preparations such as warning agents, lotions, pasta agents, sprays, inhalants, patches, sterile injection solutions, or aerosols, and the external agents are creams, gels, patches, sprays, ointments, and warning agents. , lotion, liniment, pasta, or cataplasma may have formulations such as the like.

Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, phosphoric acid as additives for tablets, powders, granules, capsules, pills, and troches according to the present invention Calcium monohydrogen, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethyl Excipients such as cellulose (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose phthalate acetate, carboxymethyl cellulose, calcium carboxymethyl cellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethyl cellulose, sodium methyl cellulose, methyl cellulose, microcrystalline cellulose, dextrin Binders such as hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, purified shellac, starch arc, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, and polyvinylpyrrolidone may be used, Hydroxypropyl Methyl Cellulose, Corn Starch, Agar Powder, Methyl Cellulose, Bentonite, Hydroxypropyl Starch, Sodium Carboxymethyl Cellulose, Sodium Alginate, Calcium Carboxymethyl Cellulose, Calcium Citrate, Sodium Lauryl Sulfate, Silicic Anhydride, 1-Hydroxy Propyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl cellulose, white sugar, magnesium aluminum silicate, di-sorbitol solution, and light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopod, kaolin, petrolatum, sodium stearate, cacao butter, sodium salicylate, magnesium salicylate, polyethylene glycol 4000, polyethylene glycol 6000, liquid paraffin, hydrogenated soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acid, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, starch, A lubricant such as sodium chloride, sodium acetate, sodium oleate, dl-leucine, light anhydrous silicic acid; may be used.

Additives for the liquid formulation according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (tween esters), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, and the like may be used.

In the syrup according to the present invention, a solution of white sugar, other sugars, or a sweetener may be used, and aromatics, coloring agents, preservatives, stabilizers, suspending agents, emulsifiers, thickeners, etc. may be used as necessary.

Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.

Acacia, tragacantha, methylcellulose, carboxymethylcellulose, carboxymethylcellulose sodium, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose, HPMC 1828, HPMC 2906, HPMC 2910, etc. and, if necessary, surfactants, preservatives, stabilizers, colorants, and fragrances may be used.

Injections according to the present invention include distilled water for injection, 0.9% sodium chloride injection, IV injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated IV injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; solubilizing agents such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, twins, nijuntinamide, hexamine, and dimethylacetamide; buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and gums; tonicity agents such as sodium chloride; Stabilizers such as sodium bisulfite (NaHSO ₃ ) carbon dioxide gas, sodium metabisulfite (Na ₂ S ₂ O ₅ ), sodium sulfite (Na ₂ SO ₃ ), nitrogen gas (N ₂ ), ethylenediaminetetraacetic acid; Sulfating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, ethylenediamine disodium tetraacetate, acetone sodium bisulfite; analgesics such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; Suspending agents such as Siemesis sodium, sodium alginate, Tween 80, aluminum monostearate may be included.

The suppository according to the present invention includes cacao butter, lanolin, witapsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lannet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolen (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Buytyrum Tego-G -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxycote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hyde Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), suppository type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), Supostal (N, Es), Wecobi (W, R, S, M, Fs), testosterone triglyceride base (TG-95, MA, 57) and The same mechanism can be used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, for example, starch, calcium carbonate, sucrose, etc. ) or by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. there is. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, activity of the drug, It may be determined according to factors including sensitivity to the drug, administration time, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field.

The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention belongs.

The pharmaceutical composition of the present invention can be administered to a subject by various routes. All modes of administration can be envisaged, eg oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal insertion, vaginal It can be administered by intraoral insertion, ocular administration, otic administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, and the like.

The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient together with various related factors such as the disease to be treated, the route of administration, the age, sex, weight and severity of the disease of the patient.

In the present invention, "subject" means a subject in need of treatment of a disease, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse, cow, etc. of mammals.

In the present invention, "administration" means providing a given composition of the present invention to a subject by any suitable method.

In the present invention, "prevention" refers to any action that suppresses or delays the onset of a desired disease, and "treatment" means that a desired disease and its associated metabolic abnormalities are improved or treated by administration of the pharmaceutical composition according to the present invention. All actions that are beneficially altered are meant, and "improvement" means any action that reduces a parameter related to a desired disease, for example, the severity of a symptom, by administration of the composition according to the present invention.

In addition, it provides a health functional food composition for preventing or improving chronic obstructive pulmonary disease, comprising an octopus extract as an active ingredient.

When the octopus extract of the present invention is used as a food additive, the octopus extract may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). In general, when preparing food or beverage, the octopus extract of the present invention may be added in an amount of 15% by weight or less, or 10% by weight or less based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.

There is no particular limitation on the type of food. Examples of foods to which the above substances can be added include meat, sausages, bread, chocolates, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice creams, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and includes all health functional foods in a conventional sense.

The health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional components, like conventional beverages. The aforementioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrins and cyclodextrins, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The proportion of the natural carbohydrate is generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention.

In addition to the above, the composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, A carbonation agent used in carbonated beverages and the like may be contained. In addition, the composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The ratio of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the following examples are presented to aid understanding of the present invention. However, the following examples are provided to more easily understand the present invention, and the content of the present invention is not limited by the following examples.

[Example]

Example 1. Preparation of True Octopus Extract

After immersing the octopus ( Octopus vulgaris ) leg sample (1.5 kg) in 3 L of 20% ethanol, it was extracted twice at room temperature at 3-hour intervals. After partially concentrating the obtained extract, it was lyophilized to obtain a concentrate. The true octopus extract was named 2-84.

Example 2. Confirmation of anti-inflammatory effect of octopus extract

RAW 264.7 cells, which are mouse-derived macrophages, were treated with octopus extract (2-84) and LPS (lipopolysaccharide) for 20 hours, and NO released in the medium was evaluated in terms of nitrite concentration. Specifically, RAW 264.7 cells were added to each well of a 24-well plate at 2.5x10 ⁵ cells, and after 1 day, the octopus extract was treated with LPS 1 μg/ml at concentrations of 250, 500, and 1000 μg/mL, 37 ℃, 5% CO ₂ It was cultured for 20 hours in a cell incubator. After incubation, 50 μL of the medium was placed in a 96-well plate, 1% sulfanilamide solution prepared in 5% phosphoric acid solution was added, and after incubation at room temperature for 10 minutes, 0.1% N-1-naphthylethylenediamine diamine was added. 50 μL of the hydrochloride solution was treated, and absorbance was measured at 540 nm to quantitatively measure the degree of color development. After reacting with sodium nitrite solutions diluted with various concentrations under the same conditions, a calibration curve was prepared and NO in the medium was converted into nitrite concentration. The results are shown in Figure 1.

As shown in Figure 1, the octopus extract inhibited NO production by LPS in a concentration-dependent manner. This means that the octopus extract has an anti-inflammatory effect.

Example 3. Confirmation of antioxidant effect of octopus extract

Mouse-derived macrophage RAW 264.7 cells were treated with octopus extract and LPS (lipopolysaccharide) for 20 hours, and intracellular ROS was measured using H ₂ DCF-DA. Specifically, RAW 264.7 cells were added to each well of a 96-well black 96-well plate with a transparent bottom in 5x10 cells, and after 1 day ^, octopus extract was added with 1 μg/mL of LPS at concentrations of 250, 500, and 1000 μg/mL. They were treated together and cultured for 20 hours in a cell incubator at 37°C and 5% CO ₂ conditions. After incubation, the cells were treated with a 20 μM H ₂ DCF-DA solution and incubated for 1 hour in a cell incubator at 37° C. under 5% CO ₂ conditions, and fluorescence was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. . The results are shown in Figure 2.

As shown in Figure 2, the octopus extract inhibited ROS production by LPS in a concentration-dependent manner. This means that octopus extract has an antioxidant effect.

Example 4. Confirmation of Toxicity of Octopus Extract to Normal Cells

After evaluating the NO or ROS production inhibitory activity of Example 2 or 3, the medium was recovered and the attached cells were fixed with 100% methanol at room temperature for 30 minutes. After fixation, methanol was removed, and after drying at room temperature, the fixed cells were stained with 0.025% crystal violet solution for 1 hour at room temperature. After removing the crystal violet solution, the stained cells were washed several times with tap water to remove excess staining solution and dried. Then, the stained cells were dissolved in a 1% SDS (sodium dodecyl sulfate) solution and absorbance was measured at 570 nm. Cell viability was calculated as a percentage of the absorbance of the experimental group to the absorbance of the control group. The results are shown in Figure 3.

As shown in Figure 3, the octopus extract did not affect the viability of normal cells, and through this, it was confirmed that the octopus extract had low cytotoxicity.

Example 5. Inhibition of inflammation-related cytokines and inflammatory enzyme expression of octopus extract confirmed

Mouse-derived macrophage RAW 264.7 was treated with 500 μg/mL of octopus extract, 1 μg/mL of LPS (lipopolysaccharide) or 0.01 U/mL of elastase, and a cell incubator under 37°C and 5% CO ₂ conditions. incubated for 20 hours. After culturing, the cells were disassembled with an easy-BLUE solution (Intron), and RNA was isolated from the cells using a phenol-chloroform method. Then, the amount and purity of RNA were determined by measuring absorbance at 260 nm, 280 nm, and 230 nm, and then 1-2 μg of RNA was converted into cDNA using a first-strand cDNA synthesis kit, and 1/10 to 1 /50 diluted cDNA was amplified using nTaq-HOT DNA polymerase mixed with SYBR Green I dye, dNTP solution, and gene-selective primers. Amplification of cDNA was carried out by repeating the conditions of pretreatment at 95 ° C for 20 minutes, incubation at 95 ° C for 15 seconds and at 60 ° C for 30 seconds in total 45 times, and to verify the selectivity of SYBR Green dye incorporation into amplified cDNA. A melting curve analysis was performed for After determining the CT (cycle threshold) value by monitoring the amplification of cDNA in real time, the gene expression change by the octopus extract was confirmed by the 2 ^-ΔΔCt method by referring to the amplification level of the 18S rRNA (Rn18s) gene. The results are shown in Figures 4 and 5. In addition, the sequences of the primers used in the experiment are shown in Table 1 below.

As shown in Figure 4, the octopus extract significantly suppressed the expression of the inflammatory enzyme Nos2 and the inflammatory cytokine TNF-α induced by LPS.

As shown in Figure 5, the octopus extract significantly suppressed the expression of the inflammatory cytokines IL-1β and IL-6 induced by elastase.

Gene Forward Sequence (5'-3') sequence number Reverse Sequence (5'-3') sequence number Nos2 CAGCTGGGCTGTACAAACCTT One CATTGGAAGTGAAGCGTTTCG 2 Il1b AACCTGCTGGTGTGTGACGTTC 3 CAGCACGAGGCTTTTTTGTTGT 4 Il6 CTGCAAGTGCATCATCGTTGTT 5 CCGGAGAGGAGACTTCACAGAG 6 Tnf -α CAGCCGATGGGTTGTACCTT 7 TGTGGGTGAGGAGCACGTAGT 8 Rn18s GGAATAATGGAATAGGACCG 9 TCTGTCAATCCTGTCCGTGTCC 10

Example 6. Confirmation of the effect of the extract of the octopus on the inhibition of emphysema

6.1. Confirmation of lung function

The effect of octopus extract on suppression of emphysema in vivo was confirmed through lung function. Specifically, after oral administration of 500 mg/kg of octopus extract once to FVB mice, 0.5 U of porcine pancreatic elastase (PPE; a proteolytic enzyme that causes lung tissue destruction) was administered once through the airway. administered. And again, the octopus extract was administered 6 times a week for 3 weeks. Then, in order to confirm lung function, lung compliance and lung elasticity (tissue elastance, ability to breathe by muscle contraction of the diaphragm) of the mice were measured using the FlexiVent RM. The results are shown in FIG. 6 .

As shown in FIG. 6, when only PPE was treated, lung compliance increased and lung elasticity decreased, resulting in a marked decrease in lung function. However, in the experimental group administered with octopus extract along with PPE, lung compliance again decreased, and lung elasticity increased again, confirming that lung function was restored. In addition, it was confirmed that lung compliance and lung elasticity were similar to those of the control group in the experimental group administered only with the octopus extract. Through the above results, it was confirmed that the octopus extract had an emphysema inhibitory effect.

6.2. H&E staining

In order to confirm the effect of octopus extract administration on damage to lung tissue, the lungs of mice treated in the same manner as in Example 6.1 were isolated, and the isolated lungs were fixed for 24 hours using 10% formalin After that, a paraffin block was prepared using paraffin. After cutting the fabricated paraffin block to a thickness of 4 μm, it was attached to a silane coated slide and dried. The dried slides were put in a dry oven at 65° C. to deparaffinize for 16 hours, and washed by immersing them in a xylene solution twice for 5 minutes each. Then, the fixed lung tissue sections were deparaffinized and hydrated with 100%, 95%, and 70% alcohol, and washed with distilled water. Then, it was stained for 1 minute and 30 seconds using a Harris hematoxylin solution, washed by immersion with a 1% HCl alcohol solution and ammonia, and then stained for 30 seconds using an eosin solution. Then, after sequential dehydration using 95% ethanol and 100% ethanol, final washing using a xylene solution was carried out, and the cells were sealed, observed under a microscope, and photographs were obtained. The results are shown in FIG. 7 .

As shown in Figure 7, the lung tissue of the experimental group administered only with PPE collapsed, but in the case of the experimental group administered with octopus extract together with PPE, it was confirmed that the damage to lung tissue was reduced.

Example 7. Confirmation of effect of octopus extract on emphysema treatment

7.1. Confirmation of lung function

The effect of octopus extract on the treatment of emphysema in vivo was confirmed through lung function. Specifically, porcine pancreatic elastase (PPE; porcine pancreatic elastase, a proteolytic enzyme that causes lung tissue destruction) was administered to FVB mice once through the airway, and 2 weeks later, the same dose was administered once more. . Then, 500 mg/kg of octopus extract was administered 6 times a week for 2 weeks. Then, in order to confirm lung function, lung compliance and lung elasticity (tissue elastance, ability to breathe by muscle contraction of the diaphragm) of the mice were measured using the FlexiVent RM. The results are shown in FIG. 8 .

As shown in FIG. 8, when only PPE was treated, lung compliance increased and lung elasticity decreased, resulting in significantly reduced lung function. However, in the experimental group in which the octopus extract was administered with PPE, lung compliance again decreased, and lung elasticity increased again, confirming that lung function was restored. Through the above results, it was confirmed that the octopus extract had a therapeutic effect on already formed emphysema.

7.2. H&E staining

Experiments were conducted in the same manner as in Example 6.2. The results are shown in FIG. 9 .

As shown in FIG. 9, the lung tissue of the experimental group administered only with PPE was severely disintegrated, but in the experimental group administered with the octopus extract together with PPE, it was confirmed that damage to the lung tissue was significantly reduced.

Through the above results, the composition containing the octopus extract of the present invention as an active ingredient inhibits lung damage and destruction in an emphysema animal model administered with PPE and effectively reduces the inflammatory response, thereby maintaining lung function and / or confirmed to recover. Through this, it was confirmed that the octopus extract can be used as a composition for preventing or treating chronic obstructive pulmonary disease.

The description of the present invention described above is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting.

<110> Seoul National University R&DB Foundation Republic of Korea (National Fisheries Research and Development Institute) <120> Phamaceutical composition for preventing or treating chronic Obstructive pulmonary disease comprising Octopus vulgaris extract as an active ingredient <130> MP21-176 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> artificial sequence <220> <223> Nos2_F <400> 1 cagctgggct gtacaaacct t 21 <210> 2 <211> 21 <212> DNA <213> artificial sequence <220> <223> Nos2_R <400> 2 cattggaagt gaagcgtttc g 21 <210> 3 <211> 22 <212> DNA <213> artificial sequence <220> <223> Il1b_F <400> 3 aacctgctgg tgtgtgacgt tc 22 <210> 4 <211> 22 <212> DNA <213> artificial sequence <220> <223> Il1b_R <400> 4 cagcacgagg cttttttgtt gt 22 <210> 5 <211> 22 <212> DNA <213> artificial sequence <220> <223> Il6_F <400> 5 ctgcaagtgc atcatcgttg tt 22 <210> 6 <211> 22 <212> DNA <213> artificial sequence <220> <223> Il6_R <400> 6 ccggagagga gacttcacag ag 22 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> Tnf_F <400> 7 cagccgatgg gttgtacctt 20 <210> 8 <211> 21 <212> DNA <213> artificial sequence <220> <223> Tnf_R <400> 8 tgtgggtgag gagcacgtag t 21 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> Rn18s_F <400> 9 ggaataatgg aataggaccg 20 <210> 10 <211> 22 <212> DNA <213> artificial sequence <220> <223> Rn18s_R <400> 10 tctgtcaatc ctgtccgtgt cc 22

Claims (8)

A pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, comprising an extract of octopus as an active ingredient.
According to claim 1,
The chronic obstructive pulmonary disease is characterized in that emphysema (emphysema), a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease.
According to claim 1,
The octopus extract is a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, characterized in that suppressing or improving one or more of the following symptoms:
i) increase in lung compliance; and
ii) a decrease in lung elasticity.
According to claim 1,
The octopus extract is characterized by inhibiting the expression of one or more inflammatory cytokines selected from the group consisting of TNF-α, IL-1β, and IL-6, a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease.
According to claim 1,
The octopus extract is a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, characterized in that inhibiting the expression of Nos2.
According to claim 1,
The octopus extract is characterized in that it is extracted with one or more solvents selected from the group consisting of water, C ₁ to C ₄ alcohol, ethyl acetate, chloroform, hexane, and mixed solvents thereof, prevention of chronic obstructive pulmonary disease or Therapeutic pharmaceutical composition.
According to claim 1,
The octopus extract is characterized in that the octopus leg extract, a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease.
A health functional food composition for preventing or improving chronic obstructive pulmonary disease, comprising an octopus extract as an active ingredient.

Images