KR20230042682A - Marker for cervical insufficiency - Google Patents

Marker for cervical insufficiency Download PDF

Info

Publication number
KR20230042682A
KR20230042682A KR1020230034446A KR20230034446A KR20230042682A KR 20230042682 A KR20230042682 A KR 20230042682A KR 1020230034446 A KR1020230034446 A KR 1020230034446A KR 20230034446 A KR20230034446 A KR 20230034446A KR 20230042682 A KR20230042682 A KR 20230042682A
Authority
KR
South Korea
Prior art keywords
protein
cervical incompetence
gene
defa3
genes
Prior art date
Application number
KR1020230034446A
Other languages
Korean (ko)
Other versions
KR102635258B1 (en
Inventor
손가현
김영미
박성택
이근영
이재준
Original Assignee
한림대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한림대학교 산학협력단 filed Critical 한림대학교 산학협력단
Priority to KR1020230034446A priority Critical patent/KR102635258B1/en
Publication of KR20230042682A publication Critical patent/KR20230042682A/en
Application granted granted Critical
Publication of KR102635258B1 publication Critical patent/KR102635258B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/689—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to pregnancy or the gonads
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/36—Gynecology or obstetrics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Abstract

The present invention relates to a marker for incompetent cervix. The marker for incompetent cervix comprises an agent for measuring transcription levels of one or more genes selected from DEFA3, CD177, JUN, ELANE, BPI, MMP8, CEACAM8, CA1, HBA1, SLC4A1, ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15, and IDH3A. According to the present invention, the health of a mother and a fetus can be improved.

Description

자궁경부 무력증 마커 {Marker for cervical insufficiency}Marker for cervical insufficiency}

본 발명은 자궁경부 무력증 및 자궁경부 봉축술 이후의 예후를 진단할 수 있는 마커 및 이의 이용에 관한 것이다.The present invention relates to markers capable of diagnosing cervical incompetence and prognosis after cervical ablation, and their use.

임신 37주 이전에 분만하는 것으로 정의되는 조산 (Preterm birth; PTB)은 10명의 아기 중 1명 이상에서 발생하며, 조산과 관련된 합병증으로 인해 매년 약 백만명의 어린이가 사망한다 [1]. 더욱이 조산은 장기 시스템 미성숙과 관련된 미숙아의 즉각적인 합병증뿐만 아니라 신경발달 장애와 같은 장기 이환율로 인해 의료 시스템에 큰 부담이 된다 [2-4]. 조산으로 이어지는 한 가지 요인은 자궁경부 무력증 (cervical insufficiency; CI)으로, 임신 이삼분기에 통증이 있는 자궁 수축이 없는 자궁 경부의 자발적 확장 및 소멸을 특징으로 하며, 태아막이 부풀어 오르고, 태아막이 조기 파열되며, 궁극적으로 미숙 태아의 출산에 이르게 한다 [5]. 자궁경부 무력증은 모든 임신의 약 0.5~1%를 차지하며, 임신 중기 조산의 2~15% 또는 극심한 조산 (<28주)의 5~15%와 관련이 있다 [6, 7]. 자궁 경부 조작수술 (예: 루프 전기수술적 절제술, 확장 및 소파술, 냉도 원추절제술 (cold-knife conization), 자궁경 검사), 자궁 경부 열상 또는 산과 손상, 콜라겐 장애 (예: Ehlers-Danlos) 및 자궁 내 디에틸스틸베스트롤 노출과 같은 여러 요인이 자궁경부 무력증과 관련이 있으며 발생 원인은 아직 알려지지 않았다 [8]. 그리하여, 자궁경부 무력증은 고전적인 과거 산과 병력 (선행하는 자궁 수축이 없이 임신 이삼분기 또는 삼삼분기 초에 발생하는 연속적인 유산) 또는 산과 병력과 자궁 경부 길이 측정의 조합을 기반으로 진단된다 (Roman et al., 2016). 더욱이 자궁경부 무력증의 진단 또는 예측을 위한 실험실 테스트 또는 유용한 바이오마커는 상용화되지 않았다. 자궁 경부 봉축술은 자궁경부 무력증 환자를 위한 치료법이다. 그러나 자궁경부 봉축술 수행 여부를 결정하는 지침은 다르며 심지어는 수술 후의 지침도 다르고, 임신 결과를 예측하는 데 한계가 있다 [9]. Preterm birth (PTB), defined as delivery before 37 weeks of gestation, occurs in more than 1 in 10 babies, and causes approximately one million child deaths each year from complications related to preterm birth [1]. Moreover, preterm birth is a major burden on the health care system due to long-term morbidity, such as neurodevelopmental disorders, as well as immediate complications of prematurity related to organ system immaturity [2-4]. One factor leading to preterm birth is cervical insufficiency (CI), characterized by spontaneous dilatation and disappearance of the cervix without painful contractions in the second trimester, accompanied by swelling of the fetal membranes, and premature rupture of the fetal membranes. and ultimately leads to the birth of an immature fetus [5]. Cervical incompetence accounts for approximately 0.5% to 1% of all pregnancies, and is associated with 2% to 15% of preterm births in the second trimester or 5% to 15% of extremely preterm births (<28 weeks) [6, 7]. Cervical manipulation surgery (e.g. loop electrosurgical resection, dilatation and curettage, cold-knife conization, hysteroscopy), cervical lacerations or obstetric injuries, collagen disorders (e.g. Ehlers-Danlos) and uterus Several factors, such as my exposure to diethylstilbestrol, are associated with cervical incompetence, and the cause is unknown [8]. Thus, cervical incompetence is diagnosed on the basis of either the classical past obstetric history (consecutive miscarriage occurring in the second or early third trimester without preceding uterine contractions) or a combination of obstetric history and cervical length measurement (Roman et al. al., 2016). Moreover, no laboratory tests or useful biomarkers for the diagnosis or prediction of cervical incompetence have been commercially available. Cervical ablation is a treatment for patients with cervical incompetence. However, guidelines for determining whether or not to perform cervical ablation are different, and even postoperative guidelines are different, and there are limitations in predicting pregnancy outcomes [9].

한국특허 제1978401호 (2019.05.15. 공고) "자궁경부무력증 진단용 마커 및 이의 용도"Korean Patent No. 1978401 (Announced on May 15, 2019) "Marker for diagnosis of cervical incompetence and its use"

Liu L. et al., The Lancet Global health 2019, 7(6):e721-e734Liu L. et al., The Lancet Global health 2019, 7(6):e721-e734 Iams JD, The New England journal of medicine 2014, 370(3):254-261Iams JD, The New England journal of medicine 2014, 370(3):254-261 Mwaniki MK et al., Lancet (London, England) 2012, 379(9814):445-452Mwaniki MK et al., Lancet (London, England) 2012, 379(9814):445-452 Murray CJ et al., Lancet (London, England) 2012, 380(9859):2197-2223Murray CJ et al., Lancet (London, England) 2012, 380(9859):2197-2223 Vink J et al., Seminars in fetal & neonatal medicine 2016, 21(2):106-112Vink J et al., Seminars in fetal & neonatal medicine 2016, 21(2):106-112 Mann EC et al., American journal of obstetrics and gynecology 1961, 81:209-222Mann EC et al., American journal of obstetrics and gynecology 1961, 81:209-222 Stromme WB et al., American journal of obstetrics and gynecology 1963, 85:223-233Stromme WB et al., American journal of obstetrics and gynecology 1963, 85:223-233 Thakur M, Mahajan K: Cervical Incompetence. In: StatPearls. Treasure Island (FL): StatPearls Publishing Copyright ⓒ 2020, StatPearls Publishing LLC.; 2020Thakur M, Mahajan K: Cervical Incompetence. In: StatPearls. Treasure Island (FL): StatPearls Publishing Copyright ⓒ 2020, StatPearls Publishing LLC.; 2020 ACOG Practice Bulletin No.142: Cerclage for the management of cervical insufficiency. Obstetrics and gynecology 2014, 123(2 Pt 1):372-379ACOG Practice Bulletin No.142: Cerclage for the management of cervical insufficiency. Obstetrics and gynecology 2014, 123(2 Pt 1):372-379 Kukurba KR, Montgomery SB: RNA Sequencing and Analysis. Cold Spring Harbor protocols 2015, 2015(11):951-969Kukurba KR, Montgomery SB: RNA Sequencing and Analysis. Cold Spring Harbor protocols 2015, 2015(11):951-969 Wang Z et al., Nature reviews Genetics 2009, 10(1):57-63Wang Z et al., Nature reviews Genetics 2009, 10(1):57-63 Nagalakshmi U et al., RNA-Seq: a method for comprehensive transcriptome analysis. Current protocols in molecular biology 2010, Chapter 4: Unit 4.11.11-13Nagalakshmi U et al., RNA-Seq: a method for comprehensive transcriptome analysis. Current protocols in molecular biology 2010, Chapter 4: Unit 4.11.11-13 Jiang H et al., BMC bioinformatics 2014, 15:182Jiang H et al., BMC bioinformatics 2014, 15:182 Dobin A et al., Bioinformatics (Oxford, England) 2013, 29(1):15-21Dobin A et al., Bioinformatics (Oxford, England) 2013, 29(1):15-21 Trapnell C et al., Nature biotechnology 2010, 28(5):511-515Trapnell C et al., Nature biotechnology 2010, 28(5):511-515 Cullum R et al., Respirology (Carlton, Vic) 2011, 16(2):210-222Cullum R et al., Respirology (Carlton, Vic) 2011, 16(2):210-222 Reimand J, Arak T, Adler P, Kolberg L, Reisberg S, Peterson H, Vilo J: g:Profiler-a web server for functional interpretation of gene lists (2016 update). 2016, 44(W1):W83-89Reimand J, Arak T, Adler P, Kolberg L, Reisberg S, Peterson H, Vilo J: g:Profiler-a web server for functional interpretation of gene lists (2016 update). 2016, 44(W1):W83-89 Hein M et al., American journal of obstetrics and gynecology 2001, 185(3):586-592Hein M et al., American journal of obstetrics and gynecology 2001, 185(3):586-592 Kawana K et al., Infection and immunity 2008, 76(7):3011-3018Kawana K et al., Infection and immunity 2008, 76(7):3011-3018 Borregaard N et al., Trends in immunology 2007, 28(8):340-345Borregaard N et al., Trends in immunology 2007, 28(8):340-345 Stock AJ, Kasus-Jacobi A, Pereira HA: The role of neutrophil granule proteins in neuroinflammation and Alzheimer's disease. 2018, 15(1):240.Stock AJ, Kasus-Jacobi A, Pereira HA: The role of neutrophil granule proteins in neuroinflammation and Alzheimer's disease. 2018, 15(1):240. Selsted ME et al., The Journal of clinical investigation 1985, 76(4):1436-1439Selsted ME et al., The Journal of clinical investigation 1985, 76(4):1436-1439 Aldred PM et al., Human molecular genetics 2005, 14(14):2045-2052Aldred PM et al., Human molecular genetics 2005, 14(14):2045-2052 Prasad SV, Fiedoruk K: Expression and Function of Host Defense Peptides at Inflammation Sites. 2019, 21(1).Prasad SV, Fiedoruk K: Expression and Function of Host Defense Peptides at Inflammation Sites. 2019, 21(1). Heine RP et al., Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 1998, 27(3):513-518Heine RP et al., Clinical infectious diseases: an official publication of the Infectious Diseases Society of America 1998, 27(3):513-518 Lee SE et al., American journal of obstetrics and gynecology 2008, 198(6):633.e631-638Lee SE et al., American journal of obstetrics and gynecology 2008, 198(6):633.e631-638 Canny G et al., Proceedings of the National Academy of Sciences of the United States of America 2002, 99(6): 3902-3907Canny G et al., Proceedings of the National Academy of Sciences of the United States of America 2002, 99(6): 3902-3907 Biggio JR et al., American journal of obstetrics and gynecology 2005, 192(1):109-113Biggio JR et al., American journal of obstetrics and gynecology 2005, 192(1):109-113 Son GH et al., American journal of reproductive immunology (New York, NY : 1989) 2016, 75(2):155-161Son GH et al., American journal of reproductive immunology (New York, NY : 1989) 2016, 75(2):155-161 Wehkamp J et al., Proceedings of the National Academy of Sciences of the United States of America 2005, 102(50):18129-18134Wehkamp J et al., Proceedings of the National Academy of Sciences of the United States of America 2005, 102(50):18129-18134 Bryce J et al., Lancet (London, England) 2005, 365(9465):1147-1152Bryce J et al., Lancet (London, England) 2005, 365(9465):1147-1152

따라서, 본 발명은 자궁경부 무력증에 대한 바이오마커를 발굴하고, 이를 이용하여 자궁경부 무력증을 진단하는 조성물, 진단키트 및 진단방법을 제공하고, 또한, 자궁경부 무력증을 치료하는 표적을 선정하는 것을 목표로 한다.Therefore, the present invention aims to discover biomarkers for cervical incompetence, provide a composition, diagnostic kit, and diagnostic method for diagnosing cervical incompetence using the same, and also to select targets for treating cervical incompetence. do it with

본 발명자들은 자궁경부 무력증 (CI)과 관련된 유전자 발현 프로필 및 생물학적 경로를 확인하여 CI에 대한 잠재적인 바이오 마커 또는 치료 표적을 탐색하였다. RNA 시퀀싱 (RNA-Seq)은 게놈의 포괄적인 전사체 분석을 가능하게 하는 기술이다 [10-12]. 마이크로 어레이와 비교하여 RNA 시퀀싱은 유전자 발현 데이터에 대해 편향되지 않은 프로브 독립적 검사를 가능하게 한다. 우리는 RNA 시퀀싱을 사용하여 CI 환자의 전사체 프로파일과 정상 대조군의 전사체 프로파일을 비교하여 CI에서 독특한 유전자 발현 프로파일을 확인했다. 또한, CI 환자의 임신 결과에 따라 유전자가 차별적으로 발현되는지 여부를 조사했다.We identified gene expression profiles and biological pathways associated with cervical insufficiency (CI) to explore potential biomarkers or therapeutic targets for CI. RNA sequencing (RNA-Seq) is a technology enabling comprehensive transcriptome analysis of genomes [10-12]. Compared to microarrays, RNA sequencing enables unbiased, probe-independent examination of gene expression data. We identified distinct gene expression profiles in CI by comparing the transcriptome profiles of CI patients with those of normal controls using RNA sequencing. In addition, we investigated whether genes were differentially expressed according to pregnancy outcomes in CI patients.

우리는 CI 환자에서 전혈 RNA-Seq를 수행하고 전사체 프로필을 정상 대조군의 프로필과 비교했다. 그 결과, 대조군에 비해 CI 그룹에서 호중구 활성화 및 호중구 매개 면역과 관련된 유전자의 상향 조절을 확인했다. 자궁 경부는 풍부한 질 미생물 환경을 가진 질과 무균 상태로 추정되는 자궁 내 공간 사이에 위치한다. 따라서 자궁 경부는 출산까지 폐쇄를 유지하고 면역 세포 (수지상 세포, 호중구 및 대식세포)와 패턴 인식 수용체, Toll 유사 수용체, 고급 당화 최종 산물, 사이토카인 및 케모카인, 손상 관련 분자 패턴 및 항균 펩타이드에 대한 수용체를 포함하는 분자 구성 요소 등으로 면역학적 장벽을 유지함으로써 감염 상승에 대한 기계적 장벽으로 기능을 수행한다 [18, 19]. 따라서, 진행된 자궁 경부 확장과 같이 자궁 경부 장벽이 파괴된 여성의 경우, 양막 내 미생물 침입 위험이 증가했다. 본 발명에서 확인된 자궁 경부 확장과 같은 임상 증상을 보이는 CI 환자에서 상향 조절된 호중구 면역 관련 유전자는 아마도 감염 상승을 예방함으로써 태아를 보호하는 것으로 보인다. 호중구는 과립으로 조밀하게 포장된 특화된 선천성 식세포로, 1차 (아즈로필), 2 차 (특이적), 젤라티나제 및 분비 과립으로 나뉘는 광범위한 항균 작용을 가진 여러 단백질을 포함한다 [20, 21]. 과립은 구조, 함량 및 기능면에서 이질적이며 쉽게 방출되어 감염 또는 염증에 대한 숙주 반응에 참여할 수 있다. 본 발명에서 우리는 대조군보다 CI를 가진 여성에서 훨씬 더 높은 수준으로 발현되는 광범위한 호중구 관련 유전자를 확인했다. 아주로필 과립으로 발현되는 알파 디스펜신은 다양한 미생물에 대해 현저한 항균, 항진균 및 항바이러스 활성을 가진 항균 펩타이드로, 선천적 면역에서 그 역할을 암시하며, 또한 면역 반응을 조절하는 데 중요한 역할을 한다 [22-24]. 이전 연구에서 막의 조기 파열 후 조직학적 융모양막염이 발생한 여성에게서 산모의 혈장 디펜신 수치가 증가했다고 보고된 바 있다 [25]. 따라서 본 발명에서 관찰된 CI 그룹의 모체 혈액에서 DEFA3 발현이 상향 조절된 것은 CI 환자의 80%에서 발견되는 양막 내 염증으로 설명될 수 있다 [26].We performed whole blood RNA-Seq in patients with CI and compared the transcriptome profile to that of normal controls. As a result, it was confirmed that genes related to neutrophil activation and neutrophil-mediated immunity were upregulated in the CI group compared to the control group. The cervix is located between the vagina, which has a rich vaginal microbial environment, and the presumed sterile intrauterine space. Thus, the cervix remains closed until childbirth and contains immune cells (dendritic cells, neutrophils, and macrophages) and receptors for pattern recognition receptors, Toll-like receptors, advanced glycation end products, cytokines and chemokines, damage-associated molecular patterns, and antimicrobial peptides. It functions as a mechanical barrier against the rise of infection by maintaining an immunological barrier with molecular components including [18, 19]. Thus, women with disruption of the cervical barrier, such as with advanced cervical dilatation, have an increased risk of microbial invasion into the amnion. In CI patients with clinical symptoms such as cervical dilatation identified in the present invention, upregulated neutrophil immunity-related genes seem to protect the fetus, possibly by preventing the rise of infection. Neutrophils are specialized innate phagocytic cells densely packed into granules, which contain several proteins with a broad spectrum of antibacterial activity, divided into primary (azrophil), secondary (specific), gelatinase and secretory granules [20, 21 ]. Granules are heterogeneous in structure, content and function and can be readily released to participate in the host response to infection or inflammation. In this study, we identified a wide range of neutrophil-associated genes that were expressed at significantly higher levels in women with CI than in controls. Alpha dispensin expressed as azurophil granules is an antibacterial peptide with remarkable antibacterial, antifungal and antiviral activity against various microorganisms, implying its role in innate immunity, and also plays an important role in regulating the immune response [ 22-24]. A previous study reported that maternal plasma defensin levels were increased in women with histological chorioamnionitis after premature membrane rupture [25]. Therefore, the up-regulation of DEFA3 expression in maternal blood of the CI group observed in this study can be explained by intra-amniotic inflammation found in 80% of CI patients [26].

그람 음성 유기체에 대한 살균 활성을 갖는 지질 다당류 결합 단백질인 BPI (bactericidal/permeability-increasing protein)는 지질 다당류에 의해 유도된 염증 반응을 중화시키고 식균 작용 조절을 강화하며 항진균 특성을 나타낸다 [27]. CI 그룹에서 DEFA3뿐만 아니라 광범위한 호중구 과립 관련 유전자 (ELANE, BPI, MMP8, CRISP3 및 CEACAM8)의 과발현을 고려하면 자궁 경부 장벽이 파괴된 후 질내 미생물 감염이 상승하여 자궁 내 염증/감염, 산모 전신 염증 반응 및 호중구 활성화가 일어날 수 있다. 알파 디펜신과 MMP8은 이전에 조산 산모의 양수에서 정상 출산보다 높은 농도로 인해 조산 (PTB)의 바이오마커로 제안되었다 [25, 28]. 그러나 CI에서 알파 디펜신과 MMP8 발현에 대한 정보는 없었다. 본 발명의 결과는 CI 그룹에서 알파 디펜신 3의 혈청 농도가 대조군보다 유의하게 높음을 보여주었다. 따라서 알파 디펜신 3은 CI에 대한 바이오마커가 될 수 있다.Bactericidal/permeability-increasing protein (BPI), a lipopolysaccharide-binding protein with bactericidal activity against Gram-negative organisms, neutralizes the inflammatory response induced by lipopolysaccharide, enhances phagocytosis regulation, and exhibits antifungal properties [27]. Considering the overexpression of DEFA3 as well as a wide range of neutrophil granule-related genes (ELANE, BPI, MMP8, CRISP3 and CEACAM8) in the CI group, vaginal microbial infection rises after cervical barrier disruption, leading to intrauterine inflammation/infection and maternal systemic inflammatory response. and neutrophil activation. Alpha-defensins and MMP8 have previously been proposed as biomarkers of preterm birth (PTB) due to their higher than live birth concentrations in the amniotic fluid of preterm mothers [25, 28]. However, there was no information about alpha-defensin and MMP8 expression in CI. Our results showed that the serum concentration of alpha-defensin 3 in the CI group was significantly higher than that in the control group. Thus, alpha-defensin 3 could be a biomarker for CI.

또한, 우리는 골수성 백혈구 활성화 및 호중구 매개 면역과 관련된 유전자가 대조군에 비해 CI 그룹에서 상향 조절되어 CI 환자에서 전신 및 자궁 내 염증이 발생한다는 것을 확인했다. 자궁 내 염증은 CI와 연관되어 있을 가능성이 있으며, 그 중증도는 CI 환자의 조산과 관련이 있다 [29]. 우리의 결과는 CI-만삭 분만 (CI-term; CI에 대한 자궁경부 봉축술 후 정상 기간에 출산) 그룹보다 CI-조산 (CI-preterm; CI에 대한 자궁경부 봉축술 후 조산) 그룹에서 더 높은 호중구 수를 보여 주어 더 심한 염증을 나타내었다. 알파 디펜신은 호중구에서 생성되기 때문에 알파 디펜신 3의 농도는 CI-만삭 분만 그룹보다 CI-조산 그룹에서 더 높을 것으로 예상되었다. 그러나 우리의 결과는 알파 디펜신 3의 농도가 CI-만삭 분만 그룹에서 더 높은 경향이 있음을 보여주었다. 이러한 경향은 RNA 시퀀싱 및 qRT-PCR 결과에서도 나타났다. DEFA3 발현은 CI-조산 그룹보다 CI-만삭 분만 그룹에서 더 높았다. 이러한 결과에 대해 다음을 추측할 수 있다. 알파 디펜신은 호중구의 아주로필 과립에 저장되지만 과립은 일반적으로 분비가 제한되어 활성화된 호중구의 탈과립을 통해 세포외 환경으로 방출된다. 또한, 알파 디펜신은 호중구의 세포 사멸, 괴사 또는 NET-증 이후에 방출될 수 있다. 따라서 알파 디펜신의 발현 수준은 호중구의 수에 비례하지 않고, 호중구의 활성화 정도와 더 관련이 있다고 생각할 수 있다. 알파 디펜신은 대식세포의 전 염증성 사이토카인의 생합성을 억제함으로써 염증을 조절할 수 있다. 유사한 맥락에서, 본 발명의 결과는 DEFA3와 같은 다양한 숙주 방어 관련 유전자의 상향 조절된 발현이 CI 환자에서 유리한 임신 결과와 관련이 있음을 보여주었다.In addition, we confirmed that genes related to myeloid leukocyte activation and neutrophil-mediated immunity were upregulated in the CI group compared to the control group, resulting in systemic and intrauterine inflammation in CI patients. Intrauterine inflammation may be associated with CI, and its severity is associated with preterm birth in patients with CI [29]. Our results showed higher rates in the CI-preterm (CI-preterm; preterm delivery after cervical ablation for CI) group than in the CI-term (CI-term; delivery at normal term after cervical ablation for CI) group. Neutrophil counts were shown to indicate more severe inflammation. Since alpha-defensin is produced by neutrophils, the concentration of alpha-defensin 3 was expected to be higher in the CI-preterm delivery group than in the CI-term delivery group. However, our results showed that the concentration of alpha-defensin 3 tended to be higher in the CI-term delivery group. This trend was also shown in RNA sequencing and qRT-PCR results. DEFA3 expression was higher in the CI-term delivery group than the CI-preterm delivery group. The following can be inferred from these results. Alpha-defensins are stored in azurophil granules of neutrophils, but the granules are normally secretion-limited and are released into the extracellular milieu through degranulation of activated neutrophils. Also, alpha-defensins can be released after apoptosis, necrosis or NET-injury of neutrophils. Therefore, it can be considered that the expression level of alpha-defensin is not proportional to the number of neutrophils, but more related to the degree of activation of neutrophils. Alpha-defensins can modulate inflammation by inhibiting the biosynthesis of pro-inflammatory cytokines in macrophages. In a similar vein, our results showed that upregulated expression of various host defense-related genes, such as DEFA3, was associated with favorable pregnancy outcomes in CI patients.

주로 말라리아, HIV 및 기생충으로 인한 감염은 전세계적으로 조산의 주요 원인으로 알려져 있다 [31]. 이와 일관되게, 본 발명자들은 말라리아와 아프리카 트리파노소마증 경로가 CI 그룹의 유전자에서 풍부하다는 것을 발견했다. 이러한 발견은 전통적인 미생물 배양에서 확인되지 않은 CI에 과소 평가된 감염이 많이 있음을 나타내며 현재 배양 기술은 양수 및 전신 수준의 감염에 대한 진단 테스트로 극히 제한적임을 말해준다. 더욱이, 임신 유지 유전자에서 풍부한 것으로 확인된 경로는 타고난 면역 반응과 관련된 NOD 유사 수용체 및 RIG-I 유사 수용체 신호 전달 경로였다. 따라서 우리의 연구 결과는 모체-태아 인터페이스 및 전신 수준에서의 면역 반응이 염증 반응을 조절하고 CI 감염을 예방하여 임신을 연장하는 데 중요한 역할을 함을 시사한다.Infections mainly caused by malaria, HIV, and parasites are known to be major causes of preterm birth worldwide [31]. Consistent with this, we found that the malaria and African trypanosomiasis pathways are enriched in the genes of the CI group. These findings indicate that there are many underestimated infections in CI that have not been identified in traditional microbial cultures, and that current culture techniques are extremely limited as diagnostic tests for amniotic fluid and systemic level infections. Moreover, the pathways identified as enriched in pregnancy maintenance genes were the NOD-like receptor and RIG-I-like receptor signaling pathways involved in the innate immune response. Our findings thus suggest that the immune response at the maternal-fetal interface and systemic level plays an important role in prolonging pregnancy by regulating the inflammatory response and preventing CI infection.

우리가 아는 한 본 발명은 CI 환자의 전혈에 대한 최초의 RNA-seq 연구이다. 현재까지 CI에 대한 고 처리량 연구는 거의 없었으며, 분리된 CI는 비교적 드문 상태이고 객관적인 진단 기준이 없기 때문에 피험자 포함 여부를 결정하기 어렵고 임신 중 자궁 경부 조직을 분석하기가 어렵기 때문이다. 본 발명에서는 초음파 검사에서 자궁경부가 짧은 여성을 제외하고 자궁 경부 확장이 있는 여성만 포함하였다. 자궁 수축 또는 질 출혈과 같은 증상의 존재는 CI 그룹에서 면밀히 관찰되었으며 증상이 의심되는 환자는 연구 그룹에서 제외하였다. 또한, 자궁경부 조직을 이용하여 CI의 병태생리나 병인을 조사할 수는 없었지만, 본 발명은 임신 결과에 따른 자궁경부 장벽 파괴 및 차별적 유전자 발현에 대한 고유한 전사체 프로파일을 밝혔다. 우리 연구에서 표본 크기는 특히 대조군에서 작았다. 그러나 우리는 CI 및 대조군 여성의 모성 및 임신 연령을 신중하게 일치시켰으며 정상 대조군의 동종 유전자 발현을 통해 작은 샘플 크기의 한계를 극복할 수 있었다.To the best of our knowledge, this is the first RNA-seq study of whole blood from patients with CI. To date, there have been few high-throughput studies of CI, because isolated CI is a relatively rare condition and there are no objective diagnostic criteria, making it difficult to determine whether subjects should be included or not, and it is difficult to analyze cervical tissue during pregnancy. In the present study, only women with cervical dilatation were included, excluding women with short cervix in ultrasound examination. The presence of symptoms such as uterine contraction or vaginal bleeding was closely monitored in the CI group, and patients with suspected symptoms were excluded from the study group. In addition, although the pathophysiology or pathogenesis of CI could not be investigated using cervical tissue, the present invention revealed a unique transcriptome profile for cervical barrier disruption and differential gene expression according to pregnancy outcomes. The sample size in our study was small, especially in the control group. However, we carefully matched the maternal and gestational ages of CI and control women and were able to overcome the limitations of the small sample size through homologous gene expression in normal controls.

결론적으로, 우리는 대조군과 비교하여 CI 그룹에서 호중구 활성화 및 호중구 매개 면역 관련 유전자의 상향 조절을 나타내는 CI와 대조군 간의 유전자 발현의 잠재적 차이를 확인했다. 더욱이, 유기체 관련 유전자에 대한 면역 및 방어 반응과 면역 반응 신호전달 경로는 CI 환자의 임신 결과와 관련 가능성이 있다.In conclusion, we identified potential differences in gene expression between CI and control groups, indicating upregulation of genes related to neutrophil activation and neutrophil-mediated immunity in the CI group compared to the control group. Moreover, immune and defense responses to organism-specific genes and immune response signaling pathways are likely related to pregnancy outcomes in CI patients.

본 발명은 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택되는 1종 이상의 유전자 전사 수준을 측정하는 제제를 포함하는 자궁경부 무력증 진단용 조성물에 관한 것이다.DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member) 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15, and IDH3A. It relates to a composition for diagnosing cervical incompetence comprising an agent for measuring the level.

또한, 본 발명은 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택되는 유전자로부터 생성되는 1종 이상의 단백질 발현 수준을 측정하는 제제를 포함하는 자궁경부 무력증 진단용 조성물에 관한 것이다.In addition, the present invention is DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family) 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 and IDH3A It relates to a composition for diagnosing cervical incompetence comprising an agent for measuring the expression level of at least one protein.

또한, 본 발명은 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4 및 CFAP45 중 선택된 하나 이상의 유전자의 전사 수준 또는 이 유전자로부터 생성되는 단백질 발현 수준이 정상 대조군에 비하여 증가하는 경우 자궁경부 무력증으로 판단하는, 자궁경부 무력증 진단용 조성물에 관한 것이다.In addition, the present invention is DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family) 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, and the transcription level of one or more genes selected from CFAP45, or generated from these genes It relates to a composition for diagnosing cervical incompetence, which is judged as cervical incompetence when the protein expression level is increased compared to a normal control group.

또한, 본 발명은 OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택된 하나 이상의 유전자의 전사 수준 또는 이 유전자로부터 생성되는 단백질 발현 수준이 정상 대조군에 비하여 감소하는 경우 자궁경부 무력증으로 판단하는, 자궁경부 무력증 진단용 조성물에 관한 것이다.In addition, the present invention is OSBPL1A, SIGLEC8, ALOX15 and IDH3A in the case where the transcription level of one or more genes selected from or the protein expression level produced from this gene is reduced compared to the normal control group, the composition for diagnosing cervical incompetence, which is judged as cervical incompetence it's about

또한, 본 발명은 상기 유전자 전사 수준을 측정하는 제제가 상기 유전자에 특이적으로 결합하는 프라이머, 프로브 또는 안티센스 뉴클레오타이드인, 자궁경부 무력증 진단용 조성물에 관한 것이다.In addition, the present invention relates to a composition for diagnosing cervical incompetence, wherein the agent for measuring the gene transcription level is a primer, probe, or antisense nucleotide that specifically binds to the gene.

또한, 본 발명은 상기 단백질 발현 수준을 측정하는 제제가 상기 유전자로부터 생성되는 단백질 또는 이의 단편에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편인 것인, 자궁경부 무력증 진단용 조성물에 관한 것이다.In addition, the present invention relates to a composition for diagnosing cervical incompetence, in which the agent for measuring the protein expression level is an antibody or antigen-binding fragment thereof that specifically binds to a protein produced from the gene or a fragment thereof.

또한, 본 발명은 상기 항체가 폴리클론 항체 또는 모노클론 항체인, 자궁경부 무력증 진단용 조성물에 관한 것이다.In addition, the present invention relates to a composition for diagnosing cervical incompetence, wherein the antibody is a polyclonal antibody or a monoclonal antibody.

또한, 본 발명은 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택되는 1종 이상의 유전자 전사 수준을 측정하는 제제를 포함하는 자궁경부 무력증 진단용 키트에 관한 것이다.In addition, the present invention is DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family) 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15, and IDH3A. It relates to a kit for diagnosing cervical incompetence including an agent for measuring gene transcription levels.

또한, 본 발명은 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택되는 유전자로부터 생성되는 1종 이상의 단백질 발현 수준을 측정하는 제제를 포함하는 자궁경부 무력증 진단용 키트에 관한 것이다.In addition, the present invention is DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family) 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 and IDH3A It relates to a kit for diagnosing cervical incompetence comprising an agent for measuring the expression level of at least one protein.

또한, 본 발명은In addition, the present invention

1) 개체로부터 분리된 생물학적 시료에서 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택된 1종 이상의 유전자의 전사 수준 또는 이 유전자로부터 생성되는 단백질 또는 이의 단편의 발현 수준을 측정하는 단계; 및 1) DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 in biological samples isolated from the subject (solute carrier family 4 member 1), selected from ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CRISP3, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 and IDH3A Measuring the transcription level of one or more genes or the expression level of a protein or fragment thereof produced from the gene; and

2) 상기 측정된 전사 수준 또는 발현 수준을 정상 대조군의 전사 수준 또는 단백질 발현 수준과 비교하는 단계;를 포함하는 자궁경부 무력증 진단과 관련된 정보를 제공하는 방법에 관한 것이다.2) comparing the measured transcription level or expression level with the transcription level or protein expression level of a normal control;

또한, 본 발명은 상기 1) 단계가 RT-PCR, 경쟁적 RT-PCR(competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA: RNase protection assay), 노던 블랏팅(Northern blotting) 또는 DNA 칩을 이용하는, 자궁경부 무력증 진단과 관련된 정보를 제공하는 방법에 관한 것이다.In addition, in the present invention, step 1) is RT-PCR, competitive RT-PCR (Real-time RT-PCR), RNase protection assay (RPA: RNase protection assay), Northern It relates to a method for providing information related to the diagnosis of cervical incompetence using Northern blotting or a DNA chip.

또한, 본 발명은 상기 생물학적 시료가 혈액, 혈장, 혈소판, 혈청, 복수액, 골수액, 림프액, 타액, 누액, 점막액, 양수 또는 이들의 조합인, 자궁경부 무력증 진단과 관련된 정보를 제공하는 방법에 관한 것이다.In addition, the present invention provides a method for providing information related to diagnosis of cervical incompetence, wherein the biological sample is blood, plasma, platelets, serum, ascites fluid, bone marrow fluid, lymph fluid, saliva, tear fluid, mucosal fluid, amniotic fluid, or a combination thereof It is about.

또한, 본 발명은 DEFA3, CXCL10, RNASE3, CRISP3, FOLR3 (folate receptor gamma), MCEMP1 (mast cell-expressed membrane protein 1) 및 CD177 중 선택된 1종 이상의 유전자 전사 수준 또는 이 유전자로부터 생성되는 단백질 수준을 측정하는 제제를 포함하는 자궁경부 무력증 환자의 만삭 분만 여부를 판별하는, 자궁경부 무력증 예후 진단용 조성물에 관한 것이다.In addition, the present invention measures the transcription level of one or more genes selected from among DEFA3, CXCL10, RNASE3, CRISP3, FOLR3 (folate receptor gamma), MCEMP1 (mast cell-expressed membrane protein 1) and CD177 or the protein level produced from this gene The present invention relates to a composition for diagnosing the prognosis of cervical incompetence, which determines whether a patient with cervical incompetence has a full-term delivery or not, comprising a preparation for cervical incompetence.

또한, 본 발명은 자궁경부 무력증 환자로부터 분리된 생물학적 시료로부터 DEFA3, CXCL10, RNASE3 및 CRISP3 중 선택된 하나 이상의 유전자의 전사 수준 또는 이 유전자로부터 생성되는 단백질 발현 수준을 측정하여 유전자 전사 수준 또는 단백질 발현 수준이 자궁경부 무력증 환자의 평균값보다 높은 경우 자궁경부 무력증 봉합 수술 후 만삭 분만 가능성이 큰 것으로 판단하는, 자궁경부 무력증 예후 진단용 조성물에 관한 것이다. In addition, the present invention measures the transcription level of one or more genes selected from DEFA3, CXCL10, RNASE3 and CRISP3 or the protein expression level produced from this gene from a biological sample isolated from a patient with cervical asthenia, and the gene transcription level or protein expression level is The present invention relates to a composition for diagnosing the prognosis of cervical incompetence, which determines that the possibility of full-term delivery after cervical incompetence suture surgery is high when the average value of cervical incompetence patients is higher.

또한, 본 발명은 자궁경부 무력증 환자로부터 분리된 생물학적 시료로부터 FOLR3 (folate receptor gamma), MCEMP1 (mast cell-expressed membrane protein 1) 및 CD177 중 선택된 하나 이상의 유전자의 전사 수준 또는 이 유전자로부터 생성되는 단백질 발현 수준을 측정하여 유전자 전사 수준 또는 단백질 발현 수준이 자궁경부 무력증 환자의 평균값보다 작은 경우 자궁경부 무력증 봉합 수술 후 만삭 분만 가능성이 큰 것으로 판단하는, 자궁경부 무력증 예후 진단용 조성물에 관한 것이다.In addition, the present invention is a transcription level of one or more genes selected from FOLR3 (folate receptor gamma), MCEMP1 (mast cell-expressed membrane protein 1) and CD177 from biological samples isolated from cervical asthenia patients, or protein expression produced from these genes The present invention relates to a composition for diagnosing prognosis of cervical incompetence, in which the possibility of full-term delivery after cervical incompetence suture surgery is determined by measuring the gene transcription level or protein expression level is lower than the average value of cervical incompetence patients.

또한, 본 발명은 상기 자궁경부 무력증 예후 진단용 조성물을 포함하는 자궁경부 무력증 예후 진단용 키트에 관한 것이다.In addition, the present invention relates to a kit for diagnosing the prognosis of cervical incompetence comprising the composition for diagnosing the prognosis of cervical incompetence.

이뿐만 아니라, 본 발명은In addition to this, the present invention

1) 자궁경부 무력증 환자로부터 분리된 생물학적 시료에서 DEFA3, CXCL10, RNASE3, CRISP3, FOLR3 (folate receptor gamma), MCEMP1 (mast cell-expressed membrane protein 1) 및 CD177 중 선택된 1종 이상의 유전자의 전사 수준 또는 이 유전자로부터 생성되는 단백질 또는 이의 단편의 발현 수준을 측정하는 단계; 및 1) Transcription level of one or more genes selected from among DEFA3, CXCL10, RNASE3, CRISP3, FOLR3 (folate receptor gamma), MCEMP1 (mast cell-expressed membrane protein 1) and CD177 in biological samples isolated from cervical asthenia patients Measuring the expression level of a protein or fragment thereof produced from the gene; and

2) 상기 측정된 전사 수준 또는 발현 수준을 자궁경부 무력증 환자들의 상기 해당 유전자 전사 수준 또는 단백질 발현 수준 평균값과 비교하는 단계;를 포함하는 자궁경부 무력증 예후 진단과 관련된 정보를 제공하는 방법에 관한 것이다. 2) comparing the measured transcription level or expression level with the average value of the gene transcription level or protein expression level of cervical incompetence patients; to provide information related to prognosis diagnosis of cervical incompetence.

본 발명에 따르면, DEFA3 등의 유전자 전사 정도 또는 단백질 발현 정도를 정상 대조군과 비교하여 차이가 있는 경우 자궁경부 무력증 여부를 진단할 수 있다.According to the present invention, the level of gene transcription or protein expression, such as DEFA3, can be compared with a normal control group, and if there is a difference, cervical incompetence can be diagnosed.

또한, 본 발명에 따르면, CRISP3 등의 유전자 전사 정도 또는 단백질 발현 정도를 자궁경부 무력증 환자들의 평균값과 대비하여 차이가 있는 경우 자궁경부 무력증 봉합 수술 이후 만삭 분만 또는 조산 여부를 진단할 수 있다.In addition, according to the present invention, when the level of gene transcription or protein expression, such as CRISP3, is compared with the average value of cervical incompetence patients, full-term delivery or premature birth can be diagnosed after cervical incompetence suture surgery.

이와 같은 진단을 통하여 임산부의 안전한 분만을 예측하거나 조기 치료할 수 있어 산모 및 태아의 건강을 제고할 수 있다. Through such a diagnosis, it is possible to predict a safe delivery of a pregnant woman or to treat it early, thereby improving the health of the mother and fetus.

도 1. 전혈 전사체의 전체 유전자 발현 및 차등 발현 분석. A. 자궁경부 무력증 및 정상 대조군을 나타내는 다차원 스케일링 (MDS). B. 자궁경부 무력증 여성과 정상 대조군의 전체 유전자 기반 차별적 발현을 나타내는 화산형 플롯. x 축은 군간 폴드 변경 차이의 로그에 해당하고 y 축은 P 값의 음의 로그에 해당한다. 조정된 P 값 <0.05를 사용할 때 차별적으로 발현된 유전자 (빨간 점)가 30개 있었다.
도 2. 자궁경부 무력증 유전자의 강화된 유전자 온톨로지 (GO) 범주 (A-C) 및 KEGG (Kyoto Encyclopedia of Genes and Genomes) 경로 (D). 자궁경부 무력증 여성과 대조군에서 차별적으로 발현되는 유전자의 생물학적 과정 (A), 세포 (B) 및 분자 (C)에 대한 GO 비교. CI-조산 (CI-preterm) 대 CI-만삭 분만 (CI-term) 여성의 유전자에 대한 강화된 유전자 온톨로지 (GO) 범주 (D-F) 및 KEGG 경로 (G). CI-조산 (CI-preterm) 대 CI-만삭 분만 (CI-term) 여성 간에 차별적으로 발현된 유전자의 생물학적 과정 (A), 세포 (B) 및 분자 (C)의 GO 비교. 모든 제시된 GO 항은 조정된 P 값 <0.01로 상당히 풍부하다. CI, 자궁경부 무력증.
도 3. CI 및 대조군 (A)의 전혈과 CI-만삭 분만 및 CI-조산 그룹 (B)의 전혈에서 선택된 DEGs 발현의 mRNA. * 대조군과 비교하여 유의한 차이 (P <0.05). CI, 자궁경부 무력증.
도 4. CI 및 대조군 (A)에서 알파 디펜신 3의 혈청 농도. CI, 자궁경부 무력증.Figure 1. Global gene expression and differential expression analysis of whole blood transcripts. A. Multidimensional scaling (MDS) representing cervical incompetence and normal controls. B. Volcano plot showing global gene-based differential expression in women with cervical incompetence and normal controls. The x-axis corresponds to the logarithm of the fold change difference between groups and the y-axis corresponds to the negative logarithm of the P value. There were 30 differentially expressed genes (red dots) when using an adjusted P value <0.05.
Figure 2. Enriched Gene Ontology (GO) categories (AC) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways (D) of cervical asthenia genes. GO comparison for biological processes (A), cells (B) and molecules (C) of genes differentially expressed in cervical asthenia women and controls. Enriched Gene Ontology (GO) categories (DF) and KEGG pathways (G) for genes in CI-preterm versus CI-term women. GO comparison of biological processes (A), cells (B) and molecules (C) of differentially expressed genes between CI-preterm versus CI-term (CI-term) women. All presented GO terms are significantly enriched with adjusted P values <0.01. CI, cervical incompetence.
Figure 3. mRNA expression of selected DEGs in whole blood of CI and control groups (A) and CI-term and CI-preterm groups (B). *Significant difference compared to control group ( P < 0.05). CI, cervical incompetence.
Figure 4. Serum concentrations of alpha-defensin 3 in CI and controls (A). CI, cervical incompetence.

아래에서는 구체적인 실시예를 들어 본 발명의 구성을 좀 더 자세히 설명한다. 그러나 본 발명의 범위가 실시예의 기재에만 한정되는 것이 아님은 본 발명이 속한 기술분야에서 통상의 지식을 가진 자에게 자명하다.In the following, the configuration of the present invention will be described in more detail with reference to specific embodiments. However, it is apparent to those skilled in the art that the scope of the present invention is not limited only to the description of the examples.

연구 대상 환자study patient

검경 검사에서 2차 삼분기에 태아막이 보이는 자궁 경부 확장을 나타내며, 증상이 거의 없거나 전혀 없는 환자는 자궁경부 무력증인 것으로 간주되어 연구에 포함되었다. 자궁 경부 확장, 소실 및 돌출 태아막은 초음파 검사로 평가하고 검경 검사로 확인했다. 막의 조기 파열을 배제하기 위해 나이트라진 테스트 및/또는 Actim Prom™ 테스트 (Medix Biochemica, Kauniainen, Finland)를 수행했다. 자궁 수축은 환자의 지각, 심전도 및 복부 촉진에 의해 평가되었다. 자궁 경부 확장이 있는 환자는 최소 6시간 동안 관찰되었으며, 신체검사에서 조기 진통과 융모양막염을 제외하면 자궁경부 봉축술을 시행한 것으로 나타났다. 임상 융모양막염의 진단 기준은 다음 중 하나 이상을 포함한다: 산욕열 38℃ 이상, 산모 또는 태아 빈맥 (각각 분당 100회 이상, 분당 160회 이상) 또는 자궁 압통. 우리는 주요 기형 태아, 다태 임신, 지속적인 정기적 자궁 수축, 질 출혈, 막 파열, 임상 융모양막염 또는 사전 예방적 자궁경부 봉축술한 여성을 제외했다. 또한, 기침, 발열, 구토, 설사, 임신에 영향을 미칠 수 있는 바이러스 및 세균성 질환을 시사하는 비정상적인 피부 발진과 같은 전신 증상 및 징후가 있는 여성과 임상 화학 검사에서 비정상적인 간 및 신장 기능 검사를 받은 여성 및 소변 검사에서 요로 감염이 있는 여성을 제외했다.Patients who exhibited cervical dilatation with visible fetal membranes in the second trimester on microscopy and who had few or no symptoms were considered to have cervical incompetence and were included in the study. Cervical dilatation, loss, and protruding fetal membranes were evaluated by ultrasonography and confirmed by speculum examination. A nitrazine test and/or an Actim Prom™ test (Medix Biochemica, Kauniainen, Finland) was performed to rule out premature rupture of the membrane. Uterine contraction was assessed by patient's perception, electrocardiogram and abdominal palpation. Patients with cervical dilatation were observed for at least 6 hours, and physical examination revealed that cervical ablation was performed except for preterm labor and chorioamnionitis. Diagnostic criteria for clinical chorioamnionitis include one or more of the following: puerperal fever greater than 38°C, maternal or fetal tachycardia (>100 and 160/min, respectively), or uterine tenderness. We excluded women with major fetal malformations, multiple pregnancies, continuous regular uterine contractions, vaginal hemorrhage, membrane rupture, clinical chorioamnionitis, or prophylactic cervical ablation. Additionally, women with systemic symptoms and signs such as cough, fever, vomiting, diarrhea, abnormal skin rash suggestive of viral and bacterial disease that may affect fertility, and women with abnormal liver and kidney function tests on clinical chemistry tests. and women with urinary tract infections in urinalysis were excluded.

대조군의 여성 (n = 4)은 자궁 수축이나 체액 누출이 없고, 3cm 이상의 자궁 경부 길이, 자궁 경부 확장이 없는 외래 환자 클리닉 방문 환자 중에서 선택하였고, 초음파 촬영으로 확인하였다. 표본 이질성을 줄이기 위해 모성 연령과 제태 연령이 일치하는 환자를 선택했다. CI 진단 당일 여성에게서 전혈 샘플을 채취했다. 대조군의 경우, 연구 등록일에 샘플을 얻었다. RNA 서열결정 분석을 검증하기 위해, CI 및 대조군의 개별 샘플 세트를 사용하여 qRT-PCR 및 면역 분석 실험을 수행했다. qRT-PCR을 위한 혈액 샘플을 PAXgene™ RNA 안정화 튜브 (QIAGEN, Hilden, Germany)에 수집하고 혈액 샘플의 일부를 원심분리하여 혈청을 수집하고 혈액 및 혈청 샘플을 모두 -80℃에서 냉동 보존했다. 이 연구는 한림대학교 강남성심병원 윤리위원회의 승인을 받았다 (No. 2017-08-014). 연구 참여에 대한 서면 동의서는 모집 전에 각 개인으로부터 얻었다.Women in the control group (n = 4) were selected from outpatient clinic visits without uterine contractions or fluid leakage, cervical length greater than 3 cm, or cervical dilatation, and confirmed by ultrasonography. To reduce sample heterogeneity, patients with matching maternal and gestational ages were selected. Whole blood samples were obtained from women on the day of CI diagnosis. For the control group, samples were obtained on the day of study enrollment. To validate the RNA sequencing analysis, qRT-PCR and immunoassay experiments were performed using individual sample sets of CI and control. Blood samples for qRT-PCR were collected in PAXgene™ RNA stabilization tubes (QIAGEN, Hilden, Germany), a portion of the blood sample was centrifuged to collect serum, and both blood and serum samples were cryopreserved at -80°C. This study was approved by the Ethics Committee of Gangnam Sacred Heart Hospital, Hallym University (No. 2017-08-014). Written informed consent for study participation was obtained from each individual prior to recruitment.

라이브러리 준비 및 서열결정Library preparation and sequencing

RNA 서열결정 프로파일링을 위해 5mL 혈액을 EDTA 튜브에 수집했다. 총 RNA는 TRIzol® RNA Isolation Reagents (Life Technologies, Carlsbad, CA, USA)를 사용하여 분리하고 -80℃에서 보관했다. RNA 제품의 농도와 품질은 Agilent 2100 바이오 분석기 플랫폼 (Agilent Technologies, Santa Clara, CA, USA)에서 결정되었다. mRNA 시퀀싱 라이브러리는 제조업체의 프로토콜에 따라 Illumina TruSeq Stranded mRNA 샘플 준비 키트 (Illumina, San Diego, CA, USA)를 사용하여 총 RNA를 준비하였다. 라이브러리의 품질과 크기는 Agilent 2100 바이오 분석기 DNA 키트를 사용하여 평가하였고, CFX96 Real Time System (Bio-Rad, Hercules, CA, USA)을 사용하여 qPCR에 의해 정량화되었으며 NextSeq500 시스템 (Illumina)에서 페어드 엔드 75 염기쌍과 단일 8 염기쌍 인덱스 실행으로 시퀀싱하였다.5mL blood was collected in EDTA tubes for RNA sequencing profiling. Total RNA was isolated using TRIzol® RNA Isolation Reagents (Life Technologies, Carlsbad, CA, USA) and stored at -80°C. Concentration and quality of RNA products were determined on an Agilent 2100 bioanalyzer platform (Agilent Technologies, Santa Clara, CA, USA). mRNA sequencing libraries were prepared for total RNA using the Illumina TruSeq Stranded mRNA Sample Preparation Kit (Illumina, San Diego, CA, USA) according to the manufacturer's protocol. The quality and size of libraries were assessed using the Agilent 2100 Bioanalyzer DNA Kit, quantified by qPCR using a CFX96 Real Time System (Bio-Rad, Hercules, CA, USA) and paired-end on a NextSeq500 system (Illumina). 75 base pair and a single 8 base pair index run were sequenced.

전처리 및 게놈 Preprocessing and genomic 맵핑mapping

원시 데이터에 잠재적으로 존재하는 시퀀싱 어댑터와 원시 데이터 품질 기반은 Skewer [13]에 의해 조정되었다. -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCA 및 -y AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 옵션은 Illumina TruSeq 어댑터의 공통 어댑터 서열에 사용되었으며 -q 0 -l 25 -k 3 -r 0.1 -d 0.1 옵션은 원시 데이터의 저품질 5' 및 3' 말단 트리밍에 사용되었다. 저품질 염기와 시퀀싱 어댑터를 트리밍한 후 완전한 고품질 데이터는 STAR 소프트웨어를 사용하여 참조 게놈에 맵핑되었다 [14]. 가닥-특이적 라이브러리 옵션 --library-type = fr-firststrand가 맵핑 프로세스에 적용되었다.The sequencing adapters potentially present in the raw data and the raw data quality basis were calibrated by Skewer [13]. The -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and -y AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT options were used for common adapter sequences in the Illumina TruSeq adapters, and the -q 0 -l 25 -k 3 -r 0.1 -d 0.1 options were used for low-quality 5' and 3' end trimming of the raw data. . After trimming low-quality bases and sequencing adapters, complete high-quality data were mapped to a reference genome using STAR software [14]. The strand-specific library option --library-type = fr-firststrand was applied to the mapping process.

유전자 발현 정량 및 차별적으로 발현된 유전자 (Gene expression quantification and differentially expressed genes ( DEGDEG ) 분석) analyze

가닥-특이적 라이브러리 옵션, --library-type = fr-firststrand 및 기타 기본 옵션을 포함하는 Cufflinks를 사용하여 참조 게놈에 대한 맵핑된 읽기 데이터를 유전자 발현 값으로 정량화했다 [15]. GTF 형식의 UCSC 게놈 브라우저 데이터베이스 (https://genome.ucsc.edu)에서 참조 게놈 hg19의 유전자 주석이 유전자 모델로 사용되었으며, 발현 값은 백만 단편의 맵핑된 읽기 데이터 당 전사체 킬로베이스 당 단편으로 계산되었다. Cufflinks 패키지의 Cuffdiff 소프트웨어를 사용하여 CI와 대조군 간의 DEG, CI-조산 그룹 및 CI-만삭 분만 그룹 간의 DEG를 분석했다 [16]. 샘플 간의 발현 프로파일을 비교하기 위해 선택된 DEG의 정규화된 발현 값은 인하우스 R 스크립트로 클러스터링하였다. 발현 배수 (expression-fold) 변화와 두 그룹 사이의 조정된 P 값에 대한 화산형 플롯도 사내 R 스크립트를 사용하여 도시하였다.Data mapped to the reference genome were quantified as gene expression values using Cufflinks with the strand-specific library option, --library-type = fr-firststrand and other default options [15]. Gene annotations from the reference genome hg19 in the UCSC Genome Browser database (https://genome.ucsc.edu) in GTF format were used as a gene model, with expression values expressed as fragments per kilobase of transcript per million fragments of mapped read data. It was calculated. DEGs between CI and control groups, and DEGs between CI-preterm and CI-term delivery groups were analyzed using the Cuffdiff software of the Cufflinks package [16]. Normalized expression values of selected DEGs were clustered with an in-house R script to compare expression profiles between samples. Volcano plots of expression-fold changes and adjusted P-values between the two groups were also plotted using an in-house R script.

기능적 농축 분석 (Functional enrichment analysis)Functional enrichment analysis

CI와 대조군 사이의 차별적 유전자 발현의 생물학적 기능적 역할을 검토하기 위해, 유전자 온톨로지의 생물학적 과정, KEGG 경로 및 g : Profiler 버전 0.6.7에 의한 기타 기능적 유전자 세트를 포함하여 DEG와 기능 범주화된 유전자 간에 유전자 세트 중복 테스트를 수행했다 [17]. Benjamini-Hochberg 절차는 다중 테스트를 조정하는 데 사용되었으며 조정된 P 값이 0.05 미만인 경우 농축이 정의되었다. CI와 관련된 DEG의 효율성을 조사하기 위해 MDS (Multi-dimensional scaling)가 사용되었다.To examine the biological functional role of differential gene expression between CI and control, we analyzed genes between DEGs and functionally categorized genes, including biological processes in gene ontology, KEGG pathways, and other functional gene sets by g: Profiler version 0.6.7. A set redundancy test was performed [17]. The Benjamini-Hochberg procedure was used to adjust for multiple testing and enrichment was defined if the adjusted P value was less than 0.05. Multi-dimensional scaling (MDS) was used to investigate the efficiency of DEGs related to CI.

DEG의DEG's qRTqRT -- PCRPCR 검증 verification

제조업체의 프로토콜에 따라 PAXgene Blood RNA Isolation Kit (QIAGEN)를 사용하여 냉동 혈액 샘플에서 총 RNA를 추출했다. RNA 품질은 Agilent 2100 Bioanalyzer로 검증하였으며, RNA 정량은 NanoDrop® ND-1000 분광 광도계 (Thermo Fisher Scientific, Waltham, MA, USA)를 사용하여 수행하였다. 더 높은 통계적 유의성, 더 큰 절대적 배수-변화 및 임상적 유의성을 기반으로 유전자를 선택하고 qRT-PCR로 테스트하여 RNA-Seq 분석 결과를 확인했다. DEFA3 (defensin alpha 3), JUN (jun proto-oncogene), ELANE (호중구 엘라 스타 제) 및 CD177 (CD177 분자)은 CI와 대조군 사이의 검증 실험을 위해 선택되었지만 CEACAM8 (CEA 세포 접착 분자 8), CRISP3 (시스테인이 풍부한 분비 단백질 3), DEFA3 및 RNASE3 (리보 뉴 클레아 제 A 패밀리 구성원 3)은 CI-조산 그룹과 CI-만삭 분만 그룹 간의 차별적인 발현을 확인하기 위하여 선택하였다. Maxime RT PreMix Kit (iNtRON Biotechnology, Seoul, South Korea)를 이용한 cDNA 합성에 4 마이크로그램의 RNA를 사용했다. PCR은 Rotor-Gene Q (QIAGEN)에서 2Х Rotor-Gene SYBR Green PCR Master Mix (QIAGEN)를 사용하여 수행되었다. 프라이머 서열은 표 4에 나와 있다. 액틴은 하우스 키핑 대조군으로 사용되었다. 각 샘플은 세 번 실행되었으며 모든 샘플은 세 번의 수행 사이의 표준 편차가 0.5 미만이었다.Total RNA was extracted from frozen blood samples using the PAXgene Blood RNA Isolation Kit (QIAGEN) according to the manufacturer's protocol. RNA quality was verified with an Agilent 2100 Bioanalyzer, and RNA quantification was performed using a NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Genes were selected based on higher statistical significance, greater absolute fold-change and clinical significance and tested by qRT-PCR to confirm RNA-Seq analysis results. DEFA3 (defensin alpha 3), JUN (jun proto-oncogene), ELANE (neutrophil elastase) and CD177 (CD177 molecule) were selected for validation experiments between CI and control, whereas CEACAM8 (CEA cell adhesion molecule 8), CRISP3 (cysteine-rich secreted protein 3), DEFA3 and RNASE3 (ribonuclease A family member 3) were selected to confirm differential expression between the CI-preterm and CI-term delivery groups. 4 micrograms of RNA were used for cDNA synthesis using the Maxime RT PreMix Kit (iNtRON Biotechnology, Seoul, South Korea). PCR was performed using 2Х Rotor-Gene SYBR Green PCR Master Mix (QIAGEN) in Rotor-Gene Q (QIAGEN). Primer sequences are shown in Table 4. Actin was used as a housekeeping control. Each sample was run three times and all samples had a standard deviation less than 0.5 between the three runs.

혈청 알파 serum alpha 디펜신defensins 3에 대한 ELISA ELISA for 3

혈청 알파 디펜신 3의 수준은 제조업체의 지침에 따라 ELISA 키트 (Cusabio, Wuhan, China)를 사용하여 이중으로 결정되었다. 알파 디펜신 3의 농도는 표준 곡선에서 보간하여 결정되었다. 검출 분석의 한계는 1.87 ng/mL이었고, 계산된 분석 간 및 분석 내 변동 계수는 <10%였다.Levels of serum alpha-defensin 3 were determined in duplicate using an ELISA kit (Cusabio, Wuhan, China) according to the manufacturer's instructions. The concentration of alpha-defensin 3 was determined by interpolation from the standard curve. The assay limit of detection was 1.87 ng/mL and the calculated inter- and intra-assay coefficient of variation was <10%.

통계 분석statistical analysis

데이터는 연속 변수의 경우 평균 ± 표준 편차 또는 중앙값 (사 분위수 범위)으로 표시되고 범주형 변수의 경우 n (%)으로 표시된다. Mann-Whitney U 테스트를 사용하여 CI와 대조군 사이, CI-만삭 분만과 CI-조산 그룹 간의 비교를 수행했다. 비율은 Fisher의 정확한 검정을 사용하여 비교되었다. 통계 분석은 SPSS 소프트웨어 (버전 23.0, SPSS, Inc., Chicago, IL, USA)를 사용하여 수행되었다. P <0.05는 통계적으로 유의한 것으로 간주되었다.Data are presented as mean ± standard deviation or median (interquartile range) for continuous variables and as n (%) for categorical variables. Mann-Whitney U tests were used to make comparisons between CI and control groups, CI - term delivery and CI - preterm groups. Proportions were compared using Fisher's exact test. Statistical analysis was performed using SPSS software (version 23.0, SPSS, Inc., Chicago, IL, USA). P<0.05 was considered statistically significant.

결과 1: 연구 대상Outcome 1: Study subject

RNA-Seq 분석에 포함된 15명의 시험자 (CI 군, n = 11; 대조군, n = 4)의 임상적 특징은 표 1에 나와 있다. 시료 채취 시점의 산모 연령과 제태 연령 (gestational age)은 두 군 사이에 유의한 차이가 없었다. CI 군 중 4명의 여성이 조산했다 [CI-조산 그룹; 분만시 임신 주수, 19.8 (17.4-30.9)], 나머지는 임신 37주 후에 분만하였다 [CI-만삭 분만 그룹; 분만시 임신 주수, 38.0 (37.0-39.0)]. CI-조산 그룹의 백혈구 (WBC)와 호중구 수는 CI-만삭 분만 그룹보다 유의하게 높았다 (표 1).The clinical characteristics of 15 test subjects (CI group, n = 11; control group, n = 4) included in the RNA-Seq analysis are shown in Table 1. Maternal age and gestational age at the time of sampling were not significantly different between the two groups. Four women in the CI group gave birth prematurely [CI-preterm group; gestational age at delivery, 19.8 (17.4-30.9)], the remainder delivered after 37 weeks of gestation [CI-term delivery group; Gestational age at delivery, 38.0 (37.0–39.0)]. The white blood cell (WBC) and neutrophil counts of the CI-preterm delivery group were significantly higher than those of the CI-term delivery group (Table 1).

결과 2: CI와 대조군 사이에서 차별적으로 발현된 유전자Result 2: Differentially expressed genes between CI and control

11개의 CI 및 4개의 대조군 샘플에 대해 RNA-Seq를 사용하여 혈액 샘플의 게놈 전체 전사체를 분석했다. 유전자 발현 데이터에 대해 MDS를 수행하여 CI와 대조군 사이의 유사성 패턴을 결정했다. MDS 플롯은 대조군 샘플이 CI 샘플과 명확하게 구별되고 CI 샘플이 더 큰 다양성을 나타냄을 보여준다 (도 1A). 30개의 유전자가 CI와 대조군 사이에서 유의하게 차별적으로 발현되는 것으로 확인되었다 (잘못된 발견률 <0.05, 겹 변화 ≥2) (그림 1B, 표 2). 이 중 유전자 26개는 대조군에 비해 CI 군에서 크게 상향 조절되었고 4개는 하향 조절되었다. 상향 조절된 DEG에는 호중구 매개 면역 관련 유전자 [DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8) 및 CEACAM8)], 중탄산염 수송 관련 유전자 [(CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1)]가 있었다. 두 그룹 간에 차별적으로 조절되는 근본적인 생물학적 경로를 이해하기 위해 기능적 농축 분석을 수행했다. 생물학적 과정의 범주에서 23개 용어가 농축되었고, 중탄산염 수송, 골수성 백혈구 활성화, 산소 수송, 호중구 탈과립 및 호중구 활성화가 DEGs에 대해 가장 유의하게 농축되었다. 이와 유사하게, DEGs는 세포 성분 범주에서 23개 용어로, 분자 기능 범주에서 5개 용어로 농축되었다 (도 2A-C). KEGG 경로 분석 결과 가장 농축된 경로는 말라리아와 아프리카 트리파노소마증이었다 (도 2D).We analyzed genome-wide transcriptomes of blood samples using RNA-Seq for 11 CI and 4 control samples. MDS was performed on the gene expression data to determine similarity patterns between CIs and controls. The MDS plot shows that the control samples are clearly distinct from the CI samples and the CI samples show greater diversity (Fig. 1A). Thirty genes were found to be significantly differentially expressed between CI and control (false discovery rate <0.05, fold change ≥2) (Fig. 1B, Table 2). Of these, 26 genes were significantly up-regulated and 4 were down-regulated in the CI group compared to the control group. Upregulated DEGs include genes related to neutrophil-mediated immunity [DEFA3, CD177, JUN, ELANE, bactericidal permeability increasing protein (BPI), matrix metallopeptidase 8 (MMP8) and CEACAM8)], genes related to bicarbonate transport [(carbonic anhydrase 1 (CA1)) , HBA1 (hemoglobin subunit alpha 1), and SLC4A1 (solute carrier family 4 member 1)]. To understand the underlying biological pathways that were differentially regulated between the two groups, functional enrichment analysis was performed.23 in the category of biological processes. Terms were enriched, and bicarbonate transport, myeloid leukocyte activation, oxygen transport, neutrophil degranulation and neutrophil activation were most significantly enriched for DEGs Similarly, DEGs were enriched with 23 terms in the cellular component category and 5 terms in the molecular function category. KEGG pathway analysis showed that the most enriched pathways were malaria and African trypanosomiasis (FIG. 2D).

결과 3: CI-조산 및 CI-만삭 분만 그룹 간의 Results 3: Between CI-preterm and CI-term delivery groups DEGDEG

임신 결과를 바탕으로 CI 그룹의 환자를 CI-만삭 분만 (n = 7)과 CI-조산 (n = 4) 그룹으로 더 나누고 이들 사이의 DEG를 조사했다. 두 그룹 간의 임상 특성 비교는 표 1에 나와 있다. CI-만삭 분만과 CI-조산 그룹 간에 총 338개의 유전자가 차별적으로 발현되었다 (잘못된 발견률 <0.05 및 fold-change ≥2) (표 5 내지 표 26, 표의 크기가 과도하게 큰 관계로 표 5~ 표 26으로 나누어 표시함, 표 5와 표 6은 서로 연결된 표이고, 표 7, 표 8은 서로 연결된 표이며, 이후 표 25와 표 26까지 두 개의 표가 서로 연결된 표임). 이 중 194개의 유전자가 CI-조산 그룹에 비해 CI-만삭 분만 그룹에서 유의하게 상향 조절되었고 144개가 하향 조절되었다. DEFA3, CXCL10 (C-X-C motif chemokine ligand 10), RNASE3 및 CRISP3와 같은 유기체 관련 유전자에 대한 면역 반응 및 방어 반응은 CI-만삭 분만 그룹에서 상향 조절된 반면, 골수성 백혈구 매개 면역, 호중구 활성화에 관여하는 FOLR3 (folate receptor gamma), MCEMP1 (mast cell-expressed membrane protein 1) 및 CD177과 같은 유전자들은 CI-조산 그룹에서 상향 조절되었다. 기능적 농축 분석 결과, DEGs가 생물학적 과정 범주에서 84개 용어로 농축되었으며, 방어 반응 및 면역 반응 용어가 가장 유의하게 농축된 것으로 나타났다. DEG는 세포 성분 범주에서 32개 용어로, 분자 기능 범주에서 5개 용어로 농축되었다 (도 2D-F). 또한, KEGG 경로 분석에서 가장 유의하게 상향 조절된 경로는 인플루엔자 A, NOD 유사 수용체 (nucleotide-binding oligomerization domain-like receptor) 및 RIG-I 유사 수용체 (retinoic acid-inducible gene-I-like receptor) 신호 경로였다 (도 2G).Based on the pregnancy results, patients in the CI group were further divided into CI-term delivery (n = 7) and CI-preterm delivery (n = 4) groups, and the DEG between them was investigated. A comparison of clinical characteristics between the two groups is shown in Table 1. A total of 338 genes were differentially expressed (false discovery rate <0.05 and fold-change ≥2) between the CI-term and CI-preterm groups (Tables 5 to 26, Table 5 to Table 26 due to the excessively large table size). Divided into Table 26, Table 5 and Table 6 are tables linked to each other, Tables 7 and 8 are linked tables, and the two tables up to Table 25 and Table 26 are linked tables). Of these, 194 genes were significantly up-regulated and 144 were down-regulated in the CI-term delivery group compared to the CI-preterm group. Immune response and defense response to organism-related genes such as DEFA3, CXCL10 (C-X-C motif chemokine ligand 10), RNASE3 and CRISP3 were up-regulated in the CI-term delivery group, whereas FOLR3 (which is involved in myeloid leukocyte-mediated immunity and neutrophil activation) folate receptor gamma), MCEMP1 (mast cell-expressed membrane protein 1) and CD177 were upregulated in the CI-preterm group. As a result of functional enrichment analysis, DEGs were enriched in 84 terms in the biological process category, with defense response and immune response terms being the most significantly enriched. DEGs were enriched with 32 terms in the cellular component category and 5 terms in the molecular function category (Fig. 2D-F). In addition, the most significantly up-regulated pathways in the KEGG pathway analysis were the influenza A, NOD-like receptor (nucleotide-binding oligomerization domain-like receptor) and RIG-I-like receptor (retinoic acid-inducible gene-I-like receptor) signaling pathways. was (Fig. 2G).

결과 4: Result 4: DEGs의DEGs qRTqRT -- PCRPCR 검증 verification

RNA-Seq 결과에서 중요한 DEGs를 검증하기 위해 4개의 유전자 (DEFA3, JUN, ELANE 및 CD177)를 선택하고 CI (n = 11)과 대조군 (n = 5)의 개별 샘플 세트 간의 차별적인 발현을 qRT-PCR로 평가하였다. 환자 인구 통계 및 임상 특성은 표 27에 제시되어 있다. 4개의 유전자가 대조군보다 CI 그룹에서 더 높은 mRNA 발현을 나타내어 RNA-Seq 분석과 일치하였다 (도 3A). 또한, CI-만삭 분만과 CI-조산 그룹 간에 차이가 있는 네 가지 유전자 (DEFA3, RNASE3, CRISP3 및 CEACAM8)의 mRNA 발현을 평가하였다 (도 3B). 이들 유전자는 CI-조산 그룹에 비해 CI-만삭 분만 그룹에서 상당히 상향 조절되었으며 결과는 RNA-Seq 분석의 결과와 일치했다.Four genes (DEFA3, JUN, ELANE and CD177) were selected to validate significant DEGs from the RNA-Seq results and differential expression between individual sample sets of CI (n = 11) and controls (n = 5) was qRT- Evaluated by PCR. Patient demographics and clinical characteristics are presented in Table 27. Four genes showed higher mRNA expression in the CI group than in the control group, consistent with RNA-Seq analysis (Fig. 3A). In addition, the mRNA expression of four genes (DEFA3, RNASE3, CRISP3 and CEACAM8) that differed between the CI-term and CI-preterm groups were evaluated (Fig. 3B). These genes were significantly upregulated in the CI-term delivery group compared to the CI-preterm group, and the results were consistent with those of RNA-Seq analysis.

결과 5: CI 환자의 알파 Outcome 5: Alpha in CI patients 디펜신defensins 3 발현 3 expression

RNA-Seq 분석은 DEFA3를 대조군과 비교하여 CI 그룹에서 최고 상향조절된 DEG 중 하나인 것으로 확인했다. 또한, DEFA3은 CI-조산 그룹에 비해 CI-만삭 분만 그룹에서 상당히 상향조절되었다. 이뿐만 아니라, DEFA3 mRNA 발현 패턴은 RNA-Seq 분석 결과와 일치했다. 따라서, CI 환자 (n = 25)와 정상 대조군 (n = 17)에서 혈청 알파 디펜신 3의 차별적 발현을 확인하기 위해 면역 분석을 수행했다. 환자의 임상적 특징은 표 3에 나와 있다. 알파 디펜신 3은 대조군에 비해 CI 그룹에서 유의하게 상향 조절되었다 [CI 그룹 14.9 ng/mL (10.5 ~ 47.2 ng/mL) vs. 대조군 9.9 ng/mL (4.6 ~ 17.2 ng/mL), p = 0.014; 도 4]. RNA-Seq analysis identified DEFA3 as one of the highest upregulated DEGs in the CI group compared to the control group. Also, DEFA3 was significantly upregulated in the CI-term delivery group compared to the CI-preterm delivery group. In addition to this, the DEFA3 mRNA expression pattern was consistent with the results of RNA-Seq analysis. Therefore, an immunoassay was performed to confirm differential expression of serum alpha-defensin 3 in CI patients (n = 25) and normal controls (n = 17). The clinical characteristics of the patients are shown in Table 3. Alpha-defensin 3 was significantly up-regulated in the CI group compared to the control [CI group 14.9 ng/mL (10.5 to 47.2 ng/mL) vs. control 9.9 ng/mL (4.6 to 17.2 ng/mL), p = 0.014; Fig. 4].

Figure pat00001
Figure pat00001

Figure pat00002
Figure pat00002

Figure pat00003
Figure pat00003

Figure pat00004
Figure pat00004

Figure pat00005
Figure pat00005

Figure pat00006
Figure pat00006

Figure pat00007
Figure pat00007

Figure pat00008
Figure pat00008

Figure pat00009
Figure pat00009

Figure pat00010
Figure pat00010

Figure pat00011
Figure pat00011

Figure pat00012
Figure pat00012

Figure pat00013
Figure pat00013

Figure pat00014
Figure pat00014

Figure pat00015
Figure pat00015

Figure pat00016
Figure pat00016

Figure pat00017
Figure pat00017

Figure pat00018
Figure pat00018

Figure pat00019
Figure pat00019

Figure pat00020
Figure pat00020

Figure pat00021
Figure pat00021

Figure pat00022
Figure pat00022

Figure pat00023
Figure pat00023

Figure pat00024
Figure pat00024

Figure pat00025
Figure pat00025

Figure pat00026
Figure pat00026

Figure pat00027
Figure pat00027

Claims (12)

시험 대상 개체에서 분리된 혈액 시료로부터 중합효소 연쇄반응으로 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택되는 1종 이상의 유전자 전사 수준을 측정하는 제제를 포함하는 자궁경부 무력증 진단용 조성물.
DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit) by polymerase chain reaction from blood samples isolated from test subjects alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 and A composition for diagnosing cervical incompetence comprising an agent for measuring the transcription level of at least one gene selected from IDH3A.
 시험 대상 개체에서 분리된 혈액 시료로부터 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택되는 유전자로부터 생성되는 1종 이상의 단백질 발현 수준을 측정하는 제제를 포함하는 자궁경부 무력증 진단용 조성물.
DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 from blood samples isolated from the test subject. (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 and IDH3A genes A composition for diagnosing cervical incompetence comprising an agent for measuring the expression level of at least one protein produced from.
 청구항 1 또는 청구항 2에 있어서,
DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4 및 CFAP45 중 선택된 하나 이상의 유전자의 전사 수준 또는 이 유전자로부터 생성되는 단백질 발현 수준이 정상 대조군에 비하여 증가하는 경우 자궁경부 무력증으로 판단하는, 자궁경부 무력증 진단용 조성물.
According to claim 1 or claim 2,
DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), The transcription level of one or more genes selected from among ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4 and CFAP45, or the protein expression level produced from this gene, was higher than that of the normal control group. A composition for diagnosing cervical incompetence, which is judged to be cervical incompetence when increased compared to that of the present invention.
 청구항 1 또는 청구항 2에 있어서,
OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택된 하나 이상의 유전자의 전사 수준 또는 이 유전자로부터 생성되는 단백질 발현 수준이 정상 대조군에 비하여 감소하는 경우 자궁경부 무력증으로 판단하는, 자궁경부 무력증 진단용 조성물.
According to claim 1 or claim 2,
When the transcription level of one or more genes selected from OSBPL1A, SIGLEC8, ALOX15 and IDH3A or the protein expression level produced from this gene is reduced compared to the normal control group, cervical incompetence is determined as a composition for diagnosing cervical incompetence.
 청구항 1에 있어서,
상기 유전자 전사 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머, 프로브 또는 안티센스 뉴클레오타이드를 포함하는 것인, 자궁경부 무력증 진단용 조성물.
The method of claim 1,
The agent for measuring the level of gene transcription is a composition for diagnosing cervical asthenia, comprising a primer, probe or antisense nucleotide that specifically binds to the gene.
 청구항 2에 있어서,
상기 단백질 발현 수준을 측정하는 제제는 상기 유전자로부터 생성되는 단백질 또는 이의 단편에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 포함하는 것인, 자궁경부 무력증 진단용 조성물.
The method of claim 2,
The agent for measuring the protein expression level is a composition for diagnosing cervical incompetence, comprising an antibody or antigen-binding fragment thereof that specifically binds to a protein produced from the gene or a fragment thereof.
 청구항 6에 있어서,
상기 항체는 폴리클론 항체 또는 모노클론 항체인, 자궁경부 무력증 진단용 조성물.
The method of claim 6,
The antibody is a polyclonal antibody or a monoclonal antibody, a composition for diagnosing cervical incompetence.
 시험 대상 개체에서 분리된 혈액 시료로부터 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택되는 1종 이상의 유전자 전사 수준을 중합효소 연쇄반응을 이용하여 측정하는 제제를 포함하는 자궁경부 무력증 진단용 키트.
DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 from blood samples isolated from the test subject. (solute carrier family 4 member 1), 1 selected from ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 and IDH3A A kit for diagnosing cervical incompetence comprising an agent for measuring gene transcription levels of at least one species by using a polymerase chain reaction.
 시험 대상 개체에서 분리된 혈액 시료로부터 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택되는 유전자로부터 생성되는 1종 이상의 단백질 발현 수준을 측정하는 제제를 포함하는 자궁경부 무력증 진단용 키트.
DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 from blood samples isolated from the test subject. (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 and IDH3A genes A kit for diagnosing cervical incompetence comprising an agent for measuring the expression level of at least one protein produced from.
 1) 시험 대상 개체에서 분리된 혈액 시료에서 DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1), SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 및 IDH3A 중 선택된 1종 이상의 유전자의 전사 수준 또는 이 유전자로부터 생성되는 단백질 또는 이의 단편의 발현 수준을 측정하는 단계; 및
2) 상기 측정된 전사 수준 또는 발현 수준을 정상 대조군의 전사 수준 또는 단백질 발현 수준과 비교하는 단계;를 포함하는 자궁경부 무력증 진단과 관련된 정보를 제공하는 방법.
1) DEFA3, CD177, JUN, ELANE, BPI (bactericidal permeability increasing protein), MMP8 (matrix metallopeptidase 8), CEACAM8, CA1 (carbonic anhydrase 1), HBA1 (hemoglobin subunit alpha 1) from blood samples isolated from the test subject , SLC4A1 (solute carrier family 4 member 1), ALAS2, BTNL3, SLC2A14, SELENBP1, HBA2, HBD, MPP6, THNSL2, SERINC2, GADD45G, CEACAM6, PGLYRP1, CHST13, CITED4, CFAP45, OSBPL1A, SIGLEC8, ALOX15 and IDH3A Measuring the transcription level of one or more genes or the expression level of a protein or fragment thereof produced from the gene; and
2) comparing the measured transcription level or expression level with the normal control group's transcription level or protein expression level; a method for providing information related to diagnosis of cervical incompetence.
 청구항 10에 있어서,
상기 1) 단계는 RT-PCR, 경쟁적 RT-PCR(competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA: RNase protection assay), 노던 블랏팅(Northern blotting) 또는 DNA 칩을 이용하는, 자궁경부 무력증 진단과 관련된 정보를 제공하는 방법.
The method of claim 10,
Step 1) above is RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting ) or a method of providing information related to the diagnosis of cervical incompetence using a DNA chip.
 청구항 10에 있어서,
상기 생물학적 시료는 혈액, 혈장, 혈소판, 혈청 중 1종 이상인, 자궁경부 무력증 진단과 관련된 정보를 제공하는 방법.The method of claim 10,
The method of providing information related to the diagnosis of cervical incompetence, wherein the biological sample is one or more of blood, plasma, platelets, and serum.
KR1020230034446A 2021-02-09 2023-03-16 Marker for cervical insufficiency KR102635258B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020230034446A KR102635258B1 (en) 2021-02-09 2023-03-16 Marker for cervical insufficiency

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210017997A KR102551213B1 (en) 2021-02-09 2021-02-09 Prognostic markers for cervical insufficiency
KR1020230034446A KR102635258B1 (en) 2021-02-09 2023-03-16 Marker for cervical insufficiency

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020210017997A Division KR102551213B1 (en) 2021-02-09 2021-02-09 Prognostic markers for cervical insufficiency

Publications (2)

Publication Number Publication Date
KR20230042682A true KR20230042682A (en) 2023-03-29
KR102635258B1 KR102635258B1 (en) 2024-02-07

Family

ID=83110862

Family Applications (2)

Application Number Title Priority Date Filing Date
KR1020210017997A KR102551213B1 (en) 2021-02-09 2021-02-09 Prognostic markers for cervical insufficiency
KR1020230034446A KR102635258B1 (en) 2021-02-09 2023-03-16 Marker for cervical insufficiency

Family Applications Before (1)

Application Number Title Priority Date Filing Date
KR1020210017997A KR102551213B1 (en) 2021-02-09 2021-02-09 Prognostic markers for cervical insufficiency

Country Status (1)

Country Link
KR (2) KR102551213B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101978401B1 (en) 2017-08-01 2019-05-15 순천향대학교 산학협력단 A biomarker for diagnosing incompetent internal os of cervix and the uses thereof
KR20200132530A (en) * 2019-05-17 2020-11-25 한국표준과학연구원 Protein markers for predicting of preterm birth and diagnostic methods thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101978401B1 (en) 2017-08-01 2019-05-15 순천향대학교 산학협력단 A biomarker for diagnosing incompetent internal os of cervix and the uses thereof
KR20200132530A (en) * 2019-05-17 2020-11-25 한국표준과학연구원 Protein markers for predicting of preterm birth and diagnostic methods thereof

Non-Patent Citations (32)

* Cited by examiner, † Cited by third party
Title
ACOG Practice Bulletin No.142: Cerclage for the management of cervical insufficiency. Obstetrics and gynecology 2014, 123(2 Pt 1):372-379
Aldred PM et al., Human molecular genetics 2005, 14(14):2045-2052
Am J Reprod Immunol. 2018;80:e13030. (2018.12.31.) *
Biggio JR et al., American journal of obstetrics and gynecology 2005, 192(1):109-113
Borregaard N et al., Trends in immunology 2007, 28(8):340-345
Bryce J et al., Lancet (London, England) 2005, 365(9465):1147-1152
Canny G et al., Proceedings of the National Academy of Sciences of the United States of America 2002, 99(6): 3902-3907
Cullum R et al., Respirology (Carlton, Vic) 2011, 16(2):210-222
Dobin A et al., Bioinformatics (Oxford, England) 2013, 29(1):15-21
Hein M et al., American journal of obstetrics and gynecology 2001, 185(3):586-592
Heine RP et al., Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 1998, 27(3):513-518
Iams JD, The New England journal of medicine 2014, 370(3):254-261
Jiang H et al., BMC bioinformatics 2014, 15:182
Kawana K et al., Infection and immunity 2008, 76(7):3011-3018
Kukurba KR, Montgomery SB: RNA Sequencing and Analysis. Cold Spring Harbor protocols 2015, 2015(11):951-969
Lee SE et al., American journal of obstetrics and gynecology 2008, 198(6):633.e631-638
Liu L. et al., The Lancet Global health 2019, 7(6):e721-e734
Mann EC et al., American journal of obstetrics and gynecology 1961, 81:209-222
Murray CJ et al., Lancet (London, England) 2012, 380(9859):2197-2223
Mwaniki MK et al., Lancet (London, England) 2012, 379(9814):445-452
Nagalakshmi U et al., RNA-Seq: a method for comprehensive transcriptome analysis. Current protocols in molecular biology 2010, Chapter 4: Unit 4.11.11-13
Prasad SV, Fiedoruk K: Expression and Function of Host Defense Peptides at Inflammation Sites. 2019, 21(1).
Reimand J, Arak T, Adler P, Kolberg L, Reisberg S, Peterson H, Vilo J: g:Profiler-a web server for functional interpretation of gene lists (2016 update). 2016, 44(W1):W83-89
Selsted ME et al., The Journal of clinical investigation 1985, 76(4):1436-1439
Son GH et al., American journal of reproductive immunology (New York, NY : 1989) 2016, 75(2):155-161
Stock AJ, Kasus-Jacobi A, Pereira HA: The role of neutrophil granule proteins in neuroinflammation and Alzheimer's disease. 2018, 15(1):240.
Stromme WB et al., American journal of obstetrics and gynecology 1963, 85:223-233
Thakur M, Mahajan K: Cervical Incompetence. In: StatPearls. Treasure Island (FL): StatPearls Publishing Copyright ⓒ 2020, StatPearls Publishing LLC.; 2020
Trapnell C et al., Nature biotechnology 2010, 28(5):511-515
Vink J et al., Seminars in fetal & neonatal medicine 2016, 21(2):106-112
Wang Z et al., Nature reviews Genetics 2009, 10(1):57-63
Wehkamp J et al., Proceedings of the National Academy of Sciences of the United States of America 2005, 102(50):18129-18134

Also Published As

Publication number Publication date
KR20220114687A (en) 2022-08-17
KR102551213B1 (en) 2023-07-03
KR102635258B1 (en) 2024-02-07

Similar Documents

Publication Publication Date Title
Romero et al. Clinical chorioamnionitis at term I: microbiology of the amniotic cavity using cultivation and molecular techniques
Romero et al. Sterile intra-amniotic inflammation in asymptomatic patients with a sonographic short cervix: prevalence and clinical significance
Gomez-Lopez et al. Preterm labor in the absence of acute histologic chorioamnionitis is characterized by cellular senescence of the chorioamniotic membranes
Fang et al. Highly expressed miR-182-5p can promote preeclampsia progression by degrading RND3 and inhibiting HTR-8/SVneo cell invasion.
Luo et al. Long non-coding RNAs serve as diagnostic biomarkers of preeclampsia and modulate migration and invasiveness of trophoblast cells
US20080009552A1 (en) Markers of pre-term labor
Makieva et al. The preterm cervix reveals a transcriptomic signature in the presence of premature prelabor rupture of membranes
Pereyra et al. Transcriptomic analysis of fetal membranes reveals pathways involved in preterm birth
Schwebke et al. Midtrimester vaginal Mycoplasma genitalium in women with subsequent spontaneous preterm birth
Couture et al. Proinflammatory changes in the maternal circulation, maternal–fetal interface, and placental transcriptome in preterm birth
Dvorakova et al. Expression profile of heat shock proteins in placental tissues of patients with preterm prelabor rupture of membranes and spontaneous preterm labor with intact membranes
Sattorov PREDICTION OF PREMATURE OUTFLOW OF AMNIOTIC FLUID IN PRETERM PREGNANCY
WO2010033553A2 (en) Gene expression related to preeclampsia
Drozdzik et al. Interleukin‐6 level and gene polymorphism in spontaneous miscarriage
Son et al. Whole blood RNA sequencing reveals a differential transcriptomic profile associated with cervical insufficiency: a pilot study
US11149315B2 (en) Method for predicting cervical shortening and preterm birth
KR102551213B1 (en) Prognostic markers for cervical insufficiency
Chang et al. Analyses of placental gene expression in pregnancy-related hypertensive disorders
CN108866181B (en) Application of MBOAT1 gene in preeclampsia period
Funghi et al. Placental and maternal serum activin A in spontaneous and induced labor in late-term pregnancy
RU2592204C1 (en) Method for early prediction of habitual miscarriage
JP2022510488A (en) Nucleic acid biomarker for placental insufficiency
Lledo et al. Identification of vaginal microbiome associated with IVF pregnancy
Xie et al. Diagnostic gene biomarkers for predicting immune infiltration in endometriosis
RU2477861C1 (en) Early diagnostic technique in postpartum endometritis

Legal Events

Date Code Title Description
A107 Divisional application of patent
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant