KR20230016150A - Oleaginous yeast Yarrowia lipolytica sur2 mutant strain and method for cell surface-associated secretory production of sphingoid-based precursors, sphingosine and sphingolipids using the same - Google Patents

Abstract

The present invention relates to a mutant strain of oleaginous yeast Yarrowia lipolytica sur2 and a method for producing cell surface secretion of sphingoid-based precursors, sphingosine, and sphingolipids using the same. In the mutant strain of Yarrowia lipolytica sur2 according to the present invention, sur2 genes in Yarrowia lipolytica strains are deleted or expressions thereof are suppressed. According to the present invention, dihydrosphingosine can be mass-produced.

Description

Oleaginous yeast Yarrowia lipolytica sur2 mutant strain and method for cell surface secretion production of sphingoid-based precursors, sphingosine and sphingolipids using the same based precursors, sphingosine and sphingolipids using the same}

The present invention relates to the oleaginous yeast Yarrowia lipolytica ( Yarrowia lipolytica ) sur2 mutant strain and a sphingoid-based precursor using the same, cell surface secretion production method of sphingosine and sphingolipid, more specifically, dehydrogenase involved in the production of phytosphingosine of Yarrowia lipolytica SUR2 encoding phingosine C4-hydroxylase Genetically inactivated mutant strains are prepared, and various sphingosine precursors, dihydrosphingosine and sphingosine-based lipid glucosylceramide, are transferred to the cell surface with high efficiency without acetylation. It relates to a method for producing secretions. Furthermore, using the Yarrowia lipolytica sur2 mutant strain as a parent strain to amplify ceramidase gene expression or SLD1 It relates to a method for producing a strain that secretes and produces sphingosine by additionally inactivating a gene.

Sphingolipids represent a group of lipids derived from sphingoid bases such as sphingosine and are mainly present in cell membranes of animals, plants and microorganisms. Ceramide is a type of sphingolipid and is a molecule composed of a sphingoid base and a fatty acid. Ceramide is a major lipid component of the stratum corneum, the upper layer of the skin, and topical application of a composition containing ceramide can improve the barrier function and water retention properties of the skin. In addition, sphingoid bases, including sphingosine and dihydrosphingosine, are known to mediate various physiological effects such as inhibition of protein kinase C (PKC), and anti-inflammatory and antimicrobial compositions or Contained in skin and hair strengthening compositions.

Synthesis of sphingolipids begins when the amino acid serine and palmitate, one of the lipids, are combined and a palmitoyl group is attached to serine by serine palmitoyltransferase (SPT). . SPT enzyme activity is mainly determined by the concentration of saturated fatty acid as a substrate, which controls the degree of biosynthesis of sphingolipids. Then, dihydrosphingosine is produced by 3-keto-dihydrosphingosine reductase. This process is common to microorganisms, plants and animals. Afterwards, plants synthesize phytosphingosine and phytoceramide to finally produce glycosyl inositol phospho ceramides (GIPCs) and glucosylceramides (GlcCer), whereas animals Starting with hydrosphingosine, ceramide is synthesized to produce sphingomyelin, galactosylceramide, gangliosides, and glucosylceramide. In the case of yeast, there is a very large difference in sphingolipid biosynthesis between Saccharomyces cerevisiae and many other non-traditional yeasts. Saccharomyces cerevisiae strain DES1 encoding a sphingolipid desaturase enzyme starting from dihydrosphingosine Since there is no gene, only phytosphingosine and phytoceramide are produced and only mannosyl inositol phospho ceramide (MIPC) is produced, whereas many other yeasts have the DES1 gene and can produce phytoceramide starting with dihydrosphingosine. In addition, ceramide can also be produced to produce MIPC, GIPC, and GlcCer (FIG. 1).

As such, dihydrosphingosine is a key material commonly present in the sphingolipid production process of all organisms, and various types of sphingolipids can be synthesized using it. Therefore, sphingolipids and dihydrosphingosine are attracting attention as important ingredients in many cosmetic industries. As raw materials for these sphingolipids, animal-derived materials such as cattle have been used so far, but due to infection problems, rice, Vegetable sphingolipids such as wheat, soybean or potato are mainly used. However, since the amount of sphingolipids present in animals and plants is small, extraction and purification are difficult and expensive. Therefore, it is desired to develop a new production technology that can overcome this problem, and mass production technology of sphingolipids using microorganisms is a new strategy. It's getting attention.

In the case of the traditional yeast Saccharomyces cerevisiae, a mutant strain lacking SUR2 , a gene encoding dihydrosphingosine C4-hydroxylase that introduces an -OH group at the 4th carbon, induces a dehydrogenation in cells. It has been confirmed that hydrosphingosine is increased. However, its production level was found to be only 346 pmol per mg of intracellular protein, corresponding to approximately 10 μg per gram of biomass. This is a very low level not sufficient for efficient production in commercial processes. Synthesis levels of dihydrosphingosine and ceramide through amplification of TSC10 , a gene encoding 3-ketodihydrosphingosine reductase involved in the synthesis of dihydrosphingosine, in a wild-type Saccharomyces cerevisiae strain. Recombinant yeast with a level of 9.8 mg per 1 g has been described. In addition, human-derived DES1 was added to SUR2- deficient strains. A recombinant yeast strain producing human-type ceramide (ceramide-NS) has been prepared by introducing the gene. Unlike ceramide, sphingoid bases are known to induce apoptosis, so problems may arise in recombinant yeast that overproduce several sphingoid bases, including sphingosine. Pichia ciferrii exclusively produces phytosphingosine and its acetylated derivatives, and production levels have been found to be much higher than those required for de novo sphingolipid biosynthesis. That is, it is possible to bypass this problem by secreting a sphingoid base such as phytosphingosine through an excellent acetylating enzyme. In fact, Pichia sipherai SUR2 obtained using syringomycin E It was confirmed that the mutant strain overproduced its acetylated derivative along with accumulation of dihydrosphingosine. In addition, Pichia sipherai, unlike Saccharomyces cerevisiae, has DES1 and can convert dihydrosphingosine into ceramide. Overexpression of the sphingolipid desaturase gene DES1 and introduction of an additional mouse-derived alkaline ceramidase gene made it possible to detach sphingosine from ceramide, producing sphingosine and its acetylated derivatives at a level of 240 mg/L. reported

Yarrowia lipolytica yeast, an oleaginous yeast, is characterized by being able to use hydrophobic substrates well, so it can grow well using inexpensive substrates such as alkanes, as well as liposomes composed of more than 20% of the fat content of the cells. contains It is known that these fat granules mostly store triacylglyceride (TAG), and also contain ingredients such as ergosterol, and secrete or absorb them out of cells to control their amount. Yarrowia lipolytica follows the same process as microorganisms, plants, and animals until the synthesis of dihydrosphingosine, and can synthesize various complex sphingolipids including inositol similar to the characteristics of other yeasts. DES1 in Yarrowia lipolytica Because the gene exists, it is possible to produce various ceramides and glucosylceramides with sphingosine as the basic skeleton. In the case of the Yarrowia lipolytica strain, the acetylation of sphingoid bases such as phytosphingosine was confirmed by introducing ATF2 and SLI1 , which are Pichia sipherai acetylase genes, into the wild type strain. LCB4 encoding sphingoid long-chain base kinase It was confirmed that the production of phytosphingosine and its acetylated derivatives was increased up to 142 mg/L by further deleting the gene, and up to 650 mg/L under optimal conditions. However, technology for mass production of dihydrosphingosine, sphingosine and glucosylceramide with high efficiency without acetylation in Yarrowia lipolytica has not been developed.

Korean Patent Publication No. 10-2020-0031489 (published on March 24, 2020)

An object of the present invention is Yarrowia lipolytica ( Yarrowia lipolytica ) provides a Yarrowia lipolytica mutant strain in which the sur2 gene is deleted in the strain and a cell surface secretion production method of dihydrosphingosine, sphingosine or glucosylceramide using the strain is to do

In order to solve the above problems, the present invention Yarrowia lipolytica ( Yarrowia lipolytica ) Provides a Yarrowia lipolytica mutant strain in which the sur2 gene is deleted or expression is suppressed in the strain.

In addition, the present invention provides a method for producing dihydrosphingosine, sphingosine or glucosylceramide comprising culturing the Yarrowia lipolytica mutant strain in a medium.

In addition, the present invention is an enhanced cell surface secretion production of dihydrosphingosine or sphingosine, into which a gene encoding ceramidase is introduced into the Yarrowia lipolytica mutant strain. A cell surface secretion production method of dihydrosphingosine or sphingosine comprising the step of providing a Y. lipolytica mutant recombinant strain and culturing the Y. lipolytica mutant recombinant strain in a medium provides

In addition, the present invention is a cell surface of sphingosine or human glucosylceramide, in which the SLD1 gene encoding △8 desaturase is additionally deleted in the Yarrowia lipolytica mutant strain. Providing a Yarrowia lipolytica mutant recombinant strain with enhanced secretion production, and culturing the Yarrowia lipolytica mutant recombinant strain in a medium of sphingosine or human glucosylceramide Methods for producing cell surface secretions are provided.

The present invention relates to an oleaginous yeast Yarrowia lipolytica sur2 mutant strain and a method for producing cell surface secretion of sphingoid-based precursors, sphingosine and sphingolipids using the same, lipolytica ) by deleting the SUR2 gene encoding dihydrosphingosine C4-hydroxylase to produce a mutant with significantly increased productivity of dihydrosphingosine, and using this, dehydrosphingosine without a separate acetylation process It is a technology that secretes and produces to the cell surface. According to the present invention, using the Yarrowia lipolytica sur2 mutant strain, which is a GRAS with proven stability to the human body, not only can mass-produce dihydrosphingosine, but also, unlike other yeasts, it is possible to produce dihydrosphingosine through liposomes without an acetylation process. It can be secreted to the cell surface to simplify the extraction process. Also, Yarrowia lipolytica sur2 The mutant strain is also characterized by secreting glucosylceramide, a sphingosine-based lipid, to the cell surface with high efficiency. Therefore, the Yarrowia lipolytica sur2 prepared in the present invention The mutant strain can economically mass-produce dihydrosphingosine, a key substance commonly present in the production process of various sphingolipids, and furthermore, various sphingosine-based useful substances such as various types of sphingosine and ceramide through metabolic engineering. It is expected that it can be provided as a parent strain for the development of artificial yeast that mass-produces.

1 is a diagram showing the sphingolipid biosynthetic pathways of mammals, plants, and yeast.
Figure 2 is Yarrowia lipolytica ku70 A schematic diagram of the production of the defective strain (A) and the result of confirming KU70 gene disruption through PCR (B).
Figure 3 is Saccharomyces cerevisiae, Pichia siferai, Yarrowia lipolytica Amino acid sequence and domain analysis of Sur2 protein (A) and sur2 It is a schematic diagram of a cassette vector for producing a defective strain and the result of confirming SUR2 gene disruption through PCR (B).
Figure 4 is a growth curve (A), cell micrographs (B), and growth analysis results (C) of various cell wall weakening conditions and osmotic stress conditions according to the type of medium of Yarrowia lipolytica sur2 -deficient strain.
Figure 5 shows the structure of dihydrosphingosine (A), copper sulfate (CuSO ₄ ) detection method (B ) and ninhydrin (Ninhydrin) detection method (C) TLC results and dihydrosphingosine secretion of Y. lipolytica sur2 -deficient strain through comparison with Saccharomyces cerevisiae sur2 -deficient strain It is a TLC analysis result comparing production efficiency and a graph quantifying it (D).
6 shows the results of HPLC (A) and LC/MS/MS (B, C) analysis of dihydrosphingosine extracted from the cell surface of a Yarrowia lipolytica sur2 deficient strain.
7 is a TLC analysis result (A) of glucosylceramide extracted from the cell surface, cell culture medium, and cytoplasm of Yarrowia lipolytica sur2 deficient strain and LC/MS analysis result (B) of the cell surface sample and inositol extracted from the cytoplasm It is the TLC analysis result (C) confirming the change of the sphingolipid.
Figure 8 is Yarrowia lipolytica wild type strain (A) and sur2 It is a schematic showing the sphingolipid biosynthetic pathway of the defective strain (B).
9 shows strategies (A) and TLC analysis results (B) for amplifying sphingosine production by introducing various types of ceramidase genes into Yarrowia lipolytica sur2 -deficient strains.
Figure 10 is Yarrowia lipolytica, Candida albicans, Pichia pastoris Amino acid sequence of Sld1 protein, domain analysis (A) and sld1 A schematic diagram of a cassette vector for producing a defective strain, a result of confirming SLD1 gene disruption through PCR (B), and a result of analyzing growth under various cell wall weakening conditions and osmotic stress conditions (C).
11 is Yarrowia lipolytica sld1 Schematic diagram showing the sphingolipid biosynthetic pathway of the defective strain (A), TLC analysis result comparing sphingolipid secretion production efficiency extracted from the cell surface (B), TLC analysis result of glucosylceramide (C), and LC/MS analysis This is the result (D).

Accordingly, the present inventors prepared a mutant strain in which the SUR2 gene was deleted in order to block the phytosphingosine and phytoceramide biosynthetic pathways in the oleaginous yeast Yarrowia lipolytica, and using the mutants, the sphingosine precursors dihydrosphingosine and sphingosine were used with high efficiency. The present invention was completed by establishing a technology in which glucosylceramide, a base lipid, is secreted and produced on the cell surface.

The present invention is Yarrowia lipolytica ( Yarrowia lipolytica ) Provides a Yarrowia lipolytica mutant strain in which the SUR2 gene in the strain is missing or expression is suppressed.

The SUR2 gene is a gene encoding dihydrosphingosine C4-hydroxylase, and may be represented by SEQ ID NO: 4, but is not limited thereto. On the other hand, the amino acid sequence of Sur2 protein can be represented by SEQ ID NO: 3.

More preferably, the Yarrowia lipolytica mutant strain may be a strain ( Yarrowia lipolytica sur2 Δ) deposited under accession number KCTC 14592BP.

More preferably, the Yarrowia lipolytica mutant strain can enhance cell surface secretion production of dihydrosphingosine or glucosylceramide.

In addition, the present invention provides a method for producing dihydrosphingosine or glucosylceramide comprising culturing the mutant strain of Yarrowia lipolytica in a medium.

Preferably, the medium may include glycerol as a carbon source, but is not limited thereto.

Preferably, the method can secrete dihydrosphingosine or glucosylceramide to the cell surface through adipocytes without an additional acetylation process.

In addition, the present invention is an enhanced cell surface secretion production of dihydrosphingosine or sphingosine, into which a gene encoding ceramidase is introduced into the Yarrowia lipolytica mutant strain. Provided is a Yarrowia lipolytica mutant recombinant strain.

Preferably, the gene encoding the ceramidase is the human alkaline ceramidase 1 gene ( hACER1 ) represented by SEQ ID NO: 5, the human alkaline ceramidase 2 gene ( hACER2 ) represented by SEQ ID NO: 6, Human alkaline ceramidase 3 gene ( hACER3 ) represented by SEQ ID NO: 7, mouse alkaline ceramidase 1 gene ( mACER1 ) represented by SEQ ID NO: 8, N-fragment defective human alkaline ceramidase 2 represented by SEQ ID NO: 9 It may be a gene ( hACER2 (N12Δ)) or a Yarrowia lipolytica ceramidase gene ( YlYDC1 ) represented by SEQ ID NO: 10, but is not limited thereto.

The amino acid sequences of human-derived alkaline ceramidase hACER1, hACER2 and hACER3 used in the present invention are respectively NCBI accession no. NP_597999.1, NCBI accession no. NP_001010887.2, NCBI accession no. AAH73853.1, and the amino acid sequence of mouse-derived ceramidase mACER1 is NCBI accession no. NP_783858.1, and the amino acid sequence of ceramidase YlYdc1 derived from Yarrowia lipolytica is NCBI accession no. It may be QNP97986.1, but is not limited thereto.

In addition, the present invention is dihydrosphingosine comprising the step of culturing in a medium a Y. lipolytica mutant recombinant strain into which a gene encoding ceramidase has been introduced into the Y. lipolytica mutant strain. (dihydrosphingosine) or cell surface secretion production method of sphingosine.

In addition, the present invention is a cell surface secretion of sphingosine or human glucosylceramide, in which the SLD1 gene encoding △8 desaturase is additionally deleted in the Yarrowia lipolytica mutant strain Provided is a Yarrowia lipolytica mutant recombinant strain with enhanced production.

Preferably, the SLD1 gene encoding the Δ8 desaturase may be represented by SEQ ID NO: 12, but is not limited thereto. Meanwhile, the amino acid sequence of the Sld1 protein may be represented by SEQ ID NO: 11.

Preferably, the human glucosylceramide may be glucosylceramide GlcCer (d18:1(4E)/16:0(2OH)), but is not limited thereto.

More preferably, the Yarrowia lipolytica mutant recombinant strain is a strain deposited with accession number KCTC 14980BP ( Yarrowia lipolytica sld1 Δ sur2 Δ).

In addition, the present invention comprises the step of culturing in a culture medium a Yarrowia lipolytica mutant recombinant strain in which the SLD1 gene encoding △8 desaturase is additionally deleted from the Yarrowia lipolytica mutant strain A cell surface secreted production method of sphingosine or human glucosylceramide is provided.

Furthermore, it is possible to produce strains that mass-produce various types of sphingosine-based useful substances through metabolic engineering using the Yarrowia lipolytica sur2 defective strain or the sld1 sur2 double defective mutant strain prepared in the present invention as a parent strain.

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the content of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

< Example 1> Yarrowia lipolytica sur2 Creation of defective strains

1-1. Production of Yarrowia lipolytica ku70 strain

In order to increase the efficiency of homologous recombination (HR)-based genetic manipulation in Yarrowia lipolytica strains, a mutant strain with non-homologous end joining (NHEJ) removed through KU70 gene disruption was primarily prepared. did Ku70 and Ku80 together form a Ku heterodimer and bind to DNA double-stranded ends to participate in the non-homologous end joining pathway of DNA repair. Based on the genome of the Yarrowia lipolytica PO1f (MATA ura3-302 leu2-270 xpr2-322 axp2-deltaNU49 XPR2::SUC2) strain, the promoter -286 bp branch of the YALI0C08701g gene (SEQ ID NO: 2), which is a KU70 gene, and the open type The 5' part of the KU70 gene was amplified by PCR using the Ylku70dNfw and Ylku70dNrv primers for the open reading frame (ORF) 472 bp and the KU70 orf 1555 bp point fw and the terminator 480 bp were Ylku70dCfw and Ylku70dCrv After amplifying the 3' part of the KU70 gene by PCR, the N and C fragments were ligated through additional fusion PCR and introduced into the pT-blunt vector to obtain the pTB-ku70dNC vector. Thereafter, the YlURA3 gene having the same specific sequence of 580 bp forward and backward was introduced into the MluI site of the pTB-ku70dNC vector to obtain the pTB-ku70dNC-YlURA3 vector. Using pTB-ku70dNC-YlURA3 as a template, Ylku70dNfw and YlURA3Nrv primers listed in Table 1 were used to obtain an N fragment, and a C fragment was obtained using YlURA3Cfw and Ylku70dCrv primers, and transduced into Yarrowia lipolytica PO1f strain. Ylku70 disrupted strain was prepared through homologous recombination within (Fig. 2A). Whether or not the correct KU70 gene was disrupted was confirmed by PCR after chromosome extraction (Fig. 2B). Then, to recover the URA3 marker used in the case of KU70 deficiency, the Ylku70 -deficient strain was cultured in YPD medium containing 1 mg/ml 5-FOA to induce deletion of the URA3 gene (FIG. 2A).

1-2. Yarrowia lipolytica ku70 Construction of sur2 deficient strain using strain

In order to block the phytosphingosine biosynthetic pathway in Yarrowia lipolytica, the present inventors discovered a gene (SEQ ID NO: 4) encoding a protein showing 45.6% identity with Saccharomyces cerevisiae Sur2 protein and used homologous recombination to wanted to destroy it. The Yarrowia lipolytica Sur2 protein showed some structural differences from other yeasts. Saccharomyces cerevisiae had slightly fewer membrane domains than Pichia sipherai, and instead of having KKXX, an ER signal sequence, at the C-terminus, it had a polyampholyte, polar structure. However, the fatty acid hydroxylase domain was well conserved (Fig. 3A).

To construct the Yarrowia lipolytica SUR2 gene disruption cassette, the SUR2 promoter -668 bp site and the open reading frame (ORF) 100 bp were spliced into 5 segments of the SUR2 gene using the Ylsur2dNfw and Ylsur2dNrv primers listed in Table 1. ' part was amplified by PCR and SUR2 SUR2 using Ylsur2dCfw , Ylsur2dCrv for orf 1,011 bp point fw and terminator 639 bp After amplifying the 3' part of the gene by PCR, linking the 5' part and 3' part through fusion-PCR using the MluI-NheI-SalI part that both the 5' part and the 3' part have at the same time, pT Blunt vector was introduced to construct a pTB-SUR2dNC vector. After YlLEU2 The gene fragment was amplified by PCR, treated with NheI/SalI, and ligated with the pTB-SUR2dNC vector treated with NheI/SalI to construct pTB-SUR2d NC-YlLEU2 vector. Thereafter, the pTB-SUR2dNC-YlLEU2 vector was treated with SpeI/NsiI to prepare a cassette, and then the previously prepared Y. lipolytica ku70 deficient strain was transformed to prepare a Y. lipolytica sur2 deficient strain (FIG. 3B) .

Primers used in the present invention are listed in Table 1.

Primer Sequence (5`→3`) Description ku70dNfw gagcggtttgctcgaaaccagt YlKU70
deletion ku70dNrv taca gtcgacgcgt gggcgt atcgat tatcgtcgtctgtgatatagatgattcg ku70dCfw cgatacgccc acgcgt cgactgtaaggctgagaagaaagtcaagag ku70dCrv gagcggtttgctcgaaaccag URA3Nrv cagctcggccagcatgag URA3Cfw ccaacctgtgtgcttctctgg Ylsur2dNfw cgaccgaaaatgtgcaagcg YlSUR2
deletion Ylsur2dNrv acga gctagc cgcgcg acgcgt cgagtggtggaatggagtgtttg Ylsur2dCfw gaaca gtcgac tggagcttctacttccgagc Ylsur2dCrv catgcgtcctctcctccacgattc LEU2fw cgcgcg gctagc tcgtcgcctgagtcatcatttat LEU2rv gctcca gtcgac tgttcggaaatcaacggatgctc Scsur2dNfw tcaccccgcgtccttcttcgggcagtcgcgcttttctccggcttctgcggaaattgaagctctaatttgtgagtttag ScSUR2
deletion Scsur2dCrv ctcatcagttttcgaagatttcaagaaagtccgaagaacatttaagaccttttcaattcaattcatcattttttttttttctt TEF1pfw ccg gaattc agagaccgggttggcggcgt hACER1
expression TEF1p(h1)rv tgcgaagatcgaaggcattttgaatgattctttatactcagaaggaaatgc hACER1fw gagtataagaatcattcaaaatgccttcgatcttcgcataccaatc hACER1rv atcaccggcaaactatctgtctaacaatccttgtcatctccccgaa XPR2t(h1)fw ggggagatgacaaggattgttagacagatagtttgccggtgataattctctta XPR2trv ctag tctaga ggggg gctagc cacgggcatctcacttgcgc TEF1p(h2)rv caccaatgaggtgctcccattttgaatgattctttatactcagaaggaaatgc hACER2
expression hACER2fw gagtataagaatcattcaaaatggggagcacctcattggtgg hACER2rv atcaccggcaaactatctgtctaggtaatcttaacgctgctctttttgttag XPR2t(h2)fw agagcagcgttaagattacctagacagatagtttgccggtgataattctctta TEF1p(h2Δ)rv cagtccacctcagacgacattttgaatgattctttatactcagaaggaaatgc hACER2 (12Δ)
expression hACER2(12Δ)fw gagtataagaatcattcaaaatgtcgtctgaggtggactgg hACER2(12Δ)rv caccggcaaactatctgtctaggtaatcttaacgctgctctttttg XPR2t(h2Δ)fw gagcagcgttaagattacctagacagatagtttgccggtgataattctctta TEF1p(h3)rv cgatctgcggcgggggccattttgaatgattctttatactcagaaggaaatgc hACER3
expression hACER3fw gagtataagaatcattcaaaatggcccccgccgcagatcg hACER3rv atcaccggcaaactatctgtctagtgttttcgaagaggttcaaagagaatc XPR2t(h3)fw ctttgaacctcttcgaaaacactagacagatagtttgccggtgataattctctta TEF1p(m1)rv tccagggacgtgcattttgaatgattctttatactcagaaggaaatgc mACER1
expression mACER1fw gagtataagaatcattcaaaatgcacgtccctggaacgag mACER1rv atcaccggcaaactatctgtctaacagttcttatcattttcctggatctc XPR2t(m1)fw ggaaaatgataagaactgttagacagatagtttgccggtgataattctctta TEF1p(YDC1)rv gggattcctccaggtagcattttgaatgattctttatactcagaaggaaatgcttaacg YlYDC1
expression YlYDC1fw gagtataagaatcattcaaaatgctacctggaggaatcccatacc YlYDC1rv atcaccggcaaactatctgtctagttgtgatggttaacaga XPR2t(YDC1)fw ctgttaaccatcacaactagacagatagtttgccggtgataattctcttaac YlSLD1dNfw atgcagacggataggtggtggg YlSLD1
deletion YlSLD1dNrv ctcaagctggacaactggctcgatggtagctacttacgcgatcgtagggccagctg YlSLD1dCfw cc atcgat gaatgc gctagc atcccg gtcgac gtgactgtgagcgacatcttcg YlSLD1dCrv cggctaaccagaaacggtcctatc

*Underlined: restriction enzyme

The strains produced in the present invention are listed in Table 2.

Strain Description Source
/Reference Y. lipolytica PO1f MATA ura3-302 leu2-270 xpr2-322 axp2-deltaNU49 XPR2::SUC2 ATCC MYA-2613 Ylku70 Δ MATA ura3-302 leu2-270 xpr2-322 axp2-deltaNU49 XPR2::SUC2 ku70:tc This study S. cerevisiae BY4742 MATα his3A1 leu2A0 lys2A0 ura3A0 Open Biosystems Ylsur2Δ MATA ura3-302 leu2-270 xpr2-322 axp2-deltaNU49 XPR2::SUC2 ku70::tc sur2::YlLEU2 This study Scsur2Δ MATα his3A1 leu2A0 lys2A0 ura3A0 sur2::ScURA3 This study hACER1 / Ylsur2 Δ pIMR53-hACER1/Yl sur2 Δ This study hACER2 / Ylsur2 Δ pIMR53-hACER2/Yl sur2 Δ This study hACER2 (12Δ)/ Ylsur2 Δ pIMR53-hACER2(12Δ)/Yl sur2 Δ This study hACER3 / Ylsur2 Δ pIMR53-hACER3/Yl sur2 Δ This study mACER1 / Ylsur2 Δ pIMR53-mACER1/Yl sur2 Δ This study YlYDC1 / Ylsur2 Δ pIMR53-YlYDC1/Yl sur2 Δ This study Ylsld1 Δ MATA ura3-302 leu2-270 xpr2-322 axp2-deltaNU49 XPR2::SUC2 ku70::tc sld1::YlURA3 This study Ylsld1 Δ sur2 Δ MATA ura3-302 leu2-270 xpr2-322 axp2-deltaNU49 XPR2::SUC2 ku70::tc sur2::YlLEU2 sld1::YlURA3 This study

< Example 2> Yarrowia lipolytica sur2 Analysis of growth characteristics of defective strains

In order to confirm the growth pattern of the Y. lipolytica sur2 deficient strain ( Ylsur2 △) prepared in Example 1 according to the type of carbon source and the composition of the medium, it was compared and analyzed with Ylku70 △ / PO1f strain, the parent strain of Ylsur2 △. The strain culture medium pre-cultured in 2 ml of YPD medium was inoculated into YPD or GB 25 ml medium with _OD600 = 0.1 and cultured in a mixed incubator under conditions of 28 ° C and 220 rpm. was written. As a result, compared to the WT strain, which showed the highest OD ₆₀₀ value at about 36 hours of YPD culture, the Ylsur2- deficient strain showed the highest OD600 value at 72 hours, about twice as long as that. i.e. Ylsur2 It can be seen that the growth pattern of the defective strain has a long lag phase and logarithmic growth phase, and it takes a relatively long time to reach a stationary phase. In addition, when cultured in GB medium containing 8% glycerol rather than glucose as a carbon source, it was confirmed that the time to reach a plateau was shortened, overcoming the growth difference from the wild-type strain to some extent (FIG. 4A).

In addition, it was confirmed in micrographs after culturing in YPD medium for 24 hours that the Ylsur2 -deficient strain grew in a mycelial form with a much higher specific gravity than the parent strain (FIG. 4B).

Temperature stress (30 ~ 39 ℃), cell wall and osmotic stressors (NaCl, SDS, CFW (= Fluorescent Brightener 28), caffeine) , and growth patterns were confirmed in various YPD medium conditions containing antibiotics. As a result of growing for 4 days after smearing on YPD plates, Ylsur2 It can be seen that the defective strain is very sensitive to temperature, as growth is inhibited from 30 ° C and almost does not grow from 33 ° C. In addition, it can be confirmed that they became very sensitive to osmotic pressure and cell wall stress, and growth was reduced even in a medium containing hygromycin B, a protein synthesis inhibitor. These characteristics are considered to be the result of abnormal sphingolipid production, which weakens the cell membrane, makes the cell wall vulnerable to various stresses, and easily penetrates the antibiotic substance into the cell. However, resistance was also shown in some media containing caffeine, which is one of the cell wall stress conditions, and zeocin, which induces DNA double-strand separation (FIG. 4C).

< Example 3> Yarrowia lipolytica by TLC analysis sur2 Confirmation of cell surface secretion production of dihydrosphingosine from defective strains

Sphingolipid components are characterized by being aggregated on the cell surface rather than being secreted out of the medium due to their hydrophobic nature. Therefore, in order to recover sphingolipids collected on the cell surface, cell pellets were recovered after culturing, 10 ml of methanol was added per 1 g, and sonication was performed for 30 minutes. Thereafter, the sample dissolved in 10 ml methanol was concentrated 10 times to 1 ml through drying to obtain a final cell surface sample. In the case of cell culture (supernatant) samples, the supernatant separated by centrifugation of the strain culture was mixed with the same amount of chloroform: methanol (2: 1, v / v), and then the centrifuged lower layer was used. In the case of cytosol samples, after recovering cell surface samples, the remaining cell pellets are dissolved in chloroform:methanol:water (20:10:1, v/v), the cells are broken with a beadbeater, and then freeze-dried. dissolved in methanol. All samples were prepared by drying in the same way and then concentrating with 1 ml of methanol.

10 μl of the extracted samples were accumulated on a TLC silica gel 60 plate and developed using a non-polar solvent consisting of chloroform:methanol:ammonia water (18:2:1). After development, the overall lipid change was analyzed using the copper sulfate (CuSO4) detection method, and sphingoid bases, among which dihydrosphingosine, were identified using a ninhydrin solution (FIG. 5A). After development, the completely dried TLC plate was soaked in a solution of copper sulfate and ninhydrin, completely dried, and then burned at 200°C. The detection solution used was 10% copper sulfate dissolved in 8% sulfuric acid and 0.2% ninhydrin dissolved in ethanol. For comparison, it was developed with sphingosine, dihydrosphingosine and phytosphingosine standards.

As a result of TLC analysis using the copper sulfate detection method, Ylsur2 Dihydrosphingosine can be found in all of the cell surface, culture supernatant, and cytosol samples of the deficient strain. This can be interpreted as the accumulation of dehydrosphingosine due to the deletion of the SUR2 gene responsible for phytosphingosine synthesis, and dehydrosphingosine not only in the cytosol but also in the cell surface and culture supernatant samples. This confirms that it can be secreted through lipid droplets (Fig. 5B).

In this experiment, a ninhydrin detection method capable of reacting to the amino group (NH ₂ ) of serine, the basic skeleton of sphingolipids, was also used to identify only pure sphingoid bases. Through the results of the dihydrosphingosine band identified by the copper sulfate detection method also confirmed by the ninhydrin detection method, the substance is a sphingoid base itself with no substance linked to the amino group (-NH ₂ ) of the sphingolipid, that is, the dihydrosphingoid base itself. Hydrosphingosine was reconfirmed (Fig. 5C). Through these results, Yarrowia lipolytica sur2 It can be inferred that dehydrosphingosine accumulates in the defective strain and a large amount of it is secreted to the cell surface and medium.

In order to confirm that the secretion and production of dihydrosphingosine in the Yarrowia lipolytica sur2 -deficient strain is unique to this strain, unlike other yeasts, Saccharomyces cerevisiae and Yarrowia lipolytica strains were analyzed. Hydrosphingosine cell surface secretion efficiency was compared and analyzed. The sample extraction method and TLC analysis method were the same as in Example 3, and a ninhydrin solution was used for detection. As a result of TLC analysis, Yarrowia lipolytica sur2 It can be seen that dihydrosphingosine is specifically secreted and produced in the defective strain (FIG. 5D).

< Example 4> Yarrowia lipolytica through HPLC and LC/MS/MS analysis sur2 Confirmation of dihydrosphingosine secretion production of defective strains

HPLC analysis was performed using the cell surface sphingolipid sample used in Example 3. Cosmosil packed column 5C18-PAQ , 4.1ID x 250 mm column (40 ° C) and MeOH: water: ammonia (80: 19.5: 0.5) mobile phase were analyzed with a 210 mM UV detector using a speed of 0.5 ml / min, Yarrowia lipolytica sur2 In the defective strain, a band was confirmed at the same position as the dihydrosphingosine standard (FIG. 6A). On the other hand, as a result of LC / MS / MS analysis, Yarrowia lipolytica sur2 It was confirmed that the material produced in the defective strain was the same as that of the dihydrosphingosine standard (FIGS. 6B and 6C).

Therefore, the dihydrosphingosine secretion producing yeast strain developed in the present invention is used as a host for mass production of cell surface of sphingolipids, emerging as an effective alternative to complex intracellular extraction methods in terms of productivity and simplicity of separation and purification. hopefully it can be

< Example 5> Yarrowia lipolytica by TLC analysis sur2 Confirmation of biosynthesis of glucosylceramide and inositol sphingolipid in defective strains

Yarrowia lipolytica sur2 Glucosylceramide and inositolsphingolipid, which are the final steps of the sphingolipid synthesis pathway, were identified in order to analyze the overall changed lipid components in the defective strain. Sample preparation was prepared in the same manner as in Example 3, and TLC analysis was performed. To confirm glucosylceramide, the components of the developing solvent were changed and developed with chloroform:methanol:acetic acid:water (20:3.5:2.5:0.7, v/v), then wetted in the detection solution, dried completely, and reacted at 80℃. . The detection solution is used by dissolving 0.1 g of orcinol per 45 ml of sulfuric acid: water: ethanol (5:13:27), which is used to identify glycosides and glycolipids in TLC analysis. As one of the detection methods used, glucosylceramide reacts with glucose and appears as a purple band on a TLC plate. For comparison, GlcCer (d18:1(4E)/16:0) and GlcCer (d18:2(4E,8E)/16:0(2OH)) were used as standards.

As a result of TLC analysis, Yarrowia lipolytica wild type strain and sur2 A band consistent with the GlcCer (d18:2(4E,8E)/16:0(2OH)) standard appeared in the cell surface sample of the defective strain, and it was confirmed that the band was slightly darkened in the Ylsur2- deficient strain. did In addition, only in the Ylsur2 -deficient strain, a band similar to that of the GlcCer (d18:1(4E)/16:0) standard appeared (Fig. 7A).

As a result of LC/MS analysis with the cell surface sample that confirmed the highest amount of glucosylceramide, both the wild-type strain and the Y. lipolytica sur2 -deficient strain showed GlcCer (d18:2 (4E,8E) ( 9Me) / 16: 0 (2OH)) was present in the highest amount, and the amount increased about 3 times in the Ylsur2- deficient strain. In addition to WT, Ylsur2 GlcCer (d18:2(4E)/16:0(2OH)) identified in all of the defective strains is present in very small amounts compared to GlcCer (d18:2(4E,8E)(9Me)/16:0(2OH)) confirmed. Since the bands consistent with the GlcCer (d18:1(4E)/16:0) standard identified in FIG. 7A are very small, it seems that they were not confirmed by LC/MS analysis (FIGS. 7A and 7B).

Next, additional TLC analysis was performed to confirm inositol sphingolipid, which is one of the final sphingolipids present in Yarrowia lipolytica. Sample preparation and TLC analysis methods are described in S. Tanaka and M. Tani. (2018). YPD, recovering the cell pellet of the strain cultured for 8 hours and reacting with 350 ul of ethanol/water/diethyl ether/pyridine/15 M ammonia (15:15:5:1:0.018, v/v) at 65 degrees for 15 minutes After that, the supernatant was separated, dried, and reacted with 130 ul of monomethylamine (40% in methanol)/water (10:3, v/v) at 53 degrees for 1 hour to remove unnecessary phospholipids. Then, the well-dried sample was prepared by dissolving it in 60 ul of chloroform/methanol/water (5:4:1, v/v). The wild-type strain and Ylsur2 were plated on TLC silica gel 60 plates. Samples extracted from the defective strain were collected in 15 μl increments and developed using a solvent consisting of chloroform:methanol:4.2 M ammonia (9:7:2, v/v). For comparison, the Saccharomyces cerevisiae wild-type strain (BY4742) used in the referenced paper was analyzed together. After development, it was confirmed using the copper sulfate (CuSO4) detection method, and the classification of IPC, MIPC, and M(IP)2C was inferred from the analysis results of Saccharomyces cerevisiae strains. As a result of TLC analysis, in the case of Yarrowia lipolytica wild type strain, B type (t18:0/24:0) with phytosphingosine base as the basic skeleton or C type (t18:0/24:0 (2OH) with hydroxyl group attached to the fatty chain) )) was mainly identified, while Yarrowia lipolytica sur2 In the case of the defective strain, since phytosphingosine is not produced at all, type A (d18:0/24:0) with dihydrosphingosine base as the basic skeleton and type B' with hydroxyl group attached to the fatty chain (d18:0/24: 0(2OH)) was also weakly identified (Fig. 7C).

Accordingly, the sphingolipid biosynthetic pathways of Yarrowia lipolytica wild-type and sur2- deficient strains are summarized as follows based on the TLC and LC/MS results of cell surface samples (FIG. 8).

In the case of Yarrowia lipolytica wild-type strain, most inositol sphingolipids are synthesized with phytoceramide as the backbone, and all types of IPC and MIPC (t18:0/24:0(2OH), C type in LC/MS results) ) has been confirmed, and most of them have a structure in which a hydroxyl group (-OH) is attached to the fatty acid chain due to Scs7. In addition, it was confirmed that glucosylceramide was secreted to the cell surface in a relatively large amount compared to inositol sphingolipid, and that dihydrosphingosine was synthesized as a basic skeleton. Afterwards, △4 desaturase (Des1), α-hydroxylase (Scs7), △8 desaturase (Sld1), and C9 methyltransferase (Mts1) act to synthesize ceramides with various structures. Finally, glucosylceramide is synthesized by glucosylceramide synthase (Hsx11), and the GlcCer (d18:2(4E,8E)(9Me)/16:0(2OH)) structure produced by the action of all the enzymes described above is the most ratio (Fig. 8A).

In contrast, in the case of Yarrowia lipolytica sur2 -deficient strains, SUR2 responsible for phytosphingosine synthesis It can be seen that MIPC (d18:0/24:0, A type) with dihydrosphingosine as a skeleton is synthesized due to the gene defect. On the other hand, as compared to the wild type strain, a large amount of glucosylceramide was secreted to the cell surface, indicating that SUR2 genetic It can be inferred that a large amount of dihydrosphingosine was accumulated due to the deletion, and the synthesis of glucosylceramide, which has it as a basic skeleton, also increased (FIG. 8B).

<Example 6> Yarrowia lipolytica sur2 Amplification of sphingosine biosynthesis through overexpression of ceramidase gene in defective strains

Sphingosine biosynthesis from ceramide was amplified by additionally expressing human and mouse-derived ceramidase genes in the Yarrowia lipolytica sur2 -deficient strain (FIG. 9A). Genes encoding the three alkaline ceramidases ACER1, ACER2, and ACER3 derived from humans and the mouse-derived ceramidase ACER1 known to produce sphingosine from ceramide were synthesized in Yarrowia lipolytica through codon optimization. human alkaline ceramidase genes hACER1 (SEQ ID NO: 5), hACER2 (SEQ ID NO: 6), and hACER3 (SEQ ID NO: 7), mouse-derived ceramidase gene mACER1 (SEQ ID NO: 8), N-terminal to induce endoplasmic reticulum expression Human-derived alkaline ceramidase 2 gene hACER2 (N12Δ) (SEQ ID NO: 9) with 12 amino acids removed, PCR and fusion PCR of DNA fragments containing information about Yarrowia lipolytica-derived ceramidase gene YlYDC1 (SEQ ID NO: 10) After preparing by connecting the TEF1 promoter and XPR2 terminator using the primers listed in Table 1, introduce them into the pIMR53 CEN vector to generate pIMR53-hACER1, pIMR53-hACER2, pIMR53-hACER2(12Δ), pIMR53-hACER3, pIMR53-mACER1, pIMR53 -YlYDC1 was produced.

Each vector was introduced into Ylsur2- deficient strains to construct hACER1 / Ylsur2 Δ, hACER2 / Ylsur2 Δ, hACER2 (N12Δ)/ Ylsur2 Δ, hACER3 / Ylsur2 Δ, mACER2 / Ylsur2 Δ, and YlYDC1 / Ylsur2 Δ strains (Table 2). . Each strain was cultured in SC-U medium for 4 days, treated with methanol to a concentration of 10 ml/g, followed by sonication for 30 minutes and centrifuged, and the supernatant obtained was used for TLC analysis. As a result, the production of not only sphingosine but also dihydrosphingosine increased in all strains introduced with ceramidase (FIG. 9B). However, TLC analysis of glucosylceramide showed a decrease in glucosylceramide only in the YlYDC1 / Ylsur2 Δ strain (FIG. 9C). Although Yarrowia lipolytica ceramidase-overexpressing strains are not more prevalent in accumulation of sphingoid precursors than other ceramidase-overexpressing strains, their ability to degrade ceramides to produce sphingosine and dihydrosphingosine is significant. analyzed to be more dominant.

<Example 7> Yarrowia lipolytica sld1 Production of defective strains and analysis of growth characteristics

Yarrowia lipolytica sur2 In order to amplify the sphingosine biosynthetic pathway in the defective strain, the SLD1 gene (SEQ ID NO: 12) encoding the Δ8 desaturase protein was further disrupted using homologous recombination techniques. Unlike Candida albicans and Pichia pastoris, Yarrowia lipolytica Sld1 protein showed slight structural differences with low complexity and coiled coil structure. However, cytochrome b5-like heme/steroid binding, fatty acid fatty acid desaturase, histidine box, and membrane domains were well conserved (FIG. 10A).

Yarrowia lipolytica To construct the SLD1 gene disruption cassette, the 5' part of the SLD1 gene including the SLD1 promoter -869 bp site and the open reading frame (ORF) 152 bp was amplified by PCR, and the SLD1 gene including the ORF 1,582 bp site and the terminator 955 bp was amplified. After amplifying the 3' part by PCR, connect the 5' part and the 3' part through fusion-PCR using the ClaI-NheI-SalI part that both the 5' and 3' parts have, and introduce it into the pT Blunt vector. A pTB-SLD1dNC vector was constructed. Then, the YlURA3 gene fragment was amplified by PCR, treated with ClaI/NheI, and ligated with the pTB-SLD1dNC vector treated with ClaI/NheI to construct a pTB-SLD1dNC-YlURA3(TcR) vector. Thereafter, the pTB-SLD1dNC-YlURA3 (TcR) vector was treated with HindIII/NsiI to prepare a cassette, and then transformation was performed on the previously prepared Yarrowia lipolytica wild-type strain and sur2- defective strain. Rowia lipolytica sld1 Defective strains ( Ylsld1 △) and sld1 sur2 The double deletion strain ( Ylsld1 △ sur2 Δ) was fabricated (FIG. 10B).

Yarrowia lipolyticasld1 Temperature stress (20-35℃), osmotic stressors (NaCl, Sorbitol, KCl), ER stressors (Tunicamycin, DTT), and cell wall stressors (Caffeine, SDS, CFW, Congo red, Hygromycin B) were cultured in YPD medium conditions. As a result of growing for 3 days after spotting on the YPD plate,Ylsld1 It was observed that the growth of the defective strain was slightly inhibited even under normal culture conditions and further inhibited under temperature stress conditions than the wild type strain. also,Ylsld1 Defective strains were more sensitive to Congo red and hygromycin B, which induce cell wall stress, but also showed resistance to caffeine-containing media. These characteristics are considered to be the result of abnormal sphingolipid production, which weakens the cell membrane, making the cell wall vulnerable to various stresses, and also easily permeating high molecular weight antibiotic substances into the cell. In contrastYlsld1 sur2 double deletion strainsYlsur2 Compared to the deficient strain, growth was somewhat restored and increased resistance was observed even under stress conditions. However, increased sensitivity was shown in some media containing KCl and hygromycin B. this isSUR2Instability due to structural changes in the cell membrane caused by excessive accumulation of dihydrosphingosine while deletingSLD1 It is believed to be the result of recovery of growth while somewhat stabilizing with further deletion (Fig. 10C).

< Example 8> Through TLC and LC/MS analysis Yarrowia lipolytica sld1 Confirmation of cell surface secretion production of sphingosine and glucosylceramide of the defective strain

Yarrowia lipolytica sld1 Defective strain , sld1 sur2 In order to analyze the overall changed lipid components in the double-deficient strains, pure sphingoid bases and glucosylceramide, which is the final step in the sphingolipid synthesis pathway, were identified. Sample preparation was prepared in the same manner as in Example 3, and TLC analysis was performed. As a result of TLC analysis, Y. lipolytica sld1 compared to Y. lipolytica sur2 deficient strain ( Ylsur2 △) sur2 double deletion strain ( Ylsld1 △ In the case of sur2 △), the production of dihydrosphingosine decreased (FIG. 11A). Also Ylsur2 Compared to the defective strain, it was confirmed that the production of the final type of glucosylceramide GlcCer (d18:2(4E,8E)9Me/16:0(2OH)) was reduced and a new type of glucosylceramide band (red arrow) was generated. Since the new glucosylceramide has no C8 double band and no C9 methylation modification, it has a structure more similar to that of human glucosylceramide (FIG. 11B).

For more detailed analysis, LC/MS analysis was performed. As a result, sphingadiene (Sd) production of the Y. lipolytica sld1 sur2 double deletion strain was blocked, and sphingosine (sphingosine, So) production increased, and it was confirmed that the amount of dihydrosphingosine was also reduced compared to the sur2 -deficient strain. In addition, both the Yarrowia lipolytica sld1 -deficient strain and the sld1 sur2 double-defective strain had higher levels of glucosylceramide GlcCer (d18:2(4E, 8E)9Me/16:0(2OH)) compared to the control wild-type strain and Ylsur2 -deficient strain, respectively. The amount decreased, and instead, the production of glucosylceramide GlcCe (d18:1(4E)/16:0(2OH)) using ceramide in which the C8 double bond generation process by Sld1 and the C9 methylation process by Mts1 were omitted increased. (FIG. 11C).

Therefore, based on the TLC and LC/MS results of cell surface samples, Ylsld1 △ sur2 △ The sphingolipid biosynthetic pathway of the strain is summarized as follows (FIG. 11D). The increase in dihydrosphingosine caused by SUR2 deficiency increased the ceramide metabolic pathway based on the sphingosine skeleton as SLD1 was additionally deleted, resulting in a slight decrease in the amount of dihydrosphingosine and blocking of the sphingadienine production pathway. It can be seen that sphingosine increased. In addition, by blocking the double bond formation at the 8th position of sphingosine of sphingolipids, the amount of the existing glucosylceramide GlcCer (d18:2(4E, 8E)/16:0(2OH)) is reduced and more A near new type of glucosylceramide, GlcCer (d18:1(4E)/16:0(2OH)), was produced as the major glucosylceramide (Fig. 11D). Yarrowia lipolytica SLD1 This suggests that the gene deletion does not completely block the pathway in which glucosylceramide is produced from ceramide, but that glucose can be attached through another bypass pathway to finally produce glucosylceramide with a structural change.

Having described specific parts of the present invention in detail above, it will be clear to those skilled in the art that these specific descriptions are merely preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Korea Research Institute of Bioscience and Biotechnology KCTC14592BP 20210602 Korea Research Institute of Bioscience and Biotechnology KCTC14980BP 20220519

Claims (15)

Yarrowia lipolytica lipolytica ) SUR2 in strains gene Mutant strains of Yarrowia lipolytica whose expression is deleted or inhibited. The method of claim 1, wherein the SUR2 Yarrowia lipolytica mutant strain, characterized in that the gene is represented by SEQ ID NO: 4. According to claim 1, wherein the Yarrowia lipolytica mutant strain is Yarrowia lipolytica mutant strain, characterized in that the strain deposited with accession number KCTC 14592BP. The Yarrowia lipolytica mutant strain according to claim 1, wherein the cell surface secreted production of dihydrosphingosine or glucosylceramide is enhanced in the Yarrowia lipolytica mutant strain. A method for producing dihydrosphingosine or glucosylceramide comprising culturing the Y. lipolytica mutant strain according to any one of claims 1 to 4 in a medium. The method of claim 5, wherein the medium contains glycerol as a carbon source. The method according to claim 5, wherein the method is characterized in that dihydrosphingosine or glucosylceramide is secreted to the cell surface through liposomes without an additional acetylation process. ) or glucosylceramide production method. Of claims 1 to 4, wherein the gene encoding ceramidase is introduced into the Y. lipolytica mutant strain according to any one of claims 1 to 4, dihydrosphingosine or sphingosine. A mutant recombinant strain of Yarrowia lipolytica with enhanced cell surface secretion production. The method of claim 8, wherein the gene encoding the ceramidase is human alkaline ceramidase 1 gene ( hACER1 ) represented by SEQ ID NO: 5, human alkaline ceramidase 2 gene ( hACER2 ) represented by SEQ ID NO: 6 ), human alkaline ceramidase 3 gene ( hACER3 ) represented by SEQ ID NO: 7, mouse alkaline ceramidase 1 gene ( mACER1 ) represented by SEQ ID NO: 8, human alkaline ceramidase with N-fragment deletion represented by SEQ ID NO: 9 A second gene ( hACER2 (N12Δ)) or a Yarrowia lipolytica ceramidase gene ( YlYDC1 ) represented by SEQ ID NO: 10. A mutant recombinant strain of Yarrowia lipolytica. A cell surface secretion production method of dihydrosphingosine or sphingosine comprising the step of culturing the Y. lipolytica mutant recombinant strain according to claim 8 in a medium. In the Yarrowia lipolytica mutant strain according to any one of claims 1 to 4, the SLD1 gene encoding Δ8 desaturase is additionally deleted, sphingosine or human glucosyl Yarrowia lipolytica mutant recombinant strain with enhanced cell surface secretion production of ceramide (glucosylceramide). 12. The mutant recombinant strain of Yarrowia lipolytica according to claim 11, wherein the SLD1 gene encoding the Δ8 desaturase is represented by SEQ ID NO: 12. The Yarrowia lipolytica mutant recombinant strain according to claim 11, wherein the human glucosylceramide is glucosylceramide GlcCer (d18: 1 (4E) / 16: 0 (2OH)). According to claim 11, wherein the Yarrowia lipolytica mutant recombinant strain is Yarrowia lipolytica mutant recombinant strain, characterized in that the strain deposited with accession number KCTC 14980BP. A cell surface secretion production method of sphingosine or human glucosylceramide, comprising the step of culturing the Y. lipolytica mutant recombinant strain according to claim 11 in a medium.

Images