KR20220169425A - Use of Bacterial-Derived Extracellular Vesicles for Preparation of Nucleic Acid Vaccines and Gene Transfer - Google Patents

Abstract

The present invention relates to a use of bacteria-derived extracellular vesicles for the preparation of a nucleic acid vaccine and gene transfer. The present inventors have confirmed that fluorescent protein is expressed within macrophages as a result of transfecting beneficial bacteria-derived extracellular vesicles (EVs), called human commensal bacteria or probiotics, with GFP, which is a fluorescent protein gene, to treat animal macrophages. In addition, as a result of treating animal macrophages with bacterial-derived extracellular vesicles transfected with a miRNA precursor, it has been confirmed that the miRNA is developed into a mature form within the macrophages. Therefore, antigen genes can be effectively and safely transferred by using the bacterial-derived extracellular vesicles of the present invention, and RNA vaccines can be rapidly and safely produced through mass culturing of bacteria and isolation of bacteria-derived EVs.

Description

Use of Bacterial-Derived Extracellular Vesicles for Preparation of Nucleic Acid Vaccines and Gene Transfer}

The present invention relates to the use of bacterial-derived extracellular vesicles (EVs) for gene delivery for purposes such as nucleic acid vaccine production and gene therapy.

It is known that all cells, including Gram-negative bacteria and Gram-positive bacteria, naturally secrete extracellular vesicles. Extracellular vesicles secreted from the Gram-negative bacteria are also known as outer membrane vesicles. Bacterial-derived extracellular vesicles are mainly 20-200 nm in size, contain substances with various biological activities such as proteins, lipids, and genetic materials (DNA, RNA), and are derived from Gram-negative bacteria. also has virulence factors such as lipopolysaccharides (LPS).

According to recent research results, various bacterial-derived extracellular vesicles not only have direct therapeutic efficacy for various diseases including cancer, but can also be used as a drug delivery system to treat these diseases, and prevent or treat various diseases such as meningitis. It is being used or developed clinically as a drug delivery system for

On the other hand, mRNA is an intermediate medium that connects the translation of DNA encoding protein information and the protein production process by cytoplasmic ribosomes. To date, the two main types of RNA vaccines are non-replicating mRNA and self-amplifying RNA derived from viruses. Whereas traditional mRNA-based vaccines contain untranslational regions at the 5' and 3' ends, self-amplifying RNA has antigens as well as viral replication mechanisms that enable intracellular RNA amplification and abundant protein expression. there is.

Recently, as various mRNA vaccine platforms have been developed, results on the immunogenicity and efficacy of mRNA vaccines have been reported. High-efficiency, non-toxic RNA carriers capable of prolonging antigen expression in vivo have been developed, and while some vaccine formulations contain new adjuvants, vaccine formulations that cause a strong immune response without an adjuvant There is also

A physical method has been used as a cell membrane penetration method to increase mRNA uptake efficiency in vivo. It was initially reported that mRNA complexed with gold particles could be expressed as proteins in tissues using a gene gun. However, gene guns have been shown to be effective RNA delivery and vaccination methods in mouse models, but not in large animals or humans. In addition, in vivo electroporation has been used to increase the uptake of RNA molecules, but electroporation only increased the immunogenicity of self-amplifying RNA, and it was confirmed that non-replicating mRNA-based vaccines did not increase immunogenicity. It became. Recently, the use of lipid or polymer-based nanoparticles has been favored as a powerful and versatile delivery vehicle for mRNA-based vaccines.

However, lipid- or polymer-based nanoparticles contain ingredients that cause allergic reactions, and there are concerns about side effects such as death in severe cases. Therefore, the need for rapid and safe vaccine production is emerging.

DNA vaccines have also been studied a lot recently, and although they are similar to mRNA vaccines, they are likely to cause various side effects because viruses and the like are used as carriers.

Therefore, the present inventors used the extracellular vesicles of commensal human bacteria as a material that can be used for gene therapy and the like as a gene carrier capable of producing a new type of vaccine, and the extracellular vesicles are a carrier of nucleic acids to reduce risk factors. In addition, the present invention was completed by confirming that it can be used as an adjuvant for vaccines.

Jaewook Lee (2020). Extracellular endoplasmic reticulum (exosome) research trends. BRIC View 2020-T07 Kim Won-geun (2019). mRNA vaccines - a new era in vaccinology. BRIC View 2019-R11

Therefore, the present inventors confirmed that when a gene is injected into human resident bacteria, extracellular vesicles containing the injected gene are secreted through the extracellular vesicles, and the secreted endoplasmic reticulum can be used as a delivery vehicle for a nucleic acid-based vaccine, and the present invention has been completed.

Accordingly, an object of the present invention is to provide a nucleic acid delivery system comprising bacterial-derived extracellular vesicles as an active ingredient.

Another object of the present invention is to provide a vaccine composition comprising a bacterial-derived extracellular vesicle and a nucleic acid vaccine.

Another object of the present invention is to provide a method for separating the bacterium-derived extracellular vesicles.

Another object of the present invention is to provide a method for delivering nucleic acids into cells using the bacterium-derived extracellular vesicles.

Another object of the present invention is to provide a nucleic acid delivery kit comprising the bacterium-derived extracellular vesicles and nucleic acid.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

Accordingly, the present invention provides a nucleic acid delivery system comprising bacterial-derived extracellular vesicles as an active ingredient.

In addition, the present invention provides a composition for nucleic acid delivery comprising bacterial-derived extracellular vesicles as an active ingredient.

In addition, the present invention provides a vaccine composition comprising a bacterial-derived extracellular vesicle and a nucleic acid vaccine.

In one embodiment of the present invention, the nucleic acid may be selected from the group consisting of DNA, RNA, aptamer, LNA (locked nucleic acid), PNA (peptide nucleic acid), and morpholino, but , but is not limited thereto.

In another embodiment of the present invention, the bacteria may be selected from the group consisting of gram-negative bacteria and gram-positive bacteria, but is not limited thereto.

In another embodiment of the present invention, the gram-positive bacteria may be bacteria of the genus Lactobacillus , but are not limited thereto.

In another embodiment of the present invention, the bacteria of the genus Lactobacillus may be Lactobacillus reuteri , but is not limited thereto.

In another embodiment of the present invention, the extracellular vesicles may have a diameter of 10 to 1000 nm, but is not limited thereto.

In another embodiment of the present invention, the extracellular endoplasmic reticulum may be naturally secreted or artificially produced, but is not limited thereto.

In another embodiment of the present invention, the vaccine composition may be for at least one selected from the group consisting of anti-viral, anti-bacterial, anti-parasitic and anti-cancer, but is not limited thereto.

In another embodiment of the present invention, the vaccine composition is anti-corona, anti-HPV (human papillomavirus), anti-HBV (hepatitis B virus), anti-HCV (hepatitis C virus), anti-HIV (human immunodeficiency virus) ), anti-MERS-CoV, anti-Zika virus, anti-norovirus, anti-rotavirus, anti-influenza virus, anti-HSV (herpes simplex virus), anti-porcine reproductive and respiratory syndrome virus (PRRSV), anti -One selected from the group consisting of porcine cholera virus, anti-porcine circovirus (PCV), anti-porcine diarrhea virus (PEDV), anti-foot-and-mouth disease virus, anti-Newcastle virus and anti-viral hemorrhagic sepsis virus (VHSV) It may be for more than one, but is not limited thereto.

In addition, the present invention comprises the steps of (a) culturing bacteria; and (b) separating bacterial-derived extracellular vesicles secreted from the culture medium.

In one embodiment of the present invention, the separation in step (b) is heat treatment, centrifugation, ultra-high-speed centrifugation, high pressure treatment, extrusion, sonication, cell lysis, homogenization, freeze-thaw, electroporation, mechanical degradation, chemical At least one method selected from the group consisting of treatment, filtration with a filter, gel filtration chromatography, free-flow electrophoresis, and capillary electrophoresis may be used, but is not limited thereto.

In another embodiment of the present invention, the ultra-high-speed centrifugation may be gradient ultracentrifugation, but is not limited thereto.

In addition, the present invention comprises the steps of (a) introducing a target nucleic acid into bacterial-derived extracellular vesicles using electroporation; and (b) treating cells with bacterial-derived extracellular vesicles into which the target nucleic acid is introduced.

In addition, the present invention provides a method for preparing a vaccine composition comprising the step of introducing a nucleic acid vaccine into bacterial-derived extracellular vesicles using an electroporation method.

In one embodiment of the present invention, the electroporation of step (a) may be electroporation of a voltage of 100 to 200 V, a capacitor of 50 to 150 μF (capacitor), but is not limited thereto.

In another embodiment of the present invention, the nucleic acid may be selected from the group consisting of DNA, RNA, aptamer, locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino. , but not limited thereto.

In addition, the present invention provides a nucleic acid delivery kit comprising bacterial-derived extracellular vesicles and nucleic acids.

In addition, the present invention provides a pharmaceutical composition for preventing a disease, comprising a therapeutic nucleic acid and the nucleic acid delivery system as an active ingredient.

In addition, the present invention provides a method for preventing a disease by administering to a subject a composition comprising a therapeutic nucleic acid and the nucleic acid delivery system as an active ingredient.

In addition, the present invention provides a preventive use of a composition comprising a therapeutic nucleic acid and the nucleic acid delivery system as an active ingredient.

In addition, the present invention provides a use of a composition comprising a therapeutic nucleic acid and the nucleic acid delivery system as an active ingredient for preparing a drug for preventing a disease.

In addition, the present invention provides a nucleic acid vaccine and the use of the nucleic acid delivery system for preparing a vaccine.

In addition, the present invention provides a vaccine use of a composition comprising a nucleic acid vaccine and the nucleic acid delivery system as an active ingredient.

In one embodiment of the present invention, the therapeutic nucleic acid may be selected from the group consisting of DNA, RNA, aptamer, locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino. However, it is not limited thereto.

The present invention relates to the production of nucleic acid vaccines and the use of bacterial-derived extracellular vesicles for gene delivery. As a result of treatment with macrophages, it was confirmed that the fluorescent protein was expressed in the macrophages. In addition, as a result of treating animal macrophages with bacteria-derived extracellular vesicles transfected with miRNA precursors, it was confirmed that miRNAs developed into mature forms in macrophages.

Therefore, using the bacteria-derived extracellular vesicles of the present invention, effective and safe delivery of antigen genes is possible, and rapid and safe RNA vaccines can be prepared through mass culture of bacteria and isolation of extracellular vesicles. In addition, it is expected that it can be used as a delivery vehicle for gene therapy for the purpose of gene correction or disease treatment by delivering genes to cells or human organs.

1A is a diagram showing a process of treating animal macrophages with bacteria-derived extracellular vesicles (EVs) transfected with EGFP (Enhanced Green Fluorescent Protein) plasmid DNA or EGFP RNA.
Figure 1b is a diagram showing the results of analyzing the size distribution and amount of bacterial-derived extracellular vesicles (EVs).
Figure 1c is a diagram showing the results of confirming the cell viability after treating animal macrophages with bacterial-derived extracellular vesicles (EVs) at various concentrations.
1d shows the result of confirming through RT-PCR whether EGFP plasmid DNA or EGFP RNA is delivered to macrophages when animal macrophages are treated with bacterial-derived extracellular vesicles (EVs) transfected with EGFP plasmid DNA or EGFP RNA. is the drawing shown.
Figure 1e is a result of confocal fluorescence microscopy confirming whether EGFP plasmid DNA or EGFP RNA is delivered to macrophages when bacterial-derived extracellular vesicles (EVs) transfected with EGFP plasmid DNA or EGFP RNA are treated with animal macrophages. is a drawing showing Scale bar = 50 μm.
2 is a view showing the results of confirming the presence of EGFP in macrophages by fluorescence microscopy when extracellular vesicles (EVs) isolated from Lactobacillus reuteri transfected with EGFP RNA were treated with animal macrophages. blue (cell nuclei); green (fluorescent protein).
3a and 3b show that when animal macrophages were treated with bacteria-derived extracellular vesicles (EVs) transfected with Cel-miR-39 precursor RNA, RIP-PCR confirmed whether Cel-miR-39 was expressed in macrophages. 3a is a diagram schematically illustrating an experimental process, and FIG. 3b is a diagram illustrating an experimental result.
4 is a diagram showing a vector map of the pCMV-EGFP recombinant expression vector.

Hereinafter, the present invention will be described in detail.

First, the present invention provides a nucleic acid delivery system comprising bacterial-derived extracellular vesicles as an active ingredient.

In addition, the present invention provides a vaccine composition comprising a bacterial-derived extracellular vesicle and a nucleic acid vaccine.

In addition, the present invention provides a composition for nucleic acid delivery comprising bacterial-derived extracellular vesicles as an active ingredient.

As used herein, the term nucleic acid delivery system is for delivering a target nucleic acid to a target cell or tissue, and can be usefully used for delivery of a vaccine in the form of a nucleic acid. Accordingly, the nucleic acid delivery system of the present invention may further include a target nucleic acid, but is not limited thereto.

On the other hand, the type of material that can be encapsulated in the extracellular vesicles of the present invention is not particularly limited, and may preferably be a nucleic acid. The nucleic acid may be selected from the group consisting of DNA, RNA, aptamer, locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino, but is not limited thereto.

In the present invention, the RNA may be one or more selected from the group consisting of mRNA, rRNA, tRNA, snRNA, snoRNA, aRNA, piRNA, RNAi, siRNA, shRNA, and miRNA, but is not limited thereto. In one embodiment of the present invention, miRNA, specifically, a miRNA precursor was used as an example of the RNA.

In the present invention, the nucleic acid may be a therapeutic nucleic acid, and the therapeutic nucleic acid may include small interfering RNA (siRNA), small hairpin RNA (shRNA), endoribonuclease-prepared siRNAs (esiRNA), antisense oligonucleotides, DNA, single-stranded RNA, and double-stranded RNA. It may be one or more selected from the group consisting of RNA, DNA-RNA hybrid, and ribozyme, but is not limited thereto.

In the present invention, the RNA may be at least one selected from the group consisting of single-stranded RNA (ssRNA) and double-stranded RNA (dsRNA), but is not limited thereto.

In the present invention, the target nucleic acid is a concept that includes all of the therapeutic nucleic acids that can be used for vaccines, gene correction, or gene therapy in the form of nucleic acids. In one embodiment of the present invention, fluorescent protein GFP and Cel-miR-39 were used as examples of target nucleic acids.

The above “gene therapy product” means to express a therapeutic protein by administering genetic material such as DNA or RNA into the human body for the treatment and prevention of chronic diseases such as congenital or acquired genetic defects, viral diseases, cancer or cardiovascular diseases. It means to inhibit the expression of a specific protein.

As used herein, the term "vesicle" or "extracellular vesicle" refers to a nano-sized membrane structure secreted by various bacteria, and in the present invention, naturally secreted from bacteria, A generic term for all structures made of artificially produced membranes. The vesicles are prepared by heat treatment, centrifugation, ultra-high-speed centrifugation, high-pressure treatment, extrusion, sonication, cell lysis, homogenization, freeze-thaw, electroporation, mechanical disintegration, chemical treatment, and filtering of the culture medium containing bacterial cells. , gel filtration chromatography, free-flow electrophoresis, and at least one method selected from the group consisting of capillary electrophoresis. In addition, processes such as washing to remove impurities and concentration of the obtained vesicles may be further included.

The bacterial-derived extracellular vesicle of the present invention is divided into an inside and an outside by a lipid bilayer composed of the derived bacterial cell membrane component, and includes bacterial plasma membrane lipid, plasma membrane protein, and nucleic acid. acid) and bacterial components, and originally means smaller in size than bacteria, but is not limited thereto.

In the present invention, the extracellular vesicles have an average diameter of 1 to 1000 nm, 1 to 900 nm, 1 to 800 nm, 1 to 700 nm, 1 to 600 nm, 1 to 500 nm, 1 to 400 nm, and 1 to 300 nm. nm, 1~220 nm, 10~1000 nm, 10~900 nm, 10~800 nm, 10~700 nm, 10~600 nm, 10~500 nm, 10~400 nm, 10~300 nm, 10~220 nm, 10~200 nm, 20~220 nm, 30~1000 nm, 30~900 nm, 30~800 nm, 30~700 nm, 30~600 nm, 30~500 nm, 30~400 nm, 30~300 nm, 30~220 nm, 40~900 nm, 40~800 nm, 40~700 nm, 40~600 nm, 40~500 nm, 40~400 nm, 40~300 nm, 40~220 nm, 40~200 nm, 40~150 nm, 40~130 nm, 40~100 nm, 50~800 nm, 50~700 nm, 50~600 nm, 50~500 nm, 50~400 nm, 50~300 nm, 50~220 nm, 50 to 200 nm, 50 to 150 nm, 50 to 130 nm, or 50 to 100 nm, but is not limited thereto.

In the present invention, the bacteria may be selected from the group consisting of gram-negative bacteria and gram-positive bacteria, but is not limited thereto.

In the present invention, Gram-positive bacteria include Phylum Firmicutes and Phylum Actinobacteria , characterized by no outer membrane and thick cell wall, and Class Mollicutes , which have no cell wall but are evolutionarily derived from Phylum Firmicutes . It is a bacterium with a cell wall, Staphylococcus , Streptococcus , Enterococcus , Bacillus , Corynebacterium, Corynebacterium , Norcardia , Clostridium ), lactobacillus ( Lactobacillus ), actinobacteria ( Actinobacteria ), listeria ( Listeria ), etc. are included, and mycoplasma ( Mycoplasma ) and the like are included as bacteria without a cell wall.

In the present invention, the bacteria of the genus Lactobacillus may be Lactobacillus reuteri , but is not limited thereto.

The Lactobacillus reuteri is a lactic acid bacterium naturally present in the intestines of mammals, and according to an embodiment of the present invention, the bacteria-derived extracellular vesicles according to the present invention are derived from bacteria present in the human body and have excellent biosafety.

In the present invention, gram-positive bacteria are bacteria that are generally stained purple in Gram staining, and are characterized in that they do not have an outer cell membrane and have a large amount of peptidoglycan in their cell walls compared to gram-negative bacteria.

In the present invention, since Gram-positive bacteria-derived extracellular vesicles do not contain LPS, there is no toxicity caused by LPS and allergic reactions are low, but are not limited thereto.

In the present invention, Gram-negative bacteria refers to bacteria characterized by a sandwich-like configuration of a thin peptidoglycan cell wall between an inner cytoplasmic membrane and an outer membrane. Gram-negative bacteria include, for example, Escherichia coli ( Escherichia coli, E.coli), Salmonella, Enterobacteriaceae, pseudomonas, Moraxella, Helicobacter, Stenotrophomonas, Bdellovibrio, These include acetic acid bacteria, Legionella, Acinetobacter baumannii , and the like.

In the present invention, "vaccine" is a biological agent containing an antigen that induces an immune response in a living body, and refers to an immunogen that induces immunity in a living body by being injected or orally administered to humans or animals to prevent infections. The animal is a human or non-human animal, and the non-human animal refers to pigs, cows, horses, dogs, goats, sheep, etc., but is not limited thereto.

In the present invention, the vaccine composition may be for at least one selected from the group consisting of anti-viral, anti-bacterial, anti-parasitic and anti-cancer, but is not limited thereto.

In the present invention, the vaccine composition is anti-corona, anti-HPV (human papillomavirus), anti-HBV (hepatitis B virus), anti-HCV (hepatitis C virus), anti-HIV (human immunodeficiency virus), anti-MERS -CoV, anti-Zika virus, anti-norovirus, anti-rotavirus, anti-influenza virus, anti-HSV (herpes simplex virus), anti-porcine reproductive and respiratory syndrome virus (PRRSV), anti-porcine cholera virus, It may be for one or more selected from the group consisting of anti-porcine circovirus (PCV), anti-porcine diarrhea virus (PEDV), anti-foot-and-mouth disease virus, anti-Newcastle virus and anti-viral hemorrhagic sepsis virus (VHSV) However, it is not limited thereto.

In the present invention, "expression vector" refers to a vector capable of expressing a peptide or protein encoded by a heterologous nucleic acid inserted into a vector, and a vector prepared to express a target antigen it means. The "vector" refers to any medium for the introduction and / or transfer of a base into a host cell in vitro, ex vivo or in vivo, and a replicating unit capable of binding another DNA fragment to bring about replication of the linked fragment ( replicon), and "replication unit" refers to any genetic unit (e.g., plasmid, phage, cosmid, chromosomes, viruses, etc.)

The recombinant expression vector of the present invention preferably includes a promoter, which is a transcription initiation factor to which RNA polymerase binds, an arbitrary operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and termination of transcription and translation. It may include a sequence, a terminator, etc. that regulates, more preferably, the 5'UTR region gene of M17 to increase the amount of protein synthesis, the BiP gene to move the target protein to the endoplasmic reticulum, the expression level of the target protein, and Fc fragment that increases solubility, endoplasmic reticulum signal peptide (endoplasmic reticulum signal peptide, synonymous with endoplasmic reticulum targeting sequence) gene, cloning site, etc. It may further include, more preferably, a tag gene for easily separating recombinant proteins, a marker gene for selection such as an antibiotic resistance gene for selecting transformants, and the like may be further included.

In the present invention, the nucleic acid delivery system may include a label capable of generating a detectable signal.

A label capable of generating a detectable signal enables qualitative or quantitative measurement of the formation of antigen-antibody complexes, examples of which include enzymes, fluorophores, ligands, luminescent substances, microparticles, redox molecules, and radioactive substances. Isotopes and the like can be used. Enzymes include β-glucuronidase, β-D-glucosidase, urease, peroxidase, alkaline phosphatase, acetylcholinesterase, glycoside oxidase, hexokinase, malate dehydrogenase, glucose-6 -Phosphate dehydrogenase, invertase, etc. can be used. As the fluorescent material, fluorescein, isothiocyanate, rhodamine, phycoerytherin, phycocyanin, allophycocyanine, fluorine isothiocyanate, and the like can be used. Ligands include biotin derivatives and the like, and luminescent materials include acridinium esters, luciferin, and luciferase. Microparticles include colloidal gold and colored latex, and redox molecules include ferrocene, ruthenium complex, biologen, quinone, Ti ion, Cs ion, diimide, 1,4-benzoquinone, and hydroquinone. Radioactive isotopes include ³ H, ¹⁴ C, ³² P, ³⁵ S, ³⁶ Cl, ⁵¹ Cr, ⁵⁷ Co, ⁵⁸ Co, ⁵⁹ Fe, ⁹⁰ Y, ¹²⁵ I, ¹³¹ I, and ¹⁸⁶ Re. However, any material that can be used for immunological assays other than those exemplified above may be used.

In the present invention, the label may be a fluorophore. Fluorophores include, for example, BODIPY 493/503, BODIPY FL, BODIPY R6G, BODIPY 530/550, BODIPY TMR, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY TR, fluo Rascein, 5(6)-carboxyfluorescein, 2,7-dichlorofluorescein, N,N-bis(2,4,6-trimethylphenyl)-3,4,9,10-perylenebis ( Dicarboximide, HPTS, Ethyl Eosin, DY-490XL MegaStokes, DY-485XL MegaStokes, Adirondack Green 520, ATTO 465, ATTO 488, ATTO 495, YOYO- 1, 5-FAM, BCECF, BCECF, Dichlorofluorescein, Rhodamine 110, Rhodamine 123, Rhodamine Green, YOPRO-1, SYTOX Green, Sodium Green, SYBR Green I, Alexa Fluoro (Alexa Fluor) 500, FITC, Fluo-3, Fluo-4, fluoro-emerald, YoYo-1 ssDNA, YoYo-1 dsDNA, YoYo-1, SYTO RNA-Select, Diversa Green Green)-FP, Dragon Green, EvaGreen, Surf Green EX, Spectrum Green, Oregon Green 488, NeuroTrace 500525, NBD- X, MitoTracker Green FM, LysoTracker Green, DND-26, CBQCA, PA-GFP (after activation), WEGFP (after activation), FIASH-CCXXCC, Azami Green Monomeric (Azami Green monomeric), Azami Green, GFP, E GFP (Campbell Tsien 2003), EGFP (Patterson 2001), fluorescein, Kaede Green, 7-benzylamino-4-nitrobenz-2-oxa-1,3-diazole, Bexl, It may be one or more selected from the group consisting of Doxorubicin, Lumio Green, and SuperGlo GFP, but is not limited thereto.

In the present invention, transformation refers to the change in the genetic properties of an organism by injected DNA, and the term "transgenic organism" refers to an organism produced by injecting an external gene using a molecular genetic method. As, preferably, it is a living organism transformed by the recombinant expression vector of the present invention, and the living organism is not limited as long as it is a living organism such as a microorganism, eukaryotic cell, insect, animal, plant, etc., and may preferably be a bacterium. Not limited.

The transformants are transformed by transformation, transfection, Agrobacterium-mediated transformation method, particle gun bombardment, sonication, and electroporation. ) and PEG (Polyethylen glycol)-mediated transformation, but is not limited as long as the vector of the present invention can be injected.

The "vaccine composition" of the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and sterile injection solutions according to conventional methods, respectively. When formulated, it can be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain at least one or more excipients such as starch, calcium carbonate, sucrose in the lecithin-like emulsifier. It can be prepared by mixing sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium styrate and talc may also be used. Liquid formulations for oral administration may include suspensions, internal solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweeteners, aromatics, preservatives, etc. may be included in addition to water and liquid paraffin, which are commonly used simple diluents. can Formulations for parenteral administration include sterilized aqueous solutions, water-insoluble agents, suspensions, emulsions, and lyophilized preparations. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous preparations and suspensions.

Also, in the present invention, "adjuvant" generally refers to any substance that increases a humoral and/or cellular immune response to an antigen. Accordingly, the vaccine composition of the present invention may further include an "adjuvant." The adjuvant is, for example, Complete Freund's adjuvant (CFA), Incomplete Freund's adjuvant (IFA), alum, oil, Lipid A, monophosphorylipid A, bacterial preparations such as BCG (Bacillus-Calmette-Guerrin), nucleic acids such as CpG-DNA and dsRNA, bacterial component preparations such as tuberculin, natural high molecular substances such as keyhole limpet hemocyanin or yeast mannan, muramyl tripeptide or Muramyl dipeptide or its derivatives, alum, nonionic block copolymer, interleukin 2 (IL-2) or granulocyte macrophage colony stimulating factor (GM-CSF), interferon-α (IFN- α), cytokines such as interferon-β (IFN-β), and the like, and these may be used alone or in combination of two or more.

The present invention may also be provided in the form of a pharmaceutical composition comprising the bacterium-derived extracellular vesicles as an active ingredient.

The content of the bacterial-derived extracellular vesicles in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 0.001 to 99.9% by weight based on the total weight of the composition. It may be 50% by weight, but is not limited thereto. The content ratio is a value based on the dry amount after removing the solvent.

The pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions. The excipient may be, for example, one or more selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a moisturizer, a film-coating material, and a controlled release additive.

The pharmaceutical compositions according to the present invention are powders, granules, sustained-release granules, enteric granules, solutions, eye drops, elsilic agents, emulsions, suspensions, spirits, troches, perfumes, and limonadese, respectively, according to conventional methods. , tablets, sustained-release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusate, It can be formulated and used in the form of external preparations such as warning agents, lotions, pasta agents, sprays, inhalants, patches, sterile injection solutions, or aerosols, and the external agents are creams, gels, patches, sprays, ointments, and warning agents. , lotion, liniment, pasta, or cataplasma may have formulations such as the like.

Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, phosphoric acid as additives for tablets, powders, granules, capsules, pills, and troches according to the present invention Calcium monohydrogen, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethyl excipients such as cellulose (HPMC), HPMC 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose phthalate acetate, carboxymethyl cellulose, calcium carboxymethyl cellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethyl cellulose, sodium methyl cellulose, methyl cellulose, microcrystalline cellulose, dextrin Binders such as hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, purified shellac, starch arc, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, and polyvinylpyrrolidone may be used, Hydroxypropyl Methyl Cellulose, Corn Starch, Agar Powder, Methyl Cellulose, Bentonite, Hydroxypropyl Starch, Sodium Carboxymethyl Cellulose, Sodium Alginate, Calcium Carboxymethyl Cellulose, Calcium Citrate, Sodium Lauryl Sulfate, Silicic Anhydride, 1-Hydroxy Propyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl cellulose, white sugar, magnesium aluminum silicate, di-sorbitol solution, and light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopod, kaolin, petrolatum, sodium stearate, cacao butter, sodium salicylate, magnesium salicylate, polyethylene glycol (PEG) 4000, PEG 6000, liquid paraffin, hydrogen Added soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acid, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, Lubricants such as starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, and light anhydrous silicic acid; may be used.

Additives for the liquid formulation according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (tween esters), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, and the like may be used.

In the syrup according to the present invention, a solution of white sugar, other sugars, or a sweetener may be used, and aromatics, coloring agents, preservatives, stabilizers, suspending agents, emulsifiers, thickeners, etc. may be used as necessary.

Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.

Suspension agents according to the present invention include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc. Agents may be used, and surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.

Injections according to the present invention include distilled water for injection, 0.9% sodium chloride injection, IV injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated IV injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; solubilizing agents such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, twins, nijuntinamide, hexamine, and dimethylacetamide; buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumins, peptones, and gums; tonicity agents such as sodium chloride; Stabilizers such as sodium bisulfite (NaHSO ₃ ) carbon dioxide gas, sodium metabisulfite (Na ₂ S ₂ O ₅ ), sodium sulfite (Na ₂ SO ₃ ), nitrogen gas (N ₂ ), and ethylenediamine tetraacetic acid; Sulfating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, ethylenediamine disodium tetraacetate, acetone sodium bisulfite; analgesics such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; Suspending agents such as Siemesis sodium, sodium alginate, Tween 80, aluminum monostearate may be included.

The suppository according to the present invention includes cacao butter, lanolin, witapsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lannet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolen (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Buytyrum Tego-G -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxycote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hyde Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), suppository type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), Supostal (N, Es), Wecobi (W, R, S, M, Fs), testosterone triglyceride base (TG-95, MA, 57) and The same mechanism can be used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, for example, starch, calcium carbonate, sucrose, etc. ) or by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. there is. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, activity of the drug, It may be determined according to factors including sensitivity to the drug, administration time, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field.

The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention belongs.

The pharmaceutical composition of the present invention can be administered to a subject by various routes. All modes of administration can be envisaged, eg oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal insertion, vaginal It can be administered by intraoral insertion, ocular administration, otic administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, and the like.

The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient together with various related factors such as the disease to be treated, the route of administration, the age, sex, weight and severity of the disease of the patient.

In the present invention, "individual" means a subject in need of treatment, and is not limited if it is a vertebrate animal, but specifically, humans, mice, rats, guinea pigs, rabbits, monkeys, pigs, horses, cattle, sheep, It can be applied to antelope, dogs, cats, fish and reptiles.

Administration in the present invention means providing a given composition of the present invention to a subject by any suitable method.

In the present invention, prevention refers to any action that inhibits or delays the onset of a desired disease, and treatment refers to any activity that improves or beneficially changes a desired disease and metabolic abnormality caused by the administration of the pharmaceutical composition according to the present invention. It means an action, and improvement means any action that reduces a parameter related to a target disease, for example, the severity of a symptom, by administration of the composition according to the present invention.

In addition, the present invention can provide a method for isolating bacterial-derived extracellular vesicles comprising the following steps:

(a) culturing the bacteria; and

(b) separating bacterial-derived extracellular vesicles secreted from the culture medium.

In the present invention, the separation in step (b) is heat treatment, centrifugation, ultra-high-speed centrifugation, high-pressure treatment, extrusion, sonication, cell lysis, homogenization, freeze-thaw, electroporation, mechanical degradation, chemical treatment, filter At least one method selected from the group consisting of filtration by filtration, gel filtration chromatography, free-flow electrophoresis, and capillary electrophoresis may be used, and the ultracentrifugation may be gradient ultracentrifugation.

According to one embodiment of the present invention, the separation of bacterial-derived extracellular vesicles in step (b) may be performed by a gradient ultra-high-speed centrifugation method, but is not limited thereto, and any method for isolating bacterial-derived extracellular vesicles is not limited thereto. can be included

In addition, the present invention can provide a method for preparing a vaccine composition comprising the step of introducing a nucleic acid vaccine into bacterial-derived extracellular vesicles using an electroporation method.

In addition, the present invention can provide a method of delivering a nucleic acid into a cell comprising the following steps:

(a) introducing a target nucleic acid into bacterial-derived extracellular vesicles using electroporation; and

(b) treating cells with bacteria-derived extracellular vesicles into which the target nucleic acid has been introduced.

As described above, the target nucleic acid may be a vaccine in the form of a nucleic acid, a gene therapy product for the purpose of gene correction or disease treatment.

In the present invention, the electroporation method of step (a) may be an electroporation method of a voltage of 100 to 200 V and a capacitor of 50 to 150 μF. A nucleic acid of interest can be introduced.

The voltage (Volt; V) is 100 to 200 V, 100 to 180 V, 100 to 150 V, 100 to 130 V, 130 to 200 V, 130 to 150 V, 130 to 140 V, 140 to 150 V, 130 V , 140 V, or 150 V, and according to an embodiment of the present invention, the voltage may be 150 V.

The capacitor (C) is 50 to 150 μF, 50 to 130 μF, 50 to 100 μF, 50 to 70 μF, 70 to 150 μF, 70 to 100 μF, 70 to 90 μF, 90 to 100 μF, 70 It may be μF, 80 μF, 90 μF, or 100 μF, and according to an embodiment of the present invention, the capacitor may be 100 μF.

The present invention may also provide a nucleic acid delivery kit comprising the bacterium-derived extracellular vesicles and nucleic acid according to the present invention, and the kit may include instructions. The nucleic acid may be a nucleic acid vaccine or a gene therapy product.

The instructions include pamphlets, recordings, diagrams, or other presentation media (e.g., CD, VCD, DVD, USB) that can be used to communicate or teach how to use a kit according to the present invention. The instructions may be affixed to the container or may be packaged independently of the container containing the contents of the kit in the present invention.

The kit may further include reagents and/or devices for introducing nucleic acids into bacterial-derived extracellular vesicles.

Hereinafter, a preferred embodiment is presented to aid understanding of the present invention. However, the following examples are only provided to more easily understand the present invention, and the content of the present invention is not limited by the following examples.

[Test method]

1. Incubation

E. coli ( E. coli , K12 strain) was grown to OD ₆₀₀ =0.5 in 37 ° C. LB broth (Luria-Bertani broth, BD Difco, United States) medium.

Lactobacillus reuteri ( L. reuteri , ATCC 23272) was grown in MRS broth (de Man, Rogosa, Sharpe broth) to an OD ₆₀₀ =1.0 under anaerobic conditions.

2. Isolation and analysis of bacterial-derived extracellular vesicles (EVs)

2-1. Lactobacillus reuteri ( Lactobacillus reuteri, L. reuteri ) Isolation of derived extracellular vesicles (EVs)

The gradient ultracentrifugation method was used to isolate extracellular vesicles derived from Lactobacillus reuteri, a commensal bacterium in the human body. The strain cultured in Experimental Method 1. was centrifuged at 10,000 x g for 20 minutes at 4 ° C., and only the supernatant excluding the strain was used. The concentrated supernatant was filtered through a 0.22 μm-pore size membrane filter. 700 ml of the filtered supernatant was concentrated to about 35 ml, and ultracentrifuged at 150,000 x g for 3 hours at 4° C. (ultracentrifuge). The pellet at the bottom of the tube was suspended in 2.2 ml of 50% sucrose gradient solution. The suspended 50% opti prep was transferred to a new sealed tube for centrifugation, and 2 ml of 40% opti prep and 8 ml of 10% sucrose gradient solution were added in order so as not to damage the gradient. Then, it was ultracentrifuged at 200,000 x g for 2 hours at 4 °C. A 10 ml syringe was inserted between 40% sucrose gradient solution and 10% sucrose gradient solution, and a needle was inserted at the top of the tube to purify the extracellular vesicles of Lactobacillus reuteri. In addition, a needle was pierced at the top of the tube, and a solution flowing down through the bottom needle was taken by piercing the needle at the bottom of the tube, and the solution was taken in fractional units. By measuring the protein concentration of each fraction, extracellular vesicles were isolated from the place where the protein concentration was high.

2-2. Escherichia coli ( E. coli ) Isolation of derived extracellular vesicles (EVs)

E. coli-derived extracellular vesicles were isolated using the ExoBacteria™OMV Isolation Kit (SBI, Mountain View, CA, United States) according to the experimental method provided by the manufacturer.

2-3. Analysis of bacterial-derived extracellular vesicles (EVs)

Extracellular vesicles (EVs) isolated from Lactobacillus reuteri and Escherichia coli were treated with 1 μl of RNase A (1 U/μl, Thermo Fisher Scientific) and DNase I (2 U/μl, Thermo Fisher Scientific), respectively. EVs) were made into a volume of 1.5 ml and incubated at 37 °C for 25 minutes.

3. Analysis of host cell viability after treatment with bacterial-derived extracellular vesicles (EVs)

To investigate the effect of bacterial-derived extracellular vesicles (EVs) on cell viability, animal macrophage BV2 cells were seeded in a 96-well plate at a density of 10,000 cells/well. The next day, cells were treated with various concentrations of bacterial-derived extracellular vesicles (EVs) in fresh medium and incubated for 24 hours. Then, the viability of the cells was evaluated using the MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetra-zolium bromide) assay, and the cell viability was evaluated using an ELISA microplate reader at 570 Absorbance was measured in nm. Three independent experiments were performed to derive the results, and each bar represents the mean ± standard deviation.

4. Vector and RNA preparation

A pCMV-EGFP/Neo vector containing EGFP fluorescent protein was purchased from Clontech and used. 4 shows a vector map of the recombinant expression vector pCMV-EGFP/Neo into which EGFP and neomycin genes controlled by the CMV promoter were introduced as selectable markers.

The pCMV-EGFP vector (Clontech) shown in FIG. 4 was used for EGFP plasmid DNA and in vitro EGFP transcription.

EGFP RNA was synthesized using the Hela in vitro transcription kit (Invitrogen) using the plasmid gene (PGFP-NEO) as a template according to the manufacturer's protocol.

5. Transfection

Plasmids and in vitro transcribed RNA were introduced into bacterial-derived extracellular vesicles (EVs) by electroporation under conditions of V=150 V and C=100 μF. Specifically, bacterial-derived extracellular vesicles (EVs) were transferred to a new tube and allowed to merge with RNA or plasmid. Then, after vortexing it, 300 ml was transferred to a cuvette for electroporation (V = 150 V and C = 100 μF). Immediately after electroporation, the cuvette was transferred to ice. Thereafter, bacterial-derived extracellular vesicles (EVs) were treated with 1 μl of RNase A (1 U/μl, Thermo Fisher Scientific) and DNase I (2 U/μl, Thermo Fisher Scientific), respectively, to obtain bacterial-derived extracellular vesicles (EVs). to a volume of 1.5 ml, and incubated at 37 °C for 25 minutes.

6. RT (Reverse transcription)-PCR and qRT-PCR (quantitative RT-PCR)

The extracted RNA was synthesized into cDNA through RT-PCR. The synthesized cDNA was used to identify the plasmid gene used for transformation by testing the DNA band amplified through PCR using primers (Table 1) that specifically recognize only the EGFP gene. After PCR was performed, electrophoretic separation using an agarose gel plate was performed to confirm whether the amplified DNA band existed at the expected size of 631 bp to confirm whether the plasmid gene had been introduced.

primer order EGFP_F 5'-CTGGTCGAGCTGGACGGCGACG-3' EGFP_R 5′-CACGAACTCCAGCAGGACCATG-3′

For Cel-miR-39-3p (hereinafter referred to as Cel-miR-39), total RNA (25 ng) was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). 1.33 μl of the 15 μl reaction mixture was used for qRT-PCR, and qRT-PCR was performed using TaqMan Universal PCR Master Mix (Applied Biosystems) and TaqMan probe (Applied Biosystems).

7. RIP-PCR (RNA Immunoprecipitation-PCR)

For Ago2 RNA immunoprecipitation, BV2 cells were incubated with bacterial-derived extracellular vesicles (EVs). After 24 hours, all culture medium was removed, each plate was washed with 10 ml of PBS, and cells were collected and lysed in lysis buffer (50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 150 mM KCl, 2 mM EDTA, 1 mM NaF, 0.5% NP ₄ 0, 0.5 mM DTT). Lysates were incubated with Dynabeads Protein G (Thermo Fisher Scientific) conjugated with no antibody or Ago2-specific monoclonal antibody (ab57113; Abcam, Cambridge, MA, USA). After washing the beads repeatedly with PBS, Trizol was added to extract bound RNA, and Cel-miR-39 qRT-PCR was performed.

8. Fluorescence Microscopy

After infecting BV2 cells with pCMV-EGFP electroporated E. coli and Lactobacillus-derived extracellular vesicles (EVs) for about 24 hours, selection was performed twice with geneticin. Using the selected BV2 cell sample, it was observed under a fluorescence microscope. As a positive control, BV2 cells were transfected with pCMV-EGFP vector using Lipofectamine 2000 reagent. As a negative control group, untreated BV2 cells (negative control group for EGFP expression) were used.

9. Confocal fluorescence microscopy

Bacterial-derived extracellular vesicles (EVs) electroporated with plasmid DNA or synthetic RNA were added to BV2 cells cultured on a chamber slide, incubated at 37 °C for 24 hours, and then washed three times with 1 ml of PBS. After that, incubation was performed with DAPI (Vector Laboratories, Burlingame, CA, United States). Fluorescent signals were visualized with a laser scanning confocal microscope (LSM Zeiss 800; Carl Zeiss Microscopy, Jena, Germany).

10. Cel-miR-39 precursor RNA synthesis

Cel-miR-39 DNA, a non-mouse synthetic precursor in the form of miRNA, was synthesized with the complementary strand (5'- UAUACCGAGAGCCCAGCUGAUUUCGUCUUGGUAAUAAGCUCGUCAUUGAGAUUAUCACCGGGUGUAAAUCAGCUUGGCUCUGGUGUC-3p, Bioneer, Daejeon, Korea) and annealed. The double helix of the Cel-miR-39 precursor DNA was cloned into the pGEM-T easy vector (Promega) and transcribed in vitro as previously reported.

11. Statistical Analysis

All data are expressed as mean±standard deviation. Significant variation analysis was used to calculate the parametric two-tailed non-paired t -test. All analyzes were performed using Origin 8.0 (OriginLab, MA, USA), and a p-value ≤ 0.05 was considered statistically significant.

[Example]

Example 1. Analysis of bacterial-derived extracellular vesicles (EVs) and confirmation of cell viability after treatment with bacterial-derived extracellular vesicles (EVs)

1-1. Analysis of bacterial-derived extracellular vesicles (EVs)

In order to visualize the size distribution and amount of the isolated bacterial-derived extracellular vesicles (EVs), they were analyzed using a NanoSight system (NanoSight NS300; Malvern Panalytical, Malvern, United Kingdom). As a result, as shown in FIG. 1B, it was confirmed that bacterial-derived extracellular vesicles (EVs) having a size of 50 to 400 nm were isolated, and the number of bacterial-derived extracellular vesicles (EVs) particles included in the sample could be calculated.

1-2. Bacterial-derived extracellular vesicles (EVs) Cell viability after treatment

Bacterial-derived extracellular vesicles (EVs) contain toxic substances that can have a detrimental effect on host cells. , Sigma-Aldrich, St. louis, MO) assay was used to confirm the toxicity of bacterial-derived extracellular vesicles (EVs). As a result, as shown in Figure 1c, in the case of E. coli -derived extracellular vesicles (EVs), 126 particles per cell (126 MOI, multiplicity of infection) and Lactobacillus reuteri ( L. reuteri )-derived cells In the case of extracellular vesicles (EVs), even when 96 particles (96 MOI) per cell were treated, it was confirmed that the survival rate of cells was over 90% or there was no effect on the survival rate. The number of bacterial-derived extracellular vesicles (EVs) capable of processing could be predicted.

Example 2. EGFP DNA and RNA delivery through bacterial-derived extracellular vesicles (EVs)

Delivery of EGFP DNA and RNA into BV2 cells was confirmed by RT-PCR and confocal fluorescence microscopy analysis. EGFP plasmid DNA or RNA was transfected into bacterially derived extracellular vesicles (EVs) using electroporation. Transfected bacterial-derived extracellular vesicles (EVs) were treated with DNase I or RNase A to remove non-free nucleic acids, which were then treated with BV2 cells. RT-PCR and confocal fluorescence microscopy analysis were performed to confirm that EGFP DNA or RNA transfected into bacterial-derived extracellular vesicles (EVs) was delivered to BV2 cells.

As a result of RT-PCR, as shown in FIG. 1D, it was confirmed that DNA or RNA (631 bp) of the fluorescent protein transfected into bacterial-derived extracellular vesicles (EVs) was well expressed in BV2 cells.

As a result of confocal fluorescence microscopy analysis, as shown in Fig. 1e, colocalization of bacterial-derived extracellular vesicles (EVs) and EGFP was confirmed.

From the above results, it was confirmed that bacterial-derived extracellular vesicles (EVs) can be used as delivery vehicles for nucleic acids such as DNA or RNA.

Example 3. Confirmation of RNA delivery effect of Gram-positive bacteria-derived extracellular vesicles (EVs) using fluorescence microscopy

After transfecting the probiotics Lactobacillus reuteri with EGFP RNA encoding a fluorescent protein by electroporation, extracellular vesicles (EVs) were isolated and treated in BV2 cells. In addition, observation was performed with a fluorescence microscope to confirm the expression of the fluorescent protein in the BV2 cells.

As a result, as shown in FIG. 2 , it was confirmed that the fluorescent protein transfected into bacteria-derived extracellular vesicles (EVs) was well expressed in animal macrophages (BV2 cells), which is a completely different species. From the above results, it was confirmed that probiotic bacteria-derived extracellular vesicles can be used as a carrier of nucleic acids having specific antigenic information.

Example 4. Synthesis of pre-Cel-miR-39

Cel-miR-39 is present only in C. elegans and not in other known mammalian cells. Therefore, when bacterial-derived extracellular vesicles (EVs) containing Cel-miR-39 precursors are delivered to animal cells, if Cel-miR-39 is processed in a mature form in animal cells, miRNA It can be confirmed that it can be transmitted by bacterial-derived extracellular vesicles (EVs).

To obtain the RNA oligo of pre-Cel-miR-39, the DNA double helix form of pre-Cel-miR-39 was synthesized with Bioneer (Daejeon, Korea). Specifically, the DNA oligo was annealed and cloned into the pGEM-T Easy vector (Promega, Madison, WI), and then in vitro ( in vitro ) was transcribed. Accurate cloning using the pGEM-T easy vector was confirmed by sequencing after insertion and direction confirmation by agarose gel loading.

Example 5. Binding of Cel-miR-39 and Ago2 in BV2 cells after precursor delivery through bacterial-derived extracellular vesicles (EVs)

Pre-Cel-miR-39 delivered by bacterial-derived extracellular vesicles (EVs) can mature in host cells, and the matured miRNA functions as a miRNA by binding to the Ago2 protein together with other miRNAs already present in cells. can be performed. To confirm the mature form of Cel-miR-39 bound to the Ago2 protein using a TaqMan-specific Cel-miR-39 probe (Applied Biosystems), qRT-PCR was performed after RNA-immunoprecipitation (RIP). The lower the Ct value, the higher the expression of Cel-miR-39, and if the Ct value was higher than 36, it was considered that Cel-miR-39 was not expressed. Error bars represent standard deviation.

As a result of performing qRT-PCR after RIP with Ago2 antibody, as shown in FIG. 3B, cell samples subjected to Ago2 RIP after treating bacterial-derived extracellular vesicles (EVs) containing Cel-miR-39 precursors , the Ct value of Cel-miR-39 was significantly lower than that of the control group. This means that exogenous miRNA precursors delivered through bacterial-derived extracellular vesicles (EVs) can develop into mature miRNAs in host cells and successfully bind to the Ago2 protein.

The above description of the present invention is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting.

Claims (17)

A nucleic acid delivery system comprising bacterial-derived extracellular vesicles as an active ingredient.
According to claim 1,
Wherein the nucleic acid is selected from the group consisting of DNA, RNA, aptamer, locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino.
According to claim 1,
The nucleic acid delivery system, characterized in that the bacteria is selected from the group consisting of gram-negative bacteria and gram-positive bacteria.
According to claim 3,
The gram-positive bacteria are Lactobacillus genus bacteria, characterized in that, nucleic acid delivery system.
According to claim 4,
The nucleic acid delivery system, characterized in that the bacteria of the genus Lactobacillus is Lactobacillus reuteri .
According to claim 1,
The extracellular vesicles are characterized in that having a diameter of 10 to 1000nm, nucleic acid delivery system.
According to claim 1,
The extracellular vesicles are naturally secreted or artificially produced, characterized in that, nucleic acid delivery system.
A vaccine composition comprising a bacterial-derived extracellular vesicle and a nucleic acid vaccine.
According to claim 8,
The vaccine composition is characterized in that for at least one selected from the group consisting of anti-viral, anti-bacterial, anti-parasitic and anti-cancer, vaccine composition.
According to claim 8,
The vaccine composition is anti-corona, anti-HPV (human papillomavirus), anti-HBV (hepatitis B virus), anti-HCV (hepatitis C virus), anti-HIV (human immunodeficiency virus), anti-MERS-CoV, anti-MERS-CoV -Zika virus, anti-norovirus, anti-rotavirus, anti-influenza virus, anti-HSV (herpes simplex virus), anti-porcine reproductive and respiratory syndrome virus (PRRSV), anti-porcine cholera virus, anti-porcine circo Virus (PCV), anti-porcine diarrhea virus (PEDV), anti-foot-and-mouth disease virus, anti-Newcastle virus and anti-viral hemorrhagic sepsis virus (VHSV), characterized in that for at least one selected from the group consisting of composition.
(a) culturing the bacteria; and
(b) a method for separating bacterial-derived extracellular vesicles comprising the step of separating bacterial-derived extracellular vesicles secreted from the culture medium.
According to claim 11,
Separation in step (b) is heat treatment, centrifugation, ultra-high-speed centrifugation, high-pressure treatment, extrusion, sonication, cell lysis, homogenization, freeze-thaw, electroporation, mechanical degradation, chemical treatment, filter filtration, gel A method for separating bacterial-derived extracellular vesicles, characterized by using at least one method selected from the group consisting of filtration chromatography, free-flow electrophoresis, and capillary electrophoresis.
According to claim 12,
The ultra-high-speed centrifugation is a method for separating bacterial-derived extracellular vesicles, characterized in that the gradient ultracentrifugation.
(a) introducing a target nucleic acid into bacterial-derived extracellular vesicles using electroporation; and
(b) a method for delivering a nucleic acid into a cell, comprising the step of treating the cell with the bacteria-derived extracellular vesicle into which the target nucleic acid has been introduced.
According to claim 14,
The electroporation method of step (a) is characterized in that the electroporation method of a voltage of 100 to 200 V, a capacitor of 50 to 150 μF, a method for delivering nucleic acids into cells.
According to claim 14,
Characterized in that the nucleic acid is selected from the group consisting of DNA, RNA, aptamer, locked nucleic acid (LNA), peptide nucleic acid (PNA), and morpholino, delivering a nucleic acid into a cell How to.
A nucleic acid delivery kit comprising bacterial-derived extracellular vesicles and nucleic acids.

Images