KR20220166744A - Biomarkers for predicting prostatic carcinoma prognosis and uses thereof - Google Patents

Abstract

The present invention relates to a biomarker for diagnosing prostate cancer or predicting the prognosis of prostate cancer and a method for diagnosing prostate cancer or predicting the prognosis of prostate cancer using the biomarker. Specifically, the method of the present invention measures expression levels (concentrations) of miR-21, miR-16, miR-142-3p, miR-451, or miR-636, which are specific miRNAs, in a biometric sample, and compares the expression levels with expression levels of normal individuals, resulting in diagnosing the onset of prostate cancer or predicting the prognosis of prostate cancer. Accordingly, the method or a kit including an agent or analysis device capable of specifying a concentration of miR-21, miR-16, miR-142-3p, miR-451, or miR-636 can be usefully applied for diagnosis of prostate cancer and prediction of prognosis (preferably diagnosis of metastasis).

Description

Biomarkers for predicting prognosis of prostate cancer and their uses {BIOMARKERS FOR PREDICTING PROSTATIC CARCINOMA PROGNOSIS AND USES THEREOF}

The present invention relates to a biomarker for predicting prognosis of prostate cancer and its use, and more specifically, to diagnosis of prostate cancer consisting of miR-21, miR-16, miR-142-3p, miR-451 and/or miR-636. Alternatively, a biomarker for predicting prognosis and a composition for diagnosing or predicting prognosis of prostate cancer including an agent capable of measuring the expression level of the miRNA may be provided, thereby providing information such as metastasis of prostate cancer.

Prostate cancer is a malignant tumor that occurs in the male prostate and is known as a high-risk disease with a high incidence rate. In particular, prostate cancer is not only known as the second most common cause of cancer death in the United States, but according to the 2016 National Cancer Registry statistics, the number of newly diagnosed cancer patients in 2016 was 229,180 (men) compared to 212,542 in 2015. 120,068 cases, 109,112 females), an increase of 12,638 (5.8%) was reported, of which prostate cancer was reported as the 4th most common cancer, surpassing liver cancer, compared to 2015. It became.

Recently, the prevalence of prostate cancer seems to have increased as Korea entered an aging society, because the most important risk factor for prostate cancer is age, and prostate cancer occurs mostly in the elderly after 60 years of age. However, it is also common in men under the age of 50. Therefore, prostate cancer is positioned as a chronic disease that requires steady management, and it is time to accurately diagnose prostate cancer. In addition, since prostate cancer shows an unpredictable disease progression, it is necessary to predict in advance through prognosis.

Meanwhile, until now, cancer diagnosis methods have been performed using invasive methods such as tissue sample collection and endoscopy. In particular, a biopsy is performed by removing a part of a suspected disease area and observing it under a microscope. Therefore, in order to use a needle, punch, endoscope, or laparoscope to collect a tissue sample, the human body must be incised, causing not only a lot of discomfort to the patient, but also leaving scars and taking a long time to recover.

Conventional techniques for diagnosing prostate cancer include PSA (Prostate Specific Antigen) measurement and biopsy. PSA measurement is the most commonly used method in prostate cancer diagnosis, and it is a method of determining the risk of prostate cancer by measuring the level of specific antigens produced by prostate cells. PSA levels are higher in malignant prostate cancer, and most men without prostate cancer have levels less than 4 ng/mL. However, if the measured PSA level is very high despite the absence of prostate cancer or if it is in the PSA gray zone (PSA 4ng/mL or more and 10ng/mL or less), a biopsy is required. Biopsy is a method of diagnosing the presence or absence of a malignant tumor such as cancer or sarcoma in a patient's organ by taking tissue from an organ suspected of having cancer with a needle and performing a histopathological examination. This biopsy test is very painful for patients, and the accuracy rate of prostate cancer diagnosis in the PSA gray zone, in particular, is less than 30%. In other words, there is a disadvantage that about 70% of patients undergo costly and painful rebiopsy due to limitations of PSA.

After all, a biopsy is required for the diagnosis or prognosis of prostate cancer with such clinical characteristics, but there is a limit to biopsy of all prostate cancer patients, which are gradually increasing in clinical practice. There is an urgent need to develop tools or methods that can non-invasively diagnose .

An object of the present invention is to provide a method for diagnosing prostate cancer and predicting prognosis by measuring and comparing the content of a specific biomarker miRNA. In particular, an object of the present invention is to provide a biomarker for diagnosing metastasis of prostate cancer.

Another object of the present invention is to provide a method for diagnosing the onset or metastasis of prostate cancer by measuring and comparing the content of a specific biomarker.

Another object of the present invention is to provide a composition for diagnosis and prognosis of prostate cancer, including an agent for measuring the content of a specific biomarker.

Another object of the present invention is to provide a kit for diagnosing and predicting prognosis of prostate cancer using an agent or device for measuring the content of a specific biomarker.

In order to solve the above problems, the present invention is a diagnosis of prostate cancer, including at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636. or providing a biomarker for predicting prognosis.

According to one embodiment of the present invention, the biomarker is preferably detected in a biological sample separated from the subject, the subject sample may be a non-invasive sample, and the non-invasive sample may be blood, serum, urine, or saliva. It may be, most preferably urine.

In the present invention, prognosis of prostate cancer includes diagnosing metastasis of prostate cancer.

The present invention also relates to a prostate, including an agent capable of measuring the expression level of at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636. A composition for diagnosing or predicting the prognosis of cancer is provided.

According to one embodiment of the present invention, the agent is a nucleic acid capable of specifically binding to at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636. includes

The present invention also provides a kit for diagnosing or predicting prognosis of prostate cancer comprising the above composition.

The present invention (a) compares the expression level of miR-21, miR-16, miR-142-3p, miR-451 or miR-636 contained in samples obtained from subjects with the expression level of miRNA contained in normal group samples It provides a method for providing information for diagnosis or prognosis of prostate cancer comprising the step.

According to one embodiment of the present invention, the method may further include the following step (b): (b) the miR-21, miR-16, miR-142-3p or If the expression level of miR-451 is higher than that of the miRNA contained in the sample of the normal group, determining that prostate cancer has occurred or predicting a high level of metastasis risk or (b) If the expression level of miR-636 is lower than the expression level of miRNA contained in the normal group sample, determining that prostate cancer has occurred or predicting a high level of metastasis risk.

According to one embodiment of the present invention, the sample obtained from the subject is preferably the subject's blood or urine.

By measuring the expression level of the biomarker gene of the present invention, it is possible to quickly, easily, but accurately diagnose the onset of prostate cancer and metastasis of prostate cancer, thereby diagnosing diseases that may be caused by the onset of prostate cancer at an early stage. Alternatively, it is possible to track the progress, prognosis, or treatment effect of the disease.

1 is a risk prediction model test result according to an embodiment of the present invention. 1A is a receiver operating characteristic (ROC) analysis result for prostate cancer. Referring to Figure 1A, the sensitivity and specificity for the level of prostate-specific antigen (PSA) before surgery for prostate cancer are three miRNAs (miR-636, miR-21 and miR-451) It can be seen that it is most stratified in the ROC curve of the risk prediction model (PCa-MRS) composed of . In particular, the ROC curve of the risk prediction model (PCa-MRS) composed of the three miRNAs (miR-636, miR-21 and miR-451) is different from other miRNAs (green), preoperative PSA levels (grey) or clinical Gleason It shows superior stratification ability (AUC = 0.925) compared to other models consisting only of scores (purple).
1B is an ROC curve for PCa MRS of each sample set according to an embodiment of the present invention. In Fig. 1B, sensitivity and specificity were calculated based on a cutoff value of -0.82 in the PCa-MRS model of Youden index.
2 shows Kaplan-Meier curves for BCR-free and overall survival by risk score according to an embodiment of the present invention. Patients with high PCa-MRS scores (green) showed significantly lower BCR-free survival rates (Fig. 2 a) and overall survival rates (Fig. 2 b) than patients with low scores (blue). In Figure 2, the survival rate in parentheses represents (survival / number of cases). In this example, 136 patients who underwent radical prostatectomy (RP) for BCR-free survival and 149 patients for overall survival were investigated among 149 combined data from the external model validation set.
Figure 3 shows the progress of the experiment for identifying miRNA markers characteristic of metastatic prostate cancer performed in one embodiment of the present invention. In this example, the experiment was conducted in two stages. Referring to FIG. 3, this experiment includes (I) discovery and independent verification of differentially expressed miRNAs by TaqMan low-density miRNA array (TLDA) and quantitative reverse transcription PCR (qRT-PCR) experiments (Phase 1); (II) It consists of constructing a model using Lasso logistic regression with 5-fold cross-validation and external validation of the model (Phase 2). In (II) above, statistical analysis including risk score analysis and logistic regression model using ROC curves was performed to evaluate the predictive ability of candidate miRNAs for metastasis in the combined set.
4 is a result of confirming the relative expression of differentially expressed miRNAs in the discovery step by Taqman low-density miRNA analysis according to an embodiment of the present invention. Data were presented as box plots with median (and range) relative expression normalized to U6 snRNA.
5 is a graph confirming the performance of 100 risk prediction models according to an embodiment of the present invention. In this example, the median AUC was found to be 0.917 (range 0.909-0.925) in 100 repetitions of 5-fold cross-validation.
6 is a result of confirming urine exosomes according to an embodiment of the present invention. Exosome markers (CD63 and CD9) were identified in urine exosomes using Western blot.

Hereinafter, various embodiments are presented to aid understanding of the invention. The following examples are provided to more easily understand the invention, but the protection scope of the invention is not limited to the following examples.

According to one embodiment of the present invention, the present invention is a treatment for prostate cancer, including at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636. A biomarker (or biomarker composition) for diagnosis or prognosis is provided.

The biomarker diagnoses prostate cancer of a specific subject by detecting or measuring the expression level of at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636. and/or predict prognosis.

As used herein, the term “diagnosis” means confirming the presence or character of a pathological condition. For the purposes of the present invention, diagnosis may mean determining whether or not prostate cancer has occurred.

As used herein, the term "prognosis" refers to a prediction of disease progression and recovery, and refers to a prospective or preliminary evaluation. For the purpose of the present invention, prognosis means determining whether or not treatment success, survival, recurrence, metastasis, drug response, resistance, etc. in a subject after treatment of prostate cancer. That is, it means prediction of medical outcome (eg, long-term viability, disease-free survival rate, etc.), and includes positive prognosis (positive prognosis) or negative prognosis (negative prognosis), wherein the negative prognosis is recurrence, tumor growth, metastasis A positive prognosis includes remission of the disease, such as no disease, and improvement or stabilization of the disease, such as tumor regression.

The term "prediction" in the present specification means to guess in advance about medical consequences, and for the purpose of the present invention, the course of a patient diagnosed with prostate cancer (disease progression, improvement, cancer recurrence, tumor growth, drug resistance) may be meant to predict in advance.

The term "prostate cancer (PCa)" as used herein refers to cancer arising from the prostate. The prostate is a walnut-sized male reproductive organ located just below the bladder and in front of the rectum. It produces and stores some of the semen. Above is the bladder neck, that is, adjacent to the transition from the bladder to the urethra, and is fixed to the anterior pubic anterior ligament, and below is fixed by the urogenital diaphragm. Most of the cancers arising from the prostate are adenocarcinomas (cancers of glandular cells) arising from prostate cells, and types can be classified according to the degree of differentiation of tumor tissues and cell characteristics.

The term "biomarker" in this specification generally refers to changes in the body using organic biomolecules such as proteins, nucleic acids (DNA and mRNA, etc.), metabolites (lipids, glycolipids, glycoproteins and sugars, etc.). It means an index that can be produced, and specifically means a marker that can distinguish a normal or pathological state in the case of a specific disease or cancer, or can predict a treatment response and can be measured objectively. Depending on their use, biomarkers include target markers that confirm the existence of drug targets, diagnostic markers that diagnose the presence or absence of disease, predictive markers that can distinguish between responders and non-responders to a specific drug, and drug treatment effects. There are surrogate markers that can be monitored and prognostic biomarkers that inform the prognosis of diseases.

The present invention also relates to a prostate, including an agent capable of measuring the expression level of at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636. A composition for diagnosis and prognosis of cancer is provided. The same parts as described above also apply to the composition.

As used herein, the term "measurement of expression level" refers to measuring the presence, expression, or expression level of a specific gene, a specific protein (peptide), or a gene encoding the protein, specifically miR-21, miR-16 It may be to measure the expression level of at least one miRNA selected from the group consisting of miR-142-3p, miR-451 and miR-636.

The method of measuring the expression level of the miRNA or gene is reverse transcriptase polymerization (RT-PCR), competitive reverse transcriptase polymerase reaction (competitive RT-PCR), real-time reverse transcriptase polymerase reaction (real time quantitative RT-PCR), It may be quantitative polymerase reaction (quantitative RT-PCR), RNase protection method, Northern blotting, DNA chip technology, or biosensor.

Methods for measuring the expression level of the protein include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radical immunodiffusion, and Okteroni immunodiffusion method ( Ouchterlony immunodiffusion), rocket immunoeletrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, immunofluorescence, immunochromatography ( It may be immunochromatography, fluorescence activated cell sorter analysis (FACS), protein chip technology, or biosensor.

As used herein, the term "agent capable of measuring the expression level" refers to a molecule that can be used to determine the expression level of a specific gene, and specifically includes an agent capable of detecting and/or amplifying the gene. It may be, but is not limited thereto.

The "agent capable of detecting a specific gene (or specific protein)" refers to an agent capable of specifically binding to and recognizing the specific gene or protein, or detecting and amplifying the specific gene or protein. "Agent capable of amplifying" refers to an agent capable of increasing the number by repeating the replication of the specific gene or protein, for example, a primer capable of specifically amplifying a polynucleotide containing the gene or It may mean a probe capable of specifically binding, but is not limited thereto.

The present invention also provides a kit for diagnosing or predicting prognosis of prostate cancer comprising the composition. The same parts as described above also apply to the kit.

The kit for diagnosing or predicting prognosis of prostate cancer of the present invention can measure the expression level of miR-21, miR-16, miR-142-3p, miR-451 or miR-636 (derived from exosomes) from a biological sample. It may include an agent, and the agent means a molecule that can be used for detecting a marker by checking the expression level of miR-21, miR-16, miR-142-3p, miR-451 or miR-636. In the present invention, miR-21, miR-16, miR-142-3p, miR-451 or miR-636 expression levels are measured as miR-21, miR-16, miR-142-3p, miR-451 or miR-636 Antisense oligonucleotides, primers, probes, and / or antibodies that specifically bind to may be used, and a known method used to measure the level of gene expression, for example, PCR using a primer or using a probe The expression level of miR-21, miR-16, miR-142-3p, miR-451 or miR-636 can be measured by hybridization. In addition to the measurement agent, the kit may include various tools and reagents known in the art for facilitating detection, for example, a suitable carrier, a label material capable of generating a detectable signal, and a stabilizer.

In the present invention, the biological sample may be a non-invasive sample, and the non-invasive sample may be blood, serum, urine, or saliva, preferably blood or serum, and more preferably urine. It is not limited.

In the present invention, miR-21, miR-16, miR-142-3p, miR-451 or miR-636 are functional equivalents of the oligonucleotides constituting them, e.g., miR-21, miR-16, miR-142 Although some base sequences of -3p, miR-451 or miR-636 oligonucleotides were modified by deletion, substitution or insertion, miR-21, miR-16, miR-142-3p, It is a concept including variants and mimics that can functionally have the same action as miR-451 or miR-636 nucleic acid molecules.

In the present invention, "antisense oligonucleotide" is a nucleotide sequence that binds complementary to the miRNA and suppresses its expression, and includes, but is not limited to, antisenseRNA and antagonist mRNA.

In the present invention, a "primer" refers to a short nucleic acid sequence having a short free hydroxyl group that can form base pairing with a complementary template and serves as a starting point for copying a template strand. The primers of the present invention can be chemically synthesized using methods known in the art, such as, for example, the phosphoramidite solid support method.

In the present invention, "probe" refers to a nucleic acid fragment such as RNA or DNA consisting of several to hundreds of bases that can specifically bind to mRNA, and is labeled so that the presence or absence of a specific mRNA can be confirmed. The probe may be prepared in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, and the like, and may be labeled with biotin, FITC, rhodamine, DIG, or the like, or labeled with a radioactive isotope.

In the present invention, the kit may be a kit including essential elements required to perform RT-PCR, but is not limited thereto. In the case of an RT-PCR kit as an example, in addition to each primer pair specific for a marker gene, a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors , DEPC-water, sterile water, and the like.

The present invention also provides diagnosis of prostate cancer, comprising measuring the expression level of miR-21, miR-16, miR-142-3p, miR-451 and/or miR-636 in a biological sample isolated from the subject. Or to provide a method of providing information for prognosis prediction. The same parts as described above are also applied to the method.

As used herein, the term "subject" refers to all organisms that have or are likely to develop prostate cancer, and specific examples include dogs, cats, mice, rats, monkeys, cows, pigs, mini-pigs, livestock, humans, and the like. It may include mammals, farmed fish, etc., including, but is not limited thereto.

The term "sample" in the present specification means a material derived from the subject, and may specifically include tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, urine, etc., but is not limited thereto . In addition, gene and/or protein samples may be obtained from these samples, and the genetic samples may include nucleic acids, for example, DNA, mRNA, or cDNA synthesized from mRNA, from which expression of specific genes/proteins may be obtained. As long as the level can be confirmed, the type is not limited thereto.

The sample may be urine or a sample derived from urine. In addition, the sample may be isolated from an individual before or after performing digital rectal examination (DRE), and specifically may be isolated from an individual after performing DRE.

The method includes measuring the expression level of miR-21, miR-16, miR-142-3p, miR-451 and/or miR-636 in a biological sample isolated from a control group; And it may be to further include the step of comparing the expression level of the individual and the control group.

As used herein, the term "control group" may mean a general individual without prostate cancer, a non-prostate cancer patient group, a non-patient group, and the like.

The present invention can apply various transformations and can have various embodiments. Hereinafter, specific embodiments will be illustrated in the drawings and described in detail in the detailed description. However, it should be understood that this is not intended to limit the present invention to specific embodiments, and includes all transformations, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of related known technologies may obscure the gist of the present invention, the detailed description will be omitted.

Exosome preparation and RNA extraction

Exosomes were extracted from 5 mL of urine using the ExoQuick-TC (System bioscience, CA, USA) kit. Extraction of exosomes proceeded according to the experimental method suggested by the manufacturer. Roughly, exosome precipitation solution was added to the supernatant obtained after centrifugation of the urine sample at 3,000g for 15 minutes and stored at 4 ° C. overnight. Thereafter, the supernatant was removed after centrifugation at 4° C. and 1,500 g for 30 minutes, and centrifugation was performed at 1,500 g for 5 minutes to remove remaining trace liquid components.

Total RNA was extracted from the exosome pellet thus obtained using TRIzol (Thermo Fisher Sicentific, MA, USA) solution.

TLDA experiments and data analysis

Megaplex reverse transcription and pre-amplification reactions were performed using Megaplex PreAmp Primers Human Pool A and TaqMan PreAmp Master Mix (Thermo Fisher Scientific). MiRNA expression was evaluated through TLDA panel A v2.0 (Thermo Fisher Scientific), and TLDA experiments were conducted according to the experimental method suggested by the manufacturer. The raw data were processed using QuantStudio Real-Time PCR software (Thermo Fisher Scientific) to determine cycle threshold (Ct) values for each miRNA.

For TLDA data analysis, U6 snRNA, one of the most stably expressed exosomal miRNAs in human urine, was selected as an internal control for normalization. ΔCt values were normalized across all TLDA data using Bioconductor's HTqPCR R package (https://www.bioconductor.org/packages/release/bioc/html/HTqPCR.html). MiRNAs with a fold change (metastatic/localized PCa) of ±2 or more were considered differentially expressed between the two groups, except for miRNAs that were not reliably quantified during the analysis or were expressed at less than 30%.

miRNA-specific quantitative reverse transcription PCR

Expression of candidate miRNAs was confirmed using TaqMan microRNA Assay (miR-636-002088, miR-21-5p-000397, miR-16-5p-000391, miR-142-3p-000464 and miR-451a-001141) , U6 snRNA (U6 snRNA-001973) was used as an endogenous control. 5 μl of RNA was converted to first-strand cDNA with miRNA-specific primers using the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific), followed by real-time PCR using TaqMan probes. The relative expression of individual miRNAs in each case is defined as 2-ΔCt. All qRT-PCR reactions were performed in triplicate and samples with Ct>35 of U6 snRNA were excluded.

Patient information of samples used for urinary tract exosomal miRNA analysis related to PCa metastasis

The patient information of the target sample used in each step (discovery set, validation set, external model validation set, etc.) of the embodiment of the present invention is shown in Table 1 below.

Discovery set Localized Metastatic P-value Number 19 23 Age (years) 74 (58-81) 74 (63-87) 0.593 BMI ^, kg/m2 23.4 (17.6-29.4) 24.1 (16.5-31.1) 0.331 PSA before surgery
(Preoperative PSA, ng/mL) 6.03 (2.52-11.3) 34.8 (4.60-1225) ^6.79x10-6 prostate volume
(Prostate volume, mL) 35.6 (15.0-59.5) 36.5 (20.0-93.6) 0.627 PSA density
(PSA density, ng/mL) 0.177 (0.076-0.69) 0.821 (0.082-16.5) ^9.40x10-5 Clinical Gleason Score
(Clinical Gleason score) 18 One 5.04x10 ^-10 ≤6 One 4 7 (3+4) 0 7 7 (4+3) 0 11 ≥8 Validation set Localized Metastatic P-value Number 56 14 Age (years) 71 (48-83) 71.5 (61-85) 0.825 BMI ^, kg/m2 24.6 (18.0-30.9) 25.0 (20.6-28.7) 0.376 PSA before surgery
(Preoperative PSA, ng/mL) 7.35 (0.17-152) 40.6 (4.04-701) ^9.20x10-5 prostate volume
(Prostate volume, mL) 31.6 (15.0-102) 35.0 (22.1-79.1) 0.384 PSA density
(PSA density, ng/mL) 0.247 (0.003-3.66) 1.44 (0.113-31.8) 0.017 Clinical Gleason Score
(Clinical Gleason score) 0.008 ≤6 15 0 7 (3+4) 8 0 7 (4+3) 15 3 ≥8 18 11 External model validation set Localized Metastatic P-value Number 27 10 Age (years) 68 (62-80) 63.5 (52-78) 0.054 BMI ^, kg/m2 24.2 (20.8-30.1) 24.1 (17.5-29.2) 0.692 PSA before surgery
(Preoperative PSA, ng/mL) 7.37 (3.79-36.3) 22.6 (11.9-108) ^6.29x10-5 prostate volume
(Prostate volume, mL) 42.5 (23.0-76.0) 49.4 (28.0-62.9) 0.311 PSA density
(PSA density, ng/mL) 0.212 (0.072-0.88) 0.925 (0.236-3.57) 0.001 Clinical Gleason Score
(Clinical Gleason score) 0.024 ≤6 9 0 7 (3+4) 3 One 7 (4+3) 4 6 ≥8 11 3

Validation of candidate miRNAs

In order to select miRNAs associated with the onset of prostate cancer, in particular, metastasis of prostate cancer according to the present invention, the expression level of miRNAs in samples was quantitatively analyzed. Table 2 below shows the amount of change in miRNA in a patient with metastasis of prostate cancer compared to a sample of a local prostate cancer patient according to the present example.

Referring to Table 2 below, the expression levels of miR-636, miR-483-5p, miR-330, miR-29b, miR-18a, and miR-363 were decreased compared to the normal control group, and miR-142-3p, miR- In 451, miR-21, and miR-16, it can be seen that the expression level of miRNA increased.

Urinary exosomal miRNAs differentially expressed in metastatic versus local PCa Downregulated miRNAs
(Down-regulated miRNAs) Upregulated miRNAs
(Up-regulated miRNAs) miRNAs Fold change P-value miRNAs Fold change P-value miR-636 0.325 0.039 miR-142-3p 4.326 0.002 miR-483-5p 0.348 0.088 miR-451 3.878 0.049 miR-330 0.362 0.100 miR-21 3.147 0.005 miR-29b 0.419 0.929 miR-16 2.951 0.050 miR-18a 0.421 0.850 miR-126 2.439 0.479 miR-363 0.489 0.090 miR-491 2.363 0.830 miR-223 2.292 0.093 miR-210 2.169 0.206 miR-140-3p 2.166 0.017 miR-212 2.044 0.129

In particular, in Table 2, miR-636, miR-142-3p, miR-451, miR-21, and miR-16 had a P-value of 0.05 or less, making them suitable for determining metastasis of prostate cancer. After confirming suitability, qRT-PCR was performed on this target. The results are shown in Table 3 below.

discovery set
(Discovery set) validation set
(Validation set)
(qRT-PCR) combined set
(Combined:
Model construction set)
(qRT-PCR) Discovery
(TLDA) Technical validation
(qRT-PCR) miRNAs Fold change p-value
(p-value) Fold change p-value
(p-value) Fold change p-value
(p-value) Fold change p-value
(p-value) miR-636 0.33 0.039 0.82 0.582 0.44 0.013 0.53 0.004 miR-140-3p 2.17 0.017 2.62 0.005 1.76 0.137 1.19 0.424 miR-21 3.15 0.005 2.95 0.003 2.56 0.044 2.20 0.006 miR-16 2.92 0.050 3.31 0.006 1.98 0.190 2.12 0.010 miR-142-3p 4.33 0.002 11.7 ^7.92x10-6 4.83 0.206 3.20 0.021 miR-451 3.88 0.049 8.42 0.003 3.84 0.008 6.31 ^2.12x10-6

Table 3 shows the results of qRT-PCR analysis in each miR-636, miR-142-3p, miR-451, miR-21, and miR-16 Discovery set, Validation set, and Combined (Model construction) set of local prostate cancer patients Represents the amount of change in miRNA in a patient with metastasis of prostate cancer compared to a sample of . Referring to Table 3, the expression of miR-636 decreased, and the expression of miR-142-3p, miR-451, miR-21, and miR-16 increased in all values of the set (see FIG. 4).

That is, it can be seen that if the expression of miR-636 decreases or if the expression of miR-142-3p, miR-451, miR-21, or miR-16 increases, it can be determined that prostate cancer has metastasized.

statistical analysis

6-1. Development of a risk scoring model for PCa metastasis

In order to analyze the accuracy of the statistical values of the values derived in the examples of the present invention, logistic regression analysis and sensitivity, specificity and accuracy according to PCa-MRS scores were analyzed as shown in Tables 4 and 5 below.

Logistic regression results for clinical variables and five miRNAs with PCa metastasis Univariate Multivariate Variable oddsby
(OR (95% CI)) P-value
(P-value) corrected odds ratio
(aOR (95% CI)) P-value
(P-value) Age (years) 1.06 (1.00-1.12) 0.067 BMI 1.09 (0.95-1.26) 0.230 Preoperative PSA (Preoperative PSA) 1.04 (1.02-1.06) ^4.63x10-4 1.03 (1.01-1.05) 0.004 Prostate volume 1.02 (0.99-1.05) 0.118 PSA density 3.59 (1.58-8.12) 0.002 Clinical Gleason score 0.004 7 (3+4) vs ≤6 14.7 (1.45-148.0) 0.023 7 (4+3) vs ≤6 22.0 (2.58-187.8) 0.005 ≥8 vs ≤6 40.3 (5.02-324.4) ^5.09x10-4 miR-636 0.65 (0.48-0.88) 0.005 0.37 (0.23-0.61) ^9.92x10-5 miR-21 1.31 (1.07-1.61) 0.009 1.65 (1.17-2.31) 0.004 miR-16 1.34 (1.07-1.66) 0.010 miR-142-3p 1.12 (1.01-1.24) 0.035 miR-451 1.42 (1.20-1.68) ^5.13x10-5 1.48 (1.15-1.90) 0.002

Sensitivity, specificity and accuracy according to the PCa-MRS score Threshold Sensitivity Specificity Accuracy -2.19 100 58.7 72.3 -1.71 97.3 66.7 76.8 -1.66 94.6 70.7 78.6 -1.54 91.9 73.3 79.5 -1.09 89.2 81.3 83.9 -0.82 86.5 85.3 85.7 -0.67 83.8 86.7 85.7 -0.38 78.4 88.0 84.8 -0.28 75.7 89.3 84.8 -0.13 73.0 89.3 83.9 0.53 64.9 94.7 84.8 1.49 45.9 98.8 81.3

Referring to Tables 4 and 5, it can be seen that the results derived according to the present invention are reliable data.

6-2. Correlation between PCa-MRS score and biochemical recurrence (BCR)-free survival

Correlation with biochemical recurrence of prostate cancer in the patient samples used in the present invention was analyzed as shown in Table 6 below.

Cox Regression Results for Clinical Variables and PCa-MRS Scores with PCa Metastasis Univariate Multivariate Variable HR (95% CI) P-value
(P-value) HR (95% CI) P-value
(P-value) PCa-MRS highs vs lows
(high vs low score) 4.23 (2.58-6.96) ^1.25x10-8 2.26 (1.29-3.96) 0.004 Age 1.02 (0.98-1.06) 0.305 BMI 1.05 (0.97-1.15) 0.246 Prostate volume 1.00 (0.99-1.02) 0.736 Preoperative PSA (Preoperative PSA) 1.02 (1.01-1.03) ^2.49x10-8 1.01 (1.00-1.02) 0.014 PSA density 1.75 (1.40-2.19) ^7.59x10-7 Clinical Gleason score ^{4.43x10-6 1.74x10-4} 7(3+4) vs ≤6 7.58 (1.47-39.1) 0.015 7.29 (1.41-37.7) 0.018 7(4+3) vs ≤6 16.9 (3.96-72.1) ^1.34x10-4 12.6 (2.92-54.2) 0.001 ≥8 vs ≤6 28.8 (6.90-120.1) ^3.99x10-6 20.4 (4.80-86.4) ^4.33x10-5

Referring to Table 6 and FIG. 2, it can be seen that the lower the PCa-MRS score, the higher the biochemical recurrence (BCR)-free survival and overall survival rate. Therefore, it can be seen that the biomarker of the present invention can predict the prognosis of prostate cancer by diagnosing metastasis of prostate cancer.

The targets of each miRNA probe used in the present invention are shown in Table 7 below, and U6 in Table 7 is miRNA information for the endogenous control group.

Gene ID/miRBase ID_v21 LT† Analytical Name
(LT†AssayName) Target Sequence size hsa-miR-636 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA S(50RT/150 PCR rxns) hsa-miR-140-3p hsa-miR-140-3p UACCACAGGGUAGAACCACGG S(50RT/150 PCR rxns) hsa-miR-21-5p, hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA S(50RT/150 PCR rxns) hsa-miR-16-5p, hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG S(50RT/150 PCR rxns) hsa-miR-142-3p, hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA S(50RT/150 PCR rxns) hsa-miR-451a; mmu-miR-451 AAACCGUUACCAUUACUGAGUU S(50RT/150 PCR rxns) U6 snRNA U6 snRNA GUGCUCGCUUCGGCAGCACAUAUACUAAAAU
UGGAACGATACAGAGAAGAUUAGCAUGGCCC
CUGCGCAAGGAUGACACGCAAAUUCGUGAAG
CGUUCCAUAUUUU S(50RT/150 PCR rxns)

As shown in Table 7, miR-636 of the present invention has the gene sequence of SEQ ID NO: 1, miR-140-3p has the gene sequence of SEQ ID NO: 2, miR-21 has the gene sequence of SEQ ID NO: 3, and miR-140-3p has the gene sequence of SEQ ID NO: 3. 16 may include the gene sequence of SEQ ID NO: 4, miR-142-3p may include the gene sequence of SEQ ID NO: 5, and miR-451 may include the gene sequence of SEQ ID NO: 6.

So far, the present invention has been looked at with respect to its preferred embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> BIOMARKERS FOR PREDICTING PROSTATIC CARCINOMA PROGNOSIS AND USES THEREOF <130> 1071242 <150> KR 10-2021-0075498 <151> 2021-06-10 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> RNA <213> artificial sequence <220> <223> hsa-miR-636 <400> 1 uggcuugcu cgucccgccc gca 23 <210> 2 <211> 21 <212> RNA <213> artificial sequence <220> <223> hsa-miR-140-3p <400> 2 uaccacaggg uagaaccacg g 21 <210> 3 <211> 22 <212> RNA <213> artificial sequence <220> <223> hsa-miR-21 <400> 3 uagcuuauca gacugauguu ga 22 <210> 4 <211> 22 <212> RNA <213> artificial sequence <220> <223> hsa-miR-16 <400> 4 uagcagcacg uaaauauugg cg 22 <210> 5 <211> 23 <212> RNA <213> artificial sequence <220> <223> hsa-miR-142-3p <400> 5 uguaguguuu ccuacuuuau gga 23 <210> 6 <211> 22 <212> RNA <213> artificial sequence <220> <223> mmu-miR-451 <400> 6 aaaccguuac cauuacugag uu 22 <210> 7 <211> 106 <212> RNA <213> artificial sequence <220> <223> U6 snRNA <400> 7 gugcucgcuu cggcagcaca uauacuaaaa uuggaacgat acagagaaga uuagcauggc 60 cccugcgcaa ggaugacacg caaauucgug aagcguucca uauuuu 106

Claims (13)

A biomarker for diagnosis or prognosis of prostate cancer, comprising at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636. According to claim 1,
Wherein the biomarker is detected in a biological sample isolated from a subject, a biomarker for diagnosis or prognosis of prostate cancer. According to claim 2,
The biological sample is urine, a biomarker for diagnosis or prognosis of prostate cancer. According to claim 1,
The prognostic prediction is a biomarker for diagnosing or predicting prognosis of prostate cancer, which is to diagnose metastasis of prostate cancer. Diagnosis or prognosis of prostate cancer, including an agent capable of measuring the expression level of at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636 composition for prediction. According to claim 5,
The preparation includes a nucleic acid capable of specifically binding to at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636, diagnosis of prostate cancer or A composition for predicting prognosis. According to claim 6,
Wherein the prognosis is to diagnose metastasis of prostate cancer, a composition for diagnosing or predicting prognosis of prostate cancer. A kit for diagnosing or predicting prognosis of prostate cancer, comprising the composition of claim 5. According to claim 8,
The kit further comprises a nucleic acid capable of specifically binding to at least one miRNA selected from the group consisting of miR-21, miR-16, miR-142-3p, miR-451 and miR-636, A kit for diagnosing or predicting the prognosis of prostate cancer. A method for providing information for diagnosis or prognosis of prostate cancer comprising the following steps:
(a) comparing the expression level of miR-21, miR-16, miR-142-3p, miR-451 or miR-636 in the sample obtained from the subject with the expression level of miRNA included in the sample of the normal group. 11. The method of claim 10, wherein the method further comprises the following steps:
(b) When the expression level of miR-21, miR-16, miR-142-3p or miR-451 included in the sample of the subject is higher than the expression level of miRNA included in the sample of the normal group, prostate cancer The stage at which the disease is identified or the risk of metastasis is predicted at a high level. 11. The method of claim 10, wherein the method further comprises the following steps:
(b) determining that prostate cancer has occurred or predicting a high level of metastasis risk when the expression level of miR-636 included in the sample of the subject is lower than the expression level of miRNA included in the sample of the normal group . According to claim 10,
A method for providing information for diagnosis or prognosis of prostate cancer, wherein the sample obtained from the subject is urine of the subject.

Images