KR20220163838A - Extracellular Vesicles Derived from Lactobacillus plantarum and use thereof - Google Patents

Abstract

The present invention relates to Lactobacillus plantarum-derived vesicles and a use thereof, and more specifically, to a composition containing Lactobacillus plantarum-derived vesicles as an active ingredient for prevention, alleviation, or treatment of an immune disease or a metabolic disorder. The present inventors found that when Lactobacillus plantarum-derived vesicles were administered into an immune disease or metabolic disorder model, pathogenic factor-induced immune dysfunction and metabolite-induced metabolic dysfunction can be effectively inhibited. Thus, the Lactobacillus plantarum-derived vesicles according to the present invention are expected to be usefully applied in the development of medical products or health function foods for preventing or treating immune diseases or metabolic disorders or for alleviating symptoms thereof.

Description

Extracellular Vesicles Derived from Lactobacillus plantarum and use thereof {Extracellular Vesicles Derived from Lactobacillus plantarum and use thereof}

The present invention relates to a composition for preventing, improving, or treating immune or metabolic diseases caused by immune function and metabolic function disorders, comprising Lactobacillus plantarum -derived vesicles as an active ingredient.

Entering the 21st century, the importance of acute infectious diseases, which were recognized as infectious diseases in the past, has decreased, while chronic diseases caused by immune function and metabolic dysfunction occurring in major organs of the body have decreased the quality of life and become a major factor determining human lifespan. Disease patterns have changed. Changes in these disease patterns are closely related to changes in dietary patterns. In the past, acute infectious diseases were the main cause of death in the past when nutritional status was insufficient. Chronic diseases are becoming a major problem.

As a result of metabolic dysfunction due to excessive nutrition, fat is accumulated in blood vessels, heart, liver, kidney, muscle, etc. as well as adipose tissue, which is a place where fat is normally stored, resulting in lipotoxicity, which causes metabolic diseases. In other words, blood lipids and fatty acids increase due to carbohydrate or lipid metabolism disorders, and fatty acids increase in cells, resulting in inflammatory reactions caused by fatty acids. The inflammatory reactions cause cell aging and death, resulting in cardiovascular, liver, kidney, muscle, Functional disorders of organs such as the brain may occur. Diseases caused by these etiologies include cardiovascular diseases such as arteriosclerosis, metabolic syndrome, and heart failure, liver diseases such as non-alcoholic steatohepatitis and cirrhosis, kidney diseases such as chronic nephropathy and renal failure, and musculoskeletal diseases such as gout, sarcopenia, and osteoporosis. , degenerative brain diseases such as Alzheimer's disease and Parkinson's disease.

Immunity is a cellular defense mechanism against biological, chemical, physical, and mental stresses, and occurs through innate immunity and adaptive immunity. Recently, it has been revealed that immune function is closely related to the metabolic function of cells. In relation to the pathogenesis of immune function disorder caused by metabolic function disorder, metabolites such as fatty acids and uric acid in the cytoplasm act as a danger signal, resulting in a pattern present in the cytoplasm. It is recognized by the pattern recognition receptor, NLRP (Nucleotide-binding oligomerization domain). It is known that this induces apoptosis by forming inflammasomes and simultaneously secretes inflammatory mediators to induce inflammatory cell infiltration.

On the other hand, it is known that the number of microorganisms symbiotic with the human body is 100 trillion, which is more than human cells, and the number of genes of microorganisms is more than 100 times the number of human genes. The microbiota or microbiome refers to the microbial community, including bacteria, archaea, and eukarya, present in a given habitat.

Bacteria that live symbiotically in our bodies and those that exist in the surrounding environment secrete nanometer-sized vesicles to exchange information such as genes, low-molecular-weight compounds, and proteins with other cells. The mucous membrane forms a physical barrier that does not allow particles larger than 200 nanometers (nm) to pass through, so bacteria that live symbiotically on the mucous membrane cannot pass through the mucous membrane, but bacterial-derived vesicles are relatively free because they are less than 200 nanometers in size. It passes through the epithelial cells through the mucous membrane and is absorbed into our body. In this way, bacterial-derived vesicles are secreted from bacteria, but are different from bacteria in terms of composition, absorption rate in the body, risk of side effects, etc. indicate

Bacterial-derived vesicles secreted locally are absorbed through the epithelial cells of the mucous membrane and induce a local inflammatory response. The vesicles that have passed through the epithelial cells are absorbed systemically through the lymphatic vessels and distributed to each organ. Regulates metabolic and immune functions. For example, vesicles derived from pathogenic Gram-negative bacteria such as Escherichia coli are pathogenic nanoparticles that cause colitis or food poisoning locally, and when absorbed into blood vessels, are absorbed by vascular endothelial cells to induce an inflammatory response. It promotes systemic inflammatory response and blood coagulation, and also causes metabolic diseases such as insulin resistance and diabetes by being absorbed into muscle cells where insulin acts. On the other hand, vesicles derived from beneficial bacteria can control diseases by regulating immune and metabolic abnormalities caused by pathogenic vesicles.

Bacteria of the genus Lactobacillus are known as representative beneficial bacteria that secrete lactic acid. Among them, Lactobacillus plantarum is a gram-positive bacillus that grows well in an aerobic environment as well as in an anaerobic environment, and is a bacterium that lives symbiotically in the vagina, oral cavity, skin, intestines, and the like. It is also known as an important bacterium in the fermentation process. Vesicles derived from gram-positive bacteria such as Lactobacillus plantarum have bacterial cell wall components such as peptidoglycan and lipoteichoic acid in addition to bacterial proteins, metabolites and nucleic acids. have.

However, no case has been reported in which vesicles secreted from Lactobacillus plantarum have been applied to the prevention or treatment of diseases caused by immune and metabolic dysfunction.

Choi YW et al., Gutmicrobe-derived extracellular vesicles induce insulin resistance, thereby impairing glucose metabolism in skeletal muscle. Scientific Reports, 2015.

As a result of intensive research to solve the above conventional problems, the inventors of the present invention confirmed that Lactobacillus plantarum-derived vesicles are effective in treating immune or metabolic diseases caused by immune function and metabolic function disorders, and thus the present invention completed.

Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating immune diseases or metabolic diseases, containing vesicles derived from Lactobacillus plantarum as an active ingredient.

Another object of the present invention is to provide a food composition for preventing or improving immune or metabolic diseases, containing Lactobacillus plantarum-derived vesicles as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating aging, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

Another object of the present invention is to provide a food composition for preventing or improving aging, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

Another object of the present invention is to provide a cosmetic composition for preventing or improving aging, comprising vesicles derived from Lactobacillus plantarum as an active ingredient.

Another object of the present invention is to provide a drug delivery composition for treating an immune disease or a metabolic disease, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention as described above, the present inventors confirmed the effect through various experiments. More specifically, when Lactobacillus plantarum bacteria were cultured and vesicles were separated from the culture medium and orally administered to mice, the vesicles were absorbed through the gastrointestinal tract and distributed to organs such as the lungs, liver, kidneys, and brain. In addition, when epithelial cells were treated with the vesicles, apoptosis caused by biological pathogenic factors was inhibited in a dose-dependent manner. In addition, when the vesicles were orally administered to a mouse model of colitis induced by dextran, an abnormal metabolite produced by specific bacteria when sugar (sucrose) was ingested, anatomical changes in the large intestine were significantly suppressed. In addition, when the vesicle was administered to nerve cells, the expression of a neurotrophic factor gene suppressed by stress hormones was significantly increased. In addition, the expression of Sirt 1, a key anti-aging gene that is suppressed by stress hormones, was significantly increased. In addition, it was confirmed that the vesicles increased the activation of AMPK (AMP-activated kinase), a key signal for overcoming metabolic stress, in which ATP generation does not occur well.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating immune or metabolic diseases, containing Lactobacillus plantarum-derived vesicles as an active ingredient.

In one embodiment of the present invention, the immune disease or metabolic disease is one or more gastrointestinal diseases selected from the group consisting of gastritis, peptic ulcer, celiac disease, and inflammatory bowel disease. disease;

one or more oral diseases selected from the group consisting of gingivitis, periodonditis, and caries;

at least one female vaginal disease selected from the group consisting of candida vaginitis, atrophic vaginitis, bacterial vaginitis or vaginosis, and trichomonas vaginitis;

At least one liver selected from the group consisting of non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis, liver cirrhosis, cholangitis, cholecystitis, and pancreatitis -biliary-pancreatic disease;

At least one selected from the group consisting of chronic obstructive pulmonary disease, chronic interstitial pneumonitis, emphysema, bronchopulmonary dysplasia, and idiopathic pulmoniary fibrosis lung disease;

from the group consisting of hyperinsulinemia, dyslipidemia, arrhythmia, atherosclerosis, angina, metabolic syndrome, myocardial infarction, stroke, and cardiomyopathy selected one or more cardiovascular diseases;

one or more kidney diseases selected from the group consisting of glomerulonephritis and chronic nephropathy;

Atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, Gout, sarcopenia, osteoporosis, Paget's disease, one or more musculoskeletal disorders selected from the group consisting of rheumatoid arthritis and osteoarthritis; and

Mild cognitive impairment, dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease, Amyotrophic lateral sclerosis (ALS), Batten disease ), Kearns-Sayre syndrome (KSS), chronic progressive external ophthalmoplegia (CPEO), mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), MERRF syndrome ( myoclonic epilepsy with ragged-red fibers (MERRF), neurogenic weakness with ataxia and retinitis pigmentosa (NARP), Leigh syndrome (LS), mitochondrial recessive ataxia syndrome (MIRAS syndrome), Dementia with Lewy Bodies (DLB), Multi-Infarct Dementia (MID), frontotemporal lobar degeneration (FTLD), Pick's disease, Corticobasal degeneration (CBD), progressive supranuclear palsy palsy (PSP), age-related macular degeneration (AMD), dysosmia, deafness, and diabetic retinopathy. It may be selected from the group, but is not limited thereto.

In another embodiment of the present invention, the vesicles may have an average diameter of 10 to 1000 nm, but is not limited thereto.

In another embodiment of the present invention, the vesicles may be isolated from Lactobacillus plantarum culture, but are not limited thereto.

In another embodiment of the present invention, the vesicles may be separated from food prepared by adding Lactobacillus plantarum, but is not limited thereto.

In another embodiment of the present invention, the vesicles may be naturally or artificially secreted from Lactobacillus plantarum, but are not limited thereto.

In addition, the present invention provides a food composition for preventing or improving immune diseases or metabolic diseases, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating aging, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

In addition, the present invention provides a food composition for preventing or improving aging, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

In addition, the present invention provides a cosmetic composition for preventing or improving skin aging, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

In addition, the present invention provides a drug delivery composition for treating an immune disease or a metabolic disease, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

In one embodiment of the present invention, the food composition may be a health functional food composition, but is not limited thereto.

In addition, the present invention provides a method for preventing or treating an immune disease or a metabolic disease, comprising administering to a subject a composition containing Lactobacillus plantarum-derived vesicles as an active ingredient.

In addition, the present invention provides a preventive or therapeutic use of an immune disease or metabolic disease of a composition comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

In addition, the present invention provides the use of Lactobacillus plantarum-derived vesicles for the preparation of a medicament for the treatment of immune or metabolic diseases.

In addition, the present invention provides a method for preventing or treating aging, comprising administering to a subject a composition containing Lactobacillus plantarum-derived vesicles as an active ingredient.

In addition, the present invention provides a composition containing Lactobacillus plantarum-derived vesicles as an active ingredient for preventing or treating aging.

In addition, the present invention provides the use of Lactobacillus plantarum-derived vesicles for the manufacture of a drug for the treatment of aging.

The present inventors found that Lactobacillus plantarum bacterium-derived vesicles are absorbed through the gastrointestinal tract and distributed through blood vessels to organs such as the lungs, liver, kidneys, and brain, inhibit apoptosis by pathogenic factors in a dose-dependent manner, and inhibit pathogenic factors in a dose-dependent manner. inhibits the secretion of inflammatory mediators in a dose-dependent manner, significantly suppresses the development of colitis in a colitis mouse model, activates AMPK (AMP-activated kinase) signals that increase cellular homeostasis against metabolic stress, and also activates neurotrophic As it was confirmed that the expression of the SIRT gene, which is a key protein that inhibits neurotrophic factor expression and aging, was significantly increased, the Lactobacillus plantarum-derived vesicles according to the present invention prevent immune or metabolic diseases and improve symptoms , or can be usefully used in the development of medicines or health functional foods for treatment, as well as usefully used as a drug delivery system for treating the disease.

Figures 1a and 1b show the results of orally administering Lactobacillus plantarum bacteria-derived vesicles to mice according to an embodiment of the present invention, whole body images (a) and organs harvested over time, respectively. It is a photograph measuring the intensity of fluorescence in the organ (b).
2a and 2b show the degree of death of skin epithelial cells by pathogenic bacterium Staphylococcus aureus-derived vesicles (SaEV) (a) and Lactobacillus plantarum bacterium-derived vesicles (Lp EV) according to an embodiment of the present invention. It shows the degree of death of skin epithelial cells by (b).
3a and 3b show the therapeutic effect of Lactobacillus plantarum bacteria-derived vesicles (Lp EV) on skin epithelial cell death by pathogenic bacterium Staphylococcus aureus-derived vesicles (Sa EV) according to an embodiment of the present invention. As shown, FIG. 3a shows the results of treating Lactobacillus plantarum bacterium-derived vesicles (Lp EV) simultaneously with Sa EV, and FIG. 3b shows the results before Sa EV treatment.
Figure 4 shows vesicles derived from Lactobacillus plantarum in a colitis mouse model induced by orally administering dextran (2.5% DSS), an abnormal metabolite produced in the body by specific bacteria when sugar (sucrose) is ingested. This is an experimental protocol to confirm the therapeutic effect after oral administration.
Figure 5a shows the anatomical changes of the large intestine after orally administering L. plantarum-derived vesicles (L. plantarum) to a colitis mouse model, and Figure 5b shows a representative change picture according to administration.
Figure 6 shows the expression of neurotrophic factors when Lactobacillus plantarum-derived vesicles (L-EV) were simultaneously administered to a neuron model in which expression of neurotrophic factors was suppressed by treatment with glucocorticoid hormone (GC), a stress hormone. was evaluated.
7 shows the expression of anti-aging related genes when Lactobacillus plantarum-derived vesicles (L-EV) were simultaneously administered to a neuronal model in which senescence was promoted by treatment with glucocorticoid hormone (GC), a stress hormone. it was evaluated
8 shows the evaluation of the degree of activation of AMPK signals by treating muscle cells with insulin, metformin, or Lactobacillus plantarum-derived vesicles (Lp EV).
9a and 9b show the inhibitory effect of Lactobacillus plantarum-derived vesicles (Lp EV) on the secretion of inflammatory mediators (IL-6 and TNF-α) by vesicles derived from E. coli, which are pathogenic factors. .

The present invention relates to vesicles derived from Lactobacillus plantarum and uses thereof.

Hereinafter, the present invention will be described in detail.

When the present inventors cultured Lactobacillus plantarum bacteria and separated vesicles from the culture medium and orally administered to mice, the vesicles were absorbed through the gastrointestinal tract and distributed through blood vessels to organs such as the lungs, liver, kidneys, and brain. was confirmed (see Example 2).

In addition, when epithelial cells were treated with the vesicles, it was confirmed that apoptosis by Staphylococcus aureus-derived vesicles, a biological pathogenic factor, was inhibited in a dose-dependent manner (see Example 3).

In addition, when the vesicles were orally administered to a colitis mouse model induced by ingestion of dextran, an abnormal metabolite of sugar (sucrose), it was confirmed that anatomical changes caused by inflammation were significantly suppressed (see Example 4) .

In addition, when the vesicle was administered to nerve cells, it was confirmed that the expression of a neurotrophic factor gene suppressed by stress hormones and the expression of Sirt 1, a key gene for suppressing aging, were significantly increased (Examples see 5).

In addition, it was confirmed that when the vesicles were administered to muscle cells, phosphorylation of AMPK, a key signal for suppressing metabolic dysfunction, was increased (see Example 6), similar to metformin, an anti-aging drug.

In addition, when the vesicles were administered to inflammatory cells, it was confirmed that secretion of inflammatory mediators (IL-6 and TNF-α) by pathogenic factors was inhibited in a dose-dependent manner (see Example 7).

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating immune or metabolic diseases comprising vesicles derived from Lactobacillus plantarum as an active ingredient.

As used herein, the term "extracellular vesicle" or "vesicle" refers to a nano-sized membrane structure secreted by various bacteria, for example, endotoxin (lipopolysaccharide) , vesicles or outer membrane vesicles (OMVs) derived from gram-negative bacteria such as Escherichia coli, which also have toxic proteins and bacterial DNA and RNA, and peptidoglycan, a component of bacterial cell walls, in addition to proteins and nucleic acids. vesicles derived from gram-positive bacteria, such as micrococcus bacteria, which also contain peptidoglycan and lipoteichoic acid.

In the present invention, the vesicles collectively refer to all membrane structures naturally secreted or artificially produced from Lactobacillus plantarum.

The vesicles are subjected to heat treatment, high pressure treatment in the process of culturing Lactobacillus plantarum, or centrifugation, ultra-high-speed centrifugation, high pressure treatment, extrusion, sonication, cell lysis, homogenization, freeze-thaw, electroporation, mechanical degradation of the bacterial culture medium , chemical treatment, filtration with a filter, gel filtration chromatography, free-flow electrophoresis, and can be separated using at least one method selected from the group consisting of capillary electrophoresis. In addition, processes such as washing to remove impurities and concentration of the obtained vesicles may be further included.

The method of separating vesicles from the culture broth or fermented food of Lactobacillus plantarum of the present invention is not particularly limited as long as it includes vesicles. For example, vesicles can be separated using methods such as centrifugation, ultra-high-speed centrifugation, filter filtration, gel filtration chromatography, free-flow electrophoresis, or capillary electrophoresis, and combinations thereof, and also removal of impurities. It may further include a process of washing for, concentration of the obtained vesicles, and the like.

The vesicles of the present invention may be isolated from a culture of Lactobacillus plantarum or food prepared by adding Lactobacillus plantarum, and may be secreted naturally or artificially from Lactobacillus plantarum, but are limited thereto. it is not going to be

In the present invention, the vesicles isolated by the above method have an average diameter of 10-1000 nm, 10-900 nm, 10-800 nm, 10-700 nm, 10-600 nm, 10-500 nm, 10-400 nm, 10 ~300 nm, 10-200 nm, 10-100 nm, 10-90 nm, 10-80 nm, 10-70 nm, 10-60 nm, 10-50 nm, 10-40 nm, or 20-40 nm It may be, but is not limited thereto.

The term "comprising as an active ingredient" used in the present invention means containing an amount sufficient to achieve the efficacy or activity of the Lactobacillus plantarum-derived vesicles.

As used herein, the term "immune disease or metabolic disease" refers to diseases caused by disorders of immune function and metabolic function in vivo. In general, immune diseases cause inflammation by pathogenic factors, and as a result, apoptosis and inflammatory cell infiltration by inflammatory mediators are induced. In addition, metabolic diseases are caused by inflammation or metabolic stress caused by pathogenic metabolites produced in the body, resulting in aging or death of cells.

The immune disease or metabolic disease may be a disease caused by immune function or metabolic function disorder, but is not limited thereto.

The immune disease or metabolic disease is at least one gastrointestinal disease selected from the group consisting of gastritis, peptic ulcer, celiac disease, and inflammatory bowel disease;

one or more oral diseases selected from the group consisting of gingivitis, periodonditis, and caries;

at least one female vaginal disease selected from the group consisting of candida vaginitis, atrophic vaginitis, bacterial vaginitis or vaginosis, and trichomonas vaginitis;

At least one liver selected from the group consisting of non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis, liver cirrhosis, cholangitis, cholecystitis, and pancreatitis -biliary-pancreatic disease;

At least one selected from the group consisting of chronic obstructive pulmonary disease, chronic interstitial pneumonitis, emphysema, bronchopulmonary dysplasia, and idiopathic pulmoniary fibrosis lung disease;

from the group consisting of hyperinsulinemia, dyslipidemia, arrhythmia, atherosclerosis, angina, metabolic syndrome, myocardial infarction, stroke, and cardiomyopathy selected one or more cardiovascular diseases;

one or more kidney diseases selected from the group consisting of glomerulonephritis and chronic nephropathy;

Atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, Gout, sarcopenia, osteoporosis, Paget's disease, one or more musculoskeletal disorders selected from the group consisting of rheumatoid arthritis and osteoarthritis; and

Mild cognitive impairment, dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease, Amyotrophic lateral sclerosis (ALS), Batten disease ), Kearns-Sayre syndrome (KSS), chronic progressive external ophthalmoplegia (CPEO), mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), MERRF syndrome ( myoclonic epilepsy with ragged-red fibers (MERRF), neurogenic weakness with ataxia and retinitis pigmentosa (NARP), Leigh syndrome (LS), mitochondrial recessive ataxia syndrome (MIRAS syndrome), Dementia with Lewy Bodies (DLB), Multi-Infarct Dementia (MID), frontotemporal lobar degeneration (FTLD), Pick's disease, Corticobasal degeneration (CBD), progressive supranuclear palsy palsy (PSP), age-related macular degeneration (AMD), dysosmia, deafness, and at least one neurological disease selected from the group consisting of diabetic retinopathy.

The content of the vesicles in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the progress of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 50% by weight based on the total weight of the composition. It may, but is not limited thereto. The content ratio is a value based on the dry amount after removing the solvent.

The pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions. The excipient may be, for example, one or more selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a moisturizer, a film-coating material, and a controlled release additive.

The pharmaceutical compositions according to the present invention are powders, granules, sustained-release granules, enteric granules, solutions, eye drops, elsilic agents, emulsions, suspensions, spirits, troches, perfumes, and limonadese, respectively, according to conventional methods. , tablets, sustained-release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusate, It can be formulated and used in the form of external preparations such as warning agents, lotions, pasta agents, sprays, inhalants, patches, sterile injection solutions, or aerosols, and the external agents are creams, gels, patches, sprays, ointments, and warning agents. , lotion, liniment, pasta, or cataplasma may have formulations such as the like.

Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, phosphoric acid as additives for tablets, powders, granules, capsules, pills, and troches according to the present invention Calcium monohydrogen, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethyl Excipients such as cellulose (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose phthalate acetate, carboxymethyl cellulose, calcium carboxymethyl cellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethyl cellulose, sodium methyl cellulose, methyl cellulose, microcrystalline cellulose, dextrin Binders such as hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, purified shellac, starch arc, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, and polyvinylpyrrolidone may be used, Hydroxypropyl Methyl Cellulose, Corn Starch, Agar Powder, Methyl Cellulose, Bentonite, Hydroxypropyl Starch, Sodium Carboxymethyl Cellulose, Sodium Alginate, Calcium Carboxymethyl Cellulose, Calcium Citrate, Sodium Lauryl Sulfate, Silicic Anhydride, 1-Hydroxy Propyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl cellulose, white sugar, magnesium aluminum silicate, di-sorbitol solution, and light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopod, kaolin, vaseline, sodium stearate, cacao butter, sodium salicylate, magnesium salicylate, polyethylene glycol 4000, PEG 6000, liquid paraffin, hydrogenated soybean oil ( Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acid, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, starch, sodium chloride , lubricants such as sodium acetate, sodium oleate, dl-leucine, light anhydrous silicic acid; may be used.

Additives for the liquid formulation according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (tween esters), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, and the like may be used.

In the syrup according to the present invention, a solution of white sugar, other sugars, or a sweetener may be used, and aromatics, coloring agents, preservatives, stabilizers, suspending agents, emulsifiers, thickeners, etc. may be used as necessary.

Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.

Suspension agents according to the present invention include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc. Agents may be used, and surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.

Injections according to the present invention include distilled water for injection, 0.9% sodium chloride injection, IV injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated IV injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; solubilizing agents such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, twins, nijuntinamide, hexamine, and dimethylacetamide; buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and gums; tonicity agents such as sodium chloride; Stabilizers such as sodium bisulfite (NaHSO ₃ ) carbon dioxide gas, sodium metabisulfite (Na ₂ S ₂ O ₅ ), sodium sulfite (Na ₂ SO ₃ ), nitrogen gas (N ₂ ), ethylenediaminetetraacetic acid; Sulfating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, ethylenediamine disodium tetraacetate, acetone sodium bisulfite; analgesics such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; Suspending agents such as Siemesis sodium, sodium alginate, Tween 80, aluminum monostearate may be included.

The suppository according to the present invention includes cacao butter, lanolin, witapsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lannet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolen (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Buytyrum Tego-G -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxycote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hyde Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), suppository type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), Supostal (N, Es), Wecobi (W, R, S, M, Fs), testosterone triglyceride base (TG-95, MA, 57) and The same mechanism can be used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, for example, starch, calcium carbonate, sucrose, etc. ) or by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, activity of the drug, It may be determined according to factors including sensitivity to the drug, administration time, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field.

The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention belongs.

The pharmaceutical composition of the present invention can be administered to a subject by various routes. All modes of administration can be envisaged, eg oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal insertion, vaginal It can be administered by intraoral insertion, ocular administration, otic administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, and the like.

The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient together with various related factors such as the disease to be treated, the route of administration, the age, sex, weight and severity of the disease of the patient. Specifically, the effective amount of the composition according to the present invention may vary depending on the patient's age, sex, and weight, and is generally 0.001 to 150 mg per 1 kg of body weight, preferably 0.01 to 100 mg per day or every other day, or 1 It can be administered in 1 to 3 divided doses per day. However, since it may increase or decrease depending on the route of administration, severity of obesity, gender, weight, age, etc., the dosage is not limited to the scope of the present invention in any way.

In the present invention, "subject" means a subject in need of treatment of a disease, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse, cow, etc. It may be a mammal of, but is not limited thereto.

In the present invention, "administration" means providing a given composition of the present invention to a subject by any suitable method.

In the present invention, “prevention” refers to any action that suppresses or delays the onset of a desired disease, and “treatment” means that the desired disease and its resulting metabolic abnormality are improved or improved by administration of the pharmaceutical composition according to the present invention. All actions that are advantageously altered are meant, and "improvement" means any action that reduces a parameter related to a target disease, for example, the severity of a symptom, by administration of the composition according to the present invention.

In addition, the present invention provides a food composition for preventing or improving immune diseases or metabolic diseases comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

The food composition may be a health functional food composition, but is not limited thereto.

When the vesicle of the present invention is used as a food additive, it can be added as it is or used together with other foods or food ingredients, and can be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). In general, the antifoam of the present invention may be added in an amount of 15% by weight or less, or 10% by weight or less based on the raw material when preparing food or beverage. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.

There is no particular limitation on the type of food. Examples of foods to which the above substances can be added include meat, sausages, bread, chocolates, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice creams, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and includes all health functional foods in a conventional sense.

The health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional components, like conventional beverages. The aforementioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrins and cyclodextrins, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The proportion of the natural carbohydrate is generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention.

In addition to the above, the composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, A carbonation agent used in carbonated beverages and the like may be contained. In addition, the composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The ratio of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.

In addition, the present invention relates to a pharmaceutical composition for preventing or treating aging or aging-related diseases comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

In addition, the present invention relates to a food composition for preventing or improving aging, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

In addition, the present invention relates to a cosmetic composition for preventing or improving aging, comprising vesicles derived from Lactobacillus plantarum as an active ingredient.

In the present invention, "aging" refers to all physiological changes in the body that occur over time, and refers to a life phenomenon that occurs in a variety of ways due to numerous factors depending on the individual. Looking specifically at the aging phenomenon, changes in the function of each constituent organ and tissue occur, and the aging of an individual is ultimately caused by the aging of cells constituting the individual. In the present invention, the aging may be brain, liver, lung, kidney, muscle, skin, or cellular aging of these organs, but is not limited thereto.

The formulation of the cosmetic composition according to the present invention is skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrient lotion, massage cream, nutrient cream, mist, moisture cream, hand cream, hand lotion, foundation, It may be in the form of essence, nutritional essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, cleansing oil, cleansing balm, body lotion, or body cleanser.

The cosmetic composition of the present invention may further include a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, and sphingolipids.

Any water-soluble vitamin can be used as long as it can be incorporated into cosmetics, but examples include vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, and vitamin H. salts (thiamin hydrochloride, sodium ascorbate, etc.) or derivatives (sodium ascorbic acid-2-phosphate, magnesium salt of ascorbic acid-2-phosphate, etc.) included Water-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microbial culture, an enzymatic method, or a chemical synthesis method.

Any useful vitamin can be used as long as it can be formulated into cosmetics, but examples include vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol), etc. , their derivatives (ascorbine palmitate, ascorbine stearate, ascorbine dipalmitate, dl-alpha tocopherol acetate, dl-alpha tocopherol nicotinate, vitamin E, DL-pantothenyl alcohol, D-pantothenyl alcohol, pantothenylethyl ether, etc.) and the like are also included in the useful vitamins used in the present invention. The useful vitamins can be obtained by conventional methods such as microbial transformation, purification from microbial culture, enzymatic or chemical synthesis.

Any polymer peptide may be used as long as it can be incorporated into cosmetics, and examples thereof include collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, and keratin. Polymer peptides can be purified and obtained by conventional methods such as a purification method from a culture medium of microorganisms, an enzyme method, or a chemical synthesis method, or can be used after being purified from natural products such as pig or cow dermis or silkworm silk fibers.

The polymeric polysaccharide may be any material as long as it can be incorporated into cosmetics, and examples thereof include hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate or salts thereof (sodium salt, etc.). For example, chondroitin sulfate or a salt thereof can be used after being purified from mammals or fish.

Any sphingolipid can be used as long as it can be incorporated into cosmetics, and examples thereof include ceramide, phytosphingosine, and sphingoglycolipid. Sphingolipids can be purified by conventional methods or obtained by chemical synthesis from mammals, fish, shellfish, yeast, or plants.

In the cosmetic composition of the present invention, in addition to the above essential ingredients, other ingredients normally formulated in cosmetics may be blended as necessary.

Other ingredients that may be added include fats and oils, humectants, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, bactericides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, A blood circulation accelerator, a cooling agent, an antiperspirant, purified water, etc. are mentioned.

Examples of the oil and fat component include ester oils, hydrocarbon oils, silicone oils, fluorine oils, animal fats and vegetable oils.

Examples of ester oils include glyceryl tri-2-ethylhexanoate, cetyl 2-ethylhexanoate, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, and stearic acid. Butyl, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl myristate, isostearyl myristate, isostearyl palmitate, octyldodecyl myristate, isocetyl isostearate, diethyl sebacate, adipine Diisopropyl acid, isoalkyl neopentanoate, tri(capryl, capric acid) glyceryl, trimethylolpropane tri2-ethylhexanoate, trimethylolpropane triisostearate, pentaelislitol tetra2-ethylhexanoate , Cetyl caprylate, decyl laurate, hexyl laurate, decyl myristate, myristyl myristate, cetyl myristate, stearyl stearate, decyl oleate, cetyl ricinooleate, isostea laurate Lil, isotridecyl myristate, isocetyl palmitate, octyl stearate, isocetyl stearate, isodecyl oleate, octyldodecyl oleate, octyldodecyl linoleate, isopropyl isostearate, 2-ethylhexanoate Aryl, 2-ethyl stearyl hexanoate, hexyl isostearate, ethylene glycol dioctanoate, ethylene glycol dioleate, propylene glycol dicaprate, di(caprylic, capric acid) propylene glycol, propylene glycol dicaprylate, dicap Neopentyl glycol prinate, neopentyl glycol dioctanoate, glyceryl tricaprylate, glyceryl triundecylate, glyceryl triisopalmitate, glyceryl triisostearate, octyldodecyl neopentanoate, isostearyl octanoate , Octyl isononanoate, hexyldecyl neodecanoate, octyldodecyl neodecanoate, isocetyl isostearate, isostearyl isostearate, octyldecyl isostearate, polyglycerin oleate, polyglycerin isostearate, Triisocetyl citrate, triisoalkyl citrate, triisooctyl citrate, lauryl lactate, myristyl lactate, cetyl lactate, octyldecyl lactate, triethyl citrate, acetyltriethyl citrate, acetyltributyl citrate, trioctyl citrate, dimalate Isostearyl, 2-ethylhexyl hydroxystearate, di2-ethylhexyl succinate, diisobutyl adipate, diisopropyl sebacate, dioctyl sebacate, Cholesteryl stearate, cholesteryl isostearate, cholesteryl hydroxystearate, cholesteryl oleate, dihydrocholesteryl oleate, phyteryl isostearate, phyteryl oleate, 12-stealoyl and esters such as isocetyl hydroxystearate, stearyl 12-stealoylhydroxystearate, and isostearyl 12-stealoylhydroxystearate.

Examples of hydrocarbon-based fats and oils include hydrocarbon-based fats and oils such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybuden, microcrystalline wax, and vaseline.

Examples of silicone oils include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane/methylcetyloxysiloxane copolymer, dimethylsiloxane/methylstealoxysiloxane copolymer, alkyl Modified silicone oil, amino modified silicone oil, etc. are mentioned.

Examples of fluorine-based fats and oils include perfluoropolyether and the like.

Animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, birdflower oil, soybean oil, corn oil, rapeseed oil, algae oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil , cottonseed oil, palm oil, kukui nut oil, wheat germ oil, rice germ oil, shea butter, moonshine colostrum, marker damian nut oil, meadowsweet oil, egg yolk oil, beef tallow, horse oil, mink oil, orange raffia oil, jojoba oil , animal or plant fats and oils such as candelilla wax, carnaba wax, liquid lanolin, and hydrogenated castor oil.

Examples of the moisturizer include water-soluble low-molecular moisturizers, fat-soluble molecular moisturizers, water-soluble polymers, and oil-soluble polymers.

Examples of water-soluble low-molecular moisturizers include serine, glutamine, sorbitol, mannitol, pyrrolidone-sodium carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B (polymerization degree n = 2 or more), polypropylene Glycol (polymerization degree n = 2 or more), polyglycerol B (polymerization degree n = 2 or more), lactic acid, lactate, etc. are mentioned.

Cholesterol, cholesterol ester, etc. are mentioned as a fat-soluble low-molecular moisturizer.

Examples of water-soluble polymers include carboxyvinyl polymer, polyaspartate, tragacanth, xanthan gum, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, water-soluble chitin, chitosan, dextrin, and the like. can

Examples of the fat-soluble polymer include polyvinylpyrrolidone/eicosene copolymer, polyvinylpyrrolidone/hexadecene copolymer, nitrocellulose, dextrin fatty acid ester, and high molecular silicone.

Examples of the emollient agent include long-chain acyl glutamic acid cholesteryl ester, hydroxystearic acid cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid, lanolin fatty acid cholesteryl ester, and the like.

Examples of the surfactant include nonionic surfactants, anionic surfactants, cationic surfactants, and amphoteric surfactants.

Nonionic surfactants include self-emulsifying glycerin monostearate, propylene glycol fatty acid esters, glycerin fatty acid esters, polyglycerin fatty acid esters, sorbitan fatty acid esters, POE (polyoxyethylene) sorbitan fatty acid esters, POE sorbitan fatty acid esters, POE Glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE·POP (polyoxyethylene·polyoxypropylene) copolymer, POE·POP alkyl ether, polyether modified silicone, lauric acid alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.

Anionic surfactants include fatty acid soaps, alpha-acyl sulfonates, alkyl sulfonates, alkyl allyl sulfonates, alkyl naphthalene sulfonates, alkyl sulfates, POE alkyl ether sulfates, alkyl amide sulfates, alkyl phosphates, POE alkyl phosphates, and alkyl amide phosphates. , alkyloylalkyl taurine salts, N-acylamino acid salts, POE alkyl ether carboxylate salts, alkyl sulfosuccinic acid salts, sodium alkyl sulfoacetate, acylated hydrolyzed collagen peptide salts, perfluoroalkyl phosphate esters, and the like. .

As the cationic surfactant, alkyltrimethylammonium chloride, stearyltrimethylammonium chloride, stearyltrimethylammonium bromide, cetostearyltrimethylammonium chloride, distearyldimethylammonium chloride, stearyldimethylbenzylammonium chloride, behenyltrimethylammonium bromide, chloride Benzalkonium, stearic acid diethylaminoethylamide, stearic acid dimethylaminopropylamide, lanolin derivative quaternary ammonium salt, etc. are mentioned.

Amphoteric surfactants include carboxybetaine type, amidebetaine type, sulfobetaine type, hydroxysulfobetaine type, amide sulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, amideamine type, etc. An amphoteric surfactant etc. are mentioned.

As organic and inorganic pigments, silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium-coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine blue, chromium oxide, chromium hydroxide, calamine and complexes thereof; Polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenolic resin, fluororesin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene/styrene copolymer, organic pigments such as silk powder, cellulose, CI pigment yellow and CI pigment orange, and composite pigments of these inorganic pigments and organic pigments.

Examples of the organic powder include metal soaps such as calcium stearate; Alkyl phosphate metal salts, such as zinc sodium cetylrate, zinc laurylate, and calcium laurylate; polyvalent metal salts of acyl amino acids such as N-lauroyl-beta-alanine calcium, N-lauroyl-beta-alanine zinc, and N-lauroyl glycine calcium; polyvalent metal salts of amide sulfonic acids such as N-lauroyl-taurine calcium and N-palmitoyl-taurine calcium; N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoylizine, N-alpha-paritoylolnithine, N-alpha-lauroylarginine, N-alpha-hardened beef fatty acid acylarginine, etc. -acyl basic amino acids; N-acyl polypeptides such as N-lauroyl glycyl glycine; alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid; polyethylene, polypropylene, nylon, polymethyl methacrylate, polystyrene, divinylbenzene/styrene copolymer, tetrafluoroethylene, and the like.

Examples of UV absorbers include para-aminobenzoic acid, ethyl para-aminobenzoate, amyl para-aminobenzoate, octyl para-aminobenzoate, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butylphenyl salicylate, homomenthyl salicylate, and benzyl cinnamate. , paramethoxycinnamic acid-2-ethoxyethyl, paramethoxycinnamic acid octyl, diparamethoxycinnamic acid mono-2-ethylhexane glyceryl, paramethoxycinnamic acid isopropyl, diisopropyl-diisopropylcinnamic acid ester mixture, uro Cannic acid, ethyl urocanate, hydroxymethoxybenzophenone, hydroxymethoxybenzophenonesulfonic acid and its salts, dihydroxymethoxybenzophenone, dihydroxymethoxybenzophenone sodium disulfonate, dihydroxybenzophenone , tetrahydroxybenzophenone, 4-tert-butyl-4'-methoxydibenzoylmethane, 2,4,6-trianilino-p-(carbo-2'-ethylhexyl-1'-oxy)-1 ,3,5-triazine, 2-(2-hydroxy-5-methylphenyl)benzotriazole, etc. are mentioned.

Bactericides include hinokitiol, triclosan, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, zincophylthione, benzalkonium chloride, photosensitizer So No. 301, mononitroguacol sodium, undecyrenic acid, etc. are mentioned.

Examples of antioxidants include butylhydroxyanisole, propyl gallic acid, and elisorbic acid.

Examples of the pH adjuster include citric acid, sodium citrate, malic acid, sodium malate, fumaric acid, sodium fumalate, succinic acid, sodium succinate, sodium hydroxide, and sodium monohydrogenphosphate.

Examples of alcohol include higher alcohols such as cetyl alcohol.

In addition, the blending components that may be added are not limited to these, and any of the above ingredients can be blended within a range not impairing the objects and effects of the present invention, but 0.01 to 5% by weight percent or 0.01 to 3% based on the total weight. Can be formulated in % weight percentage.

When the formulation of the present invention is a lotion, paste, cream or gel, animal fiber, vegetable fiber, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide as a carrier component can be used

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additional chlorofluorohydrocarbon, propane / May contain a propellant such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butyl glycol oil, fatty acid esters of glycerol, polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar or tracanth and the like may be used.

When the formulation of the present invention is surfactant-containing cleansing, as carrier components, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolin derivatives, or ethoxylated glycerol fatty acid esters may be used.

In addition, the present invention relates to a drug delivery composition for treating an immune disease or a metabolic disease, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

The term "drug delivery" as used herein refers to any means or actions of loading and delivering a drug to a composition according to the present invention in order to deliver the drug to a specific organ, tissue, cell or organelle.

In the present invention, the drug delivery composition may deliver a drug to one or more organs selected from the group consisting of the stomach, small intestine, large intestine, lung, liver, kidney, and brain, but is not limited thereto.

Hereinafter, a preferred embodiment is presented to aid understanding of the present invention. However, the following examples are provided to more easily understand the present invention, and the content of the present invention is not limited by the following examples.

[Example]

Example 1. Isolation of vesicles derived from Lactobacillus plantarum

In order to isolate Lactobacillus plantarum derived vesicles (extracellular vesicle; EV), the Lactobacillus plantarum strain was inoculated into MRS (de Man-Rogosa and Sharpe) medium and absorbance at 200 rpm at 37 °C ( OD _600nm ) was cultured until it became 1.0 to 1.5, and then inoculated and cultured in LB (Luria Bertani) medium. Thereafter, the culture medium containing the cells was collected and centrifuged at 10,000 g at 4° C. for 20 minutes to obtain a supernatant from which the cells were removed. The obtained supernatant was again filtered through a 0.22 μm filter, and the filtered supernatant was concentrated to a volume of 50 mL or less using a 100 kDa Pellicon 2 Cassette filter membrane (Merck Millipore) and a MasterFlex pump system (Cole-Parmer). . The concentrated supernatant was filtered again using a 0.22 μm filter to separate Lactobacillus plantarum-derived vesicles. In the following examples, experiments were conducted using the separated vesicles.

Example 2. Confirmation of pharmacokinetic properties of vesicles derived from Lactobacillus plantarum

Lactobacillus plantarum-derived vesicles were orally administered, and distribution in the body was confirmed by the following method to confirm pharmacokinetic properties such as absorption and distribution patterns.

Lactobacillus plantarum-derived vesicles labeled with the phosphor Cy7 were orally administered to mice, and after 0, 1, 3, 6, 24, or 48 hours, invasion into various organs was evaluated. Fluorescent signals were observed for the entire mouse using an optical imaging device (Davinch-Invivo Fluoro Chemi (western); Davinch-K). In addition, in order to evaluate the distribution pattern to major organs after parcel administration, brain, blood, heart, lung, liver, stomach, spleen, small intestine, large intestine, and kidney were collected and optical imaging equipment (Davinch-Invivo Fluoro Chemi Western);Davinch-K) was used to observe fluorescence signals.

As shown in Figure 1a, it was confirmed that the vesicles were absorbed systemically at 1 hour after administration, which lasted until 24 hours after administration, and were mostly excreted after 48 hours.

In addition, as shown in Figure 1b, it was absorbed into the stomach 1 hour after administration of the vesicles, distributed in the stomach, small intestine, large intestine, and lungs 3 hours later, and distributed in the liver, kidneys, and brain 6 hours after administration. . On the other hand, it was confirmed that the distribution continued in various organs until 24 hours after the administration of the vesicles, and most of them were excreted after 48 hours.

Example 3. Confirmation of apoptosis inhibitory effect of Lactobacillus plantarum-derived vesicles on apoptosis caused by pathogenic causative factors

Biological causative factors that cause disease are recognized by cell pattern recognition receptors (prr) to form inflammasomes, which induce pyroptosis as well as inflammation through inflammatory mediators. It induces cell invasion and accelerates apoptosis, resulting in organ function damage. In the present invention, the therapeutic efficacy of Lactobacillus plantarum-derived vesicles against apoptosis caused by biological factors was evaluated.

To this end, skin epithelial cells (HaCaT cells) were treated with Staphylococcus aureus-derived vesicles (SaEV) and Lactobacillus plantarum-derived vesicles (Lp EV), which are pathogenic factors, by concentration, and the epithelial cell killing effect was compared.

As a result, as shown in Figure 2a, apoptosis was induced in a dose-dependent manner of Staphylococcus aureus-derived vesicles.

In contrast, as shown in FIG. 2B , apoptosis of epithelial cells was not induced by Lactobacillus plantarum-derived vesicles.

As shown in Figure 3a, when Lactobacillus plantarum-derived vesicles were treated before epithelial cells were treated with Staphylococcus aureus-derived vesicles, epithelial cell death was suppressed in a dose-dependent manner of Lactobacillus plantarum-derived vesicles. .

In addition, as shown in FIG. 3B, when the Lactobacillus plantarum-derived vesicles were treated simultaneously with the administration of Staphylococcus aureus-derived vesicles to epithelial cells, the death of epithelial cells was dependent on the treatment capacity of the Lactobacillus plantarum-derived vesicles. this was suppressed

Through the above results, it was found that apoptosis caused by biological pathogenic factors was significantly inhibited by Lactobacillus plantarum-derived vesicles.

Example 4. Confirmation of the therapeutic effect of Lactobacillus plantarum-derived vesicles in mice with disease induced by dextran diet

With recent changes in dietary patterns, many people are consuming diets that contain large amounts of sugar (sucrose). When sucrose is ingested, certain bacteria that have the dextransucrase enzyme in the oral cavity produce dextran using sucrose as a raw material. Dextran produced by ingesting foods containing a large amount of sucrose is not digested by enzymes in the intestine and moves to the large intestine, causing colitis.

Accordingly, in order to evaluate the therapeutic efficacy of Lactobacillus plantarum-derived vesicles for metabolic dysfunction induced by sucrose, 2.5% DSS (dextran sulfate sodium) was orally administered to mice (8-week-old C57BL/6N male mice) for 5 days. ) to create a colitis model (see FIG. 4). In addition, Lactobacillus plantarum-derived vesicles (50 μg/mouse) were administered together with DSS every day until day 5 and then once every other day, and anatomical changes in the large intestine were evaluated on day 10 of dextran administration. .

As a result, as shown in Figures 5a and 5b, the colon length of the colitis mouse model was significantly reduced compared to the colon length of normal mice (control). In addition, when Lactobacillus plantarum-derived vesicles were administered to mice administered with DSS, the length of the large intestine was restored to the normal mouse level.

Through the above results, it was found that Lactobacillus plantarum-derived vesicles significantly suppressed and improved anatomical changes for colitis caused by dextran, an abnormal metabolite of sucrose.

Example 5. Confirmation of the therapeutic effect of Lactobacillus plantarum-derived vesicles on neurotrophin gene expression related to neurogenesis

When neural stem cells and nerve cells are repeatedly exposed to various mental stresses, it is known that their neurogenesis ability is reduced. Neurotrophin is a growth factor protein group that plays a key role in the development of neural stem cells as well as the survival and function of differentiated neurons. In mammalian brains, including humans, nerve cells are usually formed in the fetal period, but neural stem cells exist in the hippocampus and striatum areas, and thus adult neurogenesis occurs. Representative examples of neurotrophins related to the survival and function of neural stem cells and nerve cells include brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT), NT4/5, and nerve growth factor (NGF). have. Among them, BDNF is present in the central nervous system and the peripheral nervous system, and is a protein that not only increases the survival and synapse formation of neurons present in the brain and peripheral nervous system through the TrkB receptor, but also induces proliferation and differentiation of neural stem cells.

Therefore, in order to evaluate the therapeutic effect of Lactobacillus plantarum-derived vesicles on the survival and function of neural stem cells and neurons by mental stress, hippocampal neurons (HT22 cells) were cultured in Dulbecco's modified Eagles (DMEM) medium. and glucocorticoid (GC 400 ng/mL) was administered to inhibit the expression of neurotrophic factor genes. In addition, Lactobacillus plantarum-derived vesicles (20 μg/mL) were simultaneously treated with nerve cells to evaluate therapeutic efficacy. As a method for evaluating gene expression, cells were lysed using a lysis buffer, genes were extracted, and gene expression was quantified using RT-PCR. The degree of gene expression was evaluated using primers specific for total Bdnf (tBdnf), Bdnf1, Bdnf4, and Ngf mRNAs. Specific sequences of the primers are listed in Table 1 below. The group not treated with GC was denoted as CON, and the control vehicle denotes the group without vesicles.

mRNA sequence sequence number total Bdnf F: TGGCTGACACTTTTTGAGCAC One R: GTTTGCGGCATCCAGGTAAT 2 Bdnf1 F: CCTGCATCTGTTGGGGAGAC 3 R: GCCTTGTCCGTGGACGTTTA 4 Bdnf4 F: CAGAGCAGCTGCCTTGATGTT 5 R: GCCTTGTCCGTGGACGTTTA 6 Ngf F: AGCATTCCCTTGACACAG 7 R: GGTCTACAGTGATGTTGC 8 Sirt1 F: GATCCTTCAGTGTCATGGTTC 9 R: ATGGCAAGTGGCTCATCA 10 Hdac2 F: GGGACAGGCTTGGTTGTTTC 11 R: GAGCATCAGCAATGGCAAGT 12 Creb1 F: GAGGCAGCAAGAGAATGTCG 13 R: CCAGTCCATTCTCCACCGTA 14

As a result, as shown in FIG. 6, the expression of the tBdnf, Bdnf1, Bdnf4, and Ngf genes was significantly suppressed when the neurons were treated with cortical hormone. In contrast, the tBdnf, Bdnf1, Bdnf4, and Ngf gene expressions suppressed by corticosteroids were improved to normal levels or higher when Lactobacillus plantarum-derived vesicles were administered.

Through the above results, it was found that Lactobacillus plantarum-derived vesicles induce nerve production by increasing neurotrophic factor gene expression.

Example 6. Confirmation of the therapeutic effect of Lactobacillus plantarum-derived vesicles on senescence-related gene expression

When repeatedly exposed to various stresses, oxidative stress causes damage to genes within cells, resulting in cell aging and abnormal cell death. Sirtuin is a key signaling protein that maintains cell homeostasis following cell damage under stress. Among sirtuin proteins, Sirtuin 1 (Sirt1) is present in the nucleus and cytoplasm, and is known as an anti-aging protein that increases cell survival by treating genetic damage caused by stress as a histone deacetylase.

Accordingly, in order to evaluate the therapeutic effect of Lactobacillus plantarum-derived vesicles on cellular senescence, hippocampal neurons (HT22 cells) were treated with Lactobacillus plantarum-derived vesicles by the method described in Example 5, and then Restoration of the expression of the citruin gene, which is suppressed by neocortical hormone, was evaluated. The gene expression level was evaluated using specific primers for Sirt1, Hdac2 (Histone Deacetylase 2), or Creb1 (CAMP Responsive Element Binding Protein 1).

As a result, as shown in FIG. 7 , Sirt1 gene expression was significantly suppressed in nerve cells by adrenal cortical hormone, which was restored to a normal level or higher when Lactobacillus plantarum-derived vesicles were administered. Through the above results, it can be seen that Lactobacillus plantarum-derived vesicles increase Sirt1 gene expression to suppress cell aging and cell death caused by gene damage caused by various stresses.

Example 7. Confirmation of the effect of Lactobacillus plantarum-derived vesicles on maintaining cell homeostasis against metabolic stress

Cellular senescence is defined as the loss of cell division ability due to repetitive physical, chemical, biological, or psychological stress. As cells age due to repetitive stress, their ability to regenerate decreases, resulting in aging-related diseases. In particular, cells activate AMPK (AMP-activated protein kinase) protein as an intracellular signal transduction pathway in metabolic stress situations where ATP production is low to induce cellular homeostasis, thereby inhibiting cell aging and death. . That is, AMPK signaling suppresses metabolic disorders that occur during energy depletion through mechanisms such as autophagy.

Thus, an experiment was performed to evaluate whether Lactobacillus plantarum-derived vesicles (Lp EV) affect cellular senescence through AMPK activation in cells. In order to evaluate the AMPK activity according to the concentration of Lactobacillus plantarum-derived vesicles in vitro, muscle cells (L6 myotube cells) were injected with Lactobacillus plantarum-derived vesicles at concentrations of 0, 0.1, 1, or 10 μg/ml treated for 1 hour. As controls, insulin (insulin, 1 μM), which promotes aging, and metformin (50 mM), which inhibits aging, were used. After treatment with the drug, the difference in the amount of pAMPK, which is an important indicator in AMPK signaling, was measured by Western blotting. First, DMEM serum-free medium in which cells were dispensed 2 x 10 ⁶ each was placed in a 60 mm cell culture petri dish and cultured for 2 hours. Thereafter, Lactobacillus plantarum-derived vesicles were treated at concentrations of 0, 0.1, 1, and 10 μg/mL for 1 hour, and control insulin (1 uM) and metformin (50 mM) were also treated for 1 hour. To proceed with the cell lysis assay, the Petri dish treated with the sample was placed on ice, and the supernatant was suctioned, and then 5 mL of cold PBS buffer was added and washed twice. After adding 10 uL of protease/phosphatase inhibitor to 1 mL of lysis buffer and mixing well, 100 μL of cell lysis buffer was added to each dish and incubated on ice for 5 minutes. After detaching the cells with a scraper, they were transferred to a 1.5 mL microtube and vortexing and incubation on ice were repeated for 20 minutes for 1 minute each. Thereafter, centrifugation was performed at 14,000 rpm, 10 minutes, and 4° C., and 5 μL and 70 μL of the dissolved sample supernatant were transferred to two new 1.5 mL microtubes, respectively. The microtube to which 5 μL was transferred was stored at -20°C, and 16.5 μL of 5X sample buffer was added to the microtube to which 70 μL was transferred and then boiled at 100°C for 5 minutes. Boiled samples were stored at -20 °C. To perform BCA quantitative analysis, 1.5 mL microtubes containing 5 μL of the dissolved sample supernatant were taken out at room temperature, vortexed with 20 μL of sterile distilled water, and then spun down. After dissolving bovine serum albumin (BSA) in sterile distilled water to a concentration of 2 mg/mL, stocks of 2, 1, 0.5, 0.25, 0.125, 0.0625, 0.03125, and 0 mg/mL were prepared by diluting by half. In a 96-well polystyrene plate, 25 μL of each BSA concentration was put into three wells, and 25 μL of the dissolved sample was also put into one well. After mixing 8 mL of BCA Protein Assay Reagent A and 160 μL of BCA Protein Assay Reagent B, 200 μL each was added to the well. After reacting for 30 minutes in a 37° C. incubator, absorbance was measured at 562 nm using a SpectraMax M3 microplate reader (Molecular Devices, USA). For Western blotting, a 10% gel was prepared in the process of Tris-glycine SDS-polyacrylamide gel electrophoresis, and 50 μg of protein was quantified and loaded for each sample. After transferring to a nitrocellulose membrane, it was blocked with 5% skim milk, diluted in 5% skim milk at a ratio of 1:400 for AMPKα antibody, 1:400 for phospho-AMPKα antibody, and 1:1,000 for β-actin antibody. It was mixed with the membrane overnight. After washing three times for 5 minutes with 1X PBST (PBS containing 0.05% tween-20) solution, anti-rabbit IgG and HRP-linked antibodies were diluted at a ratio of 1:1,000 and mixed with the membrane for 1 hour. After washing three times with 1X PBST solution for 5 minutes each, a solution of West-Q Chemiluminescent Substrate Kit solution A and solution B in a 1:1 ratio was sufficiently sprayed on the membrane, and the band was checked with a Chemidoc device.

As a result, as shown in FIG. 8, phosphorylation of AMPK (pAMPK) was inhibited by the control drug insulin and increased by metformin. In addition, when Lactobacillus plantarum-derived vesicles were treated, the expression of pAMPK increased in a dose-dependent manner.

Through the above results, it can be seen that Lactobacillus plantarum-derived vesicles enhance cell viability by increasing cell homeostasis against metabolic stress through AMPK signal activation.

Example 8. Confirmation of the effect of Lactobacillus plantarum-derived vesicles on the secretion of inflammatory mediators by pathogenic factors

In order to confirm the effect of Lactobacillus plantarum-derived vesicles on regulating the inflammatory response, mouse macrophage cell line Raw 264.7 was pretreated with Lactobacillus plantarum-derived vesicles at concentrations of 0.01, 0.1, and 1 μg/mL and cultured, The secretion of IL-6 and TNF-α, which are inflammatory mediators, was measured in macrophages stimulated by pathogenic vesicles, E. coli-derived vesicles (E. coli EV). More specifically, Raw 264.7 cells were seeded in a 48-well plate, treated with Lactobacillus plantarum-derived vesicles diluted in DMEM serum-free medium, incubated for 12 hours, and then E. coli-derived vesicles were again at a concentration of 1 μg/mL. After treatment with , it was further cultured for 12 hours. The secretion amount of IL-6 and TNF-α was measured by ELISA method in the culture medium obtained by the above method.

For ELISA analysis, Capture antibody was diluted in PBS, dispensed in 50 μl each according to the working concentration in a 96-well polystyrene plate, and reacted overnight at 4 °C. After washing twice with 100 μl of PBST (PBS containing 0.05% tween-20) solution, 100 μl of RD (PBST containing 1% BSA) solution was dispensed and blocked for 1 hour at room temperature. , After washing again with 100 μl of PBST twice, the sample and standard were dispensed in 50 μl each according to the concentration and reacted at room temperature for 2 hours. After washing again with 100 μl of PBST twice, the detection antibody was diluted in RD, dispensed by 50 μl according to the working concentration, and reacted at room temperature for 2 hours. And again, after washing twice with 100 μl of PBST, Strpetavidin-HRP was diluted 1/200 in RD, dispensed in 50 μl, and reacted at room temperature for 30 minutes. Finally, after washing three times with 100 μl of PBST, dispensing 50 μl of a 1:1 mixture of TMB substrate and 0.04% hydrogen peroxide solution, wait for color development, and when color development proceeds after 5 to 20 minutes, 1 M The reaction was stopped by dispensing 50 μl of the sulfuric acid solution, and absorbance was measured at 450 nm using a Synergy™ HT multi-detection microplate reader (BioTek, USA).

As a result, as shown in FIGS. 9A and 9B , it was confirmed that the secretion of IL-6 and TNF-α by E. coli-derived vesicles was decreased in a dose-dependent manner in the samples treated with Lactobacillus plantarum-derived vesicles. Through the above results, it was confirmed that the inflammatory response induced by pathogenic bacteria-derived vesicles can be effectively inhibited using Lactobacillus plantarum-derived vesicles.

The description of the present invention described above is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting.

<110> MD Healthcare Inc. <120> Extracellular Vesicles Derived from Lactobacillus plantarum and use it <130> MP21-115P2 <150> KR 10-2021-0072078 <151> 2021-06-03 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> total Bdnf_F <400> 1 tggctgacac ttttgagcac 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> total Bdnf_R <400> 2 gtttgcggca tccaggtaat 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> Bdnf1_F <400> 3 cctgcatctg ttggggagac 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> Bdnf1_R <400> 4 gccttgtccg tggacgttta 20 <210> 5 <211> 21 <212> DNA <213> artificial sequence <220> <223> Bdnf4_F <400> 5 cagagcagct gccttgatgt t 21 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> Bdnf4_R <400> 6 gccttgtccg tggacgttta 20 <210> 7 <211> 18 <212> DNA <213> artificial sequence <220> <223> Ngf_F <400> 7 agcattccct tgacacag 18 <210> 8 <211> 18 <212> DNA <213> artificial sequence <220> <223> Ngf_R <400> 8 ggtctacagt gatgttgc 18 <210> 9 <211> 21 <212> DNA <213> artificial sequence <220> <223> Sirt1_F <400> 9 gatccttcag tgtcatggtt c 21 <210> 10 <211> 18 <212> DNA <213> artificial sequence <220> <223> Sirt1_R <400> 10 atggcaagtg gctcatca 18 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> Hdac2_F <400> 11 gggacaggct tggttgtttc 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> Hdac2_R <400> 12 gagcatcagc aatggcaagt 20 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> Creb1_F <400> 13 gaggcagcaa gagaatgtcg 20 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> Creb1_R <400> 14 ccagtccatt ctccaccgta 20

Claims (15)

A pharmaceutical composition for preventing or treating immune or metabolic diseases, containing vesicles derived from Lactobacillus plantarum as an active ingredient.
According to claim 1,
The immune disease or metabolic disease is at least one gastrointestinal disease selected from the group consisting of gastritis, peptic ulcer, celiac disease, and inflammatory bowel disease;
one or more oral diseases selected from the group consisting of gingivitis, periodonditis, and caries;
at least one female vaginal disease selected from the group consisting of candida vaginitis, atrophic vaginitis, bacterial vaginitis or vaginosis, and trichomonas vaginitis;
At least one liver selected from the group consisting of non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis, liver cirrhosis, cholangitis, cholecystitis, and pancreatitis -biliary-pancreatic disease;
At least one selected from the group consisting of chronic obstructive pulmonary disease, chronic interstitial pneumonitis, emphysema, bronchopulmonary dysplasia, and idiopathic pulmoniary fibrosis lung disease;
from the group consisting of hyperinsulinemia, dyslipidemia, arrhythmia, atherosclerosis, angina, metabolic syndrome, myocardial infarction, stroke, and cardiomyopathy selected one or more cardiovascular diseases;
one or more kidney diseases selected from the group consisting of glomerulonephritis and chronic nephropathy;
Atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, Gout, sarcopenia, osteoporosis, Paget's disease, one or more musculoskeletal disorders selected from the group consisting of rheumatoid arthritis and osteoarthritis; and
Mild cognitive impairment, dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease, Amyotrophic lateral sclerosis (ALS), Batten disease ), Kearns-Sayre syndrome (KSS), chronic progressive external ophthalmoplegia (CPEO), mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), MERRF syndrome ( myoclonic epilepsy with ragged-red fibers (MERRF), neurogenic weakness with ataxia and retinitis pigmentosa (NARP), Leigh syndrome (LS), mitochondrial recessive ataxia syndrome (MIRAS syndrome), Dementia with Lewy Bodies (DLB), Multi-Infarct Dementia (MID), frontotemporal lobar degeneration (FTLD), Pick's disease, Corticobasal degeneration (CBD), progressive supranuclear palsy palsy (PSP), age-related macular degeneration (AMD), dysosmia, deafness, and diabetic retinopathy. A pharmaceutical composition, characterized in that selected from the group.
According to claim 1,
Characterized in that the vesicles have an average diameter of 10 to 1000 nm, the pharmaceutical composition.
According to claim 1,
The pharmaceutical composition, characterized in that the vesicles are separated from the Lactobacillus plantarum culture medium.
According to claim 1,
The pharmaceutical composition, characterized in that the vesicles are separated from food prepared by adding Lactobacillus plantarum.
According to claim 1,
The pharmaceutical composition, characterized in that the vesicles are naturally or artificially secreted from Lactobacillus plantarum.
A food composition for preventing or improving immune or metabolic diseases, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.
According to claim 7,
The immune disease or metabolic disease is at least one gastrointestinal disease selected from the group consisting of gastritis, peptic ulcer, celiac disease, and inflammatory bowel disease;
one or more oral diseases selected from the group consisting of gingivitis, periodonditis, and caries;
at least one female vaginal disease selected from the group consisting of candida vaginitis, atrophic vaginitis, bacterial vaginitis or vaginosis, and trichomonas vaginitis;
At least one liver selected from the group consisting of non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis, liver cirrhosis, cholangitis, cholecystitis, and pancreatitis -biliary-pancreatic disease;
At least one selected from the group consisting of chronic obstructive pulmonary disease, chronic interstitial pneumonitis, emphysema, bronchopulmonary dysplasia, and idiopathic pulmoniary fibrosis lung disease;
from the group consisting of hyperinsulinemia, dyslipidemia, arrhythmia, atherosclerosis, angina, metabolic syndrome, myocardial infarction, stroke, and cardiomyopathy selected one or more cardiovascular diseases;
one or more kidney diseases selected from the group consisting of glomerulonephritis and chronic nephropathy;
Atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, Gout, sarcopenia, osteoporosis, Paget's disease, one or more musculoskeletal disorders selected from the group consisting of rheumatoid arthritis and osteoarthritis; and
Mild cognitive impairment, dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease, Amyotrophic lateral sclerosis (ALS), Batten disease ), Kearns-Sayre syndrome (KSS), chronic progressive external ophthalmoplegia (CPEO), mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), MERRF syndrome ( myoclonic epilepsy with ragged-red fibers (MERRF), neurogenic weakness with ataxia and retinitis pigmentosa (NARP), Leigh syndrome (LS), mitochondrial recessive ataxia syndrome (MIRAS syndrome), Dementia with Lewy Bodies (DLB), Multi-Infarct Dementia (MID), frontotemporal lobar degeneration (FTLD), Pick's disease, Corticobasal degeneration (CBD), progressive supranuclear palsy palsy (PSP), age-related macular degeneration (AMD), dysosmia, deafness, and diabetic retinopathy. A food composition, characterized in that selected from the group consisting of the group.
According to claim 7,
The food composition, characterized in that the vesicles are separated from the Lactobacillus plantarum culture medium.
According to claim 7,
The food composition, characterized in that the vesicles are separated from the food prepared by adding Lactobacillus plantarum.
According to claim 7,
Characterized in that the vesicles are naturally or artificially secreted from Lactobacillus plantarum, food composition.
A pharmaceutical composition for preventing or treating aging, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.
A food composition for preventing or improving aging, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.
A cosmetic composition for preventing or improving skin aging, comprising vesicles derived from Lactobacillus plantarum as an active ingredient.
A drug delivery composition for the treatment of immune or metabolic diseases, comprising Lactobacillus plantarum-derived vesicles as an active ingredient.

Images