KR20220156276A - Preparation method for producing avian species producing Adiponectin and target proteins - Google Patents

Abstract

The present invention relates to an avian species capable of mass-producing human adiponectin or a foreign protein in the oviduct of the avian species, and a preparation method thereof. In the gene-edited avian species produced by the preparation method of the present invention, human adiponectin is specifically expressed in oviduct cells and accumulates in egg white of avian eggs. Therefore, a high concentration of adiponectin in the form of HMW with high biological activity can be produced through purification.

Description

Method for producing algae producing adiponectin and target proteins {Preparation method for producing avian species producing Adiponectin and target proteins}

The present invention relates to algae capable of mass-producing human exogenous proteins in the oviduct of birds and a method for preparing the same.

Adiponectin is a 30 kDa protein identified in adipose tissue and consists of four main components: a signal peptide, a variable domain, a collagenous domain, and a globular domain similar to C1q of complement. In vivo, a basic trimer is formed through the binding between the double globular domains, and a hexamer (medium molecular weight, MMW form) in which two trimers are non-covalently bonded and 18 mers (which consist of six trimers) high molecular weight, HMW form). Type 2 diabetic patients caused by insulin resistance have reduced blood adiponectin concentrations, and administration of recombinant adiponectin to mice induced with high blood sugar by a high-fat diet improved blood insulin concentration, decreased blood sugar, and Decomposition of fat was confirmed, and the correlation between obesity and diabetes and adiponectin was identified. The in vivo molecular mechanism of adiponectin is mainly mediated by the adiponectin receptors AdipoR1 and AdipoR2 present in musculoskeletal system and hepatocytes. It is known that these signaling pathways act in the same way in hepatocytes, and inhibition of gluconeogenesis is mediated by AMPK in hepatocytes. As a result, obesity and diabetes are alleviated, and these physiological activity mechanisms are shown to be more strongly mediated by the HMW form of adiponectin than the monomer form of adiponectin. Recently, the possibility of using adiponectin as a treatment for diabetes has emerged, but recombinant adiponectin derived from prokaryotic cells such as E.coli is known to have no in vivo functionality because it does not have post-translational processes and cannot be multimerized. In addition, mass production of human cell-derived cells has a very high production cost of about $4,000 per 1mg, so it is virtually impossible to use adiponectin at a concentration (0.1g/kg) for diabetes treatment. .

Embryos of birds such as chickens, quails, and pheasants develop and hatch from eggs, and eggs contain abundant nutrients essential for the development of animals. In particular, chicken eggs have a very high protein content, but their production cost is low, so they are used as a great food resource for mankind. The egg white component of an egg is secreted by the oviduct of a chicken and contains about 4 g of protein, half of which is occupied by one kind of protein, ovalbumin. In addition, since there are only about 10 major proteins constituting egg white protein, it is advantageous for the production of foreign proteins through the transcriptional regulation of ovalbumin gene, and has the characteristics of easy separation and purification. In addition, chicken egg white proteins are known to be similar to human-derived proteins in the formation of sugar chain structures through post-translational processes. Therefore, it has been regarded as a very ideal bioreactor animal for the production of antibodies, hormone preparations, and functional proteins. In fact, production and development of anti-cancer antibodies and therapeutic agents from transgenic chickens have been reported, and some of them are marketed as pharmaceuticals through pharmaceutical companies. With the recent development of gene editing technology, which is widely used at the cell level and for animals and plants, the chicken bioreactor technology has built a much more efficient mass production system than before, and the proteins produced from it have entered the stage of practical use. .

Some avian species, including chickens, naturally show high blood sugar (300 mg/dl), and due to this characteristic, multiplexing of adiponectin in blood is formed at a high level. In this case, adiponectin in blood is mostly present in the form of HMW. The present invention attempted to produce gene-edited algae that produce human recombinant adiponectin due to the characteristics of these algal species. To this end, a gene sequence expressing human adiponectin was inserted into the start codon position of the chicken ovalbumin gene using gene editing technology to produce (Knock-in) primordial germ cell (PGC), and 2.5 Germline chimera were formed by co-injection into the blood vessels of one-year-old chicken embryos. and eggs containing human adiponectin were produced through spawning of the produced G1 females. The content of human adiponectin in egg white was 1.5-4.5 mg/ml, and one egg contained 34-90 mg of human adiponectin. When only HMW adiponectin was detected, it was detected at a level of 0.3 mg to 1.2 mg/ml (6 to 24 mg/egg). The production cost of ordinary eggs is about $0.1 per egg, and the production cost of 1 mg of human adiponectin from eggs is $0.001 to 0.03, and HMW adiponectin is $0.1 to 0.3, which is much cheaper than mammalian cell production systems. Therefore, egg-derived human adiponectin is expected to have a very high commercialization potential as a therapeutic agent.

Korean Patent Publication No. 10-2011-0135724

The present invention relates to a method for producing a gene-edited bird that mass-produces a human foreign protein in the oviduct of the avian, wherein human adiponectin or a foreign gene is inserted into an endogenous ovalbumin locus to express the foreign protein introduced in the fallopian tube. It is an object of the present invention to provide a method for producing algae and gene-edited algae prepared using the same.

1. A plasmid containing a gRNA targeting intron 1 of ovalbumin and a Cas9 coding sequence; and a plasmid containing ovalbumin intron 1 and exon 2, a secretion signal peptide coding sequence, and a target protein coding sequence.

2. The composition for preparing gene-edited algae according to 1 above, wherein the target protein is human adiponectin.

3. The gene according to 1 above, wherein the secretion signal peptide is a secretion signal peptide of at least one protein selected from the group consisting of ovalbumin, ovotransferrin, ovomucoid, ovomucin, ovoinhibitor, cystatin, avidin, and lysozyme. Composition for the production of editorial algae.

4. transducing the composition of any one of 1 to 3 above into avian germ cells; and transplanting the transduced gametes into avian embryos to obtain germline chimera birds.

5. The step of obtaining a heterozygous offspring generation according to 4 above, by crossing the germline chimera bird with a wild type bird; Method for producing algae further comprising the step of obtaining a homozygous progeny by crossing the heterozygous progeny.

6. The method for producing birds according to 4 above, wherein the birds are chickens, quails, pheasants, turkeys, and ducks.

7. transducing the composition of any one of 1 to 3 above into avian germ cells; transplanting the transduced gametes into avian embryos to obtain germline chimera birds; and purifying the target protein from the egg white of the bird.

8. The step of obtaining a heterozygous offspring generation according to 7 above, by crossing the germline chimera bird with a wild type bird; The method of producing a target protein, further comprising obtaining a homozygous offspring by crossing the heterozygous progeny, wherein the target protein is purified from egg white of the homozygous offspring.

9. The method for producing a target protein according to 7 above, wherein the bird is chicken, quail, pheasant, turkey, or duck.

10. The method for producing a protein of interest according to 7 above, wherein the target protein is human adiponectin.

The gene-edited algae manufacturing method for mass-producing human foreign protein in the oviduct of the present invention can produce algae in which the human foreign protein is specifically expressed in oviduct cells and accumulated in the egg white of avian eggs, and through purification of the egg white protein. Foreign proteins with high biological activity can be produced in high concentrations.

Figure 1 shows a donor plasmid and gRNA vector for producing cOVA adiponectin knock-in chickens, and shows a process of transducing them and selecting only individuals whose genes have been edited through antibiotic treatment.
Figure 2 analyzes the characteristics of gene-edited eggs (wild-type and cOVA AdipoQ KI eggs) produced from G1 chickens.
Figure 3 shows the results of tissue immunostaining, separation of egg whites, SDS-PAGE, and ELISA to confirm the production of human adiponectin in the chicken oviduct. It was confirmed that a multimerized form of human adiponectin with high biological activity was accumulated in egg white in large quantities.
FIG. 4 shows the result of confirming the fraction containing high molecular weight adiponectin by purifying human adiponectin from cOVA adiponectin knock-in chicken eggs and performing size exclusion chromatography.

Hereinafter, the present invention will be described in detail.

The present invention provides a plasmid containing a gRNA targeting intron 1 of ovalbumin and a Cas9 coding sequence; and a plasmid containing ovalbumin intron 1 and exon 2, a secretion signal peptide coding sequence, and a target protein coding sequence; a composition for preparing gene-edited algae may be provided.

"Ovalbumin" is a protein that makes up more than half of egg white, is encoded by the OVAL gene (Gene ID: 396058), and is commonly used as an allergen that sensitizes the immune response. Ovalbumin protein consists of 385 amino acids and consists of 8 exons, and the start codon (ATG) is located in exon 2.

The target gRNA is an RNA sequence including 20 guide sequences complementary to a target sequence, for introducing a foreign gene at a specific location on the genome, and is complementary to the base sequence at a specific location to introduce the foreign gene on the genome. Composed of a nucleotide sequence, the gRNA targeting intron 1 of ovalbumin is a single guide RNA targeting intron 1 of the ovalbumin gene, that is, the nucleotide sequence of the intron between exon 1 and exon 2. It can be used to specify the position where the target protein coding sequence of is to be introduced, and the target sequence is as long as it is included in the base sequence of the intron region No. 1 of ovalbumin, and the position of the base sequence is not limited. This is because ovalbumin has a start codon in exon 2, so no frame-shift problem occurs regardless of the introductory site of intron 1. Accordingly, the gRNA sequence may be, for example, GCTGTACATAGTACCATGCA (SEQ ID NO: 1), but , but is not limited thereto.

Cas9 serves as a genetic scissors to cut out the nucleotide sequence at a specific position designated according to the gRNA, and intron 1 of endogenous ovalbumin, which is a nucleotide sequence complementary to the target gRNA, and intron 1 of ovalbumin of the plasmid It plays a role in cutting (break) the part. Accordingly, the plasmid can be linearized and inserted into a specific position of ovalbmin, that is, intron 1 of ovalbmin.

Insertion into intron 1 of ovalbumin containing the plasmid may be performed by NHEJ (non-homologous end joining), but is not limited thereto.

The plasmid containing the ovalbumin intron 1 and exon 2, the secretion signal peptide coding sequence, and the target protein coding sequence may further include a poly A region necessary for terminating translation of adiponectin, and the poly A portion terminates translation If it is a signal sequence required to do so, the type is not limited, and may be, for example, a BGH poly A region, but is not limited thereto.

A "secretion signal peptide" is a peptide that transmits a signal for protein secretion, and the sequence of the signal peptide is different depending on the type of protein to be secreted, and the sequence is not limited as long as it is a peptide that transmits a signal for protein secretion.

The secretion signal peptide may be located at the N-terminus or C-terminus of the gene encoding the target protein, and is preferably located at the N-terminus to secrete the target protein.

Secretion efficiency may vary depending on the secretion signal peptide, and for example, ovalbumin, ovotransferrin, ovomucoid, ovomucin, ovoinhibitor, cystatin, avidin, and lysozyme may be used as the secretion signal peptide. Since ovalbumin is the main protein constituting egg white (about 55% of the total protein) and has high secretion efficiency, the secretion signal peptide SEQ ID NO: 2 from ovalbumin or SEQ ID NO: 5 from lysozyme can be used, Other egg white protein secretion signal peptides may also be used, but are not limited thereto.

"Target protein" is a protein to be mass-produced by overexpression, and may be any protein that can be used as a biopharmaceutical, and if it is suitable for the purpose of transformation, its type, origin, sequence, etc. are not limited. For example, if the purpose of transformation is to produce a specific product, the target protein may be a protein encoded by a gene necessary for the production of that product, and if the purpose of transformation is to confer resistance to a specific substance, disease, etc., the target protein is It may be a protein necessary for conferring resistance, and if the purpose of transformation is to produce a disease animal model, the target protein may be a protein causing the disease or a protein necessary for causing the disease. In addition to these, proteins suitable for the purpose of transformation may be used.

The target protein may specifically be human adiponectin, but is not limited thereto.

The human adiponectin is composed of four main elements (signal peptide, variable domain, collagen domain, and globular domain), and in vivo, as a bond between globular domains, trimer, hexamer (MMW form) or 18 mer (HMW form) exists as It has been reported that patients with type 2 diabetes caused by insulin resistance have a reduced concentration of adiponectin in the blood, and that obesity and diabetes are alleviated by administration of adiponectin. In addition, compared to monomeric adiponectin, HMW form of adiponectin is known to have a higher level of physiological activity to alleviate obesity and diabetes.

The bird refers to a transgenic bird into which a gene that allows a target protein to be expressed in the fallopian tube and secreted into egg white is introduced, and may be, for example, chicken, quail, pheasant, turkey, duck, etc. There are only about 10, so it is easy to purify after production of recombinant protein, low production cost, high yield, protein sugar chain trait similar to human, and breeding and improvement to enable mass production of eggs, so that protein can be mass-produced From the side, it may preferably be chicken.

Since birds such as general wild birds and poultry, including chickens, are naturally hyperglycemic, a high level of multiplexing of adiponectin is formed in the blood. Therefore, if the adiponectin gene is overexpressed in a bird having a hyperglycemic state, it has the advantage of being able to mass-produce high molecular weight adiponectin (HMW type) with high physiological activity.

A plasmid is a means for expressing a specific gene, may mean an expression vector, and may include, but is not limited to, a plasmid vector, a cosmid vector, a bacteriophage vector, and a viral vector.

The composition for producing gene-edited algae comprises a gRNA targeting ovalbumin intron 1, a plasmid containing Cas9 (hereinafter referred to as plasmid 1) and ovalbumin intron 1 and exon 2, a secretion signal peptide coding sequence and a target protein coding sequence The plasmid (hereinafter referred to as plasmid 2) may be included together or composed of each plasmid, and the method for preparing a gene-edited bird using the composition is to treat plasmid 1 or 2 simultaneously or sequentially to introduce it into germ cells. The order is not limited to processing plasmid 1 followed by 2, processing 2 followed by 1, or processing 1 and 2 at the same time.

In addition, the present invention can provide a method for producing gene-edited algae.

The method for producing algae includes transducing the above-described composition for preparing gene-edited algae into avian germ cells; and transplanting the transduced germ cell into an avian embryo to obtain a germline chimera bird.

The type of avian germ cell is not limited as long as the avian germ cell is a cell suitable for the production of transgenic animals through germ cell development physiology and genome control. For example, primordial germ cell (PGC) Since long-term in vitro culture is possible and germline chimera can be efficiently produced, it may preferably be a primitive germ cell.

The transduced germ cell can be transplanted into an avian embryo to produce a germline chimera bird, for example, it can be transplanted into the aorta of an avian embryo.

Transduction can be performed by a general plasmid or vector introduction method known in the art, for example, a method using genetic scissors, calcium phosphate precipitation method, calcium chloride treatment method, protoplast fusion method, sonoporation method , electroporation, encapsulation of polynucleotides in liposomes, microinjection, RBC ghost fusion, or lipofection using liposomes, but It is not limited thereto.

The algae production method of the present invention comprises the steps of crossing a germline chimera bird with a wild type bird to obtain a heterozygous offspring generation; and obtaining a homozygous progeny by crossing the heterozygous progeny.

The heterozygous progeny have both the trait characteristics of the germline chimera bird and the wild-type bird, and produce a protein encoded by an exogenous gene, but the production amount corresponds to half of the homozygous progeny. Therefore, an algae prepared by crossing heterozygous progeny to obtain homozygous progeny may be more suitable for producing large amounts of protein.

The bird refers to a transgenic bird into which a gene that allows a target protein to be expressed in the fallopian tube and secreted into egg white is introduced, and may be, for example, chicken, quail, pheasant, turkey, duck, etc. There are only about 10, so it is easy to purify after production of recombinant protein, low production cost, high yield, protein sugar chain trait similar to human, and breeding and improvement to enable mass production of eggs, so that protein can be mass-produced From the side, it may preferably be chicken.

In addition, the present invention can provide a method for producing a target protein.

The manufacturing method comprises the steps of transducing the above-described composition for preparing gene-edited algae into avian germ cells; transplanting the transduced gametes into avian embryos to obtain germline chimera birds; and purifying the target protein from the egg white of the bird.

The transduction step and the step of obtaining germline chimera birds are the same as described above.

The step of purifying the target protein may be performed by a general protein purification method known in the art, and may be specifically performed by chromatography, for example, ion exchange chromatography, size exclusion chromatography, affinity It may be chromatography, but is not limited thereto.

The target protein may be, for example, human adiponectin, but is not limited thereto.

Human adiponectin has the potential to be used as a treatment for obesity, diabetes and metabolic diseases, but in the case of prokaryotic cell-derived recombinant adiponectin, it is known that it has no in vivo functionality because it does not have post-translational processes and multiplexing is impossible. The production cost of adiponectin is very high, making it difficult to use adiponectin as a treatment for diabetes. In the case of using the method for producing the target protein of the present invention, that is, the method for producing adiponectin, it is possible to mass-produce adiponectin (HMW form), a polymer with high physiological activity, based on a hyperglycemic state in which adiponectin multiplexing in blood can be formed at a high level. has the advantages of

Hereinafter, the present invention will be described in detail by examples. The following examples are intended to illustrate the present invention, but the content of the present invention is not limited to the following examples.

Example

1. Experiment method

(1) Construction of CRISPR/Cas9 expression plasmid

An all-in-one CRISPR/Cas9 plasmid targeting intron 1 of the chicken ovalbumin gene (cOVA) (gRNA recognition site (SEQ ID NO: 1): 5'-GCTGTACATAGTACCATGCA-3', and PAM sequence: GGG) was constructed. The CRISPR kit used to construct the CRISPR/Cas9 plasmid was provided by Takashi Yamamoto (Addgene, #1000000054) and the backbone CRISPR/Cas9 plasmid was provided by Feng Zhang (Addgene, #62988). Sense and antisense oligonucleotides were designed to insert guide RNA (gRNA) sequences into the backbone CRISPR/Cas9 plasmid and synthesized at Bionics. Annealing of sense and antisense oligonucleotides was performed under thermal cycling conditions of 95 °C for 30 sec, 72 °C for 2 min, 37 °C for 2 min, and 25 °C for 2 min.

(2) Construction of donor plasmid

For insertion of the target gene into the chicken OVA intron 1, a donor plasmid containing OVA intron 1, OVA exon 2, lysozyme signal peptide coding sequence, chickenized human adiponectin coding sequence and BGH poly A site (SEQ ID NO: 3 to 9) were synthesized at Bioneer (Table 1). Thereafter, a puromycin resistance gene having a cytomegalovirus (CMV) promoter was cloned and inserted into the synthesized donor plasmid. The donor plasmid has an OVA 1 intronic sgRNA recognition site for linearization.

order
number composition 5' → 3' 3 cOVA intron #1 CTACCATAGAGTACCCTGCATGGTACTATGTACAGCATTCCATCCTTACATTTTCACTGTTCTGCTGTTTGCTCTAG 4 cOVA exon 2 ACAACTCAGAGTTCACC 5 lysozyme signal peptide ATGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCCTGCCCCTGGCTGCTCTGGGG 6 Chickenized human adiponectin GGTCACGATCAGGAAACCACGACACAGGGACCCGGAGTTCTGCTTCCACTGCCCAAAGGGGCCTGTACAGGATGGATGGCGGGCATCCCAGGTCATCCGGGCCATAATGGGGCCCCCGGGAGAGATGGGAGAGATGGCACTCCTGGCGAGAAGGGTGAGAAGGGAGATCCAGGTTTAATTGGACCTAAGGGAGACATTGGTGAAACCGGCGTACCTGGGGCTGAGGGCCCCCGGGGGTTTCCGGGGATCCAAGGAAGGAAAGGTGAACCAGGAGAAGGTGCCTATGTCTACCGCTCAGCATTCAGTGTGGGATTGGAGACATACGTTACTATACCCAACATGCCTATAAGATTTACTAAGATCTTCTACAATCAGCAAAACCACTATGATGGAAGCACTGGCAAATTCCACTGCAACATTCCTGGACTGTATTACTTTGCTTACCACATCACAGTTTATATGAAGGATGTGAAGGTCAGCCTATTCAAGAAAGACAAAGCAATGTTGTTCACGTACGATCAGTATCAGGAGAACAATGTGGATCAGGCAAGCGGCTCCGTGCTCCTGCATCTGGAGGTGGGAGACCAAGTCTGGCTGCAGGTGTATGGAGAAGGAGAGAGAAATGGCCTCTACGCTGACAACGACAATGACTCTACCTTTACAGGCTTTCTTCTCTACCACGACACCAACTGA 7 BGH Poly A CTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGA 8 CMV promoter CGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATT 9 Puromycin resistance gene ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGAGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA

(3) Cultivation of chicken primordial germ cells (PGC)

White Leghorn (WL) PGCs contain 20% FBS (Thermo Fisher Scientific), 2% chicken serum (Thermo Fisher Scientific), 1x nucleosides (MilliporeSigma), 2 mM L-glutamine, 1x nonessential amino acids, beta-mercaptoethanol, They were maintained and passaged in knockout DMEM supplemented with 10 mM sodium pyruvate, 1x antibiotic-antimycotic (Thermo Fisher Scientific) and human basic fibroblast growth factor (10 ng/ml; Komabiotech). Chicken PGCs were cultured in an incubator at 37 °C under an atmosphere of 5% CO ₂ and 60–70% relative humidity. PGCs were subcultured on mitomycin-inactivated mouse embryonic fibroblasts at intervals of 5 to 6 days via gentle pipetting.

(4) PGC transduction and puromycin selection for target gene insertion

For genome editing of chicken PGCs, donor plasmid (6 μg) and CRISPR/Cas9 plasmid (6 μg) were co-introduced into cultured PGCs (1× ^{10 5} cells) with 12 μl Lipofectamine 2000 reagent suspended in 1 ml Opti-MEM. Nine hours after transduction, the transduction mixture was replaced with PGC culture medium. Puromycin (1 μg/ml) was added to the culture medium 1 day after transduction, and the selection period was 2 days.

(5) production of cOVA adiponectin (AdipoQ) knock-in (KI) chickens

To prepare cOVA AdipoQ KI chickens, a window was cut at the sharp end of Korean Ogye recipient eggs, and more than 3000 cOVA AdipoQ genome edited WL PGCs were transfected into HH (Hamburger and Hamilton) stage 14-17 recipient embryos. It was transplanted into the dorsal aorta. Egg windows were sealed with paraffin film and incubated with the tips pointed until hatching. After sexual maturity, sperm from male recipient chickens were evaluated by breed-specific PCR, and chickens with WL sperm were mated with wild-type WL female chickens. Germline-chimeric chickens were identified based on offspring feather color and subsequent genomic DNA analysis.

(6) Detection of cOVA AdipoQ KI amplicon in KI chicks

To identify altered alleles in chicken PGCs and cOVA AdipoQ KI chickens, genomic DNA was prepared using specific primers for the cOVA intron 1 and the AdiponQ coding sequence (SEQ ID NOs: 10 and 11; F: 5'-GGCAACTGGCTTCTGGGACAGT-3', R : 5'-TCTCTCCCATCTCTCCCGGG-3') was analyzed using knock-in PCR. All reactions were performed in the same conditions with a total PCR volume of 20 μl containing 100 ng of genomic DNA, 10x PCR buffer, 0.4 μl dNTPs (10 mM each), 10 pM of each primer and 0.5 U Taq polymerase (Bionics) under the following thermocycling conditions. It was performed: 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 sec, 60 °C for 30 sec, 72 °C for 30 sec, and finally 72 °C for 5 min. For sequencing, amplicons were annealed to pGEM-T Easy Vector and sequenced using an ABI Prism 3730XL DNA Analyzer. Sequences were compared to the assembled genome using BLAST.

(7) Comparison of external characteristics of cOVA adiponectin (AdipoQ) knock-in (KI) chicken eggs and WT eggs

Each egg was collected 20 from 21 wild-type (WT) cOVA AdipoQ KI females for weight measurement and 17 from 15 wild-type cOVA AdipoQ KI females for egg white volume measurement. Weight was measured using an electronic balance and volume was measured using a 100 mL mass cylinder.

(8) Tissue immunostaining for human adiponectin

Oviduct magnum segments from adult egg-laying (over 35 weeks) WT and cOVA adipoQ chickens were washed vigorously with phosphate-buffered saline (PBS) and then fixed in 4% buffered paraformaldehyde. Segments were then embedded in paraffin blocks and paraffin-embedded fallopian tube tissues were sectioned at 6 μm thickness. The deparaffinized and rehydrated samples were immersed in sodium citrate buffer at pH 6.0 for heat-induced epitope retrieval (HIER) and then heated in a microwave oven for 10 minutes. For tissue immunostaining analysis, samples were permeabilized with 0.1% Triton X-100 in PBS for 5 minutes and incubated with 0.1% normal goat serum for 1 hour to block non-specific binding. Samples were sequentially stained overnight at 4 °C by indirect labeling using the following primary antibodies; Recombinant anti-human adiponectin antibody (1:100 dilution; ab75989, Abcam). To detect the primary antibody, FITC was conjugated to an anti-rabbit IgG antibody for 1 h at RT. These fluorescent samples were counterstained with DAPI and observed under a confocal microscope (LSM-700; Carl Zeiss).

(9) SDS-PAGE and Coomassie blue staining

For Coomassie blue staining, egg whites (EW) from cOVA AdipoQ chicken and WT chicken were collected, diluted 40-fold in DW, and mixed with an equal volume of 2x Laemmli sample buffer. Serum proteins were separated on 15% SDS-PAGE. After separation, the gels were stained with Coomassie blue staining solution for 2 h at room temperature and desalted overnight using desalting buffer.

(10) Western blot analysis of cOVA AdipoQ KI chicken egg white

For Western blotting, cOVA AdipoQ chicken egg whites were harvested, diluted 10-fold in DW and mixed with an equal volume of 2-fold Laemmli sample buffer. Serum proteins were separated on 15% SDS-polyacrylamide gels to obtain unambiguous detection. The digested proteins were transferred to a Hybond 0.45 μm polyvinylidene difluoride (PVDF) membrane (GE Healthcare Life Sciences) and blocked with 5% BSA for 1 hour at room temperature. The membrane was incubated overnight in the presence of goat anti-human adiponectin antibody (Abcam) diluted in blocking buffer (1:1000) and then incubated for 1 hour with HRP-conjugated secondary antibody diluted 1:5000. Immune activation proteins were visualized using the ECL Western blot detection system (GE Healthcare Life Sciences). Wild-type WL chicken egg white was used as a control.

(11) Enzyme-Linked Immunosorbent Assay (ELISA)

Concentrations of human adiponectin (hAdiponectin) and HMW human adiponectin were measured using human total adiponectin and HMW adiponectin enzyme-linked immunosorbent assay (ELISA) kits (RnD systems, DRP300 and DHWAD0) according to the manufacturer's instructions. Concentrations of total adiponectin and HMW adiponectin were determined by comparison to the optical density of the standard protein.

(12) cOVA adiponectin KI Human adiponectin extraction and purification from chicken eggs

For human adiponectin purification, egg-egg white was added to an equal volume of 40% ammonium sulfate. The mixture was stirred overnight at 4 °C and then centrifuged at 3000 g for 1 hour at 4 °C. The pellet was resuspended in 4 volumes of 20 mM Tris-HCl, 50 mM NaCl buffer (pH 8.0) to the original egg white volume. Samples were then filtered through a 0.22 μm bottle filter. The sample was loaded onto a 5ml HiTrap Q column (GE Healthcare Bio-Sciences) and the protein was eluted with a 100ml gradient 20mM Tris-HCl, 1M NaCl buffer (pH 8.0). Proteins were further purified and fractionated by size exclusion chromatography (SEC) using a HiLoad Superdex 75 column (GE Healthcare Bio-Sciences) pre-equilibrated with 20 mM Tris-HCl, 50 mM NaCl buffer (pH 8.0). angry

2. Experimental results

(1) cOVA adiponectin knock-in chicken production

In this study, we tried to produce human adiponectin (hAdiponectin) by utilizing the endogenous promoter of ovalbumin (OVA) gene, a protein expressed in oviduct-specifically, to produce gene-edited chickens that produce human adiponectin (hAdiponectin). To this end, the gene sequence including the start codon region of exon 2 of the OVA gene, the signal peptide sequence, the human adiponectin coding sequence, the CMV promoter and the puromycin resistance gene was converted into OVA using chicken primordial germ cells (PGCs). It was inserted into the intronic sequence between exon 1 and exon 2 of the gene. The vector used for this purpose is a guide RNA (gRNA) expression vector capable of editing intron 1 of chicken OVA (cOVA) to induce an indel mutation in the intron sequence, and a donor plasmid (cOVA; adiponectin; CMV; PuroR) By adding a bait sequence recognizable to the gRNA, linearization of the donor plasmid was induced and it was designed to be inserted into the genome by non-homologous end joining (NHEJ) (Fig. 1A). PGCs were co-transduced with these vectors and the CMV::EGFP vector expressing GFP, cells were selected through puromycin treatment (FIG. 1B), and the selected cells were genotyped (FIG. 1C). The selected cells were injected into recipient embryos to form germline chimeras, and G1 KI chickens were constructed through mating of germline chimeras (Figures 1D and 1E). The gDNA of the produced chickens was confirmed through PCR testing, and only individuals with gene editing were selected (FIG. 1F). Through these results, it can be confirmed that the production of gene-edited chickens in which the gene expressing human adiponectin was specifically inserted into the chicken OVA gene locus was successfully performed.

(2) Characteristics of cOVA adiponectin heterogeneous knock-in chicken eggs

Gene-edited eggs from G1 chickens were characterized. For characterization, three G1 females (over 35 weeks of age), W0090, W0141, and W0149, during spawning were used, and their genotypes were verified (Fig. 2A). Eggs from the corresponding females were found to be smaller and lighter in size than wild-type (WT) eggs (Fig. 2B, 2E). The weights of 21 WT eggs and 20 cOVA AdipoQ KI eggs were 60.32 ± 5.40 g and 39.19 ± 3.85 g, respectively (Figure 2E). The egg white properties of cOVA AdipoQ KI eggs were composed of a gelatinous material and were opaque in color compared to WT eggs (Fig. 2C). The egg white volume of 15 WT eggs and 17 cOVA AdipoQ KI eggs were found to be 30.67 ± 2.09 ml and 10.47 ± 1.32 ml, respectively (Fig. 2D, 2F). As a result, eggs derived from gene-edited chickens into which the human adiponectin gene was inserted had lower egg white content, and egg size and weight were smaller than those of WT. This indirectly suggests that the composition of egg white components has changed due to the protein expression of the foreign gene.

(3) Verification of human adiponectin in heterogeneous knock-in chickens

Next, in order to confirm the production of human adiponectin in the chicken oviduct, tissue immunostaining for human adiponectin antibody was performed on the oviduct of laying cOVA adiponectin KI chickens. As a result of the analysis, specific expression of cOVA adiponectin was confirmed in the oviducts of KI chickens, but adiponectin expression was not confirmed in the oviducts of control WT chickens (Fig. 3A). As a result of SDS-PAGE of the egg whites of three G1 females, W0090, W0141, and W0149, a protein distribution pattern different from that of WT was confirmed. In the case of the reduced sample, a large amount was detected in the monomer size of human adiponectin. (Fig. 3B). cOVA adiponectin KI As a result of immunoblotting of chicken egg whites, adiponectin in the form of a high molecular weight (HMW) of 360 kDa or more and adiponectin in the form of a hexamer (150 kDa~) were mainly identified under denaturing conditions other than heat, and adiponectin in the form of a trimeric (60 kDa~ ) and monomeric (28kDa~) forms of adiponectin were also partially detected. Under reducing conditions, it was confirmed that HMW and hexameric adiponectin proteins were accumulated in the form of monomers and trimers (FIG. 3C). For accurate quantification, specific ELISA for total adiponectin and HMW adiponectin was performed. In order to confirm the expression level of adiponectin by individual and time period, ELISA was performed on egg white samples from three female G1 eggs, W0090, W0141, and W0149, which were used in the experiment. As a result of the experiment, it was confirmed that egg white samples from three G1 female eggs, W0090, W0141, and W0149, expressed total adiponectin at a level of 1.7 mg to 4.5 mg/ml at 1, 3, and 5 weeks (Fig. 3D). In addition, as a result of confirming the expression level by specifying only HMW adiponectin, it was confirmed that it was expressed at a level of 0.3 mg to 1.2 mg/ml, which was confirmed to be 17 to 26% of the total (FIG. 3E). When this was converted into egg white sugar content (average 10ml), it was confirmed that the total adiponectin was 17-45mg per egg, and the HMW adiponectin was 3-12mg per egg. Through this result, it was confirmed that the expression of human adiponectin specific to the oviduct of chickens was induced, and it was found that a multimerized form of human adiponectin having high biological activity was accumulated in egg white in large quantities.

(4) human adiponectin purification from cOVA adiponectin knock-in chicken eggs

For the purification of human adiponectin produced from egg white, the protein was precipitated with 40% ammonium sulfate, and the supernatant separated by centrifugation was subjected to primary purification through a HiTrap Q column. In some fractions, it was confirmed that a band-shift occurred under non-reducing and reducing conditions, and the HMW size accumulated to the monomer size, and through this, it was confirmed that it existed in fractions 7, 8, and 9. were (Figs. 4A, 4B). This was subjected to secondary purification through size exclusion chromatography using a Superdex G75 column, and it was confirmed that the purified human adiponectin was mainly distributed in HMW in fractions 4, 5, and 6 (FIGS. 4C and 4D). It was concentrated to finally obtain 21.8 mg/ml of human adiponectin, and it was confirmed that it was mainly formed in the form of hexamer (H) and HMW.

<110> SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION <120> Preparation method for producing avian species producing Adiponectin and target proteins <130> 21P04006 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> RNA <213> artificial sequence <220> <223> gRNA for ovalbumin intron1 <400> 1 gctgtacata gtaccatgca 20 <210> 2 <211> 27 <212> PRT 213 <br> <400> 2 His His Ala Asn Glu Asn Ile Phe Tyr Cys Pro Ile Ala Ile Met Ser 1 5 10 15 Ala Leu Ala Met Val Tyr Leu Gly Ala Lys Asp 20 25 <210> 3 <211> 77 <212> DNA 213 <br> <400> 3 ctaccataga gtaccctgca tggtactatg tacagcattc catccttaca ttttcactgt 60 tctgctgttt gctctag 77 <210> 4 <211> 17 <212> DNA 213 <br> <400> 4 acaactcaga gttcacc 17 <210> 5 <211> 54 <212> PRT 213 <br> <400> 5 Ala Thr Gly Ala Gly Gly Thr Cys Thr Thr Thr Gly Cys Thr Ala Ala 1 5 10 15 Thr Cys Thr Thr Gly Gly Thr Gly Cys Thr Thr Thr Gly Cys Thr Thr 20 25 30 Cys Cys Thr Gly Cys Cys Cys Cys Thr Gly Gly Cys Thr Gly Cys Thr 35 40 45 Cys Thr Gly Gly Gly Gly 50 <210> 6 <211> 693 <212> DNA <213> artificial sequence <220> <223> chickenized human adiponectin <400> 6 ggtcacgatc aggaaaccac gacacaggga cccggagttc tgcttccact gcccaaaggg 60 gcctgtacag gatggatggc gggcatccca ggtcatccgg gccataatgg ggcccccggg 120 agagatggga gagatggcac tcctggcgag aagggtgaga agggagatcc aggtttaatt 180 ggacctaagg gagacattgg tgaaaccggc gtacctgggg ctgagggccc ccgggggttt 240 ccggggatcc aaggaaggaa aggtgaacca ggagaaggtg cctatgtcta ccgctcagca 300 ttcagtgtgg gattggagac atacgttact atacccaaca tgcctataag atttactaag 360 atcttctaca atcagcaaaa ccactatgat ggaagcactg gcaaattcca ctgcaacatt 420 cctggactgt attactttgc ttaccacatc acagtttata tgaaggatgt gaaggtcagc 480 ctattcaaga aagacaaagc aatgttgttc acgtacgatc agtatcagga gaacaatgtg 540 gatcaggcaa gcggctccgt gctcctgcat ctggaggtgg gagaccaagt ctggctgcag 600 gtgtatggag aaggagagag aaatggcctc tacgctgaca acgacaatga ctctaccttt 660 acaggctttc ttctctacca cgacaccaac tga 693 <210> 7 <211> 232 <212> DNA <213> artificial sequence <220> <223> BGH poly A <400> 7 ctagagctcg ctgatcagcc tcgactgtgc cttctagttg ccagccatct gttgtttgcc 60 cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa 120 atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg 180 ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg ga 232 <210> 8 <211> 655 <212> DNA <213> artificial sequence <220> <223> CMV promoter <400> 8 cgatgtacgg gccagatata cgcgttgaca ttgattattg actagttat aatagtaatc 60 aattacgggg tcattagttc atagcccata tatggagttc cgcgttacat aacttacggt 120 aaatggcccg cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta 180 tgttcccata gtaacgccaa tagggacttt ccattgacgt caatgggtgg actatttacg 240 gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 300 cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt 360 tcctacttgg cagtacatct acgttatagt catcgctatt accatggtga tgcggttttg 420 gcagtacatc aatgggcgtg gatagcggtt tgactcacgg ggatttccaa gtctccaccc 480 cattgacgtc aatgggagtt tgttttggca ccaaaatcaa cgggactttc caaaatgtcg 540 taacaactcc gccccattga cgcaaatggg cggtaggcgt gtacggtggg aggtctatat 600 aagcagagct ctctggctaa ctagagaacc cactgcttac tggcttatcg aaatt 655 <210> 9 <211> 600 <212> DNA <213> artificial sequence <220> <223> puromycin resistant gene <400> 9 atgaccgagt acaagcccac ggtgcgcctc gccacccgcg acgacgtccc cagggccgta 60 cgcaccctcg ccgccgcgtt cgccgactac cccgccacgc gccacaccgt cgatccggac 120 cgccacatcg agcgggtcac cgagctgcaa gaactcttcc tcacgcgcgt cgggctcgac 180 atcggcaagg tgtgggtcgc ggacgacggc gccgcggtgg cggtctggac cacgccggag 240 agcgtcgaag cgggggcggt gttcgccgag atcggcccgc gcatggccga gttgagcggt 300 tcccggctgg ccgcgcagca acagatggaa ggcctcctgg cgccgcaccg gcccaaggag 360 cccgcgtggt tcctggccac cgtcggagtc tcgcccgacc accagggcaa gggtctgggc 420 agcgccgtcg tgctccccgg agtggaggcg gccgagcgcg ccggggtgcc cgccttcctg 480 gagacctccg cgccccgcaa cctccccttc tacgagcggc tcggcttcac cgtcaccgcc 540 gacgtcgagg tgcccgaagg accgcgcacc tggtgcatga cccgcaagcc cggtgcctga 600 600 <210> 10 <211> 22 <212> DNA <213> artificial sequence <220> <223> adipon Q-F primer <400> 10 ggcaactggc ttctggggaca gt 22 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> adipon Q-R primer <400> 11 tctctcccat ctctcccggg 20

Claims (10)

a plasmid containing a gRNA targeting intron 1 of ovalbumin and a Cas9 coding sequence; and
A composition for preparing gene-edited algae comprising: a plasmid containing ovalbumin intron 1 and exon 2, a secretion signal peptide coding sequence, and a target protein coding sequence.
The composition for preparing gene-edited algae according to claim 1, wherein the target protein is human adiponectin.
The gene editing alga according to claim 1, wherein the secretion signal peptide is a secretion signal peptide of at least one protein selected from the group consisting of ovalbumin, ovotransferrin, ovomucoid, ovomucin, ovoinhibitor, cystatin, avidin and lysozyme. composition for manufacture.
Transducing the composition of any one of claims 1 to 3 into an avian germ cell; and transplanting the transduced gametes into avian embryos to obtain germline chimera birds.
The method according to claim 4, comprising the step of crossing the germline chimera bird with a wild type bird to obtain a heterozygous progeny generation; Method for producing algae further comprising the step of obtaining a homozygous progeny by crossing the heterozygous progeny.
The method according to claim 4, wherein the bird is chicken, quail, pheasant, turkey, or duck.
Transducing the composition of any one of claims 1 to 3 into an avian germ cell;
transplanting the transduced gametes into avian embryos to obtain germline chimera birds; and
A method for producing a target protein comprising purifying the target protein from the egg white of the bird.
The method according to claim 7, comprising the step of crossing the germline chimera bird with a wild type bird to obtain a heterozygous progeny generation; Further comprising the step of crossing the heterozygous progeny generation to obtain a homozygous progeny generation,
The method of producing a target protein, wherein the purification of the target protein is performed from the egg white of the homozygous progeny bird.
The method according to claim 7, wherein the bird is chicken, quail, pheasant, turkey, or duck.
The method according to claim 7, wherein the target protein is human adiponectin.

Images