KR20220150025A - Saccharomyces cerevisiae with excellent brewing capacity from traditional liquor - Google Patents

Abstract

The present invention relates to yeast with excellent brewing capacity isolated from traditional liquor. More specifically, a Saccharomyces cerevisiae MBY/L3412 (KCTC 14545BP) strain of the present invention has excellent alcohol production ability and excellent emission of waxy flavor components and sweet and fruity flavor components.

Description

Yeast with excellent brewing performance isolated from traditional liquor {Saccharomyces cerevisiae with excellent brewing capacity from traditional liquor}

The present invention relates to a yeast with excellent brewing performance isolated from traditional liquor, Saccaromyces cerevisiae of the present invention ( Saccaromyces cerevisiae ) The MBY/L3412 (KCTC 14545BP) strain has excellent alcohol production ability and excellent divergence of waxy flavor components and sweet & fruity flavor components.

Beer uses yeast, malt, and hops as the main ingredients, and among them, yeast is known to be involved in alcoholic fermentation and production of fermentation by-products, affecting overall taste, aroma, and quality of beer.

The fermenting yeast used in beer is Saccharomyces cerevisiae , and various flavors and aromas are produced during the fermentation process depending on the strain. In Korea, such native yeast for beer production is being developed, but it is reported that the domestic yeast developed so far is inferior in quality and stability compared to imported yeast. As a result, most domestic breweries use yeast imported from the United States or France or use cheap baker's yeast to manufacture beer, so the diversity of the brewers for beer production is not secured.

Republic of Korea Patent Publication No. 1019980049303 (1998.09.15) discloses a yeast strain Saccharomyces cerevisiae CZ15 (KFCC-10935 No. is described.

In the present invention, it is to select and provide yeast strains suitable for beer production due to excellent ethanol production ability and flavor component production ability.

The present invention is Saccharomyces cerevisiae ( Saccaromyces cerevisiae ) MBY/L3412 (KCTC 14545BP) strain is provided.

In the present invention, the strain is preferably characterized in that it is excellent in alcohol production ability.

In the present invention, the strain is preferably a waxy flavor component ethyl decanoate (ethyl decanoate) and a sweet & fruity flavor component isoamyl acetate (isoamyl acetate) and ethyl octano It is characterized in that the production ability of ate (ethyl octanoate) is excellent.

In the present invention, the strain is characterized in that for beer fermentation.

On the other hand, the present invention provides a method for producing beer, characterized in that using the strain of the present invention as a fermentation strain.

The strain of the present invention, Saccharomyces cerevisiae ( Saccaromyces cerevisiae ) MBY/L3412 (KCTC 14545BP) (indicated as 'HY101' in the experiment below) shows excellent ethanol production ability. Confirmed. In addition, as a result of examining the sedimentation degree and survival rate to evaluate the reuse utilization efficiency of the strain after beer production, it was determined that the sedimentation rate was high and the survival rate was excellent, so that it would be easy to reuse the strain. In addition, the strain of the present invention was excellent in producing ethyl decanoate (ethyl decanoate), a waxy flavor component, and isoamyl acetate (isoamyl acetate), a sweet & fruity flavor component.

1 is a measurement result of ethanol production and reducing sugar consumption of S. cerevisiae 46 points and SafAle S-05 strain.
2 is Fragrance component analysis results from the 1st to 5th day of fermentation of the selection strain and SafAle S-05 strain.
Figure 3 is the result of quantification by preparing a standard curve by diluting ethyl hexanoate (TCI, Japan), ethyl octanoate (TCI, Japan), which are external standard substances, step by step for the fragrance component of the 4th and 5th days, which is the end point of fermentation.
4 is a result of measuring cell viability of selection strains and SafAle S-05 strain.
5 is a result of measurement of fermentation degree of selection strains and SafAle S-05 strain.

In the present invention, it was attempted to isolate yeast for brewing beer, which has excellent brewing ability and dissipation of aroma components, from traditional liquor. In the present invention, it was attempted to select strains by comparing and analyzing alcohol production, aroma components, precipitation, and survival rates with commercial strains.

In the present invention, Saccaromyces cerevisiae has excellent brewing performance and fragrance components compared to the control, which is a commercial yeast ( Saccaromyces cerevisiae ) MBY/L3412 (KCTC 14545BP) (indicated as 'HY101' in the following experiment) strain was finally selected. More specifically, as a result of measuring ethanol and reducing sugar to evaluate the degree of fermentation and comparing it with commercial yeast, it was confirmed that the strain HY101 of the present invention has a faster ethanol production rate. In addition, as a result of examining the degree of sedimentation and the survival rate to evaluate the reuse utilization efficiency of the strain after beer production, it was determined that HY101 had a high sedimentation rate and excellent survival rate, so that it would be easy to reuse the strain. In addition, in the present invention, it was confirmed that the HY101 strain of the present invention exhibited various flavors through the analysis of the aroma component of the fermented wort. From this, it was confirmed that the HY101 strain of the present invention showed superior brewing characteristics and aroma component production ability compared to commercial yeast as a control, and as a result, it was expected to be usefully used in the beer industry.

HY101 strain selected in the present invention Saccharomyces cerevisiae ( Saccaromyces cerevisiae ) It was named MBY/L3412, and a patent was deposited with KCTC (Korean Collection for Type Cultures), and was given an accession number KCTC1454BP.

On the other hand, in the present invention, beer can be prepared by inoculating the strain of the present invention in a medium containing wort as a main component and fermenting it. However, since conventional air technology can be used other than using the strain of the present invention, a specific description regarding beer production will be omitted.

Hereinafter, the content of the present invention will be described in more detail through the following examples. However, the scope of the present invention is not limited only to the following examples, and includes modifications of technical ideas equivalent thereto.

[Example 1: Saccharpmyces Securing genus yeast]

In order to isolate yeast, 6 types of fruit, 1 type of yeast, 2 types of pickles, 2 types of traditional liquor, and 1 type were collected from Hongcheon area. In addition, 22 types of makgeolli were collected, and a total of 2638 yeasts were isolated.

The isolated yeast was inoculated into YPD (10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose) medium using carbon source metabolism characteristics of yeast of the genus Saccharomyces , and inoculated with 2,638 single colonies at 30°C for 48 hours. After culturing with shaking, YPD and YPX (10 g/L yeast extract, 20 g/L peptone, 20 g/L xylose) were punched (Genetix, USA) on a plate medium and incubated at 30°C for 24 hours. Since yeast of the genus Saccharomyces cannot metabolize xylose, a pentose sugar, as a carbon source, it was primarily classified by judging the presence or absence of growth in YPX plate medium.

The sorted strains were analyzed using NL1 and NL4 primers (Table 1, primers used for 26S rRNA amplification), and then the D1/D2 fragment of the 26S rRNA region was amplified, and then nucleotide sequences were analyzed. Using the Basic Local Alignment Search Tool (BLAST) of the National Center for Biotechnology Information (NCBI, USA), it was identified based on the nucleotide sequence homology of the 26S rRNA gene fragment. 46 S. cerevisiae strains were obtained from the isolated yeast.

Primer name Base sequence (5'-3') Amplification site (Kb) NL1 GCATATCAATAAGCGGAGGAAAAG 26S rRNA (1.1-1.2) NL4 GGTCCGTGTTTCAAGACGG 26S rRNA (1.1-1.2)

In order to select yeast with excellent ethanol productivity among the obtained 46 S. cerevisiae , single colonies were inoculated into YPD medium and cultured with shaking at 30° C. for 24 hours. After the cells were recovered by centrifugation of the culture medium, the initial absorbance (OD ₆₀₀ ) was inoculated to 1.0 in wort (Spraymalt amber, Muntons) and cultured at 21° C. for 3 days.

The reducing sugar content was measured using the DNS method. DNS solution was prepared by dissolving 1 g of 3,5-dinitrosalicylic acid and 300 g of potassium sodium tartarate in 2 M NaOH solution so that the final volume was 1 L, and 100 μl of the diluted sample was added to 1 mL of DNS solution. After heating at 100° C. for 10 minutes, absorbance was measured at 570 nm. Ethanol content was determined using high performance liquid chromatography.

As a control, commercially available SafAle S-05 (Fermentis, Belgium) was used, and the top 5 strains with superior alcohol-producing ability than the control were selected.

The experimental results were as shown in FIG. 1 . 1 is a measurement result of ethanol production and reducing sugar consumption of S. cerevisiae 46 points and SafAle S-05 strain. The top 5 strains (HY67, HY72, HY75, HY99, HY101) that showed higher production than SafAle S-05 yeast, which produced 28.92 g/L of ethanol, were selected. All of the selection strains produced ethanol of 32 g/L or more (FIG. 1).

[Example 2: Analysis of flavor characteristics of fermented wort]

For the flavor component analysis of the yeast selected in Example 1, yeast washed with sterilized distilled water was inoculated into wort fermented product (Spraymalt amber, Muntons) at a concentration of 2.5 × 10 ⁵ to 3.0 × 10 ⁶ cells/mL for 24 hours Each sample was collected and fermented for 5 days. All experiments were repeated 3 times.

The volatile aroma components of yeast strains were extracted using solid phase microextraction-gas chromatography/mass spectrometry (SPME-GC/MS). To collect volatile fragrance components, 2 ml of the sample was put into a glass bottle and sealed, and then adsorbed to SPME fiber (50/30 μm DVB/CAR/PDMS) preheated at 250° C. for 30 minutes. The adsorbed fragrance component was thermally desorbed at 200° C. for 5 minutes and analyzed by GC-MS. A non-polar column, DB-5MS, was used, and 1 ml/min of helium was used as the mobile phase.

The experimental results were as shown in FIGS. 2 and 3 . 2 is Fragrance component analysis results from the 1st to 5th day of fermentation of the selection strain and SafAle S-05 strain. In the case of the control SafAle S-05 strain, waxy flavor or whiskey flavor were not measured, but sweet and fruity flavors were mainly measured, but most of the flavor components did not remain on the 5th day of fermentation. On the other hand, the selection strains were mainly analyzed for aroma components showing waxy and sweet and fruity aromas, and it was determined that they would impart good flavor to beer by displaying various aroma components until the end of fermentation (FIG. 2). In particular, high content of Isoamyl acetate and ethyl octanoate, which imparts a sweet flavor to beer with banana and pear flavor, was analyzed in the starter strains compared to the control, and it was judged that they would exhibit sweet fruity flavor characteristics during beer production.

Figure 3 is the result of quantification by preparing a standard curve by diluting ethyl hexanoate (TCI, Japan), ethyl octanoate (TCI, Japan), which are external standard substances, step by step for the fragrance component of the 4th and 5th days, which is the end point of fermentation. Selected yeast produced 2.02±0.03 and 1.91±0.12 mg/L of ethyl octanoate on the 4th and 5th days of fermentation, and showed about 3.4 and 3.7 times superior production ability compared to the control strain, SafAle S-05. On the fourth day of fermentation, 0.81±0.00 mg/L of ethyl hexanoate was produced, which was about 3.5 times superior to that of the control strain, and on the fifth day of fermentation, 0.55±0.01 mg/L was produced, which was about 1.6 times superior to the production capacity. had paid Therefore, it was thought that the selection yeast with excellent production ability of ethyl octanoate and ethyl hexanoate, which are useful flavor components of beer, would show superior flavor characteristics compared to other strains during beer production.

[Example 3: Cell viability investigation]

The purpose of this study was to measure the survival rate of the selection yeast. The selected yeast was inoculated into wort (Spraymalt amber, Muntons) at a concentration of 2.5×10 ⁵ ~3.0×10 ⁶ cells/mL and fermented for 5 days. After fermentation, the cell suspension and 0.01% methylene blue were mixed 1:1. Thus, 10 μl was injected into a hemocytometer, and the number of dead cells and unstained viable cells stained with blue was counted under a microscope and measured using Equation 1 below.

[Equation 1]

4 is a measurement result of cell viability of selection strains and SafAle S-05 strain. After fermentation, the control group showed a survival rate of 82.1 ± 2.36%, and the selection strains showed a survival rate of 88% or more. In particular, the HY101 strain showed a survival rate of 91.87 ± 2.11%, which was about 12% higher than that of the control (FIG. 4). From this, it was determined that the HY101 strain had excellent adaptability to internal and external environmental changes and had strong viability, making it easy to reuse the strain.

[Example 4: Investigation of Fermentation Degree]

Selective yeasts were inoculated into each 500 mL fermenter at a concentration of 2.5 × 10 ⁵ to 3.0 × 10 ⁶ cells/mL, and the supernatant was recovered at 24 hour intervals for 5 days, and the carbon source metabolism and ethanol production were measured to investigate the degree of fermentation. High-performance liquid chromatography was used for the amount of ethanol produced, and the DNS method was used for the amount of carbon source metabolism.

: SafAle S-05,

: HY101,

: HY65,

: HY72,

: HY75,

: HY99). 이중 1일차 발효도 (표 1) 및 5일차 발효도 (표 5)를 별도로 정리해서 하기 표 2 및 3에 기재하였다. 4 is a result of measurement of fermentation degree of selection strains and SafAle S-05 strain (

: SafAle S-05,

: HY101,

: HY65,

: HY72,

: HY75,

: HY99). Among them, the first fermentation degree (Table 1) and the fifth day fermentation degree (Table 5) were separately summarized and described in Tables 2 and 3 below.

strain Ethanol production (g/L) Reducing sugar consumption (g/L) Ethanol yield
(g ethanol/g glucose) SafAle S-05 15.87±0.72 ^a 44.95±1.70 ^a 0.35±0.00 ^a HY101 23.62±0.44 ^b 60.75±0.15 ^b 0.39±0.01 ^ab HY67 25.16±1.00 ^b 64.09±1.06 ^b 0.39±0.01 ^ab HY72 23.11±1.05 ^b 59.50±4.07 ^b 0.39±0.01 ^ab HY75 25.02±1.24 ^b 60.27±2.06 ^b 0.42±0.02 ^b HY99 15.62±0.54 ^a 42.61±2.58 ^a 0.37±0.04 ^a

strain Ethanol production (g/L) Reducing sugar consumption (g/L) Ethanol yield
(g ethanol/g glucose) SafAle S-05 36.03±0.87 ^b 84.65±0.06 ^C 0.43±0.01 ^b HY101 38.00±1.77 ^b 83.92±0.59 ^b 0.45±0.02 ^b HY67 37.80±0.43 ^b 83.97±0.36 ^bC 0.45±0.01 ^b HY72 38.16±0.32 ^b 84.91±0.68 ^bC 0.45±0.00 ^b HY75 31.31±0.25 ^b 80.32±0.62 ^C 0.39±0.00 ^b HY99 36.33±1.34 ^a 83.03±0.64 ^a 0.44±0.02 ^a

On the first day of fermentation, the control strain produced 15.87±0.72 g/L of ethanol, while the other selected strains except for the HY99 strain produced a minimum of 23 g/L of ethanol (Table 2).

On the 5th day of fermentation, there was no significant difference in ethanol production between the selected strain and the control, but the selected strains except for the HY99 strain had a high initial ethanol production rate, so the primary fermentation time of beer could be shortened and the beer production time reduced. It was judged to be a strain capable of doing (Table 3).

[Example 5: Sedimentation Investigation]

Sedimentation was performed by Helm's method. After fermentation, 5-6 g of the yeast strain was suspended in 30 mL calcium sulfate and centrifuged to recover the yeast. 1 g of the recovered yeast was placed in a 15 mL centrifuge tube, 10 mL of buffered calcium sulfate solution was added, and the resultant was allowed to stand for 20 minutes in a water bath at 20° C., then resuspended and the volume of the precipitated cells was measured after 60 minutes. If the amount of yeast sedimentation was 1 mL or more, it was classified as High flocculation type (HF) yeast, if it was between 0.5 and 1 mL, it was classified as Flocculation type (F) yeast, and if it was 0.5 mL or less, it was classified as Low flocculation type (LF) yeast.

Table 4 below shows the measurement results of the sedimentation degree of the selection strain and the SafAle S-05 strain.

strain Sedimentation volume (mL) Flocculation type SafAle S-05 0.5 F HY101 1.0 HF HY67 0.5 F HY72 0.8 F HY75 0.4 LF HY99 1.0 HF

The control showed a yeast precipitation amount of 0.5 mL, and was classified as a flocculation type yeast. HY101 strain and HY99 strain out of 5 selection yeasts showed excellent yeast sedimentation amount of 1.0 mL, and were classified as high flocculation type yeast. In high flocculation type yeast, suspended matter sinks well to the bottom of the fermenter after fermentation, so the beer does not become cloudy during beer production, and it is judged that the reuse efficiency will be excellent because it is easy to recover the strain.

Name of deposit institution: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC14545BP

Deposit date: 2021422

Claims (5)

Saccaromyces cerevisiae MBY/L3412 (KCTC 14545BP) strain.
According to claim 1,
The strain is
Characterized by excellent alcohol production ability.
According to claim 1,
The strain is
It has excellent production ability of ethyl decanoate, a waxy flavor ingredient, and isoamyl acetate and ethyl octanoate, a sweet & fruity flavor ingredient. to be.
According to claim 1,
The strain is
It is characterized in that it is for beer fermentation.
A method for producing beer, characterized in that using the strain of claim 1 as a fermentation strain.

Images