KR20220149944A - METHOD FOR EXTRACTING NUCLEIC ACID FROM SAMPLE RICH IN RNAase - Google Patents

Abstract

The present invention relates to a method for extracting nucleic acids from samples rich in RNAase such as red pepper, and a buffer composition used therein. The method for extracting nucleic acids comprises the steps of: mixing a fourth buffer containing guanidine hydrochloride (Gu-HCl) with samples; mixing a third buffer containing sodium chloride (NaCl); mixing a first buffer containing Tris-HCl; and mixing a second buffer containing sodium dodecyl sulfate (SDS).

Description

Method for extracting nucleic acids from samples rich in RNAase {METHOD FOR EXTRACTING NUCLEIC ACID FROM SAMPLE RICH IN RNAase}

The present invention relates to a method for extracting nucleic acids from a sample. In particular, the present invention relates to a method for extracting a nucleic acid from a sample richly containing RNA degrading enzyme and a reagent used therein.

Nucleic acid is a type of biomolecule as a polymer composed of units called nucleotides. Nucleic acids may be roughly classified into deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

The genetic information of a nucleic acid is contained in the nucleotide sequence of the nucleic acid and is expressed in the form of a protein through the biosynthesis process. In addition, since the expressed protein or enzyme plays an important role in cell growth, maintenance, and division, different organisms may have different combinations of DNA and RNA sequences. Also, even in the same organism, the expression pattern of genes may vary depending on external environmental conditions, nutritional status, presence or absence of pathogen infection, developmental stage, tissue differentiation, growth status, etc.

In this case, the different gene expression patterns may be expressed as RNA expression levels, gene expression levels, gene expression patterns, RNA transcription levels, changes in RNA transcription levels, transcript profiles, and the like. For this reason, the first thing that is basically performed is to purify RNA or DNA from a sample when a specific biological species is tested for the principle of life, infection, and reagent through molecular biological tools.

In general, purified DNA is used for functional genomics studies or specific regions of DNA. For example, the DNA sequence purified through COI barcode, ITS barcode, ribosomal RNA sequencing, etc. can be obtained and used for biological identification through 1:1 comparison with public databases such as Genbank. In addition, purified DNA is used as a core basic material for various basic molecular biology studies such as genetic manipulation.

Purified RNA can be synthesized into complement DNA through reverse transcription, and the synthesized DNA is also called cDNA library. cDNA can also be prepared by ^1st RT-PCR using only specific primers according to methods and procedures, and cDNA libraries can be constructed using oligo dT between 10-20 mers or random sequences between 5-20 mers. have. When PCR is performed with this synthesized cDNA library, it is said to be a two-step RT-PCR process. DNA synthesized through this process can exponentially amplify DNA of a specific nucleotide sequence through the polymerase chain reaction, a unique characteristic of taq polymerase, using taq polymerase and sequence specific DNA oligo. Through this principle, quantitative real-time PCR and gene expression relative quantitation, which track the amount of amplified DNA in real time to estimate the amount of gene expression, have been developed and are widely used worldwide.

In addition, by comparing the amplified DNA based on the principle of specific amplification of a specific sequence, which is a unique phenomenon of PCR, with an infected or uninfected sample, it can be used for diagnosis of genetic diseases or for diagnosing infectious diseases such as bacteria and viruses. As such, the PCR technique is a basic and most essential research tool in modern biology, and is currently used in almost all processes of manipulating and experimenting with genetic material.

Republic of Korea Patent No. 10-0486179, 2005.05.03., Cell lysis composition, method and kit for isolating and purifying nucleic acids U.S. Patent No. 5,234,809, August 10, 1993, Process for isolating nucleic acid Republic of Korea Patent No. 10-2094079, 2020.03.27., Composition for extracting viral RNA using silica-coated magnetic beads and RNA extraction method using the same

Aranda, P. S., LaJoie, D. M., & Jorcyk, C. L. (2012). Bleach gel: a simple agarose gel for analyzing RNA quality. Electrophoresis, 33(2), 366-369.

As described above, although the PCR technique is a very powerful tool, DNA polymerase, which is a key element of PCR, and reverse transcriptase, which synthesizes RNA into cDNA, are protein enzymes having a function, so they react sensitively to inhibitors, which are factors that inhibit the enzyme. Since these inhibitors inhibit enzyme activity in a concentration-dependent manner, the inhibitor must be maintained at a low concentration in all processes for a successful PCR experiment.

Unless it is a special experiment, the inhibitor is included in the purified RNA product or DNA product included immediately before the enzymatic reaction, and the quality of the nucleic acid extracted from the initial sample greatly affects the diagnosis and test results. Extracting high-quality nucleic acids is of paramount importance.

The method of extracting nucleic acids is based on destroying the cell wall of the sample, eluting the nucleic acids therein, and filtering out impurities other than nucleic acids. Reagents used for nucleic acid extraction can be roughly divided into a product group containing mainly chaotropic salts and a product group containing phenol, chloroform, and the like.

Chaotropic salt-based products can extract high-quality RNA by inactivating RNA-degrading enzymes based on the principle of transforming proteins by strongly stealing moisture around protein molecules. On the other hand, phenol-based products use protein dissolving ability to separate RNA and protein, and use chloroform to separate RNA and protein layers to extract high-quality RNA.

Currently, Qiagen's nucleic acid extraction kit is commonly used. Qiagen's nucleic acid extraction kit is a universal kit that can be applied primarily to unspecified samples at the laboratory level.

However, as described above, in industrial fields that require molecular diagnostic test results as high as possible, especially in the field of diagnosis of infectious diseases, high-quality nucleic acid It is very important to extract

In particular, depending on whether the sample is an animal or a plant, and even in the same plant, the extraction efficiency of the nucleic acid may be completely different due to the biological characteristics of the plants, for example, secondary metabolites present in high concentrations in leaves or tissues.

For another example, even when nucleic acids are extracted by the same method using the same detection buffer (or reagent), high-quality nucleic acids can be extracted from one sample, but not from another sample. , even in another sample, nucleic acids may not be extracted at all.

On the other hand, plants are known to be exposed to and infected with over 800 viruses. In particular, unlike animals, plants have a problem in that they have no choice but to close the area once infected because it is practically difficult to treat viral infections. On the other hand, as the size of the export and import market of edible crops has recently expanded, crop diseases that have occurred in one region are frequently expanding to other regions. For this reason, governments of each country conduct meticulous quarantine on imports and exports to prevent the spread of damage caused by virus-infected crops.

Plants contain relatively diverse DNA and RNA extraction inhibitory components compared to animals due to their biological characteristics, and relatively high-quality nucleic acid extraction is not easy. And, as a result, it may lead to an increase in the time and cost required for diagnosis, and an erroneous negative judgment or experimental result is derived.

If this phenomenon occurs in the process of import/export quarantine of crops traded in the billions of won, due to false negative results, all crops may be arbitrarily disposed of in the country of import or export due to virus infection. It is a problem that can cause economic damage.

In general, it is difficult to extract and recover high-quality nucleic acids from a sample containing a very rich RNA-degrading enzyme using a well-known nucleic acid extraction buffer. Among plants, crops such as red pepper and green pepper, their fruits, their stems, their roots, and/or their leaves can be exemplified as samples particularly rich in RNA-degrading enzymes.

Accordingly, an object of the present invention is to provide a method for extracting high-quality nucleic acids from a sample rich in RNA-degrading enzymes.

Another problem to be solved by the present invention is to provide a reagent or buffer capable of extracting high-quality nucleic acids from a sample rich in RNA-degrading enzymes.

Another problem to be solved by the present invention is to provide a kit including a reagent or buffer capable of extracting high-quality nucleic acids from a sample richly containing RNA-degrading enzymes.

The problems of the present invention are not limited to the technical problems mentioned above, and other technical problems not mentioned will be clearly understood by those skilled in the art from the following description.

The method for extracting nucleic acids according to an embodiment of the present invention for solving the above problems comprises the steps of: mixing a fourth buffer containing guanidine hydrochloride (Gu-HCl) with a sample; mixing a third buffer containing sodium chloride (NaCl); mixing a first buffer comprising Tris-HCl (tris(hydroxymethyl)aminomethane-HCl); and mixing a second buffer containing sodium dodecyl sulfate (SDS).

The steps may be performed sequentially.

In some embodiments, the method may further include mixing the fourth buffer between the mixing of the first buffer and the mixing of the second buffer.

The first buffer may include 0.8M to 1.2M Tris-HCl.

In addition, the first buffer is 20mM to 30mM of ethylenediaminetetraacetic acid (EDTA), 0.3% (w / v) to 0.7% (w / v) of sodium metabisulfite (sodium metabisulfite), sodium sulfite, Acid sodium sulfite or sodium sulfate, and 1.8% (w/v) to 2.2% (w/v) of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be further included.

The second buffer may include 3% (w/v) to 8% (w/v) SDS.

In addition, the second buffer may further include 20 mM to 30 mM EDTA, 120 mM to 180 mM sodium citrate, and 15 mM to 25 mM Tris-HCl.

The third buffer may include 4.2M to 4.8M sodium chloride.

In addition, the third buffer is 80mM to 120mM of potassium chloride, calcium chloride, ferric chloride, ferrous chloride, ammonium aluminum or ammonium sulfate, and 1.8% (w / v) to 2.2% (w / v) of polyvinyl p. Rollidone, polyvinyl polypyrrolidone or polyethylene glycol may be further included.

The fourth buffer may include 3.5M to 4.5M guanidine hydrochloride.

In addition, the fourth buffer may further include 10 mM to 20 mM Tris-HCl.

The volume ratio of the fourth buffer and the third buffer that are initially mixed may be 1:1.1 to 1:1.2.

A volume ratio of the fourth buffer and the first buffer that are initially mixed may be 1:0.6 to 1:0.8.

A volume ratio of the fourth buffer and the second buffer that are initially mixed may be 1:1.1 to 1:1.2.

The first used volume of the fourth buffer may be 350 μl to 450 μl.

In some embodiments, a mixing ratio of the fourth buffer initially mixed and the fourth buffer mixed thereafter may be 1:0.9 to 1:1.1.

Mixing the fourth buffer with the sample may include mixing 40 μl to 60 μl of the fourth buffer, the sample, and a reducing agent, and crushing the sample.

Here, the reducing agent may include β-mercaptoethanol (beta-mercaptoethanol), 0.3M to 0.7M of TCEP-HCl, or 0.8M to 1.2M of dithiothreitol (DTT).

In addition, the volume ratio of the fourth buffer and the reducing agent used may be 1:0.08 to 1:0.15.

In some embodiments, after mixing the third buffer, before mixing the first buffer, a first incubation step of incubating the mixture at 55 ° C. to 65 ° C. for 2 minutes to 8 minutes; a first centrifugation step of centrifuging the mixture after mixing the first buffer; After the first centrifugation step, a second culturing step of incubating the mixture for 30 seconds to 5 minutes; After mixing the second buffer, a third incubation step of incubating the mixture for 30 seconds to 5 minutes; a second centrifugation step of centrifuging the culture of the third culturing step; The method may further include mixing the supernatant of the second centrifugation step and isopropanol and loading the mixture into the column.

The mixing of the second buffer may include mixing the culture of the supernatant of the first centrifugation step or the supernatant of the first centrifugation step and the second buffer.

In some embodiments, a first washing step of washing the column with a fifth buffer comprising isopropanol and sodium chloride; a second washing step of washing the column with a sixth buffer containing ethanol, Tris-HCl and guanidine-hydrochloric acid; and a third washing step of washing the column with a seventh buffer containing ethanol and Tris-HCl; And it may further include sequentially recovering the nucleic acid.

The sample may be derived from an orchard including red pepper or green pepper.

A kit including a plurality of buffers according to an embodiment of the present invention for solving the other problem is a kit including a plurality of buffers including a first buffer, a second buffer, a third buffer and a fourth buffer. , The fourth buffer and the reducing agent are mixed to disrupt the sample, the first buffer to the third buffer are further mixed, and then isopropanol is mixed to load the column, and at least one wash buffer is used to wash the sample. is composed

Details of other embodiments are included in the detailed description.

According to embodiments of the present invention, it is possible to extract high-quality nucleic acids from a sample richly containing RNA-degrading enzyme, for example, a plant sample, more specifically, from crops such as red pepper and green pepper.

Effects according to the embodiments of the present invention are not limited by the contents exemplified above, and more various effects are included in the present specification.

1 and 2 are flowcharts illustrating a method for extracting nucleic acids according to an embodiment of the present invention.
3 is an image showing the result of extracting nucleic acids according to Example 2 and electrophoresis.
4 is an image showing the result of nucleic acid extraction and electrophoresis according to Example 3.
5 is an image showing the result of nucleic acid extraction and electrophoresis according to Comparative Example 1-1.
6 is an image showing the result of nucleic acid extraction and electrophoresis according to Comparative Example 1-2.
7 and 8 are images showing the results of nucleic acid extraction and electrophoresis according to Comparative Example 2.
9 is an image showing the results of nucleic acid extraction and electrophoresis according to Comparative Examples 3;
10 is an image showing the result of nucleic acid extraction and electrophoresis according to Comparative Example 4.
11 is an image showing the result of nucleic acid extraction and electrophoresis according to Comparative Example 5;
12 is an image showing the results of nucleic acid extraction and electrophoresis according to Comparative Examples 6.
13 is an image showing the result of nucleic acid extraction and electrophoresis according to Comparative Example 7.
14 to 16 are images showing the purity of nucleic acids measured according to Experimental Example 1.
17 is an image showing an amplification curve and a melting curve according to Experimental Example 2.

Advantages and features of the present invention and methods of achieving them will become apparent with reference to the embodiments described below in detail in conjunction with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below, but will be implemented in various different forms, and only the embodiments allow the disclosure of the present invention to be complete, and those of ordinary skill in the art to which the present invention pertains. It is provided to fully inform the person of the scope of the invention, and the present invention is only defined by the scope of the claims. That is, various changes may be made to the embodiments presented by the present invention. It should be understood that the embodiments described below are not intended to limit the embodiments, and include all modifications, equivalents, and substitutions thereto.

Unless otherwise defined, all terms (including technical and scientific terms) used herein may be used with the meaning commonly understood by those of ordinary skill in the art to which the present invention belongs. In addition, terms defined in a commonly used dictionary are not to be interpreted ideally or excessively unless clearly defined in particular.

In this specification, 'and/or' includes each and every combination of one or more of the mentioned items. The singular also includes the plural, unless the phrase specifically states otherwise. As used herein, 'comprises' and/or 'comprising' does not exclude the presence or addition of one or more other components in addition to the stated components. Numerical ranges indicated using 'to' indicate numerical ranges including the values stated before and after them as the lower and upper limits, respectively. 'About' or 'approximately' means a value or numerical range within 20% of the value or numerical range recited thereafter.

As used herein, the term 'buffer' or 'reagent' refers to a material that is added, mixed, or added during the extraction of nucleic acids, and is not limited to the meaning of the buffer solution. The terms 'buffer' and 'reagent' may be used interchangeably.

As used herein, the term 'primer' is a nucleic acid sequence having a short free 3' hydroxyl group, capable of forming a base pair with a complementary template of the nucleic acid, and the template strand refers to a nucleic acid sequence that serves as a starting point for copying.

Hereinafter, the present invention will be described in detail.

first buffer composition

The first buffer composition may neutralize the acidic or basic pH of the sample to a neutral value of about 7.0 and inhibit the oxidation process of the antioxidant material of the sample. For example, it may be a buffer designed to prevent ROS, quinone, etc. generated by oxidation of polyphenols, which are major antioxidant factors, or it may be for the purpose of adsorbing polyphenols and preventing them from chemically reacting with nucleic acids. In addition, the first buffer composition may function as a homogenizing solution that prevents the temperature of the sample from rising rapidly during a homogenization process in which high heat such as bead beating occurs.

The first buffer composition contains Tris-HCl (Tris buffer solution), ethylenediaminetetraacetic acid (EDTA), sodium metabisulfite, and polyvinyl pyrrolidone further may include

The concentration of Tris-HCl may be about 0.8M to 1.2M, or about 0.9M to 1.1M. The pH of Tris-HCl may be about 6.9 to 7.1, or about 7.0.

If the content of Tris-HCl is too small, the buffering effect is reduced, and the pH of the homogenate may change rapidly due to acidic or basic substances derived from the sample during homogenization of the sample. In this case, the quality or yield of the nucleic acid to be extracted may be drastically reduced. On the other hand, if the content of Tris-HCl is too large, the osmotic pressure may increase, resulting in the release of a large amount of endogenous RNAse and DNAase in an undesired stage, thereby reducing the yield of nucleic acids.

In addition, the concentration of EDTA may be about 20mM to 30mM, or about 22mM to 28mM, or about 24mM to 26mM.

If the content of EDTA is too small, DNA extraction efficiency may be lowered because DNAse activity cannot be reduced. Conversely, if the content of EDTA is too large, the pH of the composition may rise and the pH buffering effect of the original purpose may be lost.

In some embodiments, the molar ratio of Tris-HCl to EDTA is about 35:1 to 45:1, or about 36:1 to 44:1, or about 37:1 to 43:1, or about 38: 1 to 42:1, or about 39:1 to 41:1, or about 40:1.

The concentration of sodium metabisulfite is about 0.3% (w/v) to 0.7% (w/v), or about 0.4% (w/v) to 0.6% (w/v), or about 0.5% (w/v) ) to 0.6% (w/v). In the present specification, unless otherwise defined, % concentration in solution means % (w/v, weight/volume).

If the content of sodium metabisulfite is too small, it cannot prevent the oxidation of polyphenols, so the extraction efficiency of RNA and DNA is lowered.

In other embodiments, sodium sulfite, sodium sulfite acid and/or sodium sulfate may be further included in place of, or in addition to, sodium metabisulfite. In this case, the sum of the contents of sodium metabisulfite, sodium sulfite, acid sodium sulfite and sodium sulfate may be within the above-mentioned concentration.

The concentration of polyvinylpyrrolidone is about 1.8% (w/v) to 2.2% (w/v), or about 1.9% (w/v) to 2.1% (w/v), or about 2.0% (w/v) v) can be In another embodiment, instead of or in addition to polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be further included. In this case, the sum of the contents of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be within the above-mentioned concentration.

If the content of polyvinylpyrrolidone (or polyvinylpolypyrrolidone, or polyethylene glycol) is too small, the adsorption amount of polyphenols decreases, so that the polyphenols cannot be effectively removed in the subsequent precipitation step. In this case, the polyphenol reacts with the nucleic acid, and the extraction efficiency of RNA and DNA decreases. If too much, the viscosity of the solution increases, making the homogenization process difficult, and the difficulty may increase in the subsequent liquid handling process.

In some embodiments, the weight ratio of sodium metabisulfite to polyvinylpyrrolidone and the like may be about 1:3.8 to 1:4.2, or about 1:3.9 to 1:4.1, or about 1:4.

In an exemplary embodiment, the first buffer composition is a cationic interface such as guanidine salt, phenol, chloroform, iso-amyl alcohol and/or cetyl trimethylammonium bromide (CTAB). It may contain no active agent.

As will be described later, the first buffer composition may be a buffer that is first mixed with the crushed sample rich in polyphenols and/or polysaccharides. In this case, the first buffer composition according to the present embodiment does not contain a guanidine salt to prevent chemical reaction between polyphenols and polysaccharides in advance.

In addition, since it does not contain substances that are highly volatile and harmful to the human body, such as phenol, chloroform and/or isoamyl alcohol, it is possible to promote the safety of workers extracting nucleic acids, and it does not have complicated facilities and is stable under relatively mild conditions. It can be implemented as a point-of-care kit because it can perform the task. In addition, since it does not contain cetyltrimethylammonium bromide, the use of liquid nitrogen may not be essential, and since it is not necessary to use the ethanol co-precipitation method, depending on the sample, if the liquid nitrogen or ethanol co-precipitation method is not used, the nucleic acid extraction process is As well as simplifying, it is possible to prevent the problem of sample contamination in the process of crushing and homogenizing the sample using liquid nitrogen, and shortening the time required for nucleic acid extraction.

Method for preparing the first buffer composition

The first buffer composition may be prepared by mixing Tris-HCl, and further mixing EDTA, sodium metabisulfite and polyvinylpyrrolidone or polyethylene glycol. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and substitute substances are the same as described above.

In an exemplary embodiment, the first buffer composition contains 25 ml of 2M Tris-HCl (pH 7.0), 2.5 ml of 0.5 M EDTA, 0.25 g of sodium metabisulfite (powder), and polyvinylpyrrolidone (pH value 3.0 to 5.0). , molar average molecular weight 25,000 to 35,000, powder) 1.0 g can be prepared by mixing. In this case, the volume of the prepared first buffer composition may be about 50ml.

However, the present invention is not limited thereto, and when the above-described molar (mol), volume (ml), and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the first buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less, or about 40 ml or less, or about 30 ml or less. .

The lower limit of the total amount of the first buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

second buffer composition

The second buffer composition may include a surfactant to destroy and modify cells and proteins, and to adsorb proteins. In addition, polysaccharides can be at least partially removed.

The second buffer composition includes sodium dodecyl sulfate (SDS), and may further include EDTA, sodium citrate, and Tris-HCl (Tris buffer solution).

The concentration of SDS is from about 3% (w/v) to 8% (w/v), or from about 4% (w/v) to 7% (w/v), or from about 5% (w/v) to 6 % (w/v).

If the content of SDS is too small, the denaturing ability of the protein, for example, the denaturation of RNase, is lowered, and thus the eluted RNA can be degraded. Since the cell destruction efficiency is lowered, the elution amount of RNA or DNA may be reduced, and thus the extraction efficiency of RNA or DNA may be reduced. If too much, it may excessively react with other compounds of the protein or buffer composition to increase the operation difficulty of the subsequent step, and the extraction efficiency may be lowered by adsorbing RNA and DNA together.

In addition, the concentration of EDTA may be about 20mM to 30mM, or about 22mM to 28mM, or about 24mM to 26mM.

If the content of EDTA is too small, DNA extraction efficiency may be lowered because DNAse activity cannot be reduced. If it is too large, the pH of the composition may rise and the original purpose of pH buffering effect may be lost.

The concentration of sodium citrate may be about 120 mM to 180 mM, or about 130 mM to 170 mM, or about 140 mM to 160 mM, or about 150 mM.

If the content of sodium citrate is too small, DNA extraction efficiency may be lowered because the activity of DNAse cannot be reduced, and the cell wall cannot be destroyed because calcium ions or other iron ions cannot be removed. If it is too large, the pH of the composition may rise and the original purpose of pH buffering effect may be lost.

In some embodiments, the molar ratio of EDTA to sodium citrate may be about 1:4 to 1:8, or about 1:5 to 1:7, or about 1.6.

Further, the concentration of Tris-HCl may be about 15mM to 25mM, or about 16mM to 24mM, or about 17mM to 23mM, or about 18mM to 22mM, or about 19mM to 21mM. The pH of Tris-HCl may be about 7.4.

If the content of Tris-HCl is too small, the buffering effect is reduced, and the pH of the homogenate may change rapidly due to acidic or basic substances derived from the sample during homogenization of the sample. In this case, the quality or yield of the nucleic acid to be extracted may be drastically reduced. If too much, the osmotic pressure may increase, resulting in the release of a large amount of endogenous RNAse and DNAase at an undesired stage, thereby reducing the yield of nucleic acids.

In some embodiments, the molar ratio of EDTA and Tris-HCl may be about 1:1 to 1.5:1, or about 1.1:1 to 1.4:1, or about 1.2:1 to 1.3:1, or about 1.25:1. .

Method for preparing the second buffer composition

The second buffer composition may be prepared by mixing SDS and further mixing EDTA, sodium citrate and Tris-HCl. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the second buffer composition is prepared by mixing 12.5 ml of 20% SDS, 2.5 ml of 0.5M EDTA, 1.93 g of sodium citrate (powder), and 1.0 ml of 1.0M Tris-HCl (pH 7.4) can do. In this case, the volume of the prepared second buffer composition may be about 50ml.

However, the present invention is not limited thereto, and when the above-described molar (mol), volume (ml), and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the second buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less, or about 40 ml or less, or about 30 ml or less. .

The lower limit of the total amount of the second buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

third buffer composition

The third buffer composition may reduce the solvent phase dissolution rate by forming a high osmotic pressure and neutralizing the surface charge of the nucleic acid eluted by the second buffer composition. In addition, the SDS of the second buffer composition may be adsorbed and/or removed by precipitation, proteins and polysaccharides may be precipitated, and may help in binding of nucleic acids. In addition, sodium ions react with phosphoric acid of nucleic acids to coat the surface, which can prevent access to nucleases such as RNAse and DNase.

The third buffer composition may include sodium chloride (NaCl), potassium chloride (KCl), and polyvinylpyrrolidone.

The concentration of sodium chloride may be about 4.2M to 4.8M, or about 4.3M to 4.7M, or about 4.4M to 4.6M, or about 4.5M.

If the content of sodium chloride is too small, the osmotic pressure is lowered, and the above-described osmotic pressure formation, surface charge neutralization of nucleic acids, nucleic acid binding, protein and polysaccharide precipitation, and SDS adsorption and precipitation effects cannot be obtained. Too much may saturate the solution and precipitate sodium chloride and other additives.

The concentration of potassium chloride may be about 80 mM to 120 mM, or about 90 mM to 110 mM. In other embodiments, ferric chloride, ferrous chloride, ammonium aluminum and/or ammonium sulfate may be further included in place of or in addition to potassium chloride. In this case, the sum of the contents of calcium chloride, ferric chloride, ferrous chloride, aluminum ammonium and ammonium sulfate may be within a concentration to be described later.

If the content of potassium chloride is too small, the binding force between SDS and NaCl cannot be promoted, and the stability of the precipitate may be deteriorated. If there is too much, the nucleic acid may react with potassium and elute potassium in the final recovery step, which may interfere with the PCR process or cause malfunction.

In some embodiments, the molar ratio of sodium chloride to potassium chloride, etc. is from about 40:1 to 50:1, or from about 41:1 to 49:1, or from about 42:1 to 48:1, or from about 43:1 to 47: 1, or about 44:1 to 46:1, or about 45:1.

The concentration of polyvinylpyrrolidone is about 1.8% (w/v) to 2.2% (w/v), or about 1.9% (w/v) to 2.1% (w/v), or about 2.0% (w/v) v) can be In another embodiment, instead of or in addition to polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be further included. In this case, the sum of the contents of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be within the above-mentioned concentration.

If the content of polyvinylpyrrolidone (or polyvinylpolypyrrolidone, or polyethylene glycol) is too small, the adsorption amount of polyphenols decreases, so that the polyphenols cannot be effectively removed in the subsequent precipitation step. In this case, the polyphenol reacts with the nucleic acid, and the extraction efficiency of RNA and DNA decreases. If too much, the viscosity of the solution increases, making the homogenization process difficult, and the difficulty may increase in the subsequent liquid handling process.

Method for preparing the third buffer composition

The third buffer composition may be prepared by mixing sodium chloride and further mixing potassium chloride and polyvinylpyrrolidone. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and substitute substances are the same as described above.

In an exemplary embodiment, the third buffer composition contains 45 ml of 5M sodium chloride, 0.37 g of potassium chloride (powder), and 1.0 g of polyvinylpyrrolidone (pH value 3.0 to 5.0, molar average molecular weight 25,000 to 35,000, powder) It can be prepared by mixing. In this case, the volume of the prepared third buffer composition may be about 50ml.

However, the present invention is not limited thereto, and when the above-described molar (mol), volume (ml), and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the third buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less, or about 40 ml or less, or about 30 ml or less. .

The lower limit of the total amount of the third buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

fourth buffer composition

The fourth buffer composition may precipitate polyvinylpyrrolidone combined with SDS and polyphenol of the second buffer composition. In addition, the residual protein can be denatured, and it can help the binding of nucleic acids.

The fourth buffer composition includes guanidine-HCl, and may further include Tris-HCl.

The concentration of guanidine hydrochloride may be about 3.5M to 4.5M, or about 3.6M to 4.4M, or about 3.7M to 4.3M, or about 3.8M to 4.2M, or about 3.9M to 4.1M.

If the content of guanidine hydrochloride is too small, PVP bound to polyphenol cannot be precipitated, and as a result, the extracted nucleic acid may be contaminated with polyphenol. In addition, the efficiency of binding of the nucleic acid with the silica film may decrease, thereby reducing the extraction efficiency of the nucleic acid. If too much, the solution may be saturated and sodium chloride and other additives of the 3-buffer composition may be precipitated.

In addition, the concentration of Tris-HCl may be about 10mM to 20mM, or about 12mM to 18mM, or about 14mM to 16mM. The pH of Tris-HCl may be about 7.4. The content or concentration of Tris-HCl of the fourth buffer composition may be smaller than the content of Tris-HCl of the second buffer composition.

If the content of Tris-HCl is too small, the buffering effect may be reduced, and if it is too large, the pH may rapidly increase or other additives may be precipitated.

In some embodiments, the molar ratio of guanidine hydrochloride and Tris-HCl is 250:1 to 280:1, or about 260:1 to 270:1, or about 265:1 to 268:1, or about 266:1 to 267: can be 1.

Method for preparing the fourth buffer composition

The fourth buffer composition may be prepared by mixing guanidine hydrochloride and further mixing Tris-HCl. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and substitute substances are the same as described above.

In an exemplary embodiment, the fourth buffer composition may be prepared by mixing 19.1 g of guanidine hydrochloride (powder) and 0.75 ml of 1.0M Tris-HCl (pH 7.4). In this case, the volume of the prepared fourth buffer composition may be about 50ml.

However, the present invention is not limited thereto, and when the above-described molar (mol), volume (ml), and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the fourth buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less, or about 40 ml or less, or about 30 ml or less. .

The lower limit of the total amount of the fourth buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

fifth buffer composition

The fifth buffer composition may be a first wash buffer after loading on the column. The fifth buffer composition may include isopropanol, sodium chloride and a nonionic surfactant. In particular, it may be aimed at removing a unique pigment such as chlorophyll contained in a large amount in plant tissue.

The concentration of isopropanol may be about 55% (v/v, volume/volume) to 65% (v/v), or about 60% (v/v).

If the content of isopropanol is too small, the nucleic acid does not precipitate from the lysate, making it difficult to bind to the silica film, etc., and if the content of isopropanol is too large, the volume of the whole mixture increases, increasing the difficulty of operation. may increase.

In addition, the concentration of sodium chloride may be about 120mM to 180mM, or about 130mM to 170mM, or about 140mM to 160mM.

If the content of sodium chloride is too small, the binding force between the nucleic acid and the solid support phase such as silica film is reduced during washing, and nucleic acid may be lost during the washing process. can be dropped

The concentration of the nonionic surfactant is about 0.1% (v/v) to 0.3% (v/v), or about 0.15% (v/v) to 0.25% (v/v), or about 0.2% (v/v) v) can be

If the amount of the nonionic surfactant is too small, the contact area between the solid support phase such as a silica film and the washing buffer may be reduced, and the washing efficiency may decrease due to the hydrophobicity of the silica film itself. If too much, bubbles are generated during the process, which increases the difficulty of manipulation, and the possibility of contamination between samples by particles scattered when the generated bubbles are destroyed can increase.

Method for preparing the fifth buffer composition

The fifth buffer composition may be prepared by mixing isopropanol, sodium chloride and a nonionic surfactant. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the fifth buffer composition may be prepared by mixing 30 ml of 99% isopropanol, 1.5 ml of 5M sodium chloride, and 10 μl of 99% tween-21. In this case, the volume of the prepared fifth buffer composition may be about 50ml.

However, the present invention is not limited thereto, and when the above-described molar (mol), volume (ml), and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the fifth buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less. The lower limit of the total amount of the fifth buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

sixth buffer composition

The sixth buffer composition may be a secondary washing buffer. The sixth buffer composition may include ethanol, guanidine hydrochloride (Gu-HCl) and Tris-HCl. In particular, it can be used for the purpose of removing proteins from a solid support such as a silica film by causing protein denaturation by adding guanidine hydrochloric acid.

The concentration of ethanol may be about 55% (v/v, volume/volume) to about 65% (v/v), or about 60% (v/v).

If the content of ethanol is too small, the nucleic acid may be dissolved in the buffer composition and the nucleic acid may be lost during the washing process, and if the content of ethanol is too large, guanidine hydrochloride as an additive may be precipitated, thereby reducing the desired protein removal efficiency.

In addition, the concentration of guanidine hydrochloride may be about 1.5M to 2.0M, or about 1.6M to 1.8M, or about 1.65M to 1.7M.

If the content of guanidine hydrochloride is too small, protein denaturation efficiency is reduced, so protein removal cannot be performed smoothly, and nucleic acids are eluted during the washing process, thereby reducing the quality and yield of nucleic acids. If there is too much, guanidine hydrochloride is not removed in the subsequent washing process, which may interfere with the subsequent process after nucleic acid extraction, such as PCR and RT-PCR.

The concentration of Tris-HCl may be about 10 mM to 20 mM, or about 12 mM to 18 mM, or about 14 mM to 16 mM. The pH of Tris-HCl may be about 7.4. The content or concentration of Tris-HCl of the sixth buffer composition may be smaller than the content of Tris-HCl of the second buffer composition.

If the content of Tris-HCl is too small, the buffering effect may be reduced, and if it is too large, the pH may rapidly increase or other additives may be precipitated.

Method for preparing the sixth buffer composition

The sixth buffer composition may be prepared by mixing ethanol, guanidine hydrochloric acid and Tris-HCl. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the sixth buffer composition can be prepared by mixing 30 ml of 99% ethanol, 7.98 g of 1.67 M guanidine hydrochloride (powdered), and 0.75 ml of 1.0 M Tris-HCl (pH 7.4). In this case, the volume of the prepared sixth buffer composition may be about 50 ml.

However, the present invention is not limited thereto, and when the above-described molar (mol), volume (ml), and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the sixth buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less. The lower limit of the total amount of the sixth buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

Seventh Buffer Composition

The seventh buffer composition may be a third wash buffer. The seventh buffer composition may include ethanol, sodium chloride and Tris-HCl. In particular, the purpose of removing the high-concentration salt of the above composition may be for the purpose of removing the remaining silica film or the pigment remaining on the solid support.

The concentration of ethanol is about 70% (v/v) to 80% (v/v), or about 71% (v/v) to 79% (v/v), or about 72% (v/v) to 78% (v/v). % (v/v), or between about 73% (v/v) and 77% (v/v), or between about 74% (v/v) and 76% (v/v).

If the content of ethanol is too low, the nucleic acid may be dissolved on the solid support and the nucleic acid may be lost during the washing process. If there is too much, the residual salt may not be dissolved, and the salt may be eluted together in the final extraction process.

The concentration of sodium chloride may be between about 15 mM and 25 mM, or between about 16 mM and 24 mM, or between about 17 mM and 23 mM, or between about 18 mM and 22 mM, or between about 19 mM and 21 mM.

If the content of sodium chloride is too small, the binding force between the nucleic acid and the solid support phase such as silica film is reduced during washing, and nucleic acid may be lost during the washing process. can be dropped

The concentration of Tris-HCl may be about 10 mM to 20 mM, or about 12 mM to 18 mM, or about 14 mM to 16 mM. The pH of Tris-HCl may be about 7.4. The content or concentration of Tris-HCl of the sixth buffer composition may be smaller than the content of Tris-HCl of the second buffer composition.

If the content of Tris-HCl is too small, the buffering effect may be reduced, and if it is too large, the pH may rapidly increase or other additives may be precipitated.

Method for preparing the seventh buffer composition

The seventh buffer composition may be prepared by mixing ethanol, sodium chloride and Tris-HCl. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the seventh buffer composition may be prepared by mixing 37.5 ml of 99% ethanol, 0.2 ml of 5M sodium chloride, and 0.75 ml of 1M Tris-HCl (pH 7.4). In this case, the volume of the prepared seventh buffer composition may be about 50ml.

However, the present invention is not limited thereto, and when the above-described molar (mol), volume (ml), and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the seventh buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less. The lower limit of the total amount of the seventh buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

Nucleic Acid Extraction Method

1 and 2 are flowcharts illustrating a method for extracting nucleic acids according to an embodiment of the present invention.

The nucleic acid extraction method according to the present invention comprises the steps of mixing the sample and the fourth buffer (S10), crushing the sample by further mixing a reducing agent (S20), further mixing the third buffer and culturing it (S30) , further mixing the first buffer, culturing and centrifuging it (S40), further mixing and culturing the fourth buffer (S50), further mixing the second buffer, and culturing and centrifuging it (S40) S60), further mixing isopropanol and loading the column (S70), washing with a fifth buffer (S80), washing with a sixth buffer (S90), and washing with a seventh buffer (S100) may be further included.

First, prepare a sample. In an exemplary embodiment, the sample may be derived from a plant, a plant leaf, a plant flesh, a plant stem, and/or a plant root. For example, the plant may be a tough plant rich in RNA-degrading enzymes, such as red pepper or green pepper. As described above, in the conventional nucleic acid extraction method, since the RNA-degrading enzyme functions as an inhibitor, it is extremely difficult to extract high-quality nucleic acids from such plants. However, when the above-described buffer compositions and a method for extracting nucleic acids to be described below are followed, high-quality nucleic acid extraction is possible, the reliability and accuracy of diagnosis results can be increased, and the time required for diagnosis can be significantly shortened.

Then, the sample and the fourth buffer are mixed (S10). Based on 100 mg of sample, the fourth buffer may be mixed with about 350 μl to 450 μl, or about 360 μl to 440 μl, or about 370 μl to 430 μl, or about 380 μl to 420 μl, or about 390 μl to 410 μl. have. Since the fourth buffer has been described above, a redundant description thereof will be omitted.

Then, the reducing agent is further mixed in the tube (S20). The reducing agent may include β-mercaptoethanol (99% solution), 0.5M TCEP-HCl or 1M dithiothreitol (DTT). The use volume ratio of the fourth buffer and the reducing agent may be about 1:0.07 to 1:0.16, or about 1:0.08 to 1:0.15, or about 1:0.08 to 1:0.13. For example, the reducing agent may be mixed in about 30 μl to 70 μl, or about 40 μl to 60 μl, or about 50 μl. Reducing agents may contribute to the inactivation of RNA degrading enzymes. After mixing the reducing agent, it is preferable to shake the tube to mix thoroughly.

And shake the tube in which the sample, the fourth buffer, and the reducing agent are mixed to disrupt the sample. The method of crushing the sample is not particularly limited, and a bead beating tube may be used or a liquid nitrogen crushing method may be used, and may be appropriately selected in consideration of the state of the sample, for example, moisture content.

Then, the third buffer is further mixed in the tube (S30). The use volume ratio of the fourth buffer and the third buffer may be about 1:1.05 to 1:1.25, or about 1:1.1 to 1:1.2. For example, the third buffer may be mixed between about 400 μl and 500 μl, or between about 410 μl and 490 μl, or between about 420 μl and 480 μl, or between about 430 μl and 470 μl, or between about 440 μl and 460 μl. . Since the third buffer has been described above, a redundant description thereof will be omitted. After mixing the third buffer, it is preferable to shake the tube to mix thoroughly.

And the third buffer mixture is incubated for about 2 minutes to 8 minutes, or about 3 minutes to 7 minutes under the conditions of about 55 ℃ to 65 ℃, or about 60 ℃ (first incubation step).

The above-described fourth buffer is mixed, the reducing agent is mixed, the sample is disrupted, and the nucleic acid can be eluted and the RNA-degrading enzyme can be inactivated through the steps of mixing and incubating the third buffer, but the present invention is limited to any theory it's not going to be

Then, the first buffer is further mixed in the tube (S40). The use volume ratio of the fourth buffer and the first buffer may be about 1:0.5 to 1:0.9, or about 1:0.6 to 1:0.8, or about 1:0.65 to 1:0.75. For example, the first buffer may be mixed between about 250 μl and 350 μl, or between about 260 μl and 340 μl, or between about 270 μl and 330 μl, or between about 280 μl and 320 μl, or between about 290 μl and 310 μl. . Since the first buffer has been described above, a redundant description thereof will be omitted. After mixing the first buffer, it is preferable to shake the tube to mix thoroughly.

Then, the mixture in which the first buffer is mixed is centrifuged (first centrifugation step). Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Alternatively, it may be carried out at a speed of about 12,000 rpm to 17,000 rpm for about 3 minutes to 10 minutes, or about 4 minutes to 7 minutes.

A first buffer is further mixed for oxidation and adsorption of polyphenols, and then a component of the third buffer can at least partially remove polysaccharides through a step of centrifugation, but the present invention is not limited to any theory.

In some embodiments, the next centrifuged supernatant (supernatant from the first centrifugation step), for example, approximately 2.0 ml of the supernatant, is taken and placed in another tube and mixed with the fourth buffer (S50). That is, the fourth buffer may be additionally mixed. The volume ratio of the first mixed fourth buffer and the fourth buffer mixed in this step may be about 1:0.9 to 1:1.1, or about 1:1.

A first buffer is added and polyphenol is adsorbed by the constituent materials of the first buffer (S40). After that, a fourth buffer is added to increase the concentration of the guanidine salt so that polyvinylpyrrolidone adsorbed with polyphenols is aggregated.

In another embodiment, the mixing step ( S50 ) of the second and fourth buffer may be omitted.

And the fourth buffer is further mixed with the mixture (or the mixture of the first buffer) is incubated for about 30 minutes to 5 minutes, or about 1 minute under the conditions of room temperature, for example, about 20 ° C. to 30 ° C. (second incubation stage).

Then, the second buffer is further mixed in the tube (S60). The use volume ratio of the fourth buffer and the second buffer may be about 1:0.8 to 1:1.2, or about 1:0.9 to 1:1.1. For example, the second buffer can be mixed between about 350 μl and 450 μl, or between about 360 μl and 440 μl, or between about 370 μl and 430 μl, or between about 380 μl and 420 μl, or between about 390 μl and 410 μl. . Since the second buffer has been described above, a redundant description thereof will be omitted. After mixing the second buffer, it is preferable to shake the tube to mix thoroughly.

And the mixture in which the second buffer is mixed is incubated at room temperature, for example, at about 20° C. to 30° C. for about 30 seconds to 5 minutes, or about 1 minute to 3 minutes (third incubation step).

Further, the cultured culture is centrifuged (second centrifugation step). Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Alternatively, it may be carried out at a speed of about 12,000 rpm to 17,000 rpm for about 1 to 8 minutes, or about 2 to 5 minutes.

By dissolving the pulverized sample and adsorbing the protein through the step of mixing and incubating the above-mentioned second buffer, it can be partially removed, and then the protein adsorbed through centrifugation and the poly aggregated by the first buffer and the fourth buffer Phenol may be partially removed, but the present invention is not limited to any theory.

Then, take the centrifuged supernatant (supernatant from the second centrifugation step), for example, approximately 900 μl to 1,100 μl of the supernatant, put it in another tube, and mix with isopropanol (S70). The mixing amount of isopropanol may be about 400 μl to 600 μl, or about 450 μl to 550 μl. For example, the mixing ratio (v/v) of the supernatant of the second centrifugation and isopropanol may be about 1:1.5 to 1:2.5, or about 1:1.8 to 1:2.3, or about 1:2.0. After mixing isopropanol, it is preferable to shake thoroughly to mix.

And the isopropanol mixture is loaded into the column. For example, an isopropanol mixture can be loaded onto a spin column to initiate extraction of nucleic acids. The step of loading the column may be divided into two or more steps. The column may be a nucleic acid adsorbent column packed with cationic metal beads, or cationic adsorbent fibers.

However, the present invention is not limited thereto, and an ethanol precipitation method, a nucleic acid precipitation method, or a magnetic bead method may be used instead of the recovery using a column.

Then, it is washed with a fifth buffer (S80). The amount of the fifth buffer used for washing may be about 500 μl or more, or about 600 μl or more, or about 700 μl or more, or about 800 μl or more, or about 900 μl or more, or about 1,000 μl or more. The upper limit of the amount of the fifth buffer is not particularly limited, but may be about 1,500 μl or less. Since the fifth buffer has been described above, a redundant description thereof will be omitted.

Washing may be performed via centrifugation. Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Alternatively, at a speed of about 12,000 rpm to 17,000 rpm, it may be performed for about 10 seconds to 60 seconds, or about 20 seconds to 50 seconds, or about 30 seconds to 40 seconds.

Although the pigment of the sample may be removed through this step, the present invention is not limited to any theory.

In some embodiments, after the washing step using the fifth buffer, a DNA degrading enzyme (DNAse) treatment may be further performed. A well-known method can be used about a DNA-degrading enzyme treatment, treatment conditions, etc. Genomic DNA can be removed using a DNA degrading enzyme.

Then, it is washed with a sixth buffer (S90). The amount of the sixth buffer used for washing may be about 500 μl or more, or about 600 μl or more, or about 700 μl or more, or about 800 μl or more, or about 900 μl or more, or about 1,000 μl or more. The amount of the sixth buffer may be smaller than the amount of the fifth buffer. The upper limit of the amount of the sixth buffer is not particularly limited, but may be about 1,500 μl or less. Since the sixth buffer has been described above, a redundant description thereof will be omitted.

Washing may be performed via centrifugation. Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Alternatively, at a speed of about 12,000 rpm to 17,000 rpm, it may be performed for about 10 seconds to 60 seconds, or about 20 seconds to 50 seconds, or about 30 seconds to 40 seconds.

In some embodiments, the method may further include waiting for a predetermined time before centrifugation after loading the sixth buffer. For example, centrifugation may be performed after waiting for about 10 seconds to 60 seconds, or about 20 seconds to 50 seconds, or about 30 seconds to 40 seconds.

Although the degraded DNA and DNA-degrading enzyme may be removed through this step and the remaining total RNA may be recombined, the present invention is not limited to any theory.

Then, it is washed with the seventh buffer (S100). The amount of the seventh buffer used for washing may be about 500 μl or more, or about 600 μl or more, or about 700 μl or more, or about 800 μl or more, or about 900 μl or more, or about 1,000 μl or more. The amount of the seventh buffer may be smaller than the amount of the fifth buffer. The upper limit of the amount of the seventh buffer is not particularly limited, but may be about 1,500 μl or less. Since the seventh buffer has been described above, a redundant description thereof will be omitted.

Washing may be performed via centrifugation. Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Alternatively, at a speed of about 12,000 rpm to 17,000 rpm, it may be performed for about 10 seconds to 60 seconds, or about 20 seconds to 50 seconds, or about 30 seconds to 40 seconds.

In some embodiments, the washing step using the seventh buffer may be performed multiple times. That is, centrifugation may be performed after loading the seventh buffer, and centrifugation may be performed after loading the seventh buffer again, but the present invention is not limited thereto.

The remaining salt may be removed through this step, but the present invention is not limited to any theory.

Thereafter, although not shown in the drawing, the nucleic acid recovery or can be extracted.

Virus diagnosis

After the nucleic acid is extracted according to the present invention, the presence or absence of a virus can be diagnosed. As the amplification method for diagnosing the presence or absence of a virus, known amplification methods, for example, PCR method, nested-PCR method, RT-PCR method, ICAN method, UCAN method, LAMP method, etc. can be used.

The PCR method is a method of amplifying a corresponding DNA region by repeating a DNA synthesis reaction by two types of primers and a DNA polymerase sandwiched between a specific DNA region. In some cases, nested-PCR method and real-time PCR method It can be used as an inclusive term, and when RNA is used as a starting material (reverse transcription), RNA can be synthesized into DNA by performing an RT step.

The nested-PCR method is a method of performing two-step PCR using an outer primer and an inner primer. Even when the target nucleic acid is not sufficiently amplified in the first round, it is possible to further amplify it in the second round. In addition, when non-specific amplification products are generated in the first PCR, the probability that these non-specific amplification products have a similar sequence to the primers in the second PCR is low, and therefore, in the second PCR, the probability of amplifying only the fragment having the sequence of the target is low can rise RT-PCR is a PCR method that includes performing a reverse transcription reaction using a reverse transcriptase as a previous step of PCR.

After the amplification of the nucleic acid, a step of detecting whether the target DNA is present in the amplified nucleic acid sample may be performed by mixing a diagnostic reagent. The detection step is performed using reagents used in probe assay, hybridization assay, oligonucleotide ligation assay, PCR (polymerase chain reaction), LCR (ligase chain reaction), etc. can be performed.

In addition, the detection of the target DNA may be performed through a DNA chip, gel electrophoresis, radiometric measurement, fluorescence/phosphorescence measurement, etc., of course, the present invention is not limited thereto.

Viruses to be detected are apple necrosis virus (NC040469, NC040470, NC040471, etc.), banana bunchy top virus (NC003473, NC003474, NC003475, NC003476, NC003477, NC003479, etc.), cherry leaf roll virus (NC015414, NC015415, etc.), cherry necrotic rusty mottle Virus (NC002468, etc.), citrus psorosis virus (NC006314, NC006315, NC006316, etc.), citrus ringspot virus (NC003093, etc.), citrus vein enation virus (NC021564, etc.), grapevine fanleaf virus (NC003615, NC003623, etc.), peach phony virus, peach rosette mosaic virus, peach wart virus, plum line pattern virus (NC003451, NC003452, NC003453, etc.), prune dwarf virus (NC008037, NC008038, NC008039, etc.), raspberry ringspot virus (NC005266, NC005267, etc.), tomato black ring virus (NC004439, NC004440, etc.), or tomato bushy stunt virus (NC001554, etc.), but the present invention is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to experimental examples.

Example 1. Preparation of buffer

Example 1-1. Preparation of the first buffer

25ml of 2M Tris-HCl (pH 7.0), 2.5ml of 0.5M EDTA, 0.25g of sodium metabisulfite (powder), and 1.0g of PVP K30 (powder) were mixed to make a final volume of 50ml. The pH of the first buffer was in the range of 7.0 to 7.4.

Example 1-2. Preparation of the second buffer

12.5ml of 20% SDS, 2.5ml of 0.5M EDTA, 1.93g of sodium citrate (powder), and 1.0ml of 1M Tris-HCl (pH 7.4) were mixed so that the final volume was 50ml. The final pH of the second buffer was in the range of 7.0 to 7.4.

Examples 1-3. Preparation of the third buffer

45 ml of 5M sodium chloride, 0.37 g of potassium chloride (powder), 1.93 g of sodium citrate (powder), and 1.0 g of PVP K30 (powder) were mixed to make a final volume of 50 ml. The final pH of the third buffer was in the range of 7.0 to 7.4.

Examples 1-4. Preparation of the fourth buffer

19.1 g of guanidine hydrochloride (Gu-HCl) (powdered) was mixed with 0.75 ml of 1M Tris-HCl (pH 7.4), and the final volume was 50 ml. The final pH of the fourth buffer was in the range of 7.0 to 7.4.

Examples 1-5. Preparation of the fifth buffer

30 ml of 99% isopropanol solution, 1.5 ml of 5M sodium chloride, and 10 μl of 99% Tween-21 solution were mixed so that the final volume was 50 ml. The final pH of the fifth buffer was in the range of 7.0 to 7.4.

Example 1-6. Preparation of the sixth buffer

30ml of 99% ethanol solution, 7.976g of guanidine hydrochloric acid (Gu-HCl) (powder), and 0.75ml of 1M Tris-HCl (pH 7.4) were mixed so that the final volume was 50mL. The final pH of the sixth buffer was in the range of 7.0 to 7.4.

Examples 1-7. Preparation of the seventh buffer

37.5ml of 99% ethanol solution, 0.2ml of 5M sodium chloride, and 0.75ml of 1M Tris-HCl (pH 7.4) were mixed so that the final volume was 50mL. The final pH of the seventh buffer was in the range of 7.0 to 7.4.

Example 2. RNA extraction

Example 2-1. Sample preparation and fourth buffer mixing

Pepper leaves were prepared as a sample. Then, 100 mg of the target sample, 400 μl of the fourth buffer, and 50 μl of 99% β-mercaptoethanol were placed in a bead beating tube (2 ml) and disrupted for 60 seconds at 5 m/s. After strongly vortexing, spin-down was performed.

Example 2-2. 3rd Buffer Mix

450 μl of the third buffer was added to the resultant of Example 2-1, vortexed strongly, and incubated at 60° C. for 5 minutes.

Example 2-3. first buffer mix

After adding 300 μl of the first buffer to the resultant of Example 2-2 and vortexing strongly, the culture was centrifuged at 13,000 rpm at 4° C. for 5 minutes.

Example 2-4. Second Buffer Mix

450 μl of the second buffer was added to the resultant of Example 2-3, vortexed strongly, and incubated at room temperature for 1 minute. And the culture was centrifuged for 3 minutes at 13,000rpm at 4 ℃.

Example 2-5. Loading the isopropanol mixture and washing the fifth buffer

800 μl of the supernatant of the result of Example 2-4 was transferred to a 2 ml tube. Then, 400 μl of isopropanol was added and vortexed vigorously.

Then, each 600 μl of the spin column was loaded and centrifuged. Then, 700 μl of the fifth buffer was added, followed by centrifugation at 4° C. at 13,000 rpm for 30 seconds, followed by washing once.

Example 2-6. DNase treatment and sixth buffer wash

Then, 50 uL of a DNAse solution (DNase 5 to 10 units, DNase buffer) is added to the spin column membrane through which the fifth buffer has passed, and then reacted at room temperature for 15 minutes. After completion of the reaction, 600 μl of the sixth buffer was added, waited for 60 seconds, and then centrifuged at 13,000 rpm at 4° C. for 30 seconds, followed by washing once.

Example 2-7. 7th Buffer Wash

Then, 600 μl of the 7th buffer was added and washed by centrifugation at 4° C. at 13,000 rpm for 30 seconds. This was repeated once more for a total of two washes.

Examples 2-8. Nucleic Acid Recovery and Electrophoresis

Then, centrifugation was performed at 13,000 rpm at 4° C. for 2 minutes, 50 μl of RNAse free water was added, and centrifugation was performed at 4° C. at 13,000 rpm for 30 seconds. The recovered RNA was electrophoresed by quantifying 400ng on a Bleach gel composed of 2% Agarose and 0.5X TBE. The results are shown in FIG. 3 .

Referring to FIG. 3 , it was confirmed that excellent quality nucleic acids were extracted from the pepper samples when the buffers and extraction method according to the present invention were used.

Example 3. Secondary use of the fourth buffer

Nucleic acid was recovered and electrophoresed in the same manner as in Example 2, except that the fourth buffer was mixed a second time between Examples 2-3 and 2-4, and the results are shown in FIG. 4 . 400 μl of the second and fourth buffer was mixed.

Referring to FIG. 4 , it was confirmed that nucleic acids of excellent quality were extracted even when the fourth buffer was mixed secondarily.

Comparative Example 1. Nucleic acid recovery using a third-party product

Comparative Example 1-1. QIAGEN N.V.

QIAGEN N.V. Mango (MG), strawberry (SB), grape (GV), tomato (TM), peach (PC), banana (BN), pear tree (PA), red pepper ( PP) was extracted, and the result of electrophoresis of the extracted nucleic acid is shown in FIG. 5 .

Referring to FIG. 5 , the quality and yield of RNA extracted from other samples except tomato (TM) and peach (PC), particularly, from red pepper (PP) samples were low and showed degradation.

That is, using the RNeasy plant mini kit commercially available from Qiagen, it could not be applied to nucleic acid extraction of pepper samples.

Comparative Example 1-2. Norgen Biotek Corp.

Norgen Biotek Corp. Mango (MG), strawberry (SB), grape (GV), tomato (TM), peach (PC), banana (BN), Nucleic acids were extracted from pear trees (PA) and red pepper (PP), and the results of electrophoresis of the extracted nucleic acids are shown in FIG. 6 .

Referring to FIG. 6 , the nucleic acid was decomposed in mango (MG). In the case of pear tree (PA), products other than nucleic acids are extracted together, showing a band dragging phenomenon, and in the case of red pepper (PP), RNA of larger molecules such as 28S rRNA was completely decomposed.

That is, it could not be applied to nucleic acid extraction of pepper samples using a plant nucleic acid purification kit (Plant RNA/DNA Purification Kit) commercially available from Norgen Biotech.

Comparative Example 2. Changing the buffer order (1)

Buffer 1, Buffer 2, Buffer 3, and Buffer 4 were sequentially mixed to extract nucleic acids and electrophoresis, and the results are shown in FIGS. 7 and 8 . As samples, mango (MG), strawberry (SB), grape (GV), tomato (TM), peach (PC), banana (BN), pear tree (PA), and red pepper (PP) were used.

7 and 8, when buffers 1 to 4 are sequentially used, nucleic acids of excellent quality can be extracted from mango, strawberry, grape, tomato, peach, banana and pear tree, whereas RNA extracted from red pepper was of low quality and yield and showed decomposition. That is, it can be confirmed that the quality of the extracted nucleic acids is affected by the mixing order of the buffer.

Comparative Example 3. Performed by adjusting some buffer concentrations and sequences

Comparative Example 3-1. Modified Example 2-2 (Sample 4)

Using a red pepper leaf sample, nucleic acid recovery and electrophoresis were performed in the same manner as in Example 2, except that 3M NaOAc was used instead of 4.5M sodium chloride in Example 2-2. 4 is shown.

Comparative Example 3-2. Modified Example 2-1 (Sample 6)

Using a red pepper sample, nucleic acid recovery and electrophoresis were performed in the same manner as in Example 2, except that the concentration of guanidine hydrochloride in the fourth buffer in Example 2-1 was 1M instead of 4M, and the results are shown in FIG. Sample 6 is shown.

Referring to FIG. 9 , it can be confirmed that RNA is completely degraded in all samples.

Comparative Example 4. Performed by adjusting the composition of the buffer

In the fourth buffer of Example 2-1, nucleic acid was recovered and electrophoresed in the same manner as in Example 2 except that guanidinethiocyanate was used instead of guanidine hydrochloride, and the results are shown in FIG. 10 .

Referring to FIG. 10 , it was confirmed that RNA was degraded in the sample and the RNA yield was low.

Comparative Example 5. Omitting the heating process

In Example 2-2, nucleic acid was recovered and electrophoresed in the same manner as in Example 2 except that heating at 60° C. was omitted, and the results are shown in FIG. 11 .

Referring to FIG. 11 , it can be seen that the amount of RNA extracted from the pepper sample was significantly reduced.

Comparative Example 6. Changing the buffer order (2)

Comparative Example 6-1. Omission of the first buffer (1)

The red pepper leaves are homogenized with the third buffer, the second buffer is mixed, the fourth buffer is added to the supernatant after the first centrifugation, and the nucleic acid is extracted by centrifugation and electrophoresis, and the result is shown in Sample 1 of FIG. It was.

Comparative Example 6-2. Omission of the first buffer (1)

The red pepper leaves are homogenized with the third buffer, the second buffer is mixed, the third buffer is added to the supernatant after the first centrifugation, and the nucleic acid is extracted by centrifugation and electrophoresis, and the result is shown in Sample 2 of FIG. It was.

Referring to FIG. 12 , in the case of homogenization without the first buffer, the quality of RNA was poor.

Specifically, referring to Sample 1, it can be seen that when homogeneous with the third buffer and secondary precipitation with the fourth buffer without the first buffer, RNA degradation of red pepper leaves was not effectively inhibited.

Also referring to sample 2, when homogenized with the fourth buffer and secondary precipitation with the third buffer without the first buffer, RNA was slightly degraded.

That is, when looking at these results, in the case of a specific plant in which RNase is overexpressed, such as red pepper leaves or tissues having equivalent characteristics, it was confirmed that it would be best to extract the intact RNA after homogenizing with the fourth buffer first and then proceeding with the subsequent process.

Comparative Example 7. Extraction with other samples

The same as in Example 2, except that leaf tissues of mango (MG), strawberry (SB), grape (GV), tomato (TM), peach (PC), banana (BN), and pear tree (PA) were used as samples. Nucleic acid was extracted by the method and electrophoresed, and the results are shown in FIG. 13 .

Referring to FIG. 13 , it was confirmed that the yield of RNA was low or no, and the band was faintly attracted due to the mixing of secondary metabolites other than RNA.

Experimental Example 1. Measurement of RNA purity and extraction amount

According to the method of Example 2, Comparative Example 1-1, and Comparative Example 1-2 described above, the purity and amount of nucleic acid extracted were measured. And the results are shown in FIGS. 14 to 16, respectively.

RNA and DNA strongly absorb a wavelength of 260 nm, which is the ultraviolet wavelength band, proteins and phenols strongly absorb a wavelength of 280 nm, and salts, carbohydrates and phenols strongly absorb a wavelength of 230 nm. The absorbance of the extracted RNA can be measured based on pure water with a UV spectrometer. A value obtained by dividing absorbance at 260 nm by 230 or 280 is defined as A260/A230 or A260/A280, respectively.

When the absorbance value of 260 is about twice or more higher than that of 230 or 280, it can be considered as pure RNA, and the more contaminated the sample, the lower the value. For example, when contamination with a guanidine salt or phenol increases, absorbance at 230 nm increases, and in particular, when contamination of phenol increases, absorbance at 260 nm increases, which may be overestimated compared to the actual amount of extracted RNA. That is, when high-purity RNA is extracted, the value of A260/A230 or A260/A280 is between 2.0 and 2.2.

Referring to FIGS. 14 to 16 , according to Example 2, higher or at least the same level of quality and recovery rate than that of a commercial kit as a comparative group. For reference, the results of mango (MG), strawberry (SB), grape (GV), tomato (TM), peach (PC), banana (BN) and pear (PA) in FIG. 14 are not related to the present invention.

Experimental Example 2. RNA amplification curve and melting curve

To evaluate whether the RNA extracted in Example 2 is suitable for downstream analysis such as qPCR, 1ug of total RNA was reverse transcribed to make cDNA, and then the house-keeping gene of each sample was PCR amplified.

For cDNA synthesis, 1 μg of total RNA was added using AccuPower® CycleScript™ RT PreMix (dN6) (Bioneer, Daejeon, South Korea) according to the manufacturer's protocol. The synthesized cDNA was diluted 10-fold and used as a template.

Then, a gene with a low expression level was selected through a literature search. Genes and their primer sequences used for real-time PCR analysis are summarized in Table 1 below.

botanical name Forward primer Reverse primer references Pepper >ACTTGTTATGGTAGGGATGGGTC
>Histone H3
GACTGATCTGCGTTTCCAGA >ACT
TTCTCTCTATTTGCCTTGGG
>Histone H3
TTGAATGTCCTTGGGCATAA (Cheng et al., 2017, Muller et al., 2015)

Real-time PCR was performed from the prepared cDNA using primers specific to the reference gene. Realtime PCR was performed using qTower3 (Analytik jena, Jena, Germany) equipment. PCR mix is 2X SFC green qPCR master mix (SFC Co., Ltd., Chungbuk, South Korea) 10 μl, template 5 μl, primer mix (forward and reverse each 10uM) 2 μl, RNase free water 3 μl in 1 reaction It was triplicated, and after heating at 95°C for 5 min for heat activation and pre-denuature, 45 cycles of 95°C 15 sec, 58°C 15 sec, 72°C (FAM fluorescence detection) 20 sec were repeated.

ller et al., 2015)Housekeeping genes such as Histone H3 and ACT were selected in pepper. (Cheng et al. , 2017, M.

ller et al. , 2015)

And the results are shown in FIG. 17 . Referring to FIG. 17 , each gene was amplified and fluorescence values were measured above the baseline threshold, and typical patterns observed in the normal realtime PCR amplification process, initiation phase, exponential phase, and linear phase were observed.

After completion of the PCR step, the FAM fluorescence was detected by heating at 95°C for 1 minute and then holding at 65°C to 95°C for 15 seconds at 0.5°C for analysis of the melting curve. (Ririe et al. , 1997) As a result of melting curve analysis to confirm the contamination of genomic DNA or the formation of non-specific PCR products, it was confirmed that the melting temperature of each PCR product was from a minimum of 78.62°C to a maximum of 85.48°C, and the melting curve Also, all of the single peaks were formed without peaks suspected of gDNA contamination or formation of non-specific products.

In the above, the embodiment of the present invention has been mainly described, but this is only an example and does not limit the present invention. It will be appreciated that various modifications and applications not exemplified above are possible.

Therefore, it should be understood that the scope of the present invention includes changes, equivalents or substitutes of the technical ideas exemplified above. For example, each component specifically shown in the embodiment of the present invention may be implemented by modification. And the differences related to these modifications and applications should be construed as being included in the scope of the present invention defined in the appended claims.

Claims (12)

mixing a fourth buffer containing guanidine hydrochloride (Gu-HCl) with the sample;
mixing a third buffer containing sodium chloride (NaCl);
mixing a first buffer comprising Tris-HCl (tris(hydroxymethyl)aminomethane-HCl); and
A method of extracting nucleic acids from a sample, comprising mixing a second buffer containing sodium dodecyl sulfate (SDS). According to claim 1,
The above steps are made sequentially, a method of extracting nucleic acids. 3. The method of claim 2,
Between the step of mixing the first buffer and the step of mixing the second buffer, the method of extracting a nucleic acid further comprising the step of further mixing the fourth buffer. 3. The method of claim 2,
The first buffer is
0.8M to 1.2M Tris-HCl;
20 mM to 30 mM ethylenediaminetetraacetic acid (EDTA);
0.3% (w/v) to 0.7% (w/v) sodium metabisulfite, sodium sulfite, acid sodium sulfite or sodium sulfate, and
A method of extracting a nucleic acid further comprising 1.8% (w/v) to 2.2% (w/v) of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol. 3. The method of claim 2,
The second buffer comprises 3% (w / v) to 8% (w / v) SDS,
EDTA from 20 mM to 30 mM,
120 mM to 180 mM sodium citrate, and
A method for extracting nucleic acids further comprising 15 mM to 25 mM Tris-HCl. 3. The method of claim 2,
The third buffer contains sodium chloride of 4.2M to 4.8M,
80 mM to 120 mM potassium chloride, calcium chloride, ferric chloride, ferrous chloride, ammonium aluminum or ammonium sulfate, and
1.8% (w / v) to 2.2% (w / v) of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol, further comprising a method of extracting a nucleic acid. 3. The method of claim 2,
The fourth buffer contains 3.5M to 4.5M guanidine hydrochloride,
10mM to 20mM Tris-HCl further comprising a method of extracting a nucleic acid. 3. The method of claim 2,
The use volume ratio of the fourth buffer and the third buffer is 1:1.1 to 1:1.2,
The use volume ratio of the fourth buffer and the first buffer is 1:0.6 to 1:0.8,
The use volume ratio of the fourth buffer and the second buffer is 1:1.1 to 1:1.2,
The volume of the fourth buffer used is 350 μl to 450 μl. According to claim 1,
The step of mixing the fourth buffer with the sample,
mixing 40 μl to 60 μl of the fourth buffer, the sample and the reducing agent, and
Comprising the step of crushing the sample,
The reducing agent includes β-mercaptoethanol, 0.3M to 0.7M of TCEP-HCl, or 0.8M to 1.2M of dithiothreitol (DTT),
The volume ratio of the fourth buffer and the reducing agent used is 1:0.08 to 1:0.15. 10. The method of claim 9,
a first incubation step of culturing the mixture at 55° C. to 65° C. for 2 minutes to 8 minutes after mixing the third buffer and before mixing the first buffer;
a first centrifugation step of centrifuging the mixture after mixing the first buffer;
After the first centrifugation step, a second culture step of culturing for 30 seconds to 5 minutes;
After mixing the second buffer, a third incubation step of incubating the mixture for 30 seconds to 5 minutes;
a second centrifugation step of centrifuging the culture of the third culturing step; and
Mixing the supernatant of the second centrifugation step and isopropanol and loading the column on the column,
The mixing of the second buffer comprises mixing the culture of the supernatant of the first centrifugation step and the second buffer. According to claim 1,
The sample is a nucleic acid extraction method that is derived from an orchard containing red pepper or green pepper. A kit comprising a plurality of buffers comprising a first buffer, a second buffer, a third buffer and a fourth buffer, the kit comprising:
The fourth buffer and the reducing agent are mixed to disrupt the sample, the first to third buffers are further mixed, the isopropanol is mixed to load the column, and at least one wash buffer is used for washing. , a nucleic acid extraction kit.

Images