KR102415720B1 - Method for extracting nucleic acid from sample rich in polyphenol and/or polysaccharide - Google Patents

Abstract

The present invention relates to a method for extracting nucleic acids from a sample richly containing polyphenols and/or polysaccharides, such as pears, bananas, and strawberries, and a buffer composition used therefor. The method of extracting the nucleic acid comprises: mixing a first buffer containing Tris-HCl with the sample; mixing a second buffer containing sodium dodecyl sulfate (SDS) with the sample; mixing a third buffer containing sodium chloride (NaCl) with the sample; and mixing a fourth buffer containing guanidine hydrochloride (Gu-HCl) with the sample.

Description

Method for extracting nucleic acids from samples rich in polyphenols and/or polysaccharides

The present invention relates to a method for extracting nucleic acids from a sample. Specifically, the present invention relates to a method for extracting nucleic acids from a sample richly containing polyphenols and/or polysaccharides, and a buffer composition used therefor.

Nucleic acid is a type of biomolecule as a polymer composed of units called nucleotides. Nucleic acids may be roughly classified into deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

The genetic information of a nucleic acid is contained in the nucleotide sequence of the nucleic acid and is expressed in the form of a protein through the biosynthesis process. In addition, since the expressed protein or enzyme plays an important role in cell growth, maintenance, and division, different organisms may have different combinations of DNA and RNA base sequences. Also, even in the same organism, the expression pattern of genes may vary depending on external environmental conditions, nutritional status, presence or absence of pathogen infection, developmental stage, tissue differentiation, growth status, etc.

In this case, the different gene expression patterns may be expressed in terms of RNA expression level, gene expression level, gene expression pattern, RNA transcription level, RNA transcription amount change, transcript profile, and the like. For this reason, the first thing that is basically performed is to purify RNA or DNA from a sample when testing the principle of life, infection, and reagents using molecular biological tools for specific species.

In general, purified DNA is used for functional genomics studies or specific regions of DNA. For example, the DNA sequence purified through COI barcode, ITS barcode, ribosomal RNA sequencing, etc. can be obtained and used for biological identification through 1:1 comparison with public databases such as Genbank. In addition, purified DNA is used as a core basic material for various basic molecular biology studies such as genetic manipulation.

Purified RNA can be synthesized into complement DNA through reverse transcription, and the synthesized DNA is also called cDNA library. cDNA can also be prepared by ^1st RT-PCR using only specific primers according to methods and procedures, and cDNA libraries can be constructed using oligo dT between 10-20 mers or random sequences between 5-20 mers. have. When PCR is performed with the cDNA library synthesized in this way, it is said to be a two-step RT-PCR process. DNA synthesized through this process can exponentially amplify DNA of a specific nucleotide sequence through the polymerase chain reaction, a unique characteristic of taq polymerase, using taq polymerase and sequence specific DNA oligo. Through this principle, quantitative real-time PCR and gene expression relative quantification method, which track the amount of amplified DNA in real time to estimate the amount of gene expression, have been developed and are widely used worldwide.

In addition, by comparing the amplified DNA based on the principle of specific amplification of a specific sequence, which is a unique phenomenon of PCR, with an infected or uninfected sample, it can be used for diagnosis of genetic diseases or for diagnosing infectious diseases such as bacteria and viruses. As such, the PCR technique is a basic and most essential research tool in modern biology, and is currently used in almost all processes of manipulating and experimenting with genetic material.

Republic of Korea Patent No. 10-0486179, 2005.05.03., Cell lysis composition, method and kit for isolating and purifying nucleic acids U.S. Patent No. 5,234,809, August 10, 1993, Process for isolating nucleic acid Republic of Korea Patent No. 10-2094079, 2020.03.27., Composition for extracting viral RNA using silica-coated magnetic beads and RNA extraction method using the same

Aranda, P. S., LaJoie, D. M., & Jorcyk, C. L. (2012). Bleach gel: a simple agarose gel for analyzing RNA quality. Electrophoresis, 33(2), 366-369.

As described above, although the PCR technique is a very powerful tool, DNA polymerase, which is a key element of PCR, and reverse transcriptase, which synthesizes RNA into cDNA, are protein enzymes with a function, so they react sensitively to inhibitors, which are factors that inhibit the enzyme. Since these inhibitors inhibit the activity of the enzyme in a concentration-dependent manner, the inhibitor must be maintained at a low concentration in all processes for a successful PCR experiment.

Unless it is a special experiment, the inhibitor is contained in the purified RNA or DNA product immediately before the enzymatic reaction, and the quality of the nucleic acid extracted from the initial sample greatly affects the diagnosis and test results. Extracting high-quality nucleic acids is of paramount importance.

The method of extracting nucleic acids is based on destroying the cell wall of the sample, eluting the nucleic acids therein, and filtering out impurities other than nucleic acids. Reagents used for nucleic acid extraction can be roughly divided into a product group containing mainly chaotropic salts and a product group containing phenol, chloroform, and the like.

Chaotropic salt-based products can extract high-quality RNA by inactivating RNA-degrading enzymes based on the principle of transforming proteins by strongly taking away moisture around protein molecules. On the other hand, phenol-based products use protein dissolving ability to separate RNA and protein, and use chloroform to separate RNA and protein layers to extract high-quality RNA.

Currently, Qiagen's nucleic acid extraction kit is commonly used. Qiagen's nucleic acid extraction kit is a universal kit that can be applied primarily to unspecified samples at the laboratory level.

However, as described above, in industrial fields that require molecular diagnostic test results as high as possible, especially in the field of diagnosis of infectious diseases, in order to increase the reliability and accuracy of test results and reduce the manpower and time required for the test, high-quality nucleic acid It is very important to extract

In particular, depending on whether the sample is an animal or a plant, and even in the same plant, the extraction efficiency of nucleic acid may be completely different due to biological characteristics of plants, such as secondary metabolites present in high concentrations in leaves or tissues.

For another example, even when nucleic acids are extracted by the same method using the same detection buffer (or reagent), high-quality nucleic acids can be extracted from one sample, but not from another sample. , even in another sample, nucleic acids may not be extracted at all.

On the other hand, it is known that plants are exposed to and infected with over 800 viruses. In particular, unlike animals, plants have a problem in that they have no choice but to close the area once infected because it is practically difficult to treat viral infections. On the other hand, as the size of the export and import market of edible crops has recently expanded, crop diseases that have occurred in one region are frequently expanding to other regions. For this reason, governments of each country conduct meticulous quarantine on imports and exports to prevent the spread of damage caused by virus-infected crops, but the period required for quarantine diagnosis is not short due to ambiguity in diagnosis results.

Plants contain relatively various DNA and RNA extraction inhibitory components compared to animals due to their biological characteristics, and relatively high-quality nucleic acid extraction is not easy.

For example, the leaf of a plant is the most used sample for diagnosing a virus in a plant because it is a major organ in which the virus propagates. At the same time, since the leaves of plants are most exposed to light, temperature, and pests, polyphenols and polysaccharides are accumulated in high concentrations in the leaves by the protective mechanism of the plant.

However, polyphenols and/or polysaccharides may function as inhibitors in the extraction process of nucleic acids, such as RNA or DNA. In particular, commercialized nucleic acid extraction kits generally use a high concentration of guanidine salt, but the buffer conditions formed by such a chaotropic agent are polyphenols and polysaccharides reacting with nucleic acids to form binding molecules or insoluble It can promote the formation of a complex, which can reduce the diagnostic sensitivity of viruses, etc., or significantly interfere with the construction of a cDNA library that can be used for gene expression research. And, as a result, it may lead to an increase in time and cost for diagnosis, and an erroneous negative judgment or experimental result is derived.

If this phenomenon occurs in the process of import/export quarantine of crops traded in the billions of won, due to false negative results, the importing country or exporting country may arbitrarily discard all crops due to virus infection. It is a problem that can cause economic damage.

In general, it is difficult to extract and recover high-quality nucleic acids from a sample richly containing polyphenols and/or polysaccharides using a well-known nucleic acid extraction buffer. Among plants, in particular, samples rich in polyphenols and/or polysaccharides include crops such as pears, bananas, strawberries, mangos, grapes, tomatoes, peaches, Arabidopsis thaliana and pineapples, their fruits, their stems, and their Roots and/or leaves thereof may be exemplified.

Accordingly, an object of the present invention is to provide a method for extracting high-quality nucleic acids from a sample richly containing polyphenols and/or polysaccharides.

Another object to be solved by the present invention is to provide a reagent or buffer capable of extracting high-quality nucleic acids from a sample rich in polyphenols and/or polysaccharides.

Another problem to be solved by the present invention is to provide a kit including a reagent or buffer capable of extracting high-quality nucleic acids from a sample richly containing polyphenols and/or polysaccharides.

The problems of the present invention are not limited to the technical problems mentioned above, and other technical problems not mentioned will be clearly understood by those skilled in the art from the following description.

A method for extracting a nucleic acid according to an embodiment of the present invention for solving the above problem, comprises the steps of: mixing a first buffer containing Tris-HCl (tris (hydroxymethyl) aminomethane-HCl) with a sample; mixing a second buffer containing sodium dodecyl sulfate (SDS) with the sample; mixing a third buffer containing sodium chloride (NaCl) with the sample; and mixing a fourth buffer containing guanidine hydrochloride (Gu-HCl) with the sample.

The above steps may be performed sequentially.

The first buffer may include 0.8M to 1.2M Tris-HCl.

In addition, the first buffer is 20mM to 30mM of ethylenediaminetetraacetic acid (EDTA), 0.3% (w / v) to 0.7% (w / v) of sodium metabisulfite (sodium metabisulfite), sodium sulfite, Acid sodium sulfite or sodium sulfate, and 1.8% (w/v) to 2.2% (w/v) of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be further included.

The second buffer may include 3% (w/v) to 8% (w/v) SDS.

In addition, the second buffer may further include 20 mM to 30 mM EDTA, 120 mM to 180 mM sodium citrate, and 15 mM to 25 mM Tris-HCl.

The third buffer may include 4.2M to 4.8M sodium chloride.

In addition, the third buffer is 80mM to 120mM potassium chloride, calcium chloride, ferric chloride, ferrous chloride, aluminum ammonium or ammonium sulfate, and 1.8% (w / v) to 2.2% (w / v) of polyvinyl blood Rollidone, polyvinyl polypyrrolidone or polyethylene glycol may be further included.

The fourth buffer may include 3.5M to 4.5M guanidine hydrochloride.

In addition, the fourth buffer may further include 10 mM to 20 mM Tris-HCl.

A used volume ratio of the first buffer and the second buffer may be 1:1.1 to 1:1.2.

A used volume ratio of the first buffer and the third buffer may be 1:0.6 to 1:0.8.

A used volume ratio of the first buffer and the fourth buffer may be 1:0.9 to 1:1.1.

The used volume of the first buffer may be 350 μl to 450 μl.

Mixing the first buffer with the sample may include mixing 40 μl to 60 μl of the first buffer, the sample, and a reducing agent, and crushing the sample.

Here, the reducing agent may include β-mercaptoethanol (beta-mercaptoethanol), 0.3M to 0.7M of TCEP-HCl, or 0.8M to 1.2M of dithiothreitol (DTT).

In addition, the volume ratio of the first buffer and the reducing agent used may be 1:0.08 to 1:0.15.

In some embodiments, after mixing the second buffer and before mixing the third buffer, a first incubation step of incubating the mixture at 55° C. to 65° C. for 2 minutes to 8 minutes; a second incubation step of culturing the mixture for 30 seconds to 5 minutes after mixing the third buffer and before mixing the fourth buffer; A first centrifugation step of centrifuging the culture before mixing the fourth buffer after the second culturing step; and a third incubation step of incubating the mixture for 30 seconds to 5 minutes at room temperature after mixing the fourth buffer; a second centrifugation step of centrifuging the culture mixture; and mixing the supernatant of the second centrifugation step with isopropanol and loading the mixture into the column.

The step of mixing the fourth buffer may include mixing the supernatant of the first centrifugation step and the fourth buffer.

In some embodiments, a first washing step of washing the column with a fifth buffer comprising isopropanol and sodium chloride; a second washing step of washing the column with a sixth buffer containing ethanol, Tris-HCl and guanidine-hydrochloric acid; and a third washing step of washing the column with a seventh buffer containing ethanol and Tris-HCl; And it may further include sequentially recovering the nucleic acid.

The sample may be derived from an orchard including pear, banana, strawberry, mango, grape, tomato, peach, Arabidopsis, or pineapple.

A kit comprising a plurality of buffers according to an embodiment of the present invention for solving the other problem is a kit comprising a plurality of buffers including a first buffer, a second buffer, a third buffer and a fourth buffer. , The first buffer and the reducing agent are mixed to disrupt the sample, the second buffer to the fourth buffer are mixed, and then isopropanol is mixed to load the column, and at least one wash buffer is used for washing. .

The kit according to this embodiment may include one or more of a first buffer, a second buffer, a third buffer, and a fourth buffer. For example, all of the first to fourth buffers, or any three of the first to fourth buffers, or any two of the first to fourth buffers, or the second Any one of the first to fourth buffers may be included.

Details of other embodiments are included in the detailed description.

According to embodiments of the present invention, a sample rich in polyphenols and/or polysaccharides, for example, a plant sample, more specifically, pear, banana, strawberry, mango, grape, tomato, peach, Arabidopsis or High-quality nucleic acids can be extracted from crops such as pineapple.

Effects according to the embodiments of the present invention are not limited by the contents exemplified above, and more various effects are included in the present specification.

1 and 2 are flowcharts illustrating a method for extracting nucleic acids according to an embodiment of the present invention.
3 is an image showing the result of extracting nucleic acids according to Example 2 and electrophoresis.
4 is an image showing the result of electrophoresis after extracting nucleic acids according to Comparative Example 1-1.
5 is an image showing the result of electrophoresis after extracting the nucleic acid according to Comparative Example 1-2.
6 is an image showing the result of nucleic acid extraction and electrophoresis according to Comparative Example 2.
7 is an image showing the results of nucleic acid extraction and electrophoresis according to Comparative Examples 3.
8 is an image showing the result of nucleic acid extraction and electrophoresis according to Comparative Example 4.
9 is an image showing the result of nucleic acid extraction and electrophoresis according to Comparative Example 5;
10 to 12 are images showing the purity of nucleic acids measured according to Experimental Example 1.
13 to 19 are images showing an amplification curve and a melting curve according to Experimental Example 2.

Advantages and features of the present invention and methods of achieving them will become apparent with reference to the embodiments described below in detail in conjunction with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below, but will be implemented in various different forms, and only the embodiments allow the disclosure of the present invention to be complete, and those of ordinary skill in the art to which the present invention pertains. It is provided to fully inform the person of the scope of the invention, and the present invention is only defined by the scope of the claims. That is, various changes may be made to the embodiments presented by the present invention. It should be understood that the embodiments described below are not intended to limit the embodiments, and include all modifications, equivalents, and substitutes thereto.

Unless otherwise defined, all terms (including technical and scientific terms) used herein may be used with the meaning commonly understood by those of ordinary skill in the art to which the present invention belongs. In addition, terms defined in a commonly used dictionary are not to be interpreted ideally or excessively unless clearly defined in particular.

In this specification, 'and/or' includes each and every combination of one or more of the recited items. The singular also includes the plural, unless the phrase specifically states otherwise. As used herein, 'comprises' and/or 'comprising' does not exclude the presence or addition of one or more other components in addition to the stated components. Numerical ranges indicated using 'to' indicate numerical ranges including the values stated before and after them as lower and upper limits, respectively. 'About' or 'approximately' means a value or numerical range within 20% of the value or numerical range recited thereafter.

As used herein, the term 'buffer' or 'reagent' refers to a material that is added, mixed, or added during the extraction of nucleic acids, and is not limited to the meaning of the buffer solution. The terms 'buffer' and 'reagent' may be used interchangeably.

As used herein, the term 'primer' is a nucleic acid sequence having a short free 3' hydroxyl group, capable of forming a base pair with a complementary template of the nucleic acid, and the template strand It refers to a nucleic acid sequence that serves as a starting point for copying.

Hereinafter, the present invention will be described in detail.

first buffer composition

The first buffer composition may neutralize the acidic or basic pH of the sample to a neutral value of about 7.0 and inhibit the oxidation process of the antioxidant material of the sample. For example, it may be a buffer designed not to generate ROS, quinone, etc. generated by oxidation of polyphenols, which are major antioxidant factors, or it may be for the purpose of adsorbing polyphenols and preventing them from chemically reacting with nucleic acids. In addition, the first buffer composition may function as a homogenizing solution that prevents the temperature of the sample from rising rapidly during a homogenization process in which high heat such as bead beating occurs.

The first buffer composition includes Tris-HCl (Tris buffer solution), ethylenediaminetetraacetic acid (EDTA), sodium metabisulfite, and polyvinyl pyrrolidone further may include

The concentration of Tris-HCl may be about 0.8M to 1.2M, or about 0.9M to 1.1M. The pH of Tris-HCl may be about 6.9 to 7.1, or about 7.0.

If the content of Tris-HCl is too small, the buffering effect is reduced, and the pH of the homogenate may change rapidly due to acidic or basic substances derived from the sample during homogenization of the sample. In this case, the quality or yield of the nucleic acid to be extracted may be drastically reduced. On the other hand, if the content of Tris-HCl is too large, the osmotic pressure may increase, resulting in the release of a large amount of endogenous RNAse and DNAase in an undesired stage, thereby reducing the yield of nucleic acids.

In addition, the concentration of EDTA may be about 20mM to 30mM, or about 22mM to 28mM, or about 24mM to 26mM.

If the content of EDTA is too small, the DNAse activity cannot be reduced and the DNA extraction efficiency may be lowered. Conversely, if the content of EDTA is too large, the pH of the composition may rise and the pH buffering effect of the original purpose may be lost.

In some embodiments, the molar ratio of Tris-HCl to EDTA is about 35:1 to 45:1, or about 36:1 to 44:1, or about 37:1 to 43:1, or about 38: 1 to 42:1, or about 39:1 to 41:1, or about 40:1.

The concentration of sodium metabisulfite is about 0.3% (w/v) to 0.7% (w/v), or about 0.4% (w/v) to 0.6% (w/v), or about 0.5% (w/v) ) to 0.6% (w/v). In this specification, unless otherwise defined, % concentration in solution means % (w/v, weight/volume).

If the content of sodium metabisulfite is too small, it cannot prevent the oxidation of polyphenols, so the extraction efficiency of RNA and DNA is lowered.

In other embodiments, sodium sulfite, sodium sulfite acid and/or sodium sulfate may be further included in place of, or in addition to, sodium metabisulfite. In this case, the sum of the contents of sodium metabisulfite, sodium sulfite, acid sodium sulfite and sodium sulfate may be within the above-mentioned concentration.

The concentration of polyvinylpyrrolidone is about 1.8% (w/v) to 2.2% (w/v), or about 1.9% (w/v) to 2.1% (w/v), or about 2.0% (w/v) v) can be In another embodiment, instead of or in addition to polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be further included. In this case, the sum of the contents of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be within the above-mentioned concentration.

If the content of polyvinylpyrrolidone (or polyvinylpolypyrrolidone, or polyethylene glycol) is too small, the adsorption amount of polyphenols decreases, so that the polyphenols cannot be effectively removed in the subsequent precipitation step. In this case, the polyphenol reacts with the nucleic acid, and the extraction efficiency of RNA and DNA decreases. If too much, the viscosity of the solution increases, making the homogenization process difficult, and the difficulty may increase in the subsequent liquid handling process.

In some embodiments, the weight ratio of sodium metabisulfite to polyvinylpyrrolidone and the like may be about 1:3.8 to 1:4.2, or about 1:3.9 to 1:4.1, or about 1:4.

In an exemplary embodiment, the first buffer composition is a cationic interface such as guanidine salt, phenol, chloroform, iso-amyl alcohol and/or cetyl trimethylammonium bromide (CTAB). It may contain no active agent.

As will be described later, the first buffer composition may be a buffer that is first mixed with the crushed sample rich in polyphenols and/or polysaccharides. In this case, the first buffer composition according to the present embodiment does not contain a guanidine salt to prevent chemical reaction between polyphenols and polysaccharides in advance.

In addition, since it does not contain substances that are highly volatile and harmful to the human body, such as phenol, chloroform and/or isoamyl alcohol, the safety of workers extracting nucleic acids can be ensured, and it is stable under relatively mild conditions without complicated facilities. Because it can perform the task, it is possible to implement it as a kit for point-of-care diagnostics. In addition, since it does not contain cetyltrimethylammonium bromide, the use of liquid nitrogen may not be essential, and since it is not necessary to use the ethanol co-precipitation method, depending on the sample, the nucleic acid extraction process may be In addition to being simple, it is possible to prevent the problem of sample contamination in the process of crushing and homogenizing the sample using liquid nitrogen, and shortening the time required for nucleic acid extraction.

Method for preparing the first buffer composition

The first buffer composition may be prepared by mixing Tris-HCl, and further mixing EDTA, sodium metabisulfite and polyvinylpyrrolidone or polyethylene glycol. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the first buffer composition contains 25 ml of 2M Tris-HCl (pH 7.0), 2.5 ml of 0.5 M EDTA, 0.25 g of sodium metabisulfite (powder), and polyvinylpyrrolidone (pH value 3.0 to 5.0). , molar average molecular weight 25,000 to 35,000, powder) 1.0 g can be prepared by mixing. In this case, the volume of the prepared first buffer composition may be about 50ml.

However, the present invention is not limited thereto, and if the above-described molar (mol), volume (ml) and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the first buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less, or about 40 ml or less, or about 30 ml or less. .

The lower limit of the total amount of the first buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

second buffer composition

The second buffer composition may include a surfactant to destroy and modify cells and proteins, and to adsorb proteins. In addition, polysaccharides can be at least partially removed.

The second buffer composition includes sodium dodecyl sulfate (SDS), and may further include EDTA, sodium citrate, and Tris-HCl (Tris buffer solution).

The concentration of SDS is from about 3% (w/v) to 8% (w/v), or from about 4% (w/v) to 7% (w/v), or from about 5% (w/v) to 6 % (w/v).

If the content of SDS is too small, the denaturing power of the protein, for example, the denaturation degree of RNase, is lowered, and thus the eluted RNA can be degraded. Since the cell destruction efficiency is lowered, the elution amount of RNA or DNA may be reduced, and thus the extraction efficiency of RNA or DNA may be reduced. If too much, it excessively reacts with proteins or other compounds of the buffer composition, which may increase the difficulty of subsequent steps, and may also adsorb RNA and DNA, thereby lowering extraction efficiency.

In addition, the concentration of EDTA may be about 20mM to 30mM, or about 22mM to 28mM, or about 24mM to 26mM.

If the content of EDTA is too small, the DNAse activity cannot be reduced and the DNA extraction efficiency may be lowered. If it is too large, the pH of the composition may rise and the original purpose of pH buffering effect may be lost.

The concentration of sodium citrate may be about 120 mM to 180 mM, or about 130 mM to 170 mM, or about 140 mM to 160 mM, or about 150 mM.

If the content of sodium citrate is too small, DNA extraction efficiency may be lowered because DNAse activity cannot be reduced, and calcium ions or other iron ions cannot be removed, so cell wall destruction cannot be performed smoothly. If it is too large, the pH of the composition may rise and the original purpose of pH buffering effect may be lost.

In some embodiments, the molar ratio of EDTA to sodium citrate may be about 1:4 to 1:8, or about 1:5 to 1:7, or about 1.6.

Further, the concentration of Tris-HCl may be about 15mM to 25mM, or about 16mM to 24mM, or about 17mM to 23mM, or about 18mM to 22mM, or about 19mM to 21mM. The pH of Tris-HCl may be about 7.4.

If the content of Tris-HCl is too small, the buffering effect is reduced, and the pH of the homogenate may change rapidly due to acidic or basic substances derived from the sample during homogenization of the sample. In this case, the quality or yield of the nucleic acid to be extracted may be drastically reduced. If too much, the osmotic pressure may increase, resulting in the release of a large amount of endogenous RNAse and DNAase at an undesired stage, thereby reducing the yield of nucleic acids.

In some embodiments, the molar ratio of EDTA and Tris-HCl may be about 1:1 to 1.5:1, or about 1.1:1 to 1.4:1, or about 1.2:1 to 1.3:1, or about 1.25:1. .

Method for preparing the second buffer composition

The second buffer composition may be prepared by mixing SDS and further mixing EDTA, sodium citrate and Tris-HCl. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the second buffer composition is prepared by mixing 12.5 ml of 20% SDS, 2.5 ml of 0.5 M EDTA, 1.93 g of sodium citrate (powder), and 1.0 ml of 1.0 M Tris-HCl (pH 7.4) can do. In this case, the volume of the prepared second buffer composition may be about 50ml.

However, the present invention is not limited thereto, and if the above-described molar (mol), volume (ml) and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the second buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less, or about 40 ml or less, or about 30 ml or less. .

The lower limit of the total amount of the second buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

third buffer composition

The third buffer composition may reduce the solvent phase dissolution rate by forming a high osmotic pressure and neutralizing the surface charge of the nucleic acid eluted by the second buffer composition. In addition, the SDS of the second buffer composition may be removed by adsorbing and/or precipitating it, proteins and polysaccharides may be precipitated, and it may help the binding of nucleic acids. In addition, sodium ions react with the phosphate of the nucleic acid to coat the surface, thereby preventing access to nucleases such as RNAse and DNase.

The third buffer composition may include sodium chloride (NaCl), potassium chloride (KCl), and polyvinylpyrrolidone.

The concentration of sodium chloride may be about 4.2M to 4.8M, or about 4.3M to 4.7M, or about 4.4M to 4.6M, or about 4.5M.

If the sodium chloride content is too small, the osmotic pressure is lowered, and the above-described osmotic pressure formation, surface charge neutralization of nucleic acids, nucleic acid binding, protein and polysaccharide precipitation, and SDS adsorption and precipitation effects cannot be obtained. Too much may saturate the solution and precipitate sodium chloride and other additives.

The concentration of potassium chloride may be about 80 mM to 120 mM, or about 90 mM to 110 mM. In other embodiments, ferric chloride, ferrous chloride, ammonium aluminum and/or ammonium sulfate may be further included in place of or in addition to potassium chloride. In this case, the sum of the contents of calcium chloride, ferric chloride, ferrous chloride, aluminum ammonium and ammonium sulfate may be within a concentration to be described later.

If the content of potassium chloride is too small, the binding force between SDS and NaCl cannot be promoted, and thus the stability of the precipitate may be deteriorated. Too much can cause the nucleic acid to react with potassium and elute potassium in the final recovery step, which can interfere with the PCR process or cause malfunction.

In some embodiments, the molar ratio of sodium chloride to potassium chloride, etc. is from about 40:1 to 50:1, or from about 41:1 to 49:1, or from about 42:1 to 48:1, or from about 43:1 to 47: 1, or about 44:1 to 46:1, or about 45:1.

The concentration of polyvinylpyrrolidone is about 1.8% (w/v) to 2.2% (w/v), or about 1.9% (w/v) to 2.1% (w/v), or about 2.0% (w/v) v) can be In another embodiment, instead of or in addition to polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be further included. In this case, the sum of the contents of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol may be within the above-mentioned concentration.

If the content of polyvinylpyrrolidone (or polyvinylpolypyrrolidone, or polyethylene glycol) is too small, the adsorption amount of polyphenols decreases, so that the polyphenols cannot be effectively removed in the subsequent precipitation step. In this case, the polyphenol reacts with the nucleic acid, and the extraction efficiency of RNA and DNA decreases. If too much, the viscosity of the solution increases, making the homogenization process difficult, and the difficulty may increase in the subsequent liquid handling process.

Method for preparing the third buffer composition

The third buffer composition may be prepared by mixing sodium chloride and further mixing potassium chloride and polyvinylpyrrolidone. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the third buffer composition contains 45 ml of 5M sodium chloride, 0.37 g of potassium chloride (powder), and 1.0 g of polyvinylpyrrolidone (pH value 3.0 to 5.0, molar average molecular weight 25,000 to 35,000, powder) It can be prepared by mixing. In this case, the volume of the prepared third buffer composition may be about 50ml.

However, the present invention is not limited thereto, and if the above-described molar (mol), volume (ml) and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the third buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less, or about 40 ml or less, or about 30 ml or less. .

The lower limit of the total amount of the third buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

fourth buffer composition

The fourth buffer composition may precipitate polyvinylpyrrolidone combined with SDS and polyphenol of the second buffer composition. In addition, the residual protein can be denatured, and it can help the binding of nucleic acids.

The fourth buffer composition includes guanidine hydrochloride (Guanidine-HCl) and may further include Tris-HCl.

The concentration of guanidine hydrochloride may be about 3.5M to 4.5M, or about 3.6M to 4.4M, or about 3.7M to 4.3M, or about 3.8M to 4.2M, or about 3.9M to 4.1M.

If the content of guanidine hydrochloric acid is too small, PVP bound to polyphenol cannot be precipitated, and as a result, the extracted nucleic acid may be contaminated with polyphenol. In addition, the efficiency of binding the nucleic acid to the silica film may decrease, thereby reducing the extraction efficiency of the nucleic acid. If too much, the solution may be saturated and sodium chloride and other additives of the 3-buffer composition may be precipitated.

In addition, the concentration of Tris-HCl may be about 10mM to 20mM, or about 12mM to 18mM, or about 14mM to 16mM. The pH of Tris-HCl may be about 7.4. The content or concentration of Tris-HCl of the fourth buffer composition may be smaller than the content of Tris-HCl of the second buffer composition.

If the content of Tris-HCl is too small, the buffering effect may be reduced, and if too much, the pH may rapidly increase or other additives may be precipitated.

In some embodiments, the molar ratio of guanidine hydrochloride and Tris-HCl is 250:1 to 280:1, or about 260:1 to 270:1, or about 265:1 to 268:1, or about 266:1 to 267: can be 1.

Method for preparing the fourth buffer composition

The fourth buffer composition may be prepared by mixing guanidine hydrochloric acid and further mixing Tris-HCl. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the fourth buffer composition may be prepared by mixing 19.1 g of guanidine hydrochloride (powdered) and 0.75 ml of 1.0M Tris-HCl (pH 7.4). In this case, the volume of the prepared fourth buffer composition may be about 50ml.

However, the present invention is not limited thereto, and if the above-described molar (mol), volume (ml) and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the fourth buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less, or about 40 ml or less, or about 30 ml or less. .

The lower limit of the total amount of the fourth buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

fifth buffer composition

The fifth buffer composition may be a first wash buffer after loading on the column. The fifth buffer composition may include isopropanol, sodium chloride and a nonionic surfactant. In particular, it may be aimed at removing a unique pigment such as chlorophyll contained in a large amount in plant tissue.

The concentration of isopropanol may be from about 55% (v/v, volume/volume) to about 65% (v/v), or about 60% (v/v).

If the content of isopropanol is too small, the nucleic acid does not precipitate from the lysate, making it difficult to bind to a silica film, etc., and if the content of isopropanol is too large, the volume of the entire mixture increases and the difficulty of operation increases. may increase.

In addition, the concentration of sodium chloride may be about 120mM to 180mM, or about 130mM to 170mM, or about 140mM to 160mM.

If the content of sodium chloride is too small, the binding force between the nucleic acid and the solid support phase such as silica film is reduced during washing, and nucleic acid may be lost during the washing process. can be dropped

The concentration of the nonionic surfactant is about 0.1% (v/v) to 0.3% (v/v), or about 0.15% (v/v) to 0.25% (v/v), or about 0.2% (v/v) v) can be

If the amount of the nonionic surfactant is too small, the contact area between the solid support phase such as a silica film and the washing buffer may decrease, and the washing efficiency may decrease due to the hydrophobicity of the silica film itself. If too much, bubbles are generated during the process, which increases the difficulty of manipulation, and the possibility of contamination between samples by particles scattered when the generated bubbles are destroyed can increase.

Method for preparing the fifth buffer composition

The fifth buffer composition may be prepared by mixing isopropanol, sodium chloride and a nonionic surfactant. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the fifth buffer composition may be prepared by mixing 30 ml of 99% isopropanol, 1.5 ml of 5M sodium chloride, and 10 μl of 99% tween-21. In this case, the volume of the prepared fifth buffer composition may be about 50ml.

However, the present invention is not limited thereto, and if the above-described molar (mol), volume (ml) and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the fifth buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less. The lower limit of the total amount of the fifth buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

sixth buffer composition

The sixth buffer composition may be a secondary washing buffer. The sixth buffer composition may include ethanol, guanidine hydrochloric acid (Gu-HCl) and Tris-HCl. In particular, it can be used for the purpose of removing proteins from a solid support such as a silica film by causing protein denaturation by adding guanidine hydrochloric acid.

The concentration of ethanol may be about 55% (v/v, volume/volume) to 65% (v/v), or about 60% (v/v).

If the content of ethanol is too small, the nucleic acid may be dissolved in the buffer composition and the nucleic acid may be lost during the washing process, and if the content of ethanol is too large, guanidine hydrochloride as an additive may be precipitated, thereby reducing the desired protein removal efficiency.

In addition, the concentration of guanidine hydrochloride may be about 1.5M to 2.0M, or about 1.6M to 1.8M, or about 1.65M to 1.7M.

If the content of guanidine hydrochloric acid is too small, the protein denaturation efficiency is reduced, so that the protein cannot be removed smoothly, and the nucleic acid is eluted during the washing process, thereby reducing the quality and yield of the nucleic acid. If too much, guanidine hydrochloride is not removed in the subsequent washing process, which may interfere with the subsequent process after nucleic acid extraction, such as PCR and RT-PCR.

The concentration of Tris-HCl may be about 10 mM to 20 mM, or about 12 mM to 18 mM, or about 14 mM to 16 mM. The pH of Tris-HCl may be about 7.4. The content or concentration of Tris-HCl of the sixth buffer composition may be smaller than the content of Tris-HCl of the second buffer composition.

If the content of Tris-HCl is too small, the buffering effect may be reduced, and if too much, the pH may rapidly increase or other additives may be precipitated.

Method for preparing the sixth buffer composition

The sixth buffer composition may be prepared by mixing ethanol, guanidine hydrochloric acid and Tris-HCl. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the sixth buffer composition may be prepared by mixing 30 ml of 99% ethanol, 7.98 g of 1.67M guanidine hydrochloride (powdered), and 0.75 ml of 1.0M Tris-HCl (pH 7.4). In this case, the volume of the prepared sixth buffer composition may be about 50ml.

However, the present invention is not limited thereto, and if the above-described molar (mol), volume (ml) and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the sixth buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less. The lower limit of the total amount of the sixth buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

Seventh Buffer Composition

The seventh buffer composition may be a third wash buffer. The seventh buffer composition may include ethanol, sodium chloride and Tris-HCl. In particular, it may be for the purpose of removing the high concentration salt of the above composition and for the purpose of removing the remaining silica film or the pigment remaining on the solid support.

The concentration of ethanol is about 70% (v/v) to 80% (v/v), or about 71% (v/v) to 79% (v/v), or about 72% (v/v) to 78% (v/v). % (v/v), or between about 73% (v/v) and 77% (v/v), or between about 74% (v/v) and 76% (v/v).

If the content of ethanol is too small, the nucleic acid may be dissolved on the solid support and the nucleic acid may be lost during the washing process. If there is too much, the residual salts may not be dissolved and the salts may be eluted together in the final extraction process.

The concentration of sodium chloride may be between about 15 mM and 25 mM, or between about 16 mM and 24 mM, or between about 17 mM and 23 mM, or between about 18 mM and 22 mM, or between about 19 mM and 21 mM.

If the content of sodium chloride is too small, the binding force between the nucleic acid and the solid support phase such as silica film is reduced during washing, and nucleic acid may be lost during the washing process. can be dropped

The concentration of Tris-HCl may be about 10 mM to 20 mM, or about 12 mM to 18 mM, or about 14 mM to 16 mM. The pH of Tris-HCl may be about 7.4. The content or concentration of Tris-HCl of the sixth buffer composition may be smaller than the content of Tris-HCl of the second buffer composition.

If the content of Tris-HCl is too small, the buffering effect may be reduced, and if too much, the pH may rapidly increase or other additives may be precipitated.

Method for preparing the seventh buffer composition

The seventh buffer composition may be prepared by mixing ethanol, sodium chloride and Tris-HCl. Molar (mol), volume (ml), and weight (g)-based content and concentration of each component, and replaceable substances are the same as described above.

In an exemplary embodiment, the seventh buffer composition may be prepared by mixing 37.5 ml of 99% ethanol, 0.2 ml of 5M sodium chloride, and 0.75 ml of 1M Tris-HCl (pH 7.4). In this case, the volume of the prepared seventh buffer composition may be about 50ml.

However, the present invention is not limited thereto, and if the above-described molar (mol), volume (ml) and weight (g)-based content can be derived, the weight and volume of each mixing component are not limited. In addition, it goes without saying that the molar concentration (M) of each component can be used as it is or diluted with a commercially available product.

The total amount (volume) of the seventh buffer composition may be about 100 ml or less, or about 90 ml or less, or about 80 ml or less, or about 70 ml or less, or about 60 ml or less, or about 50 ml or less. The lower limit of the total amount of the seventh buffer composition is not particularly limited, but in terms of high-quality nucleic acid extraction, about 300 μl or more, or about 350 μl or more, or about 400 μl or more, or about 450 μl or more, or about 500 μl or more, or at least about 550 μl, or at least about 600 μl, or at least about 650 μl, or at least about 700 μl, or at least about 750 μl, or at least about 800 μl, or at least about 850 μl, or at least about 900 μl, or about 950 μl or more. μl or more, or about 1,000 μl or more.

Nucleic Acid Extraction Method

1 and 2 are flowcharts illustrating a method for extracting nucleic acids according to an embodiment of the present invention.

The nucleic acid extraction method according to the present invention includes the steps of mixing the sample and the first buffer (S10), crushing the sample by further mixing the reducing agent (S20), further mixing the second buffer and culturing it (S30) , further mixing the third buffer, culturing and centrifuging it (S40), further mixing the fourth buffer and centrifuging it (S50), further mixing isopropanol and loading it into the column (S60) and washing with a fifth buffer (S70), washing with a sixth buffer (S80), and washing with a seventh buffer (S90) may be further included.

First, prepare a sample. In an exemplary embodiment, the sample may be derived from a plant, a plant leaf, a plant flesh, a plant stem, and/or a plant root. For example, the plant may be a tough plant rich in polyphenols and polysaccharides such as pear, banana, strawberry, mango, grape, tomato, peach, Arabidopsis or pineapple. As described above, in the conventional nucleic acid extraction method, it is extremely difficult to extract high-quality nucleic acids from tough plants because polyphenols and/or polysaccharides function as inhibitors. However, when the above-described buffer compositions and the nucleic acid extraction method described below are followed, high-quality nucleic acid extraction is possible, the reliability and accuracy of diagnosis results can be increased, and the time required for diagnosis can be significantly shortened.

Then, the sample and the first buffer are mixed (S10). Based on 100 mg of sample, the first buffer may be mixed with about 350 μl to 450 μl, or about 360 μl to 440 μl, or about 370 μl to 430 μl, or about 380 μl to 420 μl, or about 390 μl to 410 μl. have. Since the first buffer has been described above, a redundant description thereof will be omitted.

Then, the reducing agent is further mixed in the tube (S20). The reducing agent may include β-mercaptoethanol (99% solution), 0.5M TCEP-HCl, or 1M dithiothreitol (DTT). The volume ratio of the first buffer and the reducing agent used may be about 1:0.07 to 1:0.16, or about 1:0.08 to 1:0.15, or about 1:0.08 to 1:0.13. For example, the reducing agent may be mixed in about 30 μl to 70 μl, or about 40 μl to 60 μl, or about 50 μl. Reducing agents may contribute to the inactivation of RNA degrading enzymes. After mixing the reducing agent, it is preferable to shake the tube to mix thoroughly.

And shake the tube in which the sample, the first buffer, and the reducing agent are mixed to disrupt the sample. The method of crushing the sample is not particularly limited, and a bead beating tube may be used or a liquid nitrogen crushing method may be used, and may be appropriately selected in consideration of the state of the sample, for example, moisture content.

Then, the second buffer is further mixed in the tube (S30). The used volume ratio of the first buffer and the second buffer may be about 1:1.05 to 1:1.25, or about 1:1.1 to 1:1.2. For example, the second buffer can be mixed between about 400 μl and 500 μl, or between about 410 μl and 490 μl, or between about 420 μl and 480 μl, or between about 430 μl and 470 μl, or between about 440 μl and 460 μl. . Since the second buffer has been described above, a redundant description thereof will be omitted. After mixing the second buffer, it is preferable to shake the tube to mix thoroughly.

And the second buffer mixture is incubated for about 2 minutes to 8 minutes, or about 3 minutes to 7 minutes under the conditions of about 55 ℃ to 65 ℃, or about 60 ℃ (first incubation step).

Mixing the above-mentioned first buffer, mixing the reducing agent, and eluting the nucleic acid through the steps of mixing and incubating the second buffer, and may inactivate the RNA-degrading enzyme, but the present invention is not limited to any theory.

Then, the third buffer is further mixed in the tube (S40). The used volume ratio of the first buffer and the third buffer may be about 1:0.5 to 1:0.9, or about 1:0.6 to 1:0.8, or about 1:0.65 to 1:0.75. For example, the third buffer may be mixed between about 250 μl and 350 μl, or between about 260 μl and 340 μl, or between about 270 μl and 330 μl, or between about 280 μl and 320 μl, or between about 290 μl and 310 μl. . Since the third buffer has been described above, a redundant description thereof will be omitted. After mixing the third buffer, it is preferable to shake the tube to mix thoroughly.

And the third buffer-mixed mixture is incubated at room temperature, for example, at about 20° C. to 30° C. for about 30 seconds to 5 minutes, or about 1 minute to 3 minutes (second incubation step).

Further, the cultured culture is centrifuged (first centrifugation step). Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Alternatively, it may be carried out at a speed of about 12,000 rpm to 17,000 rpm for about 3 minutes to 10 minutes, or about 4 minutes to 7 minutes.

Proteins and polysaccharides may be at least partially removed through the mixing and incubation of the third buffer, but the present invention is not limited to any theory.

Then, the centrifuged supernatant (supernatant in the first centrifugation step), for example, approximately 2.0 ml of the supernatant is taken, put in another tube, and mixed with the fourth buffer (S50). The used volume ratio of the first buffer and the fourth buffer may be about 1:0.8 to 1:1.2, or about 1:0.9 to 1:1.1. In another aspect, the volume ratio of the supernatant of the first centrifugation step and the fourth buffer may be about 1:0.1 to 1:0.3, or about 1:0.15 to 1:0.25. For example, the fourth buffer may be mixed between about 350 μl and 450 μl, or between about 360 μl and 440 μl, or between about 370 μl and 430 μl, or between about 380 μl and 420 μl, or between about 390 μl and 410 μl. . Since the fourth buffer has been described above, a redundant description thereof will be omitted. After mixing the fourth buffer, it is preferable to shake the tube to completely mix it.

And the fourth buffer-mixed mixture is incubated, for example, under the conditions of about 20°C to 30°C for about 30 seconds to 5 minutes, or about 1 minute to 3 minutes (third incubation step).

Further, the cultured culture is centrifuged (second centrifugation step). Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Alternatively, it may be carried out at a speed of about 12,000 rpm to 17,000 rpm for about 1 minute to 8 minutes, or about 2 minutes to 5 minutes.

Polyphenols may be at least partially removed through the steps of mixing and incubating the above-described fourth buffer, but the present invention is not limited to any theory.

Then, the centrifuged supernatant (supernatant of the second centrifugation step), for example, approximately 900 μl to 1,100 μl of the supernatant is taken, placed in another tube, and mixed with isopropanol (S60). The mixing amount of isopropanol may be about 400 μl to 600 μl, or about 450 μl to 550 μl. For example, the mixing ratio (v/v) of the supernatant of the second centrifugation and isopropanol may be about 1:1.5 to 1:2.5, or about 1:1.8 to 1:2.3, or about 1:2.0. After mixing isopropanol, it is preferable to shake thoroughly to mix.

And the isopropanol mixture is loaded into the column. For example, an isopropanol mixture can be loaded onto a spin column to initiate extraction of nucleic acids. The step of loading the column may be divided into two or more steps. The column may be a nucleic acid adsorbent column packed with cationic metal beads, or cationic adsorbent fibers.

However, the present invention is not limited thereto, and an ethanol precipitation method, a nucleic acid precipitation method, or a magnetic bead method may be used instead of the recovery using a column.

Then, it is washed with a fifth buffer (S70). The amount of the fifth buffer used for washing may be about 500 μl or more, or about 600 μl or more, or about 700 μl or more, or about 800 μl or more, or about 900 μl or more, or about 1,000 μl or more. The upper limit of the amount of the fifth buffer is not particularly limited, but may be about 1,500 μl or less. Since the fifth buffer has been described above, a redundant description thereof will be omitted.

Washing may be performed via centrifugation. Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Or about 10 seconds to 60 seconds, or about 20 seconds to 50 seconds, or about 30 seconds to 40 seconds at a speed of about 12,000 rpm to 17,000 rpm may be performed.

Although the pigment of the sample may be removed through this step, the present invention is not limited to any theory.

In some embodiments, after the washing step using the fifth buffer, DNA degrading enzyme (DNAse) treatment may be further performed. A well-known method can be used about DNA-degrading enzyme treatment, treatment conditions, etc. Genomic DNA can be removed using a DNA degrading enzyme.

Then, it is washed with a sixth buffer (S80). The amount of the sixth buffer used for washing may be about 500 μl or more, or about 600 μl or more, or about 700 μl or more, or about 800 μl or more, or about 900 μl or more, or about 1,000 μl or more. The amount of the sixth buffer may be smaller than the amount of the fifth buffer. The upper limit of the amount of the sixth buffer is not particularly limited, but may be about 1,500 μl or less. Since the sixth buffer has been described above, a redundant description thereof will be omitted.

Washing may be performed via centrifugation. Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Or about 10 seconds to 60 seconds, or about 20 seconds to 50 seconds, or about 30 seconds to 40 seconds at a speed of about 12,000 rpm to 17,000 rpm may be performed.

In some embodiments, the method may further include waiting for a predetermined time before centrifugation after loading the sixth buffer. For example, centrifugation may be performed after waiting for about 10 seconds to 60 seconds, or about 20 seconds to 50 seconds, or about 30 seconds to 40 seconds.

Although the decomposed DNA and DNA degrading enzyme may be removed through this step and the remaining total RNA may be recombined, the present invention is not limited to any theory.

Then, it is washed with a seventh buffer (S90). The amount of the seventh buffer used for washing may be about 500 μl or more, or about 600 μl or more, or about 700 μl or more, or about 800 μl or more, or about 900 μl or more, or about 1,000 μl or more. The amount of the seventh buffer may be smaller than the amount of the fifth buffer. The upper limit of the amount of the seventh buffer is not particularly limited, but may be about 1,500 μl or less. Since the seventh buffer has been described above, a redundant description thereof will be omitted.

Washing may be performed via centrifugation. Centrifugal separation is performed under conditions of 0°C to 10°C, or about 2°C to 8°C, or about 3°C to 7°C, or about 4°C to 6°C, about 10,000 rpm to 20,000 rpm, or about 11,000 rpm to 18,000 rpm, Or about 10 seconds to 60 seconds, or about 20 seconds to 50 seconds, or about 30 seconds to 40 seconds at a speed of about 12,000 rpm to 17,000 rpm may be performed.

In some embodiments, the washing step using the seventh buffer may be performed multiple times. That is, centrifugation may be performed after loading the seventh buffer, and centrifugation may be performed after loading the seventh buffer again, but the present invention is not limited thereto.

The remaining salt may be removed through this step, but the present invention is not limited to any theory.

Thereafter, although not shown in the drawings, the nucleic acid recovery or can be extracted.

Virus diagnosis

After the nucleic acid is extracted according to the present invention, the presence or absence of a virus can be diagnosed. As the amplification method for diagnosing the presence or absence of a virus, a known amplification method, for example, PCR method, nested-PCR method, RT-PCR method, ICAN method, UCAN method, LAMP method, etc. can be used.

The PCR method is a method of amplifying a corresponding DNA region by repeating a DNA synthesis reaction by two types of primers and a DNA polymerase sandwiched between a specific DNA region. In some cases, nested-PCR method and real-time PCR method It can be used as an inclusive term, and when RNA is used as a starting material (reverse transcription), RNA can be synthesized into DNA by performing an RT step.

The nested-PCR method is a method of performing two-step PCR using an outer primer and an inner primer. Even when the target nucleic acid is not sufficiently amplified in the first round, it is possible to further amplify it in the second round. In addition, when non-specific amplification products are generated in the first PCR, the probability that these non-specific amplification products have a similar sequence to the primers in the second PCR is low, and therefore, in the second PCR, the probability of amplifying only the fragment having the sequence of the target is low can rise RT-PCR is a PCR method that includes performing a reverse transcription reaction using a reverse transcriptase as a previous step of PCR.

After amplification of the nucleic acid, a step of detecting whether the target DNA is present in the amplified nucleic acid sample by mixing a diagnostic reagent may be performed. The detection step is performed using reagents used in probe assay, hybridization assay, oligonucleotide ligation assay, PCR (polymerase chain reaction), LCR (ligase chain reaction), etc. can be performed.

In addition, the detection of the target DNA may be performed through a DNA chip, gel electrophoresis, radiometric measurement, fluorescence/phosphorescence measurement, etc., of course, the present invention is not limited thereto.

Viruses to be detected include apple necrosis virus (NC040469, NC040470, NC040471, etc.), banana bunchy top virus (NC003473, NC003474, NC003475, NC003476, NC003477, NC003479, etc.), cherry leaf roll virus (NC015414, NC015415, etc.), cherry necrotic rusty mottle Virus (NC002468, etc.), citrus psorosis virus (NC006314, NC006315, NC006316, etc.), citrus ringspot virus (NC003093, etc.), citrus vein enation virus (NC021564, etc.), grapevine fanleaf virus (NC003615, NC003623, etc.), peach phony virus, peach rosette mosaic virus, peach wart virus, plum line pattern virus (NC003451, NC003452, NC003453, etc.), prune dwarf virus (NC008037, NC008038, NC008039, etc.), raspberry ringspot virus (NC005266, NC005267, etc.), tomato black ring virus (NC004439, NC004440, etc.), or tomato bushy stunt virus (NC001554, etc.), but the present invention is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to experimental examples.

Example 1. Preparation of buffer

Example 1-1. Preparation of first buffer

25ml of 2M Tris-HCl (pH 7.0), 2.5ml of 0.5M EDTA, 0.25g of sodium metabisulfite (powder), and 1.0g of PVP K30 (powder) were mixed to make a final volume of 50ml. The pH of the first buffer was in the range of 7.0 to 7.4.

Example 1-2. Preparation of the second buffer

12.5ml of 20% SDS, 2.5ml of 0.5M EDTA, 1.93g of sodium citrate (powder), and 1.0ml of 1M Tris-HCl (pH 7.4) were mixed to make a final volume of 50ml. The final pH of the second buffer was in the range of 7.0 to 7.4.

Examples 1-3. Preparation of the third buffer

45 ml of 5M sodium chloride, 0.37 g of potassium chloride (powder), 1.93 g of sodium citrate (powder), and 1.0 g of PVP K30 (powder) were mixed to make a final volume of 50 ml. The final pH of the third buffer was in the range of 7.0 to 7.4.

Examples 1-4. Preparation of the fourth buffer

19.1 g of guanidine hydrochloric acid (Gu-HCl) (powder) was mixed with 0.75 ml of 1M Tris-HCl (pH 7.4), and the final volume was 50 ml. The final pH of the fourth buffer was in the range of 7.0 to 7.4.

Examples 1-5. Preparation of the fifth buffer

30 ml of 99% isopropanol solution, 1.5 ml of 5M sodium chloride, and 10 μl of 99% Tween-21 solution were mixed so that the final volume was 50 ml. The final pH of the fifth buffer was in the range of 7.0 to 7.4.

Example 1-6. Preparation of the sixth buffer

30ml of 99% ethanol solution, 7.976g of guanidine hydrochloric acid (Gu-HCl) (powder), and 0.75ml of 1M Tris-HCl (pH 7.4) were mixed so that the final volume was 50mL. The final pH of the sixth buffer was in the range of 7.0 to 7.4.

Example 1-7. Preparation of the seventh buffer

37.5ml of 99% ethanol solution, 0.2ml of 5M sodium chloride, and 0.75ml of 1M Tris-HCl (pH 7.4) were mixed so that the final volume was 50mL. The final pH of the seventh buffer was in the range of 7.0 to 7.4.

Example 2. RNA extraction

Example 2-1. Sample preparation and first buffer mixing

As samples, leaves of mango, strawberry, grape, tomato, peach, banana, and pear were prepared. Then, 100 mg of the target sample, 400 μl of the first buffer, and 50 μl of 99% β-mercaptoethanol were put into a bead beating tube (2 ml) and disrupted at 5 m/s for 60 seconds. After strongly vortexing, spin-down was performed.

Example 2-2. Second Buffer Mix

450 μl of the second buffer was added to the result of Example 2-1, vortexed strongly, and incubated at 60° C. for 5 minutes.

Example 2-3. 3rd Buffer Mix

300 μl of the third buffer was added to the resultant of Example 2-2, vortexed strongly, and incubated at room temperature for 1 minute. And the culture was centrifuged for 5 minutes at 13,000rpm at 4 ℃.

Example 2-4. 4th buffer mix

The entire amount of the supernatant of the result of Example 2-3 was transferred to a 2ml tube. Then, 400 μl of the fourth buffer was added, vortexed strongly, and incubated for 1 minute at room temperature. And the culture was centrifuged for 5 minutes at 13,000rpm at 4 ℃.

Example 2-5. Loading the isopropanol mixture and washing the fifth buffer

900 μl of the supernatant of the result of Example 2-4 was transferred to a 2 ml tube. Then, 450 μl of isopropanol was added and vortexed strongly.

Then, each 600 μl of the spin column was loaded and centrifuged. Then, 700 μl of the fifth buffer was added, followed by centrifugation at 4° C. at 13,000 rpm for 30 seconds, followed by washing once.

Example 2-6. DNase treatment and 6th buffer wash

Then, 50 uL of DNAse solution (DNase 5 to 10 units, DNase buffer) is added to the spin column membrane through which the fifth buffer has passed, and then reacted at room temperature for 15 minutes. After completion of the reaction, 600 μl of the sixth buffer was added, waited for 60 seconds, and then centrifuged at 13,000 rpm at 4° C. for 30 seconds, followed by washing once.

Example 2-7. 7th Buffer Wash

Then, after adding 600 μl of the 7th buffer, it was washed by centrifugation at 4° C. at 13,000 rpm for 30 seconds. This was repeated once more for a total of 2 washes.

Examples 2-8. Nucleic Acid Recovery and Electrophoresis

Then, centrifugation was performed at 13,000 rpm at 4° C. for 2 minutes, 50 μl of RNAse free water was added, and centrifugation was performed at 4° C. at 13,000 rpm for 30 seconds. 200ng of the recovered RNA was quantified on a Bleach gel composed of 2% Agarose and 0.5X TBE and electrophoresed. The results are shown in FIG. 3 .

Referring to FIG. 3 , when the buffers and extraction method according to the present invention are used, it can be confirmed that nucleic acids of excellent quality are extracted from all 7 target samples.

Comparative Example 1. Nucleic acid recovery using a third-party product

Comparative Example 1-1. QIAGEN N.V.

QIAGEN N.V. Mango (MG), strawberry (SB), grape (GV), tomato (TM), peach (PC), banana (BN), pear tree (PA), red pepper ( PP) was extracted, and the result of electrophoresis of the extracted nucleic acid is shown in FIG. 4 .

Referring to FIG. 4 , except for tomato (TM) and peach (PC), the quality and yield of the extracted RNA were low and showed degradation.

That is, using the RNeasy plant mini kit commercially available from Qiagen, it could not be universally applied to various plants.

Comparative Example 1-2. Norgen Biotek Corp.

Norgen Biotek Corp. Mango (MG), strawberry (SB), grape (GV), tomato (TM), peach (PC), banana (BN), Nucleic acids were extracted from pear tree (PA) and red pepper (PP), and the result of electrophoresis of the extracted nucleic acid is shown in FIG. 5 .

Referring to FIG. 5 , the nucleic acid was decomposed in mango (MG). In the case of pear tree (PA), products other than nucleic acids are extracted together and the band is attracted, and in the case of red pepper (PP), RNA of larger molecules such as 28S rRNA was completely degraded.

That is, it could not be universally applied to various plants using a plant nucleic acid purification kit (Plant RNA/DNA Purification Kit) commercially available from Norgen Biotech.

Comparative Example 2. Nucleic acid recovery from red pepper leaves

Nucleic acid was extracted and electrophoresis was performed in the same manner as in Example 2, except that red pepper leaf was used as a sample. And the result is shown in FIG.

Referring to FIG. 6 , even when nucleic acid extraction was attempted in the same manner as in Example 2, the quality and yield of the extracted RNA was low and showed a decomposed aspect.

Comparative Example 3. Performed by adjusting some buffer concentrations and sequences

Comparative Example 3-1. Example 2-2 omitted (Sample 1)

Using a banana sample, nucleic acid recovery and electrophoresis were performed in the same manner as in Example 2, except that Example 2-3 was immediately performed without mixing the second buffer, and the results are shown in Sample 1 of FIG. .

Comparative Example 3-2. Changing the order of Examples 2-2 and 2-3 (Sample 2)

Using a banana sample, nucleic acid recovery and electrophoresis were performed in the same manner as in Example 2, except that the order of Examples 2-2 and 2-3 was changed, and the results are shown in Sample 2 of FIG. .

Comparative Example 3-3. Changing the composition of the third buffer (Sample 3)

Using a banana sample, nucleic acid recovery and electrophoresis were performed in the same manner as in Example 2, except that 3M NaOAc was used instead of 4.5M sodium chloride in Example 2-3, and the results were shown in Sample 3 of FIG. shown in

For reference, sample 4 is a result of an experiment unrelated to the present invention.

Comparative Example 3-4. Homogenization with third buffer (Sample 5)

Using a banana sample, the same method as in Example 2, except that the third buffer was used instead of the first buffer in Example 2-1, and the first buffer was used instead of the third buffer in Example 2-3. nucleic acid recovery and electrophoresis, and the results are shown in Sample 5 of FIG. 7 .

For reference, sample 6 is a result of an experiment unrelated to the present invention.

Referring to FIG. 7 , it can be confirmed that RNA is completely degraded in all samples.

Comparative Example 4. Performed by adjusting the composition of the buffer

In the fourth buffer of Example 2-4, nucleic acid was recovered and electrophoresed in the same manner as in Example 2, except that guanidinethiocyanate was used instead of guanidine hydrochloride, and the results are shown in FIG. 8 .

Referring to FIG. 8 , it was confirmed that RNA was degraded in all samples and the RNA yield was low.

Comparative Example 5. Performed by omitting the heating process

In Example 2-2, nucleic acid was recovered and electrophoresed in the same manner as in Example 2, except that heating at 60° C. was omitted, and the results are shown in FIG. 9 .

Referring to FIG. 9 , it can be seen that the amount of RNA extracted from strawberries (SB) and grapes (GV) was significantly reduced.

Experimental Example 1. Measurement of RNA purity and extraction amount

According to the method of Example 2, Comparative Example 1-1 and Comparative Example 1-2 described above, the purity and extraction amount of the nucleic acids were measured. And the results are shown in FIGS. 10 to 12, respectively.

RNA and DNA strongly absorb 260 nm, which is a wavelength of ultraviolet light, proteins and phenols strongly absorb a wavelength of 280 nm, and salts, carbohydrates and phenols strongly absorb a wavelength of 230 nm. The absorbance of the extracted RNA can be measured based on pure water with a UV spectrometer. A value obtained by dividing absorbance at 260 nm by 230 or 280 is defined as A260/A230 or A260/A280, respectively.

If the absorbance value of 260 is about 2 times higher than that of 230 or 280, it can be considered as pure RNA, and the more the sample is contaminated, the lower the value. For example, when contamination with guanidine salt or phenol increases the absorbance at 230 nm, and especially when contamination with phenol increases, the absorbance at 260 nm increases, which may be overestimated compared to the actual amount of extracted RNA. That is, when high-purity RNA is extracted, the value of A260/A230 or A260/A280 is between 2.0 and 2.2.

Referring to FIG. 10, all of mango (MG), strawberry (SB), grape (GV), tomato (TM), peach (PC), banana (BN) and pear (PA) were higher than those of commercial kits as a comparison group or , showed at least a similar level of quality and recovery. In particular, it is confirmed that the absorbance ratio is 2.0 or higher in all samples, which means that high-quality nucleic acids can be extracted.

On the other hand, referring to FIGS. 11 and 12 , Qiagen's kit succeeded in extracting RNA from tomatoes, peaches, and strawberries, but showed low quality and recovery rates from mango, grapes, bananas, and pears. In addition, Norgen's kit showed low quality and recovery rate in mango and red pepper.

Experimental Example 2. RNA amplification curve and melting curve

To evaluate whether the RNA extracted in Example 2 is suitable for downstream analysis such as qPCR, 1ug of total RNA was reverse transcribed to make cDNA, and then the house-keeping gene of each sample was PCR amplified.

For cDNA synthesis, 1 μg of total RNA was added using AccuPower® CycleScript™ RT PreMix (dN6) (Bioneer, Daejeon, South Korea) according to the manufacturer's protocol. The synthesized cDNA was diluted 10-fold and used as a template.

Then, a gene with a low expression level was selected through a literature search. Genes and their primer sequences used for real-time PCR analysis are summarized in Table 1 below.

botanical name Forward primer Reverse primer references Mango >ACT7CGTTCTGTCCCTCTATGCCA
>GAPDH
GTGGCTGTTAACGATCCCTT >ACT7
AGATCACGGCCAGCAAGATC
>GAPDH
GTGACTGGCTTCTCATCGAA (Islas-Osuna et al., 2019) Strawberry >18STGTGAAACTGCGAATGGCTCATTAA
>GAPDH
GAGTCTACTGGAGTGTTCA
>ACTIN2
GCTAATCGTGAGAAGATGAC >18S
GAAGTCGGGATTTGTTGCACGTATT
>GAPDH
CTTGTATTCGTGCTCATTCA
>ACTIN2
AGCACAATACCAGTAGTACG (Zhang et al., 2018) Grapevine >VvCYPACAGCCAAGACCTCGTG
>VvACT
GACTACCTACAACTCCATCAT >VvCYP
GCCTTCACTGACCACAAC
>VvACT
TCATTCTGTCAGCAATAACCA (Borges et al., 2014) Tomato >EF1aGGTGGTTTTGAAGCTGGTATCTCC
>GAPDH
CTGCTCTCTCAGTAGCCAACAC
>CAC
CCTCCGTTGTGATGTAACTGG >EF1a
CCAGTAGGGCCAAAGGTCACA
>GAPDH
CTTCCTCCAATAGCAGAGGTTT
>CAC
ATTGTGGAAAGTAACATCATCG (M*?*ller et al., 2015) Peach >Got1GTTGGCAGTTGGAAGCACAGC
>GAPDH
TTTGAAGGGTGGAGCGAAGAAGG >Got1
AAATAAGGGCGCAGACCTCACAT
>GAPDH
ATGGAGTGAAACGGTGGTCATCAG (Bastias et al., 2020) Banana >ACT1pp2GAGCGGAAAGTACAGTGTCTGG
>EF1a
CGGAGCGTGAAAGAGGAAT
>GAPDH
CATCAAGCAAGGACTGGAGAG >ACT1pp2
AGAAGCACTTCCTGTGGACAA
>EF1a
ACCAGCTTCAAAACCACCAG
>GAPDH
AAGCAGGGAGAACTTTTCCAA (Podevin et al., 2012, Rego et al., 2019) Pear >ACTIN2CTCCCAGGGCTGTGTTTCCTA
>Histone H3
GTCAGAAGCCCCACAGATAC >ACTIN2
CTCCATGTCATCCCAGTTGCT
>Histone H3
CTGGAAACGCAGATCAGTCTTG (Liu et al., 2018)

Real-time PCR was performed from the prepared cDNA using primers specific to the reference gene. Realtime PCR was performed using qTower3 (Analytik jena, Jena, Germany) equipment. PCR mix is 2X SFC green qPCR master mix (SFC Co., Ltd., Chungbuk, South Korea) 10 μl, template 5 μl, primer mix (forward and reverse each 10uM) 2 μl, RNase free water 3 μl in 1 reaction It was triplicated, and after heating at 95°C for 5 min for heat activation and pre-denuature, 45 cycles were repeated at 95°C, 15 sec, 58°C 15 sec, 72°C (FAM fluorescence detection) for 20 sec.

In order, ACT7 and GAPDH from mango (Islas-Osuna et al. , 2019), 18S rRNA, GAPDH and Actin2 from strawberry (Zhang et al. , 2018), and VvCYP and VvACT from grapes (Borges et al. , 2014) tomato GAPDH, CAC, and EF1a in (Muller et al. , 2015) GAPDH and Got1 in peach (Bastias et al. , 2020) and ACT1pp2, GAPDH and EF1a in banana (Podevin et al. , 2012, Rego et al. , 2019), Histone H3 and Actin2 (Liu et al. , 2018) were selected in the embryo. (Cheng et al. , 2017, Muller et al. , 2015)

And the results are shown in FIGS. 13 to 19 . 13 to 19 , each gene was amplified and fluorescence values were measured above the baseline threshold, and typical patterns observed in the normal realtime PCR amplification process, initiation phase, exponential phase, and linear phase were observed.

After the PCR step was completed, the FAM fluorescence was detected by heating at 95°C for 1 minute and then holding at 0.5°C for 15 seconds from 65°C to 95°C for 15 seconds for analysis of the melting curve. (Ririe et al. , 1997) As a result of melting curve analysis to confirm the contamination of genomic DNA or the formation of non-specific PCR products, it was confirmed that the melting temperature of each PCR product was from a minimum of 78.62°C to a maximum of 85.48°C, and the melting curve Also, all of the single peaks were formed without peaks suspected of gDNA contamination or formation of non-specific products.

In the above, the embodiment of the present invention has been mainly described, but this is only an example and does not limit the present invention. It will be appreciated that various modifications and applications not exemplified above are possible.

Therefore, it should be understood that the scope of the present invention includes changes, equivalents or substitutes of the technical idea exemplified above. For example, each component specifically shown in the embodiment of the present invention may be implemented by modification. And differences related to such modifications and applications should be construed as being included in the scope of the present invention defined in the appended claims.

Claims (12)

A method for extracting nucleic acids from a sample derived from an orchard comprising pear, banana, strawberry, mango, grape, tomato, peach, Arabidopsis, or pineapple, the method comprising:
mixing a first buffer comprising Tris-HCl (tris(hydroxymethyl)aminomethane-HCl) and ethylene diamine tetraacetic acid (EDTA) with the sample;
further mixing a second buffer including sodium dodecyl sulfate (SDS), EDTA, sodium citrate and Tris-HCL;
Further mixing a third buffer containing sodium chloride (NaCl);
A fourth buffer containing guanidine hydrochloric acid (Gu-HCl) and Tris-HCl is mixed with the sample and centrifuged; and
Comprising the step of loading at least a portion of the centrifuged supernatant into a column,
Each of the above steps is performed sequentially. According to claim 1,
The method of extracting a nucleic acid, wherein the first buffer does not contain at least guanidine salt, chloroform and cetyltrimethylammonium bromide. According to claim 1,
The first buffer is
0.8M to 1.2M of the Tris-HCl and
The ethylene diamine tetraacetic acid (Ethylenediaminetetraacetic acid, EDTA) is contained in an amount of 20 mM to 30 mM,
0.3% (w/v) to 0.7% (w/v) sodium metabisulfite, sodium sulfite, acid sodium sulfite or sodium sulfate, and
A method of extracting a nucleic acid further comprising 1.8% (w/v) to 2.2% (w/v) of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol. According to claim 1,
The second buffer is
3% (w / v) to 8% (w / v) of the SDS,
20 mM to 30 mM of the EDTA;
120 mM to 180 mM of the sodium citrate, and
A method of extracting a nucleic acid comprising the Tris-HCl in an amount of 15mM to 25mM. According to claim 1,
The third buffer contains the sodium chloride in an amount of 4.2M to 4.8M,
80 mM to 120 mM potassium chloride, calcium chloride, ferric chloride, ferrous chloride, ammonium aluminum or ammonium sulfate, and
1.8% (w / v) to 2.2% (w / v) of polyvinylpyrrolidone, polyvinylpolypyrrolidone or polyethylene glycol, further comprising a method of extracting a nucleic acid. According to claim 1,
The fourth buffer,
3.5M to 4.5M of the guanidine hydrochloride,
A method of extracting a nucleic acid comprising the Tris-HCl in an amount of 10 mM to 20 mM. According to claim 1,
The used volume ratio of the first buffer and the second buffer is 1:1.1 to 1:1.2,
The used volume ratio of the first buffer and the third buffer is 1:0.6 to 1:0.8,
The used volume ratio of the first buffer and the fourth buffer is 1:0.9 to 1:1.1,
The volume of the first buffer used is 350 μl to 450 μl. According to claim 1,
The step of mixing the first buffer with the sample,
mixing 40 μl to 60 μl of the first buffer, the sample and the reducing agent, and
Comprising the step of crushing the sample,
The reducing agent includes β-mercaptoethanol (beta-mercaptoethanol), 0.3M to 0.7M of TCEP-HCl, or 0.8M to 1.2M of dithiothreitol (DTT),
The volume ratio of the first buffer and the reducing agent used is 1:0.08 to 1:0.15. According to claim 1,
A first incubation step of culturing the mixture at 55°C to 65°C for 2 minutes to 8 minutes after mixing the second buffer and before mixing the third buffer; and
After mixing the third buffer and before mixing the fourth buffer, further comprising a second incubation step of incubating the mixture for 30 seconds to 5 minutes,
The step of loading on the column, the supernatant of the centrifugation step and isopropanol (isopropanol) by mixing the step of loading the column to the extraction method of the nucleic acid. 10. The method of claim 9,
After the step of loading the column,
a first washing step of washing the column with a fifth buffer containing isopropanol and sodium chloride;
a second washing step of washing the column with a sixth buffer containing ethanol, Tris-HCl and guanidine-hydrochloric acid;
a third washing step of washing the column with a seventh buffer containing ethanol and Tris-HCl; and
A method of extracting nucleic acids further comprising sequentially recovering the nucleic acids. delete delete

Images