KR20220149781A - USE OF EXOSOME-BASED DELIVERY OF NF-κB INHIBITORS - Google Patents

Abstract

The present disclosure relates to methods of treating acute kidney injury using exosomes containing NF-κB inhibitors. The present disclosure relates to methods of treating diseases caused by sepsis using exosomes containing NF-κB inhibitors.

Description

USE OF EXOSOME-BASED DELIVERY OF NF-κB INHIBITORS

The present disclosure relates to a method of treating acute kidney injury using an exosome containing an inhibitor of NF-κB. The present disclosure relates to methods of treating diseases caused by sepsis using exosomes containing NF-κB inhibitors.

AKI not only contributes to short-term side effects, but survivors can develop chronic kidney (CKD) and end-stage renal disease (ESRD). As one of the most important components of pathogenesis, systemic inhibition of NF-κB affects the severity of AKI. In a folate-induced disease model, inhibition of NF-κB alleviates AKI-damage by reducing RelA and NF-κB2 activation.

More than 800 synthetic and natural materials are known to be involved in part in the regulation of activation of NF-κB. Several studies have shown that blockade of NF-ĸB signaling, such as renin-angiotensin-aldosterone system (RAAS) blockers or tumor necrosis factor-α (TNF-α) blockers, can alleviate kidney damage. However, their mechanism of action is multifaceted and lacks specificity. Recent advances in nano-technology have made it possible to produce nanoparticles or specific gene sequences that target NF-ĸB signaling. However, NF-ĸB inhibitors have not yet been commercially approved for human use.

Uncontrolled inflammation is a prominent feature of the sepsis response. Host-pathogen interactions mediated by Toll-like receptors (TLRs) stimulate the production of pro-inflammatory cytokines, chemokines and immune-activating molecules. This proinflammatory response is followed by a compensatory immunosuppressive response involving various quantitative and functional defects of immune cells. Pathogen-induced cellular transformation involves significant changes in host gene expression, using the nuclear factor kappa-B (NF-κB) transcription factor, which plays a pivotal role in regulating these changes. Several cytokines under the regulatory control of NF-κB, including tumor necrosis factor (TNF)-α and interleukin (IL)-1, can induce further activation of these transcription factors, enhancing the inflammatory response and septic shock. In addition, NF-κB is mainly involved in the apoptotic response by enhancing the transcription of anti-apoptotic genes such as Bcl-xL, A1 and A20. Thus, inflammation associated with NF-κB activation can be exacerbated by two interacting mechanisms: increased expression of proinflammatory mediators and extended lifespan of cell populations such as neutrophils, which are activated to release proinflammatory molecules. and is directly involved in the acute inflammatory process.

There are various diseases such as pneumonia caused by sepsis, cytokine storm syndrome, respiratory distress syndrome, and organ failure. Sepsis is a systemic inflammatory syndrome caused by activation of the innate immune system due to acute microbial infection and is a major cause of mortality in intensive care units. Moreover, there are various diseases caused by sepsis with widely different symptoms, some of which are fatal. Unfortunately, conventional treatments for sepsis (ie, antibiotics) may not be effective in treating different diseases caused by sepsis, such as cytokine syndrome or damaged organs. Currently, there is no clinically available treatment for diseases caused by sepsis. Therefore, there is an urgent need to develop an effective alternative therapy. More than 700 inhibitors have been reported for NF-κB, but no inhibitors have been approved as therapeutics to date. Additionally, although various steroidal and nonsteroidal anti-inflammatory agents are known to block NF-κB, their effects are not specific to inhibiting NF-κB.

Successful gene and drug delivery requires the selection of an appropriate vector to stably deliver the target molecule to the site of action without adversely affecting the recipient. Various types of vectors, including recombinant adenoviruses, liposomes, ligand-conjugated nanoparticles and ultrasonic microbubbles, have been reported to be effective for drug delivery due to their stability and high loading capacity. However, certain concerns and limitations have been associated with their use. Although they were rapidly recognized and eliminated by the reticuloendothelial system, non-uniform particle size and non-specific absorption patterns limited their use as bio-carriers. The high immunogenicity of adenoviral vectors can elicit an immune response after administration, and the virus itself can be toxic at high doses. The use of liposomes can also induce adverse immunogenicity and non-IgE-mediated hypersensitivity reactions.

Current conventional strategies for delivering therapeutic proteins include the enveloping of proteins in synthetic nanoparticles. The most preferred protein delivery systems are liposomes and polymeric nanoparticles (PNPs). Liposomes are synthetic vesicles with phospholipid membranes that self-assemble into various sizes and shapes in an aqueous environment. PNP is a solid colloidal particle having a size of 10 to 1000 nm, and a cargo protein is entrapped, encapsulated or attached to a nanoparticle matrix. Biodegradable polymer (biodegradable polymer) is composed of However, liposomes tend to fuse or aggregate with each other, resulting in premature release of the liposome cargo over time. Although PNPs may have better stability than liposomes, biocompatibility and long-term potential safety are still issues. In addition, encapsulating proteins into liposomes and PNPs requires the production of synthetic or recombinant proteins and an in vitro encapsulation process, and EXPLOR technology is a stable cell capable of generating cargo-loading exosomes through natural exosome biosynthesis. requires the creation and maintenance of In addition, exosomes possess many desirable characteristics of an ideal protein delivery system, such as biocompatibility, minimal or no inherent toxicity, long half-life in circulation, and unique ability to target tissues.

Recently, exosomes have received considerable attention as novel bio-carriers for gene/drug delivery. Exosomes are extracellular vesicles (EVs) that play an important role in intercellular communication by delivering bioactive substances to recipient cells or by influencing signaling pathways in target cells. Exosomes are easier to store and exhibit greater stability than other bioactive agents. Exosomes have a high ability to overcome biological barriers and can carry surface molecules that target specific cell types, thus causing fewer off-target effects.

The present disclosure provides a method of treating acute kidney injury (AKI) in a patient in need thereof comprising administering to the subject an effective amount of a composition comprising exosomes comprising an NF-κB inhibitor.

The present disclosure also provides a method of treating a disease caused by sepsis in a subject in need thereof, comprising administering to the subject an effective amount of a composition comprising exosomes comprising an NF-κB inhibitor.

Figure 1. Characterization of engineered exosomes produced from HEK293T.
(A) Schematic of the DNA construct used for the production of super-repressor IκB loading exosomes (exo-srlκB) (top), and cargo protein-retaining using photoreversible protein-protein interactions Biosynthesis of exosomes, the so-called EXPLOR technology (bottom). (B) Representative TEM images of exo-naive and exo-srlκB. Scale bar: 100 nm. (C) Concentration and size distributions of exo-naive (top) and exo-srlκB (bottom) were determined by the Zetaview instrument. (D) Target proteins (srlκB, mCherry, CD9 and GFP), exosome positive markers (CD63, TSG101, Alix and GAPDH) and exosome negative markers (cell organelle markers; prohibitin, calnexin, GM130 and nucleoporin) p62) immunoblotting of HEK293T cells and HEK203T cell-derived exosomes to analyze the expression. Naive cells and exo-naive were used as negative controls for exo-srlκB.
Figure 2. Renal protective effect of exo-srlκB after renal IRI.
(A) Experimental schematic of renal IRI surgery and exosome delivery. Each group of mice was intraperitoneally injected with 3×10 ⁹ pn of exo-naive or exo-srIκB 3 times at 1 hour intervals (total of 9×10 ⁹ pn). Mice were sacrificed 24 or 48 hours after IRI surgery and serum and tissues were collected for further evaluation. (BD) Serum levels of BUN, creatinine, and NGAL (24 h and 48 h) between different groups depending on treatment type (exo-naive vs. exo-srlκB), drug delivery time (pre- vs. post-treatment) and follow-up time points, which are exo -Shows renal protective effect of srIκB treatment (pretreatment 24-h, n=10; pretreatment 48-h, n=4-5; post-treatment 24-h, n=5-10; post-treatment 48-h, n= 4-11). (E) Left: Representative PAS staining images of cortical tubular cells in each group of kidney sections. normal proximal canal brush border ( ^* ) or loss of brush border (o); chromatin condensation (black arrow); denuded basement membrane (black arrow); vacuolization (yellow arrow); Scale bar, 100 μM. Right: Pathological ductal injury; Multiple kidney samples from each group showed less vascular damage with exo-srlκB treatment than with exo-naive treatment (pretreatment 24-h, n=5; post-treatment 24-h, n=5) ). Comparisons between groups were assessed using one-way ANOVA with Bonferroni's post hoc test. Data are presented as mean±SD values. ***P <0.001, comparing exo-naive-sham and exo-naive-IRI surgical groups. #P<0.05 and ###P<0.001, when comparing exo-naive-IRI and exo-srlκB-IRI surgical groups.
Figure 3. Inhibition of IRI induced NF-κB activation after exo-srlκB treatment.
(A) Western blot analysis of NF-ĸB p65 expression using kidney nuclear extracts from each experimental mouse group. Nuclear extracts were biochemically isolated from the cytoplasmic fraction, and NF-ĸB p65 and lamin B1 expression were analyzed by Western blotting. IRI-induced activation of NF-ĸB signaling was significantly inhibited by exo-srlĸB treatment before and after surgery. (B) The increased DNA binding activity of NF-ĸB p65 after renal IRI was inhibited by exo-srlĸB treatment before and after surgery. (C) Left: Representative IHC images with NF-κB p65 antibody from each treatment group. Scale bar, 50 μM. Right: Graph showing immunohistochemical detection of NF-ĸB p65 in each experimental group. Treatment with exo-srlĸB decreased NK-ĸB expression compared to the control group (pretreatment 24-h, n=5-8; pretreatment 48 h, n=4-5; post-treatment 24-h, n =5-10; post-treatment 48-h, n=4-11). Comparisons between groups were assessed using one-way ANOVA with Bonferroni's post hoc test. Data are presented as mean±SD values. **P<0.01, ***P<0.001, comparing exo-naive-sham and exo-naive-IRI surgical groups. #P<0.05, ##P<0.01, ###P<0.001, when comparing the exo-naive-IRI surgical group and the exo-srIκB-IRI surgical group.
Figure 4. Expression of pro-inflammatory cytokines/chemokines and adhesion molecules is adversely affected by exo-srlĸB treatment locally and systemically.
(A) Whole kidney lysates from each experimental group were subjected to qRT-PCR to measure the expression levels of proinflammatory cytokines, including IL-1β, IL-6, Tnf-α, Ccl2, Ccl5, and Cxcl2. did. The mRNA levels of these genes were significantly increased after IR injury in the kidney, and this effect was alleviated with exo-srlĸB treatment (pretreatment 24-h, n=5-8; pretreatment 48-h, n=4-5; post-treatment) treatment 24-h, n=5-10; post-treatment 48-h, n=4-11). (B) Multiple cytokine studies using sera from each experimental group also showed a similar trend for pro-inflammatory cytokine levels in the post-ischemic mouse group by exo-srIĸB treatment. (C) qRT-PCR data show increased levels of Icam-1 mRNA and significant reduction of Icam-1 mRNA by exo-srlĸB treatment in the post-ischemia exo-naive treatment group. (D) Western blot analysis of whole kidney lysates from each group demonstrated reduced expression of ICAM-1 in IR-injured kidneys with exo-srlĸB treatment. (E) Representative kidney sections showing ICAM-1 IHC staining (left) and graphical representation of ICAM-1 IHC (right), exo-srIĸB treatment reduced ICAM-1 expression in post-ischemic kidneys of C57BL/6J mice. indicates Scale bar, 50 μM (BE: pretreatment 24-h, n=5; pretreatment 48-h, n=4-5; post-treatment 24-h, n=5; post-treatment 48-h, n=3-6). Comparisons between groups were assessed using one-way ANOVA with Bonferroni's post hoc test. Data are presented as mean±SD values. *P<0.05, **P<0.01, ***P<0.001, comparing exo-naive-sham and exo-naive-IRI surgical groups. #P<0.05, ##P<0.01, ###P<0.001, when comparing exo-naive-IRI and exo-srIκB-IRI surgical groups.
Figure 5. Exo-srlκB treatment ameliorates IR-induced renal apoptosis.
(A) Left: Western blot analysis results comparing the expression of cleaved caspase-3 and cleaved PARP protein in the kidneys from each experimental group. Right: Graph representation shows that exo-srlκB treatment lowered cleaved caspase-3 levels and cleaved PARP compared to exo-naive treatment. (B) Left: Representative image of TUNEL staining (FITC label) is shown. Apoptotic cells are green (white arrow) and DAPI was used as counterstaining. Scale bar, 50 μM. Right: Bar graph showing TUNEL positive cells in kidney sections from each group. Exo-srlκB treatment induced fewer apoptotic cells (pretreatment 24-h, n=5, pretreatment 48-h, n=4-5, post-treatment 24-h, n=5, post-treatment 48-h) , n=3-6). Comparisons between groups were assessed using one-way ANOVA with Bonferroni's post hoc test. Data are expressed as mean±SD values. ***P<0.001, comparing exo-naive-sham and exo-naive-IRI surgical groups. #P<0.05, ##P<0.01 and ###P<0.001, when comparing exo-naive-IRI and exo-srIκB IRI surgical groups.
Figure 6. Biodistribution of exosomes after renal ischemia-reperfusion injury.
(a) Experimental schematic of in vivo imaging and exosome delivery. (b) Sequential in vivo imaging of uptake of DiD-labeled exosomes (green) into neutrophils (Ly6G ⁺ , red) and macrophages (F4/80 ⁺ , blue) in post-ischemic kidneys treated with intravenous exo-srIκB indicates. White arrows indicate DiD-labeled exosomes contained in immune cells. The white dashed line indicates renal epilepsy. (c) Biodistribution of DiD-labeled exosomes (green) in the spleen after renal IRI surgery, exosome uptake from the outer parenchyma into neutrophils (Ly6G ⁺ , red) and macrophages (F4/80 ⁺ , blue) indicates The elapsed time is displayed. Scale bar, 20 μm.
Figure 7. Exo-srlκB treatment modulates renal immune cell populations after IR-induced AKI.
(A) Mice were sacrificed 24 hours after surgery. KMNCs were enriched using enzymatic digestion, mechanical disruption, and a Percoll density gradient. The total renal cell number determined using this method showed no statistical difference between the experimental groups. (B) Graph representation of flow cytometry revealed a higher proportion of renal CD45 ⁺ cells after IRI among isolated kidney cells using enzymatic digestion, mechanical disruption and Percoll density gradient. Exo-srlκB treatment alleviated the post-ischemic surge of renal immune cells. (C) Further staining with additional immune cell markers showed that neutrophils (CD45 ⁺ Ly6G ⁺ ), pro-inflammatory/anti-inflammatory mononuclear phagocytes (CD45 ⁺ Ly6C ⁺ /CD45 ⁺ F4) in KMNC enriched /80 ⁺ ), the frequency of multilineage immune cells, including T cells (CD45 ⁺ CD3 ⁺ ), also decreased with exo-srIκB treatment in the post-ischemic kidney. (DF) Immunofluorescence studies were performed on post-ischemic kidneys in each experimental group targeting Ly6G, Ly6C and F4/80. A secondary antibody conjugated with Alexa Fluor 647 was used for all immunofluorescence experiments. The data showed a decreased frequency of Alexa Fluor 647 staining cells (white arrows) in the post-ischemic kidney after exo-srlκB treatment, which resulted in fewer neutrophils (Ly6G ⁺ ) and exo-srlκB pro/ suggesting the presence of anti-inflammatory mononuclear phagocytes (Ly6C ⁺ /F4/80 ⁺ ). Proximal tubular cells were stained with LTL (green) and DAPI was used as counterstaining. Scale bar, 50 μM. (n=5 per experimental group). Comparisons between groups were assessed using one-way ANOVA with Bonferroni's post hoc test. Data are expressed as mean±SD values. *P<0.05, **P<0.01, ***P<0.001, comparing exo-naive-sham and exo-naive-IRI surgical groups. #P<0.05, ##P<0.01, when comparing exo-naive-IRI and exo-srIκB-IRI surgical groups.
Figure 8. Intravenous delivery of exo-srlκB shows similar biological effects compared to intraperitoneal delivery in an ischemic AKI model.
(a) Experimental schematic of renal IRI surgery and exosome delivery. Each group of mice was injected intravenously with 9×10 ⁹ pn of exo-naive, exo-srlκB or PBS 1 hour after reperfusion. Mice were sacrificed 24 or 48 hours after IRI surgery and serum and tissues were collected for further evaluation. (bd) Serum levels of BUN, creatinine, and NGAL between different groups according to treatment type (PBS vs. exo-naive vs. exo-srIκB) and follow-up time points (24-h and 48-h), which is the result of exo-srIκB treatment. Renal protective effect (n=5 per experimental group). (e) Western blot analysis of NF-ĸB p65 expression using kidney nuclear extracts from each experimental mouse group. Nuclear extracts were biochemically isolated from the cytoplasmic fraction, and NF-ĸB p65 and lamin B1 expression were analyzed by Western blotting. IRI-induced activation of NF-ĸB signaling was significantly inhibited by postoperative exo-srlĸB treatment. (f) Elevated DNA binding activity of NF-ĸB p65 after renal IRI was inhibited by postoperative exo-srlĸB treatment. (g) qRT-PCR data show increased levels of Icam-1 mRNA in the post-ischemia exo-naive treatment group and a significant decrease in Icam-1 mRNA with exo-srlĸB treatment. (h) Western blot analysis of total kidney lysates from each group demonstrated reduced expression of ICAM-1 in IR-injured kidneys with exo-srlĸB treatment. Comparisons between groups were assessed using one-way ANOVA with Bonferroni's post hoc test. Data are expressed as mean±SD values. ns; Not significant, **P<0.01, ***P <0.001. When comparing the PBS-sham and exo-naive-IRI surgical groups. #P<0.05, ##P<0.01, ###P<0.001, when comparing exo-naive-IRI and exo-srIκB-IRI surgical groups.
Fig. 9(1). Generation and Characterization of Engineered Exosomes
(A) Schematic of the DNA construct used for production of super-repressor IκB-loaded exosomes (exo-srlκB) (top). Schematic showing the fusion protein and proposed activity (bottom). (B) Morphological characterization of exo-naive and exo-srIκB via transmission electron microscopy (TEM). (C) HEK293T cells stably expressing mCherry or srlKB and exosomes from these HEK293T cells were lysed and immunoblotted for the indicated proteins.
Fig. 10(2). Protective effect of exo-srIκB in endotoxemia and cecal ligation and perforation (CLP)-induced sepsis
(A) Survival curves of phosphate buffered saline (PBS)-treated, exo-naive and exo-srlκB-treated sepsis mice. Lipopolysaccharide (LPS) C57BL/6 mice (n=5-6/group), LPS BALB/c mice (n=10/group) and CLP C57BL/6 mice (n=14-15/group). **p<0.01, *p<0.05 compared to PBS-treated sepsis group. (B) Levels of tumor necrosis factor (TNF)-α, interleukin (IL)-6, IL-1β and CCL4/macrophage inflammatory protein (MIP)-1β in plasma of exosome-treated mice after LPS injection or CLP Measured at 24 hours. **p<0.01, *p<0.05 compared to PBS-treated sepsis group. † p <0.05 compared to exo-naive treated sepsis group. (C) Representative images of cortical tubular cells of kidney sections from sham, CLP with PBS, CLP with exo-naive, CLP with exo-srlκB, normal brush edge (*) or brush edge of the proximal canal loss (○); chromatin condensation (white arrow); exposed basement membrane (white arrowheads); vacuolation (yellow arrow); Scale bar, 100 μM. (D) Pathological kidney injury scores of representative kidney samples from each group. *p<0.05 compared to PBS treated sepsis group. †p<0.05 compared to exo-naive treated sepsis group.
Fig. 11(3). Biodistribution of exosomes in LPS-injected mice
(A) In vivo imaging of mCLING-labeled exosomes (red) uptake into neutrophils (LysM ^gfp/+ , green; Ly6G ⁺ , blue) in the liver of sham mice. (B) Representative time-lapse imaging of mCLING-labeled exosomes (red) inside Ly6G ⁺ neutrophil cells (green) of the liver in LPS-treated C57BL/6 mice. (C) Sequential images of the flow of mCLING-labeled exosomes (red) inside the spleen of sham and LPS-treated LysM ^GFP/+ mice. The elapsed time is displayed. magenta, autofluorescence; Scale bar, 50 μm.
Fig. 12(4). Inhibitory effect of exo-srlκB on nuclear factor-kappa-B (NF-κB) signaling in vitro
(A) HEK293-NF-κB-luciferase cells (2×10 ⁴ cells) were cultured with exo-naive or exo-srIκB 2×10 ⁵ particles. After 24 h, cells were treated with 0.5 ng/ml TNF-α for an additional 18 h. Luciferase activity was measured and normalized. (B) Exo-srIκB dose-dependently inhibited NF-κB activation in NF-κB-luciferase cells. (C) THP-1 cells (5×10 ⁵ cells) were stimulated with 1 μg/ml LPS and treated with exo-srlκB 5×10 ⁶ particles. Supernatants were collected and assayed for production of TNF-α and monocyte chemoattractant protein (MCP)-1. JSH-23 (50 μM) was used as a positive control. **p<0.01 (D) Immunofluorescence of human umbilical vein endothelial cells (HUVECs) incubated with mCLING-labeled exo-srIκB. Representative images are presented. The nucleus was labeled with Hoechst. (E) HUVECs were stimulated with 300 ng/ml LPS for 24 h. Cells were harvested as single cell suspensions and evaluated via flow cytometry using specific phycoerythrin (PE)-conjugated antibodies to human intercellular cell adhesion molecule (ICAM)-1.
13 (S1). Exosome characterization
(A) Schematic of the procedure used to generate engineered exosomes. (B) Representative graph of nanoparticle tracking analysis (NTA) demonstrating similar size distribution in diluted samples of exo-naive, exo-mCherry and exo-srlκB.
14 (S2). Inhibitory effect of exo-srIκB in a mouse model of sepsis
(A) Body temperature changes were monitored after injection of indicated exosomes in wild-type and LPS-treated C57BL/6 mice. **p<0.01 compared to PBS treated LPS group. (B) Representative of renal cortical regions in sections from C57BL/6 (top panel) and BALB/c (bottom panel) mice treated with LPS and PBS (left), exo-naive (middle) and exo-srlκB (right). image. Normal bristle edge of the proximal canal (*) or loss of bristle edge (○); chromatin condensation (red arrow); exposed basement membrane (red arrow); vacuolation (blue arrow); Scale bar, 100 μM. (C) Comparison of the number of infiltrated Ly6G ⁺ cells in each organ between exo-naive and exo-srlκB treated groups of LPS-induced sepsis mice. (D) Levels of IL-10 were measured in the plasma of septic mice treated with PBS-, exo-naive- and exo-srlκB. NS, not significant.
15 (S3). Biodistribution of exosomes in mice with or without LPS challenge
(A) Analysis of mCLING-labeled exosomes detected in the kidney using an in vivo imaging system after intravenous administration of LPS.
16 (S4). Inhibitory effect of exo-srIκB on LPS-induced inflammatory response in HUVECs
(A) HUVECs (7×10 ⁴ cells) were incubated with exo-srlκB 1×10 ⁷ particles for 24 h, followed by stimulation with 36 ng/ml LPS. After 24 hours, the supernatant was collected and the production of IL-8 (left) and MCP-1 (right), respectively, was analyzed. JSH-23 (50 μM) was used as a positive control. ***p<0.001 compared to dimethyl sulfoxide (DMSO). #p<0.05 compared to cells treated with LPS alone. (B) HUVECs were pretreated with exo-srlκB for 24 h, followed by LPS stimulation at 36 ng/ml for 1 h. Western blotting was used to assess protein levels of p65 and IκBα. GAPDH and histone H3 (HH3) were used as endogenous controls for cytoplasmic cell lysate and nuclear fraction, respectively (left). Binding of nuclear NF-κB to its target DNA sequence, 5′-GGGACTTTCC-3′, was determined via enzyme-linked immunosorbent assay (ELISA) (right).
17-20. Protective effect of exo-srlκB on lung injury in LPS-induced sepsis.
17 shows: (1) alveoli; (2) capillary; (3) neutrophils; (4) alveolar macrophages; (5) congestion; (6) bleeding; (7) H&E staining showing necrosis is shown.
18 depicts survival curves of sham, naïve exosomes, exo-srlκB treated sepsis mice.
19 depicts the levels of TNF-α in plasma of exo-srlκB-treated sepsis mice.
20 depicts H&E staining showing (1) central vein and (2) infiltration of immune cells.

The present disclosure provides the EXPLOR technology (Yim et al., Nature Communications 7, 12277 (2016)), which, in order to evaluate their effect on the ischemic AKI process, loaded srIĸB into exosomes and exosomes -srIĸB was used for systemic delivery. The human embryonic kidney (HEK) 293T cell line, which produced two recombinant proteins, CIBN-EGFP-CD9 and srIĸB-mCherry-CRY2, was transformed into srIĸB-containing exosomes (exo-) by inducing transient docking of CRY2 and CIBN using blue light illumination. srIĸB) was used to produce (Fig. 1A). Control exosomes (exo-naive) were generated in intact HEK293T cells. The results confirmed that optogenetically engineered exosomes can be utilized as therapeutic agents, and that exo-srIĸB can alleviate IR-induced kidney damage through immune response modulation and apoptosis.

The terms singular expressions ("a", "an", "the") and similar referents used in the context of describing the present disclosure (especially in the context of the claims), as otherwise specified herein or contradicted by context Unless otherwise stated, it should be construed to include both the singular and the plural. Recitation of a range of values herein is merely intended to serve as a shorthand method of referring individually to each individual value within the range. Unless otherwise indicated herein, each individual value is incorporated herein as if each were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or illustrative language (eg, “for example”) provided herein is merely to better illuminate the disclosure and does not limit the scope of the otherwise claimed disclosure. No language in this specification should be construed as indicating any non-claimed element essential to the practice of this disclosure.

As used herein, the term “about” refers to, for example, the length, degree of error, dimension, amount of a component in the composition, concentration, volume, process temperature, process time, yield, flow rate, pressure, and the like of a nucleotide sequence, for example, of a nucleotide sequence. Variations in values and ranges thereof are meant, for example, through typical measurement and handling procedures used to prepare compounds, compositions, concentrates or formulations for use; through careless errors in this procedure; through differences in the preparation, source or purity of the starting materials or components used to carry out these methods; and a change in quantity that may occur through considerations, etc. The term "about" also includes, for example, a different amount due to aging of a composition, formulation or cell culture having a certain initial concentration or mixture, and an amount different due to mixing or processing of a composition or formulation having a certain initial concentration or mixture. includes Although modified by the term “about,” the appended claims include equivalents to these quantities. The term “about” may further refer to a range of values similar to the stated reference value. In certain embodiments, the term “about” refers to a range of values that fall within 50, 25, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% or less of the stated reference value.

As used herein, the term “subject” refers to a human or non-human animal (eg, mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse or primate).

AKI

Immune response by NF-ĸB signaling may be involved in AKI, and exo-srIĸB may exert the effect of ameliorating renal damage in sepsis-induced renal damage. In some examples herein, it was evaluated whether administration of an inhibitor could alleviate the ischemic AKI process. In the example of the present application, SrIĸB was delivered to mice before and after IRI surgery using EXPLOR technology, and the results were compared with the control group. As a result, it was confirmed that exo-srlĸB-treated mice showed lower serum BUN and creatinine levels compared to the control group, thereby exerting prophylactic and therapeutic effects from IR-induced AKI. On the other hand, as a result of confirming whether the administration of exo-srIĸB locally affects the renal NF-ĸB signal, exo-srIĸB significantly improved the nuclear translocation and nuclear binding activity of NF-ĸB, compared to the control group. has been found to decrease The NF-ĸB pathway may play an important role in immune response processes. Comparison of the gene expression of Pan-inflammatory cytokines/chemokines in the exo-srIĸB treatment group and the control group, IL-1β, and IL-6, showed that a significant number of inflammatory mediators, including CCL2, CCL5, CXCL2 and TNF-α, were A decrease was confirmed. Finally, in the examples herein, flow cytometry was performed to compare whether NF-ĸB inhibitor treatment affects renal immune cell populations, and multiple immune cell populations including neutrophils, monocytes/macrophages and T cells. was observed to decrease significantly.

IRI induces inflammatory cascades and oxidative stress, triggers a cytokine storm, and induces apoptosis and structural damage to adjacent tissues. The NF-ĸB signaling pathway can regulate cell survival and inflammation with high levels of rapid response from damaged cells during IRI stimulation, particularly the early stages of hypoxia/reperfusion. For example, a number of endogenous factors are released, including mobility group box 1 (HMGB1), heat shock protein (HSP) and pathogen/damage associated molecular patterns (PAMP/DAMP). These endogenous molecules can stimulate Toll-like receptors (TLRs) such as IL-1R and pattern recognition receptors (PRPs). TLR and IL-1R share the same intracellular domain, phosphorylate inhibitory protein IĸB residues, and activate IĸB kinase (IKK), which ultimately leads to degradation of IĸB by the proteasome. This process allows heterodimers (eg, p50/p65) to migrate from the cytoplasm to the nucleus, which binds to DNA and mediates inflammatory mediation including TNF-α, IL-1, IL-6 and IL-8. It promotes factor transcription and accelerates NF-ĸB signaling. This proinflammatory cascade may modulate the surrounding microenvironment by inducing apoptosis and promoting leukocyte migration/activation in renal cells exposed to IRI. The ischemic AKI model of the present disclosure is also able to induce activation of NF-ĸB signaling, which significantly affects the renal immune cell population compared to the sham surgery group. Expression of multiple inflammatory cytokine/chemokine genes induce Recent studies have included TLR antagonists, cytokine antagonists, IKK complex antagonists, proteasome inhibitors, decoy oligodeoxynucleotides (ODNs) specific for specific NF-ĸB complexes, and ODNs that inhibit Rel protein translation in various organs. do. This shows the effect of blocking NF-ĸB in IRI by inhibiting NF-ĸB signaling using various pharmacological inhibitors. The IĸBα protein with mutations at serine residues 32 and 36 is not phosphorylated and thus holds NF-ĸB nuclear translocation because it exists as a multimer with NF-ĸB in the cytoplasm and is not degraded. This non-degradable IĸBα, the so-called super-repressor IĸBα (srIĸB), is known to induce apoptosis and thus have anti-tumor effects.

In the present disclosure, the therapeutic effect of exo-srlĸB is presented in a renal IRI model representing acute nephritis. Exo-srIĸB regulates the process of AKI by down-regulating the production of pro-inflammatory mediators that can limit leukocyte migration/activation and inducing premature apoptosis of inflammatory cells, leading to premature termination of the inflammatory phase. In the present disclosure, it was confirmed that administration of exo-srIĸB only affected the frequency of the immune cell population in the kidney, but did not affect the frequency of the immune cell population in the spleen. These results indicate that exo-srlĸB selectively inhibits cell proliferation or promotes apoptosis in renal resident immune cells. On the other hand, the in vivo delivery of exo-srIĸB can be interpreted as blocking the outflow of splenic immune cells to the damaged kidney. In the present disclosure, exo-srlĸB was found to alleviate IR-induced AKI in mice by inhibiting the activity of NF-ĸB signaling. In addition, in vivo delivery of exo-srlĸB may improve the overall inflammatory state of the kidney by reducing the expression of pro-inflammatory genes and reducing the renal immune cell population including neutrophils, monocytes/macrophages and T cells. Accordingly, in one aspect, the present disclosure relates to an exosome loaded with srIκB, and more particularly, to an exosome loaded with srIκB represented by the amino acid sequence of SEQ ID NO: 1. Hereinafter, srlκB may be expressed as a cargo protein.

In some embodiments, the AKI described herein is, but is not limited to, ischemia-reperfusion (IR)-induced AKI, lipopolysaccharide (LPS)-induced AKI, or sepsis-induced AKI. Ischemia-reperfusion (IR)-induced acute kidney injury (AKI) is a relatively common but severe medical condition that can occur when a subject suffers from systemic hypoperfusion followed by restoration of blood flow and re-oxygenation. The most common clinical examples include patients who have undergone kidney transplantation or heart surgery, and patients with sepsis, trauma or myocardial infarction. Renal IR injury (IRI) is associated with high morbidity/mortality and is known to cause dysfunction in other distant organs including the heart, lung and liver. In IR-induced AKI, hypoxia and reperfusion generate reactive oxygen species (ROS) followed by a cascade of responses including apoptosis and inflammation, and subsequently renal failure. Immunological responses can have a significant impact on renal IRI and repair. Nuclear factor (NF)-ĸB signaling, which regulates cytokine production and cell survival, is significantly involved in IR-induced AKI, and its inhibition can alleviate ischemic AKI.

Using EXPLOR, a surgically engineered exosome technology, exosomes are loaded with an exosome super-repressor inhibitor of NF-ĸB (exo-srlĸB) and post-renal IR surgery as shown in the Examples herein/ Previously administered to B6 WT mice. The results were compared with those of the control exosome (exo-naive) injection group. Exo-srlĸB treatment resulted in lower levels of serum blood urea nitrogen, creatinine and neutrophil gelatinase-associated lipocalin in post-ischemic mice than in the exo-naive treatment group. Systemic delivery of exo-srIĸB reduced NF-ĸB activity in the post-ischemic kidney, thereby lowering the level of apoptosis. The post-ischemic kidney showed a decrease in gene expression of proinflammatory cytokines and adhesion molecules with exo-srlĸB treatment, compared with the control group. Exo-srlĸB treatment also significantly affected the post-ischemic renal immune cell population, resulting in lower neutrophil, monocyte/macrophage and T cell frequencies compared to controls. Therefore, modulation of NF-ĸB signaling via exosome delivery can be used as a novel therapeutic method for AKI, including IR-induced AKI.

In another embodiment of the present invention, exosomes are engineered to contain a mutant form of a biological inhibitor of NF-κB called super-repressor (SR) IκB (srlκB, SEQ ID NO: 1). See N. Yim et al., Nature Communications 7, 12277 (2016)].

For the loading of large amounts of srlκB into exosomes in stably transfected cells, as shown in the Examples below, an optogenetic engineered exosome system (EXPLOR) was used. The following example confirms that intraperitoneal injection of purified srIκB-loaded exosomes (exo-srlκBs) attenuates mortality and systemic inflammation in a septic mouse model. In biodistribution studies using fluorescent dye-labeled exosomes, exo-srIκB was observed mainly in neutrophils and to a lesser extent monocytes in the spleen and liver of mice. Moreover, the Examples confirm that exo-srlκB alleviates the inflammatory response in monocyte THP-1 cells and human umbilical vein endothelial cells (HUVECs) in response to lipopolysaccharide (LPS) or tumor necrosis factor (TNF)-α. do. These results confirm that exo-srIκB can protect against systemic inflammation and sepsis-induced death by inhibiting NF-κB activation.

The present disclosure provides a method of treating acute kidney injury (AKI) in a subject in need thereof, comprising administering to the subject an effective amount of a composition comprising exosomes comprising an NF-κB inhibitor. do. In some embodiments, the inhibitor of NF-κB is selected from the group consisting of NF-κB inhibitory proteins, fragments thereof, and mixtures thereof.

The composition is a physiologically acceptable aqueous solution or suspension of exosomes.

The NF-κB inhibitor is selected from an NF-κB inhibitory drug, an NF-κB inhibitory protein or fragment thereof, or a mixture thereof.

Preferably, the NF-κB inhibitor is selected from the group consisting of the super-repressors IκB, IκB-α, IκB-β, IκB-ε, BCL-3, mutants thereof, and mixtures thereof.

In another preferred embodiment of the present disclosure, the exosomes of the present disclosure contain a biological inhibitor of a mutant form of NF-κB called super-repressor (SR) IκB (srlκB, SEQ ID NO: 1).

In one embodiment of the present disclosure, srlκB has Ser32 and Ser36 of IκB (SEQ ID NO: 2) substituted with Ala.

SEQ ID NO: 1 Homo sapiens, super-repressor-IκB (srlκB)

MFQAAERPQEWAMEGPRDGLKKERLLDDRHDAGLDAMKDEEYEQMVKELQEIRLEPQEVPRGSEPWKQQLTEDGDSFLHLAIIHEEKALTMEVIRQVKGDLAFLNFQNNLQQTPLHLAVITNQPEIAEALLGAGCDPELRDFRGNTPLHLACEQGCLASVGVLTQSCTTPHLHSILKATNYNGHTCLHLASIHGYLGIVELLVSLGADVNAQEPCNGRTALHLAVDLQNPDLVSLLLKCGADVNRVTYQGYSPYQLTWGRPSTRIQQQLGQLTLENLQMLPESEDEESYDTESEFTEFTEDELPYDDCVFGGQRLTL

SEQ ID NO: 2, Homo sapiens, IκB-α

MFQAAERPQEWAMEGPRDGLKKERLLDDRHDSGLDSMKDEEYEQMVKELQEIRLEPQEVPRGSEPWKQQLTEDGDSFLHLAIIHEEKALTMEVIRQVKGDLAFLNFQNNLQQTPLHLAVITNQPEIAEALLGAGCDPELRDFRGNTPLHLACEQGCLASVGVLTQSCTTPHLHSILKATNYNGHTCLHLASIHGYLGIVELLVSLGADVNAQEPCNGRTALHLAVDLQNPDLVSLLLKCGADVNRVTYQGYSPYQLTWGRPSTRIQQQLGQLTLENLQMLPESEDEESYDTESEFTEFTEDELPYDDCVFGGQRLTL

SEQ ID NO: 3 Recombinant srlκBα peptide

DRHDAGLDAMKDE

In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 86% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 87% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 88% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 89% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 91% sequence identity with SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 92% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 93% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 94% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 96% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 97% sequence identity with SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 1. In an embodiment, the NF-κB inhibitor is represented by SEQ ID NO: 1.

In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 86% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 87% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 88% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 89% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 91% sequence identity with SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 92% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 93% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 94% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 95% sequence identity with SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 96% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 97% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 98% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor is represented by SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor is represented by SEQ ID NO:2.

In certain embodiments of the present disclosure, the exosome further comprises a photo-specific binding protein. In some embodiments, the photo-specific binding protein comprises a first photo-specific binding protein and/or a second photo-specific binding protein that reversibly interact with each other upon irradiation. In some embodiments, the first light-specific binding protein conjugates to an exosome specific marker to form a first fusion protein (fusion protein I). In some embodiments, the second light-specific binding protein is conjugated to an NF-κB inhibitory protein to form a second fusion protein (fusion protein II). In some embodiments, fusion protein I and fusion protein II are reversibly linked via a first photo-specific binding protein and a second photo-specific binding protein. In some embodiments, the first photo-specific binding protein is conjugated to an exosome specific marker such that it is positioned in an inwardly directed direction of the exosome.

In a further embodiment, the first photo-specific binding protein and the second photo-specific binding protein are from the group including but not limited to CIB, CIBN, PhyB, PIF, FKF1, GIGANTEA, CRY or PHR. is chosen

In a further embodiment, the first photo-specific binding protein is CIB or CIBN and the second photo-specific binding protein is CRY or PHR; The first photo-specific binding protein is CRY or PHR and the second photo-specific binding protein is CIB or CIBN.

In a further embodiment, the first photo-specific binding protein is PhyB, the second photo-specific binding protein is PIF, or the first photo-specific binding protein is PIF, and the second photo-specific binding protein is PhyB.

In a further embodiment, the first light-specific binding protein is GIGANTEA, the second light-specific binding protein is FKF1, or the first light-specific binding protein is FKF1, and the second light-specific binding protein is is GIGANTEA.

In some embodiments, the specific marker of an exosome is selected from the group including, but not limited to, CD9, CD63, CD81 or CD82. In a further embodiment, the exosome specific marker is CD9. In a further embodiment, the exosome specific marker is CD63. In a further embodiment, the exosome specific marker is CD81. In a further embodiment, the exosome specific marker is CD82.

In some embodiments, the exosomes have a diameter between about 50 nm and about 200 nm. In some embodiments, the exosomes have a diameter of about 50 nm to about 75 nm. In some embodiments, the exosomes have a diameter of about 75 nm to about 100 nm. In some embodiments, the exosomes have a diameter between about 100 nm and about 125 nm. In some embodiments, the exosomes have a diameter between about 125 nm and about 150 nm. In some embodiments, the exosomes have a diameter between about 150 nm and about 175 nm. In some embodiments, the exosomes have a diameter between about 175 nm and about 200 nm. In an embodiment, the exosomes have a diameter of about 50 nm to about 150 nm. In some embodiments, the exosomes are about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150 greater than or equal to about 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200 or less in diameter.

Without setting forth all details, the contents of US Patent No. 10702581 and Korean Patent No. 10-2100420 are incorporated by reference to provide compositions and methods for making exosomes containing the NF-κB inhibitor of the present disclosure. introduced herein by

Although the present disclosure also provides sustained release of a therapeutically effective drug, conventional sustained effects require repeated administration of the therapeutic agent.

The present disclosure also provides an extracellular vesicle (exosome) carrying an NF-κB inhibitor and a pharmaceutical composition comprising a pharmaceutically acceptable carrier or carriers.

Despite recent remarkable advances in understanding the pathophysiology of IR-induced AKI, no drug has been developed that has demonstrated clinical efficacy and safety to treat ischemic AKI; Therefore, the relevant mortality and morbidity levels are important. Because NF-ĸB signaling is deeply involved in the process of IR-induced AKI, we evaluated whether systemic delivery of NF-ĸB inhibitors using exosomes could alleviate the ischemic AKI process. Through optically controlled biosynthesis of exosomes using EXPLOR technology, exo-srIĸB was delivered to mice before and after IRI surgery, and the results were compared with those of the control group. The results indicated that the group of mice receiving exo-srlĸB treatment was protected from IR-induced AKI; It showed better biochemical and histological results than the control group. Systemic delivery of exo-srlĸB inhibited NF-ĸB signaling in the post-ischemic kidney, which reduced the expression of pro-inflammatory cytokines/chemokines and adhesion molecules, and alleviated apoptosis. Finally, NF-ĸB treatment affected the renal immune cell population and, through flow cytometry and immunofluorescence analysis, a significant decrease in the frequency of multiple immune cell populations including neutrophils, monocytes/macrophages and T cells was observed.

In the early course of IRI, pro-inflammatory cascades and oxidative stress lead to NF-ĸB pathway activation, which in turn leads to regulation of cell survival and inflammation. In the early stages of hypoxia/reperfusion, multiple endogenous factors are released, including high mobility group box 1, heat shock proteins and pathogen-/injury-associated molecular patterns, and these molecules are Toll-like receptors (TLRs) and interleukin-1 receptors ( IL-1R) and other pattern recognition receptors. This process then activates IĸB kinase (IKK), which induces IĸB degradation by the proteasome. Heterodimers (e.g., p50/p65) then migrate from the cytosol to the nucleus, where they promote transcription of inflammatory mediators including TNF-α, IL-1, IL-6 and IL-8, and also NF- It further promotes ĸB signaling. These proinflammatory cascades regulate the surrounding microenvironment by inducing apoptosis in tubular cells presented to IRI and promoting leukocyte migration/activation. This experimental ischemic AKI model can reproduce the activation of NF-ĸB signaling after renal IRI, which induces increased expression of multiple inflammatory cytokines/chemokines and tissue apoptosis that significantly affect renal immune cell populations can do.

Recent experimental studies have investigated the effects of NF-ĸB signaling, including TLR antagonists, cytokine antagonists (33), IKK complex antagonists, proteasome inhibitors, and decoy oligodeoxynucleotides specific for specific NF-ĸB complexes in various organs. Using selective pharmacological inhibitors, more detailed evidence was presented regarding the effect of NF-ĸB blockade on IRI. srlĸB is a non-degradable IĸBα protein with mutations at serine residues 32 and 36. This protein prevents NF-ĸB nuclear translocation and subsequent NF-ĸB signaling. srlĸB is known to have a protective effect in the lung IRI model by reducing neutrophil infiltration and pulmonary edema, and also to have anti-tumor effects by reducing chemo-resistance. However, the effect of srIĸB treatment on the course of renal injury has not been fully evaluated. By using bioengineered exosomes as vectors, Choi et al recently demonstrated the therapeutic benefit of srIĸB treatment in a septic AKI model. The following example also demonstrates the protective effect of exo-srlĸB treatment in a renal IRI model and expands the therapeutic potential of srIĸB delivery via exosomes in various types of AKI.

Regulation of inflammatory processes has been an important therapeutic consideration in the field of ischemic AKI. Splenectomy and use of the anti-TNF-α agent, infliximab, showed protective effects in an experimental ischemic AKI model by lowering inflammatory cytokine expression and macrophage/monocyte accumulation. Inhibiting the migration of leukocytes and macrophages preserved renal function and alleviated apoptosis. The examples provided showed that exo-srlĸB treatment down-regulates the expression of pro-inflammatory cytokines/chemokines and adhesion molecules, reduces apoptosis, and alleviates multi-lineage immune cell accumulation in IR-injured kidneys. These results suggest that exo-srlĸB modifies the process of ischemic AKI through pro-inflammatory cascade downregulation, limiting subsequent leukocyte migration/activation and preventing apoptosis.

Exosomes have several advantages over using other types of vectors as conveyors. First, EVs are naturally protected from degradation in circulation and are non-immunogenic when used autologous. Exosomes can also overcome natural barriers, such as the blood-brain barrier, through their unique cell-targeting properties. Additionally, exosomes use the unique mechanisms of recipient cells in the process of uptake, intracellular transport, and eventual delivery of cargo to target cells. While maintaining these properties, EXPLOR technology was able to significantly increase the intracellular levels of cargo proteins through controllable and reversible separation from exosomes. Intracellular delivery of therapeutic proteins has several technical hurdles, including low purification efficiency, induction of immune responses to the host, and limited cytosolic delivery, and this novel exosome delivery method using EXPLOR technology is superior to that of previous technologies. Thus, the exosome loading performance, delivery efficiency and purity were significantly improved. The examples below show that efficient delivery of exo-srlĸB using EXPLOR technology can lead to significant improvement in renal outcomes after experimental IRI.

Systemic exo-srlĸB treatment only affects immune cell population frequency in the kidney, but not in the spleen. It may be involved in exo-srIĸB, which acts selectively on renal resident immune cells to alleviate proliferation or promotes apoptosis, or selectively acts on systemic delivery of exo-srIĸB to block the outflow of splenic immune cells into the damaged kidney. can Renal resident immune cells and immune cells from lymphoid organs are known to have different origins, phenotypic and functional properties. Further studies using chimeric mice or in vivo imaging could differentiate resident renal immune cells from circulating immune cells and provide more information about the immune cell populations affected by systemic exo-srlĸB treatment.

The use of exosomes as carriers for the delivery of cargoes of active therapeutics is a safe and efficient method of delivering srIĸB in an IR-induced AKI model. Exo-srIĸB treatment alleviates IR-induced AKI in mice by downregulating NF-ĸB signaling and ameliorating inflammation and apoptosis in ischemic damaged kidneys. Direct intracellular delivery of immunosuppressive proteins to target cells using exosomes is a promising therapeutic tool for IR-induced AKI, and the therapeutic potential of exo-srlĸB in human renal IRI should be further explored.

Diseases caused by sepsis

Sepsis is accompanied by multiple organ failure and excessive inflammatory response, has complex pathophysiological features, and it is not easy to develop a therapeutic agent that can effectively treat all symptoms. Sepsis is initiated through potent activation of the innate immune system and is mediated by the activation of pattern recognition receptors (PRR) by pathogens, leading to activation of the complement system, the coagulation system and the vascular endothelium, making normal homeostasis difficult.

As shown in the examples herein, the effect of exo-srIκB could resolve the inflammatory response and reduce organ damage through inhibition of NF-κB activity in a mouse model of sepsis. srIκB is the non-degradable form of IκBα, which prevents NF-κB from entering the nucleus and acting as a transcription factor. For example, to generate srIκB-loaded immunosuppressive exosomes, a recent technique capable of loading functional proteins into exosomes has been utilized. By systemic delivery of exo-srIκB in a mouse model of sepsis (eg, systemic delivery), the examples herein confirmed that exosomes are delivered to neutrophils and macrophages, which are major participants in the septic inflammatory response. In addition, in both mouse sepsis models of this example, exo-srIκB treatment significantly reduced proinflammatory markers such as TNF-α, IL-1β and IL-6, but inhibited the anti-inflammatory cytokine IL-10. did not decrease Even when exosomes were injected 1 hour after LPS injection, a significant therapeutic effect of exo-srIκB was observed. Thus, treatment with exo-srIκB can be applied even in the early stages of sepsis before transition to an immunosuppressive state.

Pro-inflammatory cytokines may play an important role in sepsis-induced acute kidney injury (AKI). In the example herein, in the mouse model with AKI induced by CLP surgery or LPS injection, as a result of histopathological examination, the glomerular structure is destroyed, the tubular epithelial cells are degenerate, and severe intracellular edema and congestion are sepsis. -confirmed that it occurred in the tubules of the induced group. However, exo-srlκB administration reduced the severity of the lesion, kidney damage, and infiltration of inflammatory cells.

Tissue infiltration of neutrophils may be a major process in sepsis. For example, in some studies targeting specific adhesion molecules to deplete neutrophils and inhibit recruitment of neutrophils, it has been reported that tissue damage can be reduced and protected from sepsis. TNF-α and IL-1β are major mediators for the expression of chemokines such as MCP-1 and IL-8, which are important chemoattractants for neutrophils and monocytes/macrophages during the inflammatory response. These chemokines initiate local infiltration of monocytes/macrophages after activation. However, in HUVECs, exo-srlκB has been shown to decrease LPS-induced release of MCP-1 and IL-8, thereby inhibiting monocyte/macrophage infiltration. These data are consistent with the results obtained in the in vivo study herein. In this example, exo-srlκB treatment significantly reduced neutrophil infiltration in the spleen, kidney, lung and liver in an animal model of sepsis. Given the important role of neutrophils in the pathophysiology of sepsis, the tissue protective effect of exo-srIκB may be associated with a reduction in neutrophil infiltration, at least in the kidney.

In some embodiments, the spleen exhibits high levels of neutrophils compared to other organs, such as the kidneys and liver. Pro-inflammatory cytokines can occur in the spleen and can affect other organs. Most genes encoding proinflammatory cytokines may be under the control of NF-κB, one of the important transcription factors in the septic inflammatory response induced by LPS. The expression of the NF-κB response reporter protein in the presence or absence of exo-srlκB treatment was investigated in the Examples herein, and the translocation of p65 was confirmed. Exo-srIκB inhibited NF-κB signaling activation by blocking nuclear translocation of the NF-κB subunit p65.

In some embodiments, exosomes can be used as a mechanism for therapeutic delivery of immunosuppressive proteins in a mouse model of sepsis. Exosomes may be an excellent carrier for delivering srlκB to cells and may provide a new option for the treatment of sepsis. Although a method for direct delivery of immunosuppressive proteins to target cells in vivo has not been previously established, exo-srlκB according to the present disclosure acts as an inhibitor of NF-κB, thereby directly and Inhibits the inflammatory response. Examples of the present application, it is possible to reduce the pro-inflammatory cytokine storm of sepsis and organ damage by inhibiting it.

Recent studies in animal models of sepsis induced by either lipopolysaccharide (LPS; endotoxin model) or cecal ligation and perforation (CLP, polymicrobial model) have shown that NF-κB inhibitors with diverse chemical properties and mechanisms of action It has been proven to protect animals from septic death. Although more than 700 NF-κB inhibitors have been reported, no NF-κB blockers have been approved for human use to date. Although various steroidal and non-steroidal anti-inflammatory agents have been shown to block NF-κB, their effects are highly pleiotropic and lack specificity. Novel therapeutic strategies aimed at the specific inhibition of key elements in the NF-κB activation pathway are under recent development, and there are high expectations for their potential efficacy as sepsis treatment and treatment for one or more diseases induced by sepsis. A genetic construct expressing an engineered IκBα protein without a phosphorylation site was also used, the super-repressor IκB (srlκB). IκBα mutations at specific phosphorylation sites (replacement of Ser32 and Ser36 by Ala) result in a dominantly active form of IκBα with an extended half-life. This srIκB induces a stable cytoplasmic pool of IκBα, thereby preventing nuclear NF-κB activation.

Here, exosomes were used as a therapeutic conveyor to deliver srlκB to a therapeutic target. Exosomes have been recognized as potent therapeutic mediators that transport various proteins and regulatory genes to target cells. They function as non-immunogenic nanovesicles and can protect their cargo from serum proteases and immune responses. The loading of soluble proteins into exosomes has been made possible by a technique called EXPLOR, which utilizes reversible protein-protein interactions controlled by natural exosome biosynthetic processes and optogenetics. To load specific target proteins into exosomes, a HEK293T cell line stably expressing two recombinant proteins, CIBN-EGFP-CD9 and srlκB-mCherry-CRY2, was generated ( FIG. 1A ). Consistent with previous studies, EXPLOR technology was used to produce srIκB loaded exosomes. srlκB loading exosomes were designated exo-srlκB, and exosomes generated from intact HEK293T cells were designated exo-naive. By applying exo-srlκB to a sepsis model for therapeutic purposes, sepsis-induced organ damage was ameliorated, and secretion of proinflammatory cytokines was suppressed, thereby improving the overall survival rate of sepsis patients.

The present disclosure provides a method of treating a disease caused by sepsis in a subject in need thereof, the method comprising administering to the subject an effective amount of a composition comprising exosomes comprising an NF-κB inhibitor to provide.

In an embodiment, the disease is selected from the group consisting of, but not limited to, pneumonia, cytokine storm syndrome, respiratory distress syndrome, and organ failure. In some embodiments, the disease is pneumonia. In some embodiments, the disease is cytokine storm syndrome. In some embodiments, the disease is respiratory distress syndrome. In some embodiments, the disease is organ failure.

In an embodiment, the inhibitor of NF-κB is selected from the group consisting of NF-κB inhibitory proteins, fragments thereof, and mixtures thereof. In an embodiment, the NF-κB inhibitor is selected from the group consisting of a super-inhibitor (SR)-IκB (srlκB), IκB-α, IκB-β, IκB-ε, BCL-3, mutants thereof and mixtures thereof. do. In an embodiment, the NF-κB inhibitor is a super-repressor (SR)-IκB (srlκB).

In an embodiment, the composition is administered via an oral, transdermal, intraperitoneal, intravenous, intramuscular, subcutaneous or mixed route. In some embodiments, the composition is administered via the oral route. In some embodiments, the composition is administered via a transdermal route. In some embodiments, the composition is administered via the intraperitoneal route. In some embodiments, the composition is administered via the intravenous route. In some embodiments, the composition is administered via an intramuscular route. In some embodiments, the composition is administered via the subcutaneous route. In some embodiments, the composition is administered via a mixed route.

In an embodiment, the method further comprises administering to the subject an anti-inflammatory agent.

In an embodiment, the exosome comprising an NF-κB inhibitor further comprises a photo-specific binding protein. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 85% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 86% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 87% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 88% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 89% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 91% sequence identity with SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 92% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 93% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 94% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 96% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 97% sequence identity with SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor is represented by SEQ ID NO: 1.

In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 86% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 87% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 88% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 89% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 91% sequence identity with SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 92% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 93% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 94% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 95% sequence identity with SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 96% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 97% sequence identity with SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 98% sequence identity to SEQ ID NO:2. In some embodiments, the NF-κB inhibitor comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO:2. In an embodiment, the NF-κB inhibitor is represented by SEQ ID NO: 1. In some embodiments, the NF-κB inhibitor is represented by SEQ ID NO:2.

In some embodiments, the photo-specific binding protein is a first photo-specific binding protein and/or a second photo-specific binding protein. In an embodiment, the first light-specific binding protein is conjugated to an exosome specific marker to form fusion protein I; A second photo-specific binding protein is conjugated to an NF-κB inhibitor to form fusion protein II. In an embodiment, fusion protein I and fusion protein II are reversibly linked via a first light-specific binding protein and a second light-specific binding protein. In an embodiment, the first photo-specific binding protein is conjugated to an exosome specific marker such that it is positioned in a direction towards the inside of the exosome.

In some embodiments, the first light-specific binding protein and the second light-specific binding protein are selected from the group consisting of CIB, CIBN, PhyB, PIF, FKF1, GIGANTEA, CRY and PHR. In an embodiment, the first photo-specific binding protein is CIB and the second photo-specific binding protein is CRY. In some embodiments, the first light-specific binding protein is CIBN and the second light-specific binding protein is CRY. In some embodiments, the first photo-specific binding protein is CIB and the second photo-specific binding protein is PHR. In some embodiments, the first photo-specific binding protein is CIBN and the second photo-specific binding protein is PHR.

In some embodiments, the first photo-specific binding protein is CRY or PHR and the second photo-specific binding protein is CIB or CIBN. In some embodiments, the first photo-specific binding protein is CRY and the second photo-specific binding protein is CIB. In some embodiments, the first photo-specific binding protein is CRY and the second photo-specific binding protein is CIBN. In some embodiments, the first photo-specific binding protein is PHR and the second photo-specific binding protein is CIB. In some embodiments, the first photo-specific binding protein is PHR and the second photo-specific binding protein is CIBN.

In some embodiments, the first photo-specific binding protein is PhyB and the second photo-specific binding protein is PIF. In an embodiment, the first photo-specific binding protein is PIF and the second photo-specific binding protein is PhyB.

In some embodiments, the first light-specific binding protein is GIGANTEA and the second light-specific binding protein is FKF1. In an embodiment, the first light-specific binding protein is FKF1 and the second light-specific binding protein is GIGANTEA.

In some embodiments, the exosome specific marker is selected from the group consisting of CD9, CD63, CD81 and CD82. In some embodiments, the exosome specific marker is CD9. In some embodiments, the exosome specific marker is CD63. In some embodiments, the exosome specific marker is CD81. In some embodiments, the exosome specific marker is CD82.

In some embodiments, the exosomes have a diameter between about 50 nm and about 200 nm. In some embodiments, the exosomes have a diameter of about 50 nm to about 75 nm. In some embodiments, the exosomes have a diameter of about 75 nm to about 100 nm. In some embodiments, the exosomes have a diameter between about 100 nm and about 125 nm. In some embodiments, the exosomes have a diameter between about 125 nm and about 150 nm. In some embodiments, the exosomes have a diameter between about 150 nm and about 175 nm. In some embodiments, the exosomes have a diameter between about 175 nm and about 200 nm. In an embodiment, the exosomes have a diameter of about 50 nm to about 150 nm. In some embodiments, the exosomes are about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150 greater than or equal to about 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200 or less in diameter.

In some embodiments, the composition is a pharmaceutical composition further comprising a physiologically acceptable carrier or carriers.

EXPLOR ^® technology

Recently, exosomes have received significant attention as novel bio-carriers for gene/drug delivery. Exosomes are extracellular vesicles (EVs) that play an important role in intercellular communication by delivering bioactive substances to recipient cells or by influencing signaling pathways in target cells. Exosomes are easier to store and exhibit greater stability. Exosomes have a high capacity to overcome biological barriers, can carry surface molecules that target specific cell types, and thus have less off-target effects. However, in the clinical application of exosomes, obtaining large amounts of pure exosomes and loading soluble proteins into exosomes has been a major challenge. Using the novel, optogenetic engineered exosome technology "exosomes for protein loading via photoreversible protein-protein interactions" (EXPLOR), developed by Yim et al., exosomes Significant advances have been made in the production efficiency and biological compatibility of This EXPLOR technique was recently adopted in an experimental sepsis model by Choi et al.; They delivered exosomes containing the super-repressor IĸB (srIĸB) to mice. This was a non-degradable form of a kappa B (IĸB) inhibitor that prevented nuclear translocation of NF-ĸB. Their study indicated that exo-srlĸB treatment ameliorated the systemic inflammatory response and subsequent organ dysfunction in a mouse model of sepsis.

Example

Animals: Male C57BL/6J mice were bred in a specific pathogen-free condition at the central animal facility of the Yonsei Medical Center. For all experiments, male mice aged 6-7 weeks were used. In addition, C56BL/6, C57BL/6N, and BALB/c mice were purchased from Orientbio (Seongnam, Korea). LysM ^GFP/+ mice, which express GFP intrinsically in neutrophils and macrophages, were described by Dr. generously provided by M. Kim (University of Rochester, Rochester, NY, USA).

Exosome Isolation: A HEK293T cell line expressing two recombinant proteins, CIBN-EGFP-CD9 and srlĸB-mCherry-CRY2, was used to produce srlĸB-loaded exosomes. Intact HEK293T cells were used for the production of exo-naive. Stable cells were seeded in T175 flasks at 37°C for 24 hours. After removal of the medium, the cells were washed and resuspended in exosome-depleted medium. The cells were then exposed to continuous blue light illumination of a 460 nm light emitting diode in a CO ₂ incubator. After 72 hours, the cell culture supernatant was recovered, centrifuged to remove cells and debris, and filtered through a 0.22 μm polyether sulfone filter; Exosomes were isolated using a combination of tangential flow filtration and size exclusion chromatography. In some examples, to produce exo-srlκB, stable cells were seeded into T175 flasks. After 1 day, the medium was carefully removed, the cells were washed with PBS, and the exosome-depleted medium was added. The cells were then exposed to continuous blue light illumination of a 460 nm light emitting diode in a CO ₂ incubator. After 72 hours, the cell culture supernatant was recovered, centrifuged at 1,000 g for 15 minutes to remove cells and cell debris, and then filtered through a 0.22 μm polyethersulfone (PES) filter to remove large particles. Exosomes were isolated using molecular weight cutoff (MWCO) based membrane filtration. The isolated exosomes were purified by SEC.

Transmission Electron Microscopy: To observe the morphology of EVs via TEM, 5 μL of EVs were absorbed into a carbon-coated copper grid (Electron Microscopy Sciences, Hatfield, PA) for 15 s. After removal of excess liquid, samples were negatively stained with 2% uranyl acetate (Electron Microscopy Sciences). TEM images were obtained using a Tecnai G2 Retrofit electron microscope (FEI company, Hillsboro, OR) operating at 200 kV. Extracellular vesicles (EV) were evaluated morphologically by negative staining. First, 5 μl of EVs suspended in PBS were loaded onto a glow-discharge carbon-coated copper grid (Electron Microscopy Sciences, Hatfield, PA, USA). After adsorbing the sample for 3-5 seconds, the grid was blotted with filter paper and stained with 2% uranyl acetate (UA). The sample was then dried for 20 seconds using a dryer. EVs were observed with a Tecnai G2 Retrofit (FEI Company, Hillsboro, OR, USA) at a voltage of 200 kV.

Nanoparticle tracking analysis: The particle number and size distribution of EVs was determined by NTA using a Zetaview instrument (PMX120, Particle Metrix, Germany) with a built-in 488 nm laser. Samples were diluted in particle-free PBS (serum 1:100 to 1:10000) according to the manufacturer's instructions. Samples were analyzed under constant flow conditions with camera level 78 and shutter 80 at 25°C. The size distribution determined by NTA corresponds to the hydrodynamic diameter of the EV in suspension. The number of particles was counted from the Brownian motion velocity, and the size was determined using the two-dimensional Stoke-Einstein equation based on the particle motion velocity. Specific samples were diluted 1:100 to 1:10,000 in 0.2 μM filtered PBS. EV concentrations were determined based on the number of 50 to 200 particles per frame. For each measurement, two cycles of scanning at 11 cell locations were performed with the following settings: focus, auto focus; Camera sensitivity for all samples, 78.0; shutter, 70; and cell temperature, 25°C. EV concentration was expressed as the number of particles per ml (pn/ml).

Immunoblotting: Cells were lysed in RIPA buffer containing Halt™ protease and phosphatase inhibitor cocktail (100X) (Thermo Fisher Scientific, Waltham, Mass.) and kidneys were lysed in Triton X-100 lysis buffer. Lysates were centrifuged at 9,000-16,000×g for 10-20 min at 4°C and the supernatant stored at -70°C for subsequent immunoblotting. Protein concentrations were determined using a BCA assay (Pierce™ BCA Protein Assay, Thermo Scientific™). Protein extracts were dissolved in Laemmli sample buffer (Bio-Rad, Hercules, CA) and heated at 100° C. for 5 minutes. Proteins were transferred to a nitrocellulose (NC) membrane by electrophoresis on an acrylamide-modified SDS-polyacrylamide gel. The transfer membrane was incubated in blocking buffer A (PBS, 0.1% Tween-20 and 5% nonfat milk) at 22°C for 1 hour, followed by a primary antibody against srIκB (customized antibody, Abclon, Seoul, Korea). , mCherry, Alix, TSG101, GM130, Calnexin (Abcam, Cambridge, UK), CD9, CD63 (SBI, Tokyo, Japan), GAPDH (Santa Cruz Biotechnology, Dallas, TX), Prohibitin (NOVUSBIO, Centennial, CO) ), nucleoporin p62 (BD bioscience, San Jose, CA), NF-κB (clone 8242S, Cell signaling technology, Danvers, MA), Lamin B1 (Clone ab133741), ICAM-1 (Clone AF796, R&D Systems), Cleaved caspase-3 (Clone 9661L, cell signaling technology), cleaved PARP (clone 9544S, cell signaling technology) and β-actin (A5441, Sigma-Aldrich) were incubated overnight at 4°C. After washing and incubating the membranes with specific secondary antibodies, they are developed using a chemiluminescent agent [Clarity and Clarity Max ECL Western Blotting Substrates (Bio-Rad) or West-Q Pico Dura ECL solution (GenDEPOT, Katy, TX)]. did it The relative optical density of the bands for each group was measured using Image J software (NIH).

Mouse Renal Ischemia-Reperfusion Model: Mice are anesthetized via intraperitoneal administration of a tiletamine/zolazepam (Zoletil ^{® )-xylazine (Rompun ® )} mixture (1 mg/kg) and heated surgical pad (37° C.) ) was placed in Bilateral IRI was performed using a dorsal approach. The renal pedicles were dissected, and micro clamps (Jeungdo Bio & Plant, Seoul, Korea) were placed on each renal pedicle for 30 minutes. Sham animals received anesthesia and bilateral dorsal incision alone. During surgery, mice were hydrated with 1 ml of warm normal saline to prevent dehydration. Thirty minutes after ischemia, both clamps were removed and blood flow was confirmed prior to wound closure with an Autoclip ^® wound closure system (Harvard apparatus, Holliston, MA). Animals were allowed to recover with free access to food and water. Mice were sacrificed 24 or 48 hours after IRI surgery. Serum, spleen and kidneys were collected from each mouse for further analysis. Serum BUN and creatinine levels were analyzed using a Cobas C502 automated analyzer (Roche diagnostics, Basel, Switzerland).

Enzyme-Linked Immunosorbent Assay (ELISA): A mouse ELISA kit, following the manufacturer's protocol (Mouse Lipocalin-2/NGAL Quantitative ELISA Kit) (R&D Systems, Minneapolis, MN) after diluting the samples 1:100-1000-fold was used to measure serum NGAL levels.

TNF-α, IL-8 and MCP-1 levels in supernatants collected from THP-1 and HUVEC cultures were measured using a commercial ELISA kit (R&D Systems, Minneapolis, MN, USA) and NF-κB in HUVECs. Activity was measured using the trans AM NF-κB p65 kit (Active Motif, Carlsbad, CA, USA). TNF-α, CCL-4/macrophage inflammatory protein (MIP)-1β, IL-6 and IL-1β levels in mouse plasma collected via cardiac puncture at the indicated time points after the advanced CLP procedure were determined by mouse magnetic luminex screening. Measurements were made using a Magnetic Luminex eScreening Assay kit (R&D Systems). Assays were performed according to the manufacturer's instructions. All samples and standards were calibrated in duplicate using a Luminex 200™ system (Merck Millipore, Darmstadt, Germany). To measure serum TNF-α, IL-1β, IL-6 and CCL4 at the indicated time points, blood samples were collected via cardiac puncture after the LPS endotoxemia procedure, clotted at room temperature for 2 hours, and then at 4°C. was centrifuged at 2,000 g for 20 min.

NE-PER Nuclear and Cytoplasmic Extraction: Kidneys were collected, cut into fragments, washed with PBS, and specific volumes of cytoplasm obtained from the NE-PER Nuclear and Cytoplasmic Extraction Reagent Kit (ThermoFisher, Waltham, Mass.) according to kidney weight. Homogenized with beads in extraction reagent (CER) 1. After 15 seconds of vigorous vortexing and 10 minutes of incubation on ice, CER II was added to each kidney sample, followed by incubation on ice for 1 minute and centrifugation at 16,000×g for 5 minutes. The supernatant was collected as cytoplasmic extract, and the insoluble fraction was suspended in nuclear extraction reagent. After centrifugation at 16,000×g for 10 min, all supernatants were collected and used as nuclear extracts.

Histopathological evaluation of renal injury score and immunohistochemistry: 5-micrometer-thick sections of formalin-fixed and paraffin-embedded kidney tissue samples were processed via hematoxylin-eosin (HE) and IHC staining. To histologically evaluate kidney injury, each slide was stained with HE. A renal pathologist (JIY) blindly scored the proportion of necrotic ducts in the total ducts in the cortical region. Renal impairment was scored according to the proportion of damaged ducts in total ducts: 0, normal; 1, <25% damage; 2, 25-50% damage; 3, 50-75% damage, 4, 75-90% damage; and 5, >90% damage. Histological criteria for damaged ducts included loss of duct brush edges, vacuolization, chromatin condensation, and exposed tubular basement membrane. In general, tubules were evaluated and scored in 5 randomly selected high-power regions containing 50-100 ducts.

For IHC, tissue sections were deparaffinized, rehydrated with ethyl alcohol, and washed with tap water. Using a Black & Decker vegetable steamer, antigens were retrieved in 10 mM sodium citrate buffer for 20 minutes. Slides were blocked with 10% donkey serum for 30 min at 22° C. and washed with PBS. Primary antibodies against NF-κB (Clone 8242S, Cell signaling technology, Danvers, MA) and ICAM-1 (Clone AF796, R&D Systems) were diluted to appropriate concentrations using 2% casein in bovine serum albumin, and slides was added and incubated overnight at 4°C. After washing, a secondary antibody (Dako, Carpinteria, CA) was applied at 22° C. for 1 hour. Diaminobenzidine was added for 2 min and slides were counterstained using hematoxylin. Semiquantitative scores of staining intensity were obtained by examining at least 5 fields in each section via digital image analysis (MetaMorph version 4.6r5, Universal Imaging Corp., Downingtown, PA) under 400-fold magnification.

Determination of DNA binding activity of NF-κB: Using 20 μg of kidney nuclear extract, p65/c-Rel (p65/c-Rel ( NF-κB) binding activity was measured.

Quantitative real-time polymerase chain reaction: An established method of whole kidney RNA extraction was used. Briefly, whole kidney samples were homogenized with 700 μl of RNAiso reagent (Takara Bio Inc., Otsu, Shiga, Japan). Then 160 μl of chloroform was added to the homogenized sample of kidney cells. The mixture was then vigorously shaken for 30 seconds, held at 22° C. for 3 minutes, and centrifuged at 4° C. at 16,000×g for 15 minutes. The aqueous phase placed on top of the three phases was carefully transferred to a fresh tube to avoid contamination with the other phases. 400 μl of isopropanol was added to precipitate the extracted RNA, followed by centrifugation at 16,000×g at 4° C. for 30 minutes. The RNA pellet was washed with 70% ethanol, air dried for 2 minutes, and dissolved in sterile diethyl pyrocarbonate-treated distilled water. The quantity and quality of extracted RNA was evaluated spectrophotometrically at wavelengths of 260 and 280 nm. The isolated RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio Inc, Shiga Prefecture, Japan). 5 μl of each cDNA was mixed with 10 μl of SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and 5 pmol of sense/antisense primers. Primer concentrations were determined after preliminary experiments to ascertain optimal concentrations for each primer. Expression levels of IL-1α, IL-1β, Il-2, Il-4, Il-6, Il-10, Il-17α, Ccl2, Ccl3, Ccl5, Cxcl2, Ifn-γ, Tnf-α and Icam-1 was measured using an ABI PRISM 7700 sequence detection system (Applied Biosystems). PCR conditions were as follows: an initial heating step was performed at 95°C for 9 minutes, followed by 35 cycles of denaturation at 94.5°C for 30 minutes, annealing at 60°C for 30 seconds, elongation at 72°C for 1 minute, 72°C final extension for 7 min at The sequence data for each primer is presented in Table 1.

primer sequence gene Primer type Primer sequence (in 5' to 3' direction) Il-1α forward CCCGTCCTTAAAGCTGTCTG reverse AATTGGAATCCAGGGGAAAC Il-1β forward GCCCATCCTCTGTGACTCAT reverse AGGCCACAGGTATTTTGTCG Il-2 forward CCCACTTCAAGCTCCACTTC reverse ATCCTGGGGAGTTTCAGGTT Il-4 forward CCTCACAGCAACGAAGAACA reverse ATCGAAAAGCCCGAAAGAGT Il-6 forward AGTTGCCTTCTTGGGACTGA reverse TCCACGATTTCCCAGAGAAC Il-10 forward TGCTATGCTGCCTGCTCTTA reverse TCATTTCCGATAAGGCTTGG Il-17a forward TCCAGAAGGCCCTCAGACTA reverse AGCATCTTCTCGACCCTGAA Ccl2 forward AGGTCCCTGTCATGCTTCTG reverse TCTGGACCCATTCCTTCTTG Ccl3 forward CCTCTGTCACCTGCTCAACA reverse GATGAATTGGCGTGGAATCT Ccl5 forward CCCTCACCATCATCCTCACT reverse GAGCACTTGCTGCTGTGTA Cxcl2 forward AGTGAACTGCGCTGTCAATG reverse TCCAGGTCAGTTAGCCTTGC Ifn- γ forward AAGACTGTGATTGCGGGGTT reverse GCACCAGGTGTCAAGTCTCT Tnf-α forward TATGGCTCAGGGTCCAATC reverse CTCCCTTTGCAGAACTCAGG Icam-1 forward TTCACACTGAATGCCAGCTC reverse GTCTGCTGAGACCCCTCTTG 18S forward CGCTTCCTTACCTGGTTGAT reverse GGCCGTGCGTACTTAGACAT

Each sample was run in triplicate in isolation tubes and a negative control containing no cDNA was run in parallel with each assay. After real-time PCR, melting curves were created by increasing the temperature from 60°C to 95°C at a rate of 2°C/min. The expression value of each gene was normalized to the value of 18S rRNA, and the relative fold expression value was calculated using the comparative _CT method with 2 ^-ΔΔCT .

Multiple cytokine assays in serum: IL-1α, IL-1β, IL-2, IL-4, IL-6, IL-10, IL-17A, CCL2, CCL3, CCL5, CXCL2, IFN-γ and TNF-α Thirteen inflammatory cytokines and chemokines including /Chemokine Magnetic bead Panel)- was analyzed using a multiplex assay kit. Quantification was performed using a Luminex 200 microplate reader (EMD Millipore).

Terminal deoxynucleotidyl transferase dUTP nick-end labeling assay: Cell death was assessed in a FITC-labeled TUNEL assay using a commercial kit (S7110, Merck, Millipore, Billerica, Mass.). TUNEL-positive cells of formalin-fixed kidney tissue were identified by examining at least 5 fields of each section in digital image analysis (MetaMorph version 4.6r5, Universal Imaging Corp.) at 400x magnification.

Isolation of renal mononuclear cells and spleen cells from mice: KMNCs were isolated according to established protocols. Both kidneys were removed after exsanguination, decapsulated, minced, and incubated in collagenase type I (1 mg/ml) (Worthington Biochemical, Lakewood, NJ) at 37° C. for 30 minutes. After enzymatic digestion, single-cell kidney suspensions were achieved by mechanical disruption of the tissue through a 70 μm strainer (BD bioscience, San Jose, CA). KMNCs were collected after centrifugation at RT using an isotonic Percoll density gradient (GE Healthcare, Chicago, IL) (1,500×g for 30 min in break-off mode) according to the manufacturer's instructions. Collected cells were washed, resuspended in RPMI medium containing 5% FBS, and automatically counted using a Countess ^® II FL automated cell counter (Life Technologies, Waltham, MA).

Splenocytes were collected via mechanical disruption of the spleen using a 70 μm strainer (BD bioscience) and incubated with RBC lysis solution (Qiagen, Hilden, Germany) for 3 min to remove red blood cells.

FACS Selection of Renal CD4 ⁺ T Cells: For FACS selection, KMNCs were pre-incubated with anti-CD16/CD32 Fc block (clone 93, Biolegend, San Diego, CA) for 10 min on ice and monoclonal Ab Anti-CD45 (APC, Clone 30-F11, Biolegend), anti-Ly6G (APC-Fire750, Clone 1A8, Biolegend), anti-Ly6C (FITC, Clone HK1.4, Biolegend), anti-F4/80 (PerCP - Cy5.5, Clone BM8, Biolegend) and anti-CD3 (PE, Clone 17A2, Biolegend) were stained at 4° C. for 30 min. After washing and resuspension in FACS buffer (PBS with 5% FBS), stained cells were analyzed with LSRII using FACS Diva software (BD Biosciences) and FlowJo software (version 10.2). After removal of debris/dead cells and doublets, each sample was analyzed based on CD45, Ly6G, Ly6C, F4/80 and CD3 expression. OneComp eBeads (ThermoFisher) were used for calibration.

Immunofluorescence: After deparaffinization, rehydration and antigen retrieval, slides were blocked with 10% goat serum at 22° C. for 30 min and washed with Tween-20 using phosphate buffered saline. Ly-6G (Clone ab25377, Abcam, Cambridge, UK), Ly-6C (Clone ab15627, Abcam), F4/80 (Clone ab6640, Abcam) and fluorescein (FITC)-conjugated lotus thesargonolobus lectin ( LTL) (Clone FL-1321, Vector laboratories, Burlingame, CA) was diluted to the appropriate concentration using 2% casein in bovine serum albumin, added to slides, and incubated overnight at 4°C. After washing, goat anti-rat IgG Alexa Fluor 647 (ab150167, Abcam) was applied at 22° C. for 1 hour. Slides were then counterstained using 4',6-diamidino-2-phenylindole (DAPI) (MBD0015, Sigma-Aldrich, St. Louis, MO). Staining intensity was semi-quantitatively scored by examining at least 5 fields in each section at 400x magnification via digital image analysis (MetaMorph version 4.6r5, Universal Imaging Corp.).

Statistics: Data are expressed as mean ± standard deviation (SD) values. Statistical differences were analyzed using one-way ANOVA with Bonferroni's post hoc test using Prism 8 (GraphPad, San Diego, CA). For P<0.05, the results showed a statistically significant difference.

Endotoxemia Model of LPS: To generate a mouse model of LPS endotoxemia, male mice were injected with LPS derived from Escherichia coli (Sigma-Aldrich, Milwaukee, WI, USA).

Advanced CLP sepsis model and treatment regimen: Male C57BL/6 mice purchased from ORIENTBIO (Seongnam-si, Gyeonggi-do, Republic of Korea) were given to advanced CLP at 9-10 weeks of age using previously described procedures involving small modifications. All mice were housed and experiments were performed in a specific pathogen-free area of the Institute of Biomedical Sciences, Yonsei University College of Medicine, approved by the Association for Assessment and Accreditation of Laboratory Animal Care International. Mice were anesthetized via ip injection of a mixture of 80 mg/kg ketamine and 10 mg/kg xylazine, prior to all procedures. After anesthesia, the peritoneum was opened aseptically and the cecum was ligated at the distal end using 1 cm of 4-0 black silk thread and punctured with a 23 gauge needle. After the puncture, the needle was removed, and a small amount of feces was extruded through both punctures to ensure patency. The cecum was then placed back into the abdominal cavity, the abdominal incision was closed with 6-0 nylon sutures, and a stainless steel removable wound clip was applied to the skin. After this procedure, 1 ml of preheated saline per 20 g of body weight was administered subcutaneously. The sham-treated mice were subjected to the same procedure except for ligation and perforation of the cecum. After this procedure, 1.0×10 ⁹ particles of exo-naive or exo-srlκB were administered to mice via ip injection at 0, 6, 12 and 18 hours. As a control, an equal volume of phosphate buffer (PBS) was injected in the same manner. Animals were evaluated every 2 hours for the first 48 hours after CLP and then every 4 hours for 5 days. Samples were collected and the outcome of the procedure evaluated within 18 hours after CLP.

In vivo imaging: Laser-scanning in vivo confocal microscopy (IVM-C; IVIM Technology, Daejeon, Korea) was used to visualize the biodistribution and anti-corrosive effects of exo-srIκB. During in vivo imaging, mouse body temperature was maintained at 37°C using a homoeothermic controller. Mice were anesthetized with an intramuscular injection of zoletyl (30 mg/kg) and xylazine (10 mg/kg). Small 10 mm incisions were made in both skin and peritoneum to access internal organs including liver, spleen and kidneys. The exposed organs were kept hydrated by repeated application of saline during imaging. The biodistribution of exosomes was visualized via wide-area z-stack imaging before and after exo-naive or exo-srIκB injection. For fluorescent labeling of neutrophils in C57BL/6N mice in vivo, an anti-Ly6G antibody (BD Bioscience, San Jose, CA, USA) conjugated with Alexa Fluor 555 (A20009; Thermo Fisher Scientific, Waltham, MA, USA) was administered. was injected intravenously. Naïve or srIκB exosomes labeled with mCLING ATTO 647N (Synaptic System, Gottingen, Germany) were injected intravenously via a tail vein catheter or 31-G insulin syringe. To generate a sepsis model, high-dose LPS (Sigma-Aldrich, St. Louis, MO, USA) was injected intravenously 1-16 h prior to imaging.

Confocal microscopy: For exosome uptake assays, exosomes were diluted with 0.5 ml of Dulbecco's PBS (DPBS). The suspension was then incubated with 647N-labeled mCLING-ATTO (Synaptic Systems), according to the manufacturer's instructions. A pellet of the mixture was then obtained by centrifugation, and 300 μl of the resuspended pellet was incubated with HUVECs. After 24 hours, the cells were washed with DPBS and fixed in 4% paraformaldehyde solution. Hoechst was used for nuclear staining. Images were recorded using a Zeiss 710 confocal microscope (Zeiss, Oberkochen, Germany).

Luciferase Assay: HEK293 cells were stably transfected with a luciferase receptor construct regulated under the response element of NF-κB (SL-0012; Signosis, Santa Clara, CA, USA) and grown according to the manufacturer's instructions. Cells were treated with exosomes at 37°C for 24 h, and luciferase activity was measured using a SpectraMax ID3 microplate reader (Molecular Devices, Sunnyvale, CA, USA) (E1501; Promega, Madison, WI, USA).

Flow Cytometry: Levels of surface markers expressed on HUVECs were assessed using flow cytometry. Cells were isolated, harvested via centrifugation, labeled with a phycoerythrin (PE)-conjugated antibody specific for human ICAM-1 (BD Biosciences) on ice for 30 min in the dark, followed by extensive washing . All samples were analyzed on a BD Celesta flow cytometer (BD Biosciences). Data were analyzed using BD FACSDiva software. PE-conjugated antibody specific for IgG1κ (BD Biosciences) was used as an isotype control.

Example 1. Characterization and analysis of engineered exosomes

The preparation, recovery and purification of exosomes have been fully described in previous studies, as shown in FIG. 13 . The size of the particles is mostly 30 to 120 nm, and the average size is 101 nm. Transmission electron microscopy (TEM) revealed intact cup-shaped membrane vesicles with sizes according to nanoparticle tracking analysis (NTA) results ( FIGS. 1 , B and C). Immunoblotting analysis results for exo-srlκB showed strong expression of target proteins including srlκB, mCherry, CD9 and GFP with positive exosomal markers such as CD63, TSG101, Alix and GAPDH. Exo-srlκB lacked expression of organelle markers including prohibitin, calnexin, GM130 and nucleoporin p62. Exo-naive did not express any markers except exosome markers ( FIG. 1D ).

Example 2. Injection of exo-srlĸB ameliorates renal ischemia-reperfusion injury

First, we investigated the role of exo-srIĸB in the renal IRI process. Each experimental group was injected 3×10 ⁹ pn of exo-srIκB or, before and after renal IRI, exo-naive three times at 1-hour intervals (total 9×10 ⁹ pn). (Pre-treatment: 3, 2 and 1 h before IRI surgery, Post-treatment: 1, 2 and 3 h after IRI surgery). Mice were sacrificed 24 or 48 hours after surgery ( FIG. 2A ).

Interestingly, the group of mice receiving exo-srIĸB was better than the exo-naive injection group after IRI surgery in both the pre- and post-treatment models (24-h/48-h BUN and creatinine in both models, P<0.001). Serum blood urea nitrogen (BUN) and creatinine showed significantly lower levels ( FIGS. 2B and 2C ). Serum neutrophil gelatinase-associated lipocalin (NGAL) levels were significantly decreased (P<0.001) in the exo-srlĸB injection group of the pre- and post-treatment models compared to the exo-naive group (Figure 2D). The histological evaluation also showed a lower tube injury score in the group of mice receiving exo-srlĸB treatment compared to the exo-naive group in the pre/post-treatment model (P<0.05 vs. the exo-naive injection group). (Fig. 2E). Collectively, these data indicate that systemic delivery of exo-srlĸB directly prevents the progression of ischemic AKI.

Example 3. Systemic Exo-srlB Treatment Inhibits Renal NF-AB Signaling in IR-Injured Kidneys.

To understand the underlying mechanism by which systemic exo-srIĸB treatment affects the IR-induced AKI process, we first studied the systemic delivery of exo-srIĸB to determine whether it inhibits local NF-ĸB signaling in the kidney. . The expression of NF-ĸB p65 protein in kidney nuclear extracts of each different experimental group was measured by Western blotting. Systemic treatment with 9×10 ⁹ pn of exo-srIĸB was pre-IRI (24 h after IRI, P<0.05; 48 h, P<0.01) and post-IRI, compared to that found in the exo-naive-treated group. (P<0.01 after 24-/48 h of IRI) ( FIG. 3A ) Reduced IR-induced NF-ĸB nuclear translocation in the treatment model. This finding was reconfirmed by measuring the DNA binding activity of p65 using kidney nuclear extracts from each experimental group. Exo-srIĸB treatment was, irrespective of the time of treatment (pretreatment: 24-/48-hour IRI, P<0.05; post-treatment: IRI 2-/48-hour, P<0.01), compared to the exo-naive group, , significantly downregulated the DNA binding activity of NF-ĸB after renal IRI (Fig. 3B). Further validation with NF-ĸB immunohistochemistry (IHC) staining showed that the expression of NK-ĸB was significantly reduced in the exo-srIĸB treated group compared to the control treatment group (pretreatment: 24 h after IRI, P <0.05; 48-h, P<0.001 and post-treatment: after 24-/48-h IRI, P<0.05) ( FIG. 3C ). Thus, systemic exo-srlB treatment may decrease renal NF-B signaling in the kidney after IR.

Example 4. Exo-srlκB ameliorates post-ischemic kidney inflammation.

To further investigate whether systemic exosome srIκB treatment locally alleviated renal IRI-induced inflammation, IL-1α, IL-1β, IL-2, IL-1α, IL-1β, IL-2, The gene expression levels of central inflammatory mediators including IL-4, IL-6, Il-10, Il-17α, Ccl2, Ccl3, Ccl5, Cxcl2, Ifn-γ and Tnf-α were determined. Treatment with 9×10 ⁹ pn of exo-srlĸB prior to IRI compared with that of the Ex-naive-treated group in IR-injured kidneys, Il-1β, Il-6, Tnf-α, Ccl2, Ccl5 and Cxcl2 was significantly suppressed (Fig. 4A). Multiple cytokine assays were also performed using sera from different experimental groups. The results were not as significant as the renal transcription data, but there was a clear trend toward decreased expression of inflammatory cytokines including IL-6, TNF-α, CCL2, CCL5 and CXCL2 in the exo-srlκB treated group compared to that in the control group. was present (Fig. 4B).

Additionally, the effect of treatment with exosome srIκB on the expression of adhesion molecules was evaluated by comparing the levels of adhesion molecule 1 (ICAM-1) in transcription/translation cells among the treatment groups. The qRT-PCR results showed a significantly lower level of Icam-1 expression in the exo-srlκB treatment group than in the exo-naive treatment in both the pre/post-treatment models ( FIG. 4C ). This result was reproduced at the translation level through Western blotting and IHC staining (Figs. 4, D and E). Thus, systemic exo-srlĸB delivery may downregulate the expression of pro-inflammatory cytokines/chemokines and adhesion molecules in IR-induced AKI.

Example 5 exo-srlκB alleviates apoptosis in the post-ischemic kidney.

Based on the known role of NF-ĸB in regulating programmed cell death, we investigated how exo-srlĸB affected apoptosis in the post-ischemic kidney. Renal IRI surgery induced significant apoptosis in renal cells, which showed a sharp increase in cleaved caspase-3 and cleaved poly(ADP-ribose) polymerase (PARP) levels in Western blot analysis. Systemic delivery of exo-srlĸB before/after injury can substantially downregulate the expression levels of cleaved caspase-3 and cleaved PARP, suggesting that exo-srlĸB has a protective effect against apoptosis in the post-ischemic kidney. suggest (Figure 5A). Terminal deoxynucleotidyl transferase dUTP nick-end label (TUNEL) staining was used to determine the extent of renal cell damage. Compared with the control group, exo-srlĸB treated kidneys exhibited significantly fewer TUNEL positive cells in the pre/post-treatment model ( FIG. 5B ).

Example 6. Biodistribution of exosomes after renal ischemia-reperfusion injury

The biodistribution of exo-srIĸB in a renal IRI model was investigated to better understand which cell types orchestrate the protective effect of exo-srIĸB in the post-ischemic kidney. Mice were intravenously injected with fluorochrome-labeled Ly6G and F4/80 antibodies 1 hour before IRI surgery, and 9×10 ⁹ pn of exo-srlκB intravenously injected 1 hour after reperfusion. In vivo imaging was performed at 10 min, 5 h and 24 h after reperfusion (Fig. 6A). In vivo imaging after injection of DiD-labeled exosomes, as well as anti-Ly6G antibody (Fluor 555) to visualize neutrophils and anti-F4/80 antibody (Fluor 488) to visualize macrophages, exo-srlĸB and exo It was confirmed that both -naive are taken up by neutrophils (Ly6G ⁺ ) and macrophages (F4/80 ⁺ ) in the post-ischemic kidney ( FIG. 6B ). We observed a slight increase in DiD (green) signal in the tubules after IRI and increased the likelihood of exosome uptake by tubular cells, but the signal intensity was not significantly different from that before DiD-labeled exosome injection. not (data not shown). The spleen was observed simultaneously, indicating exosome uptake in neutrophils and macrophages in the outer parenchyma (Fig. 6C). The inner parenchymal area showed no significant uptake (data not shown).

Example 7. Systemic Delivery of Exo-srlĸB Affects Renal Immune Cell Populations After Renal IRI

Immune cells are known to play an important role in the process of ischemic AKI; Therefore, we evaluated whether providing exosome srIĸB treatment prior to IRI surgery affects the population of each immune cell type. After 24 h of ischemic AKI, there were no differences in the total number of kidney cells isolated through multiple steps of mechanical disruption, enzymatic digestion and Percoll density gradient methods between the experimental groups, but the exo-srIĸB treated group was - had a significantly lower frequency of renal mononuclear cells (KMNC) than that of the treated group (P<0.05) (Figures 7, A and B). Further analysis showed that the exo-srlĸB injection group had more neutrophils (CD45 ⁺ Ly6G ⁺ ) (P<0.01), pro/anti-inflammatory mononuclear phagocytes (CD45 ⁺ Ly6C ⁺ /CD45 ⁺ F4) in total KMNC than those of the exo-naive injection group. /80 ⁺ ) (P<0.01/P<0.05, respectively), and T cells (CD45 ⁺ CD3 ⁺ ) (P<0.05) ( FIG. 7C ). Immunofluorescence results of IR-injured kidneys also revealed a decrease in neutrophil and mononuclear phagocyte frequencies in exo-srlĸB-injected kidneys ( FIG. 7D ). However, exo-srlĸB treatment did not significantly affect the total number or frequency of immune cells in the spleen after ischemic AKI. Excluding T cells (CD45 ⁺ CD3 ⁺ ), total immune cells (CD45 ⁺ ), neutrophils (CD45 ⁺ Ly6G ⁺ ), pro/anti-inflammatory mononuclear phagocytes (CD45 ⁺ Ly6C) between exo-srIĸB and exo-naive treatment groups ⁺ /CD45 ⁺ F4/80 ⁺ ), there was no difference in the total number and frequency of cells. This confirms that systemic exo-srIĸB treatment prior to ischemic AKI had a significant local effect on renal immune cell proliferation/transport, but no significant local effect on splenic immune cells.

Example 8. Intravenous delivery of exo-srlκB

To validate whether a similar protective effect in intraperitoneal exosome delivery was found with intravenous delivery, some experiments were repeated using the intravenous injection modality. The improved biochemical results, besides reduced levels of NF-ĸB signaling and ICAM-1 expression by intravenous delivery of exo-srlĸB, were reproduced as shown in FIG. 8 . Thus, intravenous delivery of exo-srIκB results also results in similar biological effects compared to intraperitoneal delivery in an ischemic AKI model.

Example 9. Further characterization and analysis of srlκB-loaded exosomes

To produce sufficient exosomes, culture medium was collected from each cell type.

HUVECs were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and contained 10% fetal bovine serum (FBS; Atlas Biologicals, Fort Worth, CO, USA), heparin (Sigma-Aldrich), Cultured in F-12K medium (ATCC) containing endothelial cell growth supplement (BD Biosciences) and 1% penicillin/streptomycin (Thermo Fisher). HUVECs between passages 3 and 6 were used for all experiments. Human monocytes (THP-1) were purchased from ATCC, and in RPMI 1640 medium (Welgene, Daegu, Korea) supplemented with 10% FBS, 1% penicillin/streptomycin and 0.05 mM 2-mercaptoethanol (Sigma-Aldrich) cultured.

Exosomes were isolated using a combination of tangential flow filtration (TFF) and size exclusion chromatography (SEC) ( FIG. 13A ). To reduce the risk of loading the SEC column with impurities that exceed binding capacity, the samples were diafiltered and concentrated through TFF. After TFF, the concentrated medium was loaded onto the SEC column for further purification. A second TFF was then performed to enrich the exosomes. Each type of exosomes isolated via sequential purification was analyzed via nanoparticle tracking analysis (NTA), thereby characterizing the size and concentration of exosomes ( FIG. 13B ). Particles with a diameter of 30-120 nm accounted for more than 80% of all particles, and the average size was found to be 101 nm, which is consistent with the characteristic size range of exosomes (30-120 nm). Transmission electron microscopy (TEM) also revealed intact cup-shaped membrane vesicles with sizes corresponding to the NTA results obtained from exo-naive and exo-srIκB ( FIG. 9B ). . To further characterize the exosomes in the formulations of the present invention, two general exosome markers were investigated. These were the tetraspanins CD63 and TSG101 by western blotting.

Western blotting was performed as described in previous studies. Antibodies targeting the following proteins were used: IκBα (CST4812; Cell Signaling Technology, Danvers, MA, USA), p65 (CST6956S; Cell Signaling Technology), CD9 (NBP2-22187; NOVUSBIO, Centennial, CO, USA), CD63 (EXOAB-CD63A-1; SBI, Tokyo, Japan), TSG101 (ab228013; Abcam, Cambridge, UK), GM130 (ab52649; Abcam), GAPDH (sc-47724; Santa Cruz Biotechnology, Santa Cruz, CA, USA), Histone H3 (ab1791; Abcam), mCherry (ab125096; Abcam) and GFP (CST2555; Cell Signaling Technology).

The presence of CD63 and TSG101 was clearly observed in the samples, whereas the Golgi-derived contaminant GM130 was only detected in cell lysates (Fig. 9C). This analysis of exosome preparations shows that they exhibit the properties of exosomes. In addition, we observed robust loading of srIκB-mCherry-CRY2 (130kDa) into exosomes isolated from the srIκB stable cell line.

Example 10. Exo-srlκB improves survival and alleviates acute organ damage in septic mice

We investigated whether intraperitoneal (i.p.) injection of exo-srIκB had a protective effect from endotoxic shock. After a single i.p injection of animals with a lethal dose of LPS (40 mg/kg body weight for C57BL/6, 20 mg/kg body weight for BALB/c), exo-srIκB was administered in a single i.p. injections (6 hours apart). Compared to control C57BL/6 mice with a mortality rate of 100% from LPS-induced sepsis, mice treated with exo-srlκB were significantly resistant to LPS-induced mortality; Most of the mice were rescued from sepsis and exhibited extended survival ( FIG. 10A , top). Exo-srκB-mediated effects were associated with moderate protection from LPS-induced temperature drop ( FIG. 14A ). A mouse model of LPS-induced sepsis was developed using BALB/c mice. Exo-srlκB treatment significantly improved the survival rate of LPS-induced sepsis in BALB/c mice ( FIG. 10A , middle). Then, using the CLP-induced sepsis model as a standardized mouse model of abdominal sepsis, the role of exo-srIκB in survival was investigated. Animals survived the 7-day monitoring period, indicating that exo-srlκB provides durable protection against sepsis mortality ( FIG. 10A , bottom). To further investigate whether exo-srlκB treatment alleviated sepsis-induced inflammation, an enzyme-linked immunosorbent assay (ELISA) was used to determine the concentrations of major inflammatory factors in serum. In the exo-srIκB treatment group with LPS-induced sepsis, it was observed that the expression levels of the proinflammatory cytokines TNFα, IL-1β and IL-6 and the chemokine carbon tetrachloride (CCL4) were significantly decreased (Fig. 10B, upper part). ). In addition, the serum levels of TNF-α and CCL4 in the CLP group were observed to be significantly higher than the serum levels of the sham control mice, but were not elevated in the mice treated with both CLP and exo-srlκB ( FIG. 10B , bottom). These results suggest that exo-srlκB alleviates inflammation induced by LPS or CLP and protects sepsis mice from acute inflammatory processes.

Numerous studies have found that acute kidney injury (AKI) is a frequent and serious complication of sepsis, occurring in more than 50% of sepsis cases, and having a very high mortality rate. To determine the role of exo-srIκB in CLP-induced AKI in a mouse model of sepsis, renal histological examination was performed. Compared to the group that underwent sham surgery, tubular cells of phosphate-buffered saline (PBS)-treated and exo-naive mice were significantly damaged with respect to vacuolation, loss of brush edges, and nuclear condensation of tubular epithelial cells. was shown (FIG. 10C). In particular, exo-srIκB treatment significantly reduced damage to the ductal region and preserved the proximal canal, demonstrating the therapeutic potential of exo-srlκB for sepsis-induced renal injury. These results are consistent with those of LPS-induced AKI (Fig. 14B). Further quantification of the severity of histological renal injury showed that exo-srIκB treatment significantly reduced the injury score by approximately 50% in both sepsis models ( FIG. 10D ). Exo-srκB ameliorated degenerative changes in the tubules, although some damaged areas were found. These data suggest the critical importance of exo-srIκB in improving renal physiological structure and function in sepsis mice.

Example 11. Biodistribution of exosomes after LPS injection

Changes in exosome biodistribution were investigated in an LPS-injected mouse model of sepsis. In vivo biodistribution was analyzed using a custom-made intravital video-rate laser scanning confocal microscopy system. LysM ^gfp/+ transgenic C57BL/6 mice already injected with anti-Ly6G antibody to visualize neutrophils (green fluorescent protein [GFP] and Alexa 555) and macrophages (GFP) were treated with mCLING fluorescent dye-labeled exosomes. was injected intravenously. We observed that most of the exosomes were rapidly taken up by neutrophils and macrophages, ie within minutes after intravenous exosome injection (Fig. 11A).

Exosomes were mainly delivered to neutrophils in the liver ( FIG. 11B ), and in the spleen of LPS-induced mice, increased recruitment of neutrophils and macrophages and increased uptake of exosomes were observed ( FIG. 11C ). mCLING-labeled exosomes also transferred to neutrophils in the kidneys of LPS-injected mice ( FIG. 15A ). These observations suggest that therapeutic exosomes were successfully delivered to neutrophils and macrophages within 30 minutes in a mouse model of sepsis.

Example 12. Exo-srlκB alleviates sepsis-associated inflammation

The target specificity and efficiency of exo-srlκB in vitro were confirmed. Exo-srlκB significantly blocked TNF-α-induced NF-κB activation in HEK293 cells stably expressing the NF-κB luciferase reporter gene, but not exo-naive ( FIG. 12A ). Increasing the amount of exo-srlκB decreased NF-κB reporter activity in a dose-dependent manner, indicating that srlκB released from exosomes prevented NF-κB transcriptional activity ( FIG. 12B ).

Of all sepsis-reactive cells, monocytes/macrophages play the most important role in promoting immune responses, and depletion of these cells increases mortality in sepsis mice. THP-1 cells are widely used as monocytes in cell culture models. When THP-1 cells were stimulated with LPS, compared to exo-naive, treatment with exo-srlκB resulted in the secretion of the inflammatory cytokines TNF-α and monocyte chemoattractant protein (MCP)-1, which are under NF-κB transcriptional regulation. was reduced (Fig. 12C). In addition, the effect of exo-srIκB was compared with that of the commonly used NF-κB inhibitor JSH-23, which interferes with the binding of NF-κB to the target DNA. Exemplary data showed that exo-srlκB and JSH-23 had comparable effects with respect to inhibition of LPS-induced NF-κB activation and cytokine production in THP-1 cells ( FIG. 12C , lane). 4 vs lane 6).

Sepsis is characterized by monocyte adhesion to the endothelium. Under normal conditions, endothelial cells are quiescent and do not interact with monocytes. However, in an inflammatory environment, activated endothelial cells express adhesion molecules such as intercellular cell adhesion molecule (ICAM)-1 that binds to monocytes. Expression of adhesion molecules is broadly postulated to be activated during the development of sepsis.

To study the effect of exo-srIκB on the expression of cell adhesion molecules in human umbilical vein endothelial cells (HUVEC), the Examples first investigated whether exo-srIκBs are internalized in the cells. mCLING-labeled exo-srlκB was detected in HUVECs and maximal internalization was observed after 24 h ( FIG. 12D ). In addition, it was confirmed that ICAM-1 expression in HUVECs was significantly inhibited by exo-srIκB treatment ( FIG. 12E ). IL-8 and MCP-1 also induced migration and adhesion of monocytes to the vascular endothelium and induced extravasation of these cells into surrounding tissues. Expression of IL-8 and MCP-1 has been previously observed in various tissues during acute inflammation caused by bacterial and viral infections and is associated with severe sepsis. Exo-srIκB was found to inhibit LPS-induced IL-8 and MCP-1 production by inhibiting the transcriptional activity of NF-κB in HUVECs ( FIG. 16B ) ( FIG. 16A ). These results confirm that exo-srIκB reduces the NF-κB-mediated inflammatory response in sepsis.

Example 13. Protective effect of exo-srlκB on lung injury in LPS-induced sepsis

Animals received a single intraperitoneal injection of a lethal dose of LPS (30 mg/kg body weight) for 30 minutes followed by a single intravenous injection of exo-srlkB (1×10 ¹⁰ ) for 10 hours. Lung tissues were analyzed by H&E staining as shown in FIG. 17 . In the group injected with LPS for 10 hours, neutrophil infiltration and proliferation of alveolar macrophages, intraalveolar and extraalveolar hyperemia, and bleeding progressed. Damage to the alveolar endothelial cells, in addition to alveolar bone necrosis, is observed. Exosome administration alleviated alveolar wall dilatation, neutrophil infiltration and alveolar macrophage proliferation, even when slight congestion was observed.

30 mg/kg LPS was administered to the LPS administration group (negative control) and the 3-dose exo-srlkB administration group consisting of 10 mice per group. After 30 minutes of administration, exo-srlkB was administered i.v once, and the 72-hour survival rate was evaluated as shown in FIG. 18 . Compared to control C57BL/6 mice, mice treated with high-dose exo-srIκB were resistant to LPS-induced mortality and exhibited prolonged survival.

30 mg/kg LPS was administered to the LPS administration group (negative control) and the 3-dose exo-srlkB administration group consisting of 5 mice per group. After 30 minutes of administration, exo-srlkB was administered i.v once, and plasma was obtained by autopsy at each time point. The obtained plasma level of TNF-α was measured by ELISA method (FIG. 19). The expression level of the proinflammatory cytokine TNF-α was decreased in a time-dependent manner in the exo-srlκB treatment group with LPS-induced sepsis.

Animals received a single intraperitoneal injection for 30 minutes with a lethal dose of LPS (30 mg/kg body weight) followed by a single intravenous injection of exo-srlkB (1×10 ¹⁰ ). Liver tissues were analyzed by H&E staining ( FIG. 20 ). One hour after LPS administration, infiltration of Kupffer and immune cells around the central vein was slightly observed, but the infiltration of inflammatory cells was reduced in the exosome-administered group. 10 hours after LPS administration, the infiltration of immune cells around the Kupffer and central veins increased significantly, and connective tissue damage between liver cells was observed. In the exosome-administered group, infiltration was reduced, but hepatocyte necrosis and edema processes were expected to be gradually alleviated. Therefore, repeated administration of exosomes is expected to enhance the protective effect.

Embodiments for treating AKI

Embodiment 1. A method for treating acute kidney injury (AKI) in a subject in need thereof, comprising administering to the subject an effective amount of a composition comprising exosomes comprising an NF-κB inhibitor.

Embodiment 2. The method of any one of the preceding embodiments, wherein the inhibitor of NF-κB is selected from the group consisting of NF-κB inhibitory proteins, fragments thereof, and mixtures thereof.

Embodiment 3. The NF-κB inhibitor according to any one of the preceding embodiments, wherein the NF-κB inhibitor is a super-repressor (SR)-IκB (srlκB), IκB-α, IκB-β, IκB-ε, BCL-3, mutants thereof sieves and mixtures thereof.

Embodiment 4. The method of any one of the preceding embodiments, wherein the NF-κB inhibitor is a super-repressor (SR)-IκB (srlκB).

Embodiment 5 The method of any one of the preceding embodiments, wherein the composition is administered via an oral, transdermal, intraperitoneal, intravenous, intramuscular, subcutaneous, or mixed route.

Embodiment 6. The method of any one of the preceding embodiments, wherein the subject is a human.

Embodiment 7. The method of any one of the preceding embodiments, further comprising administering to the subject an anti-inflammatory agent.

Embodiment 8 The method of any one of the preceding embodiments, wherein the exosome comprising the NF-κB inhibitor further comprises a photo-specific binding protein.

Embodiment 9 The method of any one of the preceding embodiments, wherein the NF-κB inhibitor comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.

Embodiment 10 The method according to any one of the preceding embodiments, wherein the NF-κB inhibitor is represented by SEQ ID NO: 1.

Embodiment 11 The method according to any one of the preceding embodiments, wherein the NF-κB inhibitor is represented by SEQ ID NO:2.

Embodiment 12 The photo-specific binding protein according to any one of the preceding embodiments, wherein the photo-specific binding protein is a first photo-specific binding protein and/or a second photo-specific binding protein; the first light-specific binding protein is conjugated to an exosome specific marker to form fusion protein I; A method, wherein the second photo-specific binding protein is conjugated to an NF-κB inhibitor to form fusion protein II.

Embodiment 13. The method of embodiment 12, wherein fusion protein I and fusion protein II are reversibly bound via the first photo-specific binding protein and the second photo-specific binding protein.

Embodiment 14. The method of embodiment 12 or 13, wherein the first photo-specific binding protein is conjugated to an exosome specific marker such that it is located in an exosome inward orientation.

Embodiment 15. The method according to any one of embodiments 12 to 14 above, wherein the first photo-specific binding protein and the second photo-specific binding protein are CIB, CIBN, PhyB, PIF, FKF1, GIGANTEA, CRY and PHR. a method selected from the group consisting of

Embodiment 16 The method of embodiment 15, wherein the first photo-specific binding protein is CIB or CIBN and the second photo-specific binding protein is CRY or PHR.

Embodiment 17 The method of embodiment 15, wherein the first photo-specific binding protein is CRY or PHR and the second photo-specific binding protein is CIB or CIBN.

Embodiment 18. The method of embodiment 15, wherein the first photo-specific binding protein is PhyB and the second photo-specific binding protein is PIF.

Embodiment 19 The method of embodiment 15 above, wherein the first photo-specific binding protein is PIF and the second photo-specific binding protein is PhyB.

Embodiment 20 The method of embodiment 15, wherein the first photo-specific binding protein is GIGANTEA and the second photo-specific binding protein is FKF1.

Embodiment 21 The method of embodiment 15, wherein the first photo-specific binding protein is FKF1 and the second photo-specific binding protein is GIGANTEA.

Embodiment 22 The method according to embodiments 12 to 21, wherein the exosome specific marker is selected from the group consisting of CD9, CD63, CD81 and CD82.

Embodiment 23 The method of any one of the preceding embodiments, wherein the exosomes have a diameter of about 50 nm to about 200 nm.

Example 24 The method of any one of the preceding embodiments, wherein the exosomes have a diameter of about 50 nm to about 150 nm.

Embodiment 25 The method of any one of the preceding embodiments, wherein the composition is a pharmaceutical composition comprising a physiologically acceptable carrier.

Embodiment 26. A composition comprising exosomes further comprising an NF-κB inhibitor as described in embodiments 1 to 16 for treating AKI.

Embodiment 27. Use of a composition comprising exosomes comprising an NF-κB inhibitor as described in embodiments 1 to 16 for treating AKI.

Embodiments for treating other diseases

Embodiment 1. A method of treating a disease caused by sepsis in a subject in need thereof, comprising administering to the subject an effective amount of a composition comprising exosomes comprising an NF-κB inhibitor.

Embodiment 2. The method of any one of the preceding embodiments, wherein the disease is selected from the group consisting of pneumonia, cytokine storm syndrome, respiratory distress syndrome, and organ failure. In some embodiments, the disease is pneumonia. In some embodiments, the disease is cytokine storm syndrome. In some embodiments, the disease is respiratory distress syndrome. In some embodiments, the disease is organ failure.

Embodiment 3. The method of any one of the preceding embodiments, wherein the NF-κB inhibitor is selected from the group consisting of NF-κB inhibitory proteins, fragments thereof, and mixtures thereof.

Embodiment 4. The NF-κB inhibitor according to any one of the preceding embodiments, wherein the NF-κB inhibitor is a super-repressor (SR)-IκB (srlκB), IκB-α, IκB-β, IκB-ε, BCL-3, mutants thereof sieves and mixtures thereof.

Embodiment 5 The method of any one of the preceding embodiments, wherein the NF-κB inhibitor is a super-repressor (SR)-IκB (srlκB).

Embodiment 6. The method of any one of the preceding embodiments, wherein the composition is administered via an oral, transdermal, intraperitoneal, intravenous, intramuscular, subcutaneous, or mixed route.

Embodiment 7. The method according to any one of the preceding embodiments, wherein the subject is a human.

Embodiment 8 The method of any one of the preceding embodiments, wherein the method further comprises administering to the subject an anti-inflammatory agent.

Embodiment 9 The method of any one of the preceding embodiments, wherein the exosome comprising the NF-κB inhibitor further comprises a photo-specific binding protein.

Embodiment 10 The method of any one of the preceding embodiments, wherein the NF-κB inhibitor comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.

Embodiment 11 The method according to embodiment 10, wherein the NF-κB inhibitor is represented by SEQ ID NO: 1.

Embodiment 12 The method according to embodiment 10, wherein the NF-κB inhibitor is represented by SEQ ID NO:2.

Embodiment 13 The photo-specific binding protein according to any one of the preceding embodiments, wherein the photo-specific binding protein is a first photo-specific binding protein and/or a second photo-specific binding protein; the first light-specific binding protein is conjugated to an exosome specific marker to form fusion protein I; A method, wherein the second photo-specific binding protein is conjugated to an NF-κB inhibitor to form fusion protein II.

Embodiment 14. The method of embodiment 13, wherein fusion protein I and fusion protein II are reversibly bound via the first photo-specific binding protein and the second photo-specific binding protein.

Embodiment 15. The method of embodiment 13 or 14, wherein the first photo-specific binding protein is conjugated to an exosome specific marker such that it is located in an exosome inward direction.

Embodiment 16. The method according to any one of embodiments 13 to 15, wherein the first photo-specific binding protein and the second photo-specific binding protein are CIB, CIBN, PhyB, PIF, FKF1, GIGANTEA, CRY and PHR. a method selected from the group consisting of

Embodiment 17 The method of embodiment 16, wherein the first photo-specific binding protein is CIB or CIBN and the second photo-specific binding protein is CRY or PHR.

Embodiment 18 The method of any one of the preceding embodiments, wherein the first photo-specific binding protein is CRY or PHR and the second photo-specific binding protein is CIB or CIBN.

Embodiment 19. The method of embodiment 16, wherein the first photo-specific binding protein is PhyB and the second photo-specific binding protein is PIF.

Embodiment 20 The method of embodiment 16, wherein the first photo-specific binding protein is PIF and the second photo-specific binding protein is PhyB.

Embodiment 21 The method of embodiment 16, wherein the first photo-specific binding protein is GIGANTEA and the second photo-specific binding protein is FKF1.

Embodiment 22 The method of embodiment 16, wherein the first photo-specific binding protein is FKF1 and the second photo-specific binding protein is GIGANTEA.

Embodiment 23 The method according to embodiments 13 to 22, wherein the exosome specific marker is selected from the group consisting of CD9, CD63, CD81 and CD82.

Embodiment 24 The method of any one of the preceding embodiments, wherein the exosomes have a diameter of about 50 nm to about 200 nm.

Example 25 The method of any one of the preceding embodiments, wherein the exosomes have a diameter of about 50 nm to about 150 nm.

Embodiment 26 The method of any one of the preceding embodiments, wherein the composition is a pharmaceutical composition further comprising a physiologically acceptable carrier.

Embodiment 27. A composition comprising exosomes comprising an NF-κB inhibitor according to embodiments 1 to 16 for treating a disease caused by sepsis.

Embodiment 28. Use of a composition comprising exosomes comprising an NF-κB inhibitor according to embodiments 1 to 16 for treating a disease caused by sepsis.

While the present disclosure has been described and described herein with reference to various specific materials, procedures, and examples, it is to be understood that the disclosure is not limited to the particular combination of materials and procedures selected for that purpose. Many variations of these details may be implied as would be understood by one of ordinary skill in the art. The specification and examples are intended to be considered by way of illustration only, the true scope and spirit of the disclosure being set forth by the following claims. All references, patents and patent applications mentioned herein are incorporated herein by reference in their entirety.

SEQUENCE LISTING <110> Ilias Biologics Inc. <120> USE OF EXOSOME-BASED DELIVERY OF NF-觀B INHIBITORS <130> IKPA210547-EN-D2 <140> PCT/IB2021/052708 <141> 2021-03-31 <150> KR 10-2020-0039011 <151> 2020-03-31 <150> US 63/112,154 <151> 2020-11-10 <150> US 63/112,155 <151> 2020-11-11 <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 317 <212> PRT <213> Homo sapiens <400> 1 Met Phe Gln Ala Ala Glu Arg Pro Gln Glu Trp Ala Met Glu Gly Pro 1 5 10 15 Arg Asp Gly Leu Lys Lys Glu Arg Leu Leu Asp Asp Arg His Asp Ala 20 25 30 Gly Leu Asp Ala Met Lys Asp Glu Glu Tyr Glu Gln Met Val Lys Glu 35 40 45 Leu Gln Glu Ile Arg Leu Glu Pro Gln Glu Val Pro Arg Gly Ser Glu 50 55 60 Pro Trp Lys Gln Gln Leu Thr Glu Asp Gly Asp Ser Phe Leu His Leu 65 70 75 80 Ala Ile Ile His Glu Glu Lys Ala Leu Thr Met Glu Val Ile Arg Gln 85 90 95 Val Lys Gly Asp Leu Ala Phe Leu Asn Phe Gln Asn Asn Leu Gln Gln 100 105 110 Thr Pro Leu His Leu Ala Val Ile Thr Asn Gln Pro Glu Ile Ala Glu 115 120 125 Ala Leu Leu Gly Ala Gly Cys Asp Pro Glu Leu Arg Asp Phe Arg Gly 130 135 140 Asn Thr Pro Leu His Leu Ala Cys Glu Gln Gly Cys Leu Ala Ser Val 145 150 155 160 Gly Val Leu Thr Gln Ser Cys Thr Thr Pro His Leu His Ser Ile Leu 165 170 175 Lys Ala Thr Asn Tyr Asn Gly His Thr Cys Leu His Leu Ala Ser Ile 180 185 190 His Gly Tyr Leu Gly Ile Val Glu Leu Leu Val Ser Leu Gly Ala Asp 195 200 205 Val Asn Ala Gln Glu Pro Cys Asn Gly Arg Thr Ala Leu His Leu Ala 210 215 220 Val Asp Leu Gln Asn Pro Asp Leu Val Ser Leu Leu Leu Lys Cys Gly 225 230 235 240 Ala Asp Val Asn Arg Val Thr Tyr Gln Gly Tyr Ser Pro Tyr Gln Leu 245 250 255 Thr Trp Gly Arg Pro Ser Thr Arg Ile Gln Gln Gln Leu Gly Gln Leu 260 265 270 Thr Leu Glu Asn Leu Gln Met Leu Pro Glu Ser Glu Asp Glu Glu Ser 275 280 285 Tyr Asp Thr Glu Ser Glu Phe Thr Glu Phe Thr Glu Asp Glu Leu Pro 290 295 300 Tyr Asp Asp Cys Val Phe Gly Gly Gln Arg Leu Thr Leu 305 310 315 <210> 2 <211> 317 <212> PRT <213> Homo sapiens <400> 2 Met Phe Gln Ala Ala Glu Arg Pro Gln Glu Trp Ala Met Glu Gly Pro 1 5 10 15 Arg Asp Gly Leu Lys Lys Glu Arg Leu Leu Asp Asp Arg His Asp Ser 20 25 30 Gly Leu Asp Ser Met Lys Asp Glu Glu Tyr Glu Gln Met Val Lys Glu 35 40 45 Leu Gln Glu Ile Arg Leu Glu Pro Gln Glu Val Pro Arg Gly Ser Glu 50 55 60 Pro Trp Lys Gln Gln Leu Thr Glu Asp Gly Asp Ser Phe Leu His Leu 65 70 75 80 Ala Ile Ile His Glu Glu Lys Ala Leu Thr Met Glu Val Ile Arg Gln 85 90 95 Val Lys Gly Asp Leu Ala Phe Leu Asn Phe Gln Asn Asn Leu Gln Gln 100 105 110 Thr Pro Leu His Leu Ala Val Ile Thr Asn Gln Pro Glu Ile Ala Glu 115 120 125 Ala Leu Leu Gly Ala Gly Cys Asp Pro Glu Leu Arg Asp Phe Arg Gly 130 135 140 Asn Thr Pro Leu His Leu Ala Cys Glu Gln Gly Cys Leu Ala Ser Val 145 150 155 160 Gly Val Leu Thr Gln Ser Cys Thr Thr Pro His Leu His Ser Ile Leu 165 170 175 Lys Ala Thr Asn Tyr Asn Gly His Thr Cys Leu His Leu Ala Ser Ile 180 185 190 His Gly Tyr Leu Gly Ile Val Glu Leu Leu Val Ser Leu Gly Ala Asp 195 200 205 Val Asn Ala Gln Glu Pro Cys Asn Gly Arg Thr Ala Leu His Leu Ala 210 215 220 Val Asp Leu Gln Asn Pro Asp Leu Val Ser Leu Leu Leu Lys Cys Gly 225 230 235 240 Ala Asp Val Asn Arg Val Thr Tyr Gln Gly Tyr Ser Pro Tyr Gln Leu 245 250 255 Thr Trp Gly Arg Pro Ser Thr Arg Ile Gln Gln Gln Leu Gly Gln Leu 260 265 270 Thr Leu Glu Asn Leu Gln Met Leu Pro Glu Ser Glu Asp Glu Glu Ser 275 280 285 Tyr Asp Thr Glu Ser Glu Phe Thr Glu Phe Thr Glu Asp Glu Leu Pro 290 295 300 Tyr Asp Asp Cys Val Phe Gly Gly Gln Arg Leu Thr Leu 305 310 315 <210> 3 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Sequence (recombinant srl kappa B alpha peptide) <400> 3 Asp Arg His Asp Ala Gly Leu Asp Ala Met Lys Asp Glu 1 5 10

Claims (9)

A composition for the prevention or treatment of acute kidney injury in a subject in need thereof, comprising an exosome comprising an NF-κB inhibitor.
The composition of claim 1 , wherein the acute kidney injury is an acute kidney injury induced by ischemia-reperfusion injury (IRI) or an acute kidney injury induced by sepsis.
The composition of claim 1 , wherein the NF-κB inhibitor is selected from the group consisting of NF-κB inhibitory proteins, fragments thereof, and mixtures thereof.
The method of claim 1 , wherein the NF-κB inhibitor is a super-repressor (SR)-IκB (srlκB), IκB-α, IκB-β, IκB-ε, BCL-3, mutants thereof, and A composition selected from the group consisting of mixtures thereof.
The composition of claim 1 , wherein the composition is administered systemically or via oral, transdermal, intraperitoneal, intravenous, intramuscular, subcutaneous, or mixed routes.
The composition of claim 1 , wherein an anti-inflammatory agent is further administered to the subject.
The composition of claim 1, wherein the exosome further comprises a photo-specific binding protein.
The composition of claim 1 , wherein the NF-κB inhibitor comprises an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
9. The method of any one of claims 1 to 8, wherein the exosome further comprises a first photo-specific binding protein, a second photo-specific binding protein, or both,
a first light-specific binding protein is conjugated to an exosome specific marker to form fusion protein I;
wherein the second photo-specific binding protein is conjugated to an NF-κB inhibitor to form fusion protein II.

Images