KR20220090452A - Novel recombinant Myxoma virus and the uses thereof - Google Patents

Abstract

The present invention relates to a recombinant myxomavirus and its use, and has been completed by confirming that the recombinant myxomavirus into which multiple anticancer genes are introduced not only has an excellent anticancer effect, but can also enhance the effect of an immune anticancer agent. The myxomavirus selected in the present invention is an anticancer virus having tumor selectivity, and since it does not cause pathology in species other than rabbits, it has the advantage of not causing disease in humans. Therefore, myxomavirus can be administered intravenously at high doses for a long period of time, and when administered in the body, dendritic cells are activated, so it has the effect of enhancing immune function. The present inventors prepared a recombinant myxomavirus by introducing a single or multiple anticancer genes into the genome of the myxomavirus, and it was confirmed that the recombinant virus exerts a stronger anticancer effect than the wild-type virus. In particular, it was confirmed that the recombinant myxomavirus according to the present invention can enhance the anticancer effect of the drug and activate the anticancer immune function in the long term when combined with an immune checkpoint inhibitor. Therefore, the recombinant myxomavirus according to the present invention is expected to be used as a new anticancer therapy for treating intractable cancer, etc. and as a combined drug for immunotherapy.

Description

Novel recombinant Myxoma virus and the uses thereof

The present invention relates to novel recombinant myxomaviruses and uses thereof.

Although the therapeutic effect of cancer is improving due to the development of early diagnosis methods for cancer and the continuous development of new anticancer therapies, cancer is still a serious disease that contends for the first and second causes of death in Korea. According to Global Cancer Statistics 2020, which was conducted by the International Agency for Research on Cancer (IARC) under the World Health Organization (WHO) on 36 carcinomas in 185 countries around the world, it is known that cancer is the leading cause of death worldwide, and in 2019 Among the 183 countries surveyed by the age group before the age of 70, cancer was identified as the 1st and 2nd leading cause of death in 112 countries, and ranked 3rd and 4th in 23 countries. Although the mortality rate due to cardiovascular disease is significantly decreasing, cancer still records a high mortality rate, which is an important barrier to extending human life expectancy. In particular, due to global aging and population growth, the number of new cancer cases, which recorded 19.3 million in 2020, is expected to increase 1.5 times to 28.4 million in 2040.

Drugs used for cancer treatment include chemical anticancer drugs, targeted anticancer drugs, and immunotherapy drugs. In the case of chemotherapy, it is pointed out as a problem in cancer treatment because it has various pharmacological actions depending on the type of cancer and various side effects due to toxicity appear because it is caused by chemotherapy. In particular, since many chemotherapy drugs penetrate not only cancer cells but also normal tissues and damage the functions and activities of normal cells, they can cause side effects such as decreased bone marrow function, gastrointestinal disorders, and alopecia. It has major problems in cancer treatment, such as drug resistance.

Targeted anticancer drugs developed one after another since the development of Gleevec in the 2020s can selectively attack only cancer cells by distinguishing them from normal cells, improving the anticancer treatment effect and long-term survival rate of cancer patients. contributed to However, targeted anticancer drugs still have problems with resistance and side effects.

Immunotherapy, which activates the body's immune system to attack cancer cells, has emerged as a new paradigm for cancer treatment. In particular, immune checkpoint inhibitors targeting immune checkpoint proteins have revolutionized various cancer treatments by reversing the immune suppression mechanism of tumor cells. As immune checkpoint inhibitors released since 2013, antibody therapeutics targeting immune checkpoint proteins such as CTLA4, PD1, and PD-L1 are showing good therapeutic effects.

However, the therapeutic response rate of checkpoint inhibitors is 15 to 45%, and a lower response rate has been reported, particularly in gastrointestinal cancer. In particular, immune checkpoint inhibitors are only effective in the treatment of hot tumors in which immune cells are infiltrated within the tumor microenvironment, and do not respond to immune exclusion or cold tumors in which immune cells are absent only at the tumor boundary. There is a limit that cannot be. In addition, there is a need to suppress tumor growth and maximize the survival period of the patient through optimized combination treatment with other anticancer agents, since rapid cancer re-growth has been reported when resistance develops after administration of immunotherapy drugs.

On the other hand, anti-cancer viruses are emerging as a fourth-generation anti-cancer agent that will change the anti-cancer drug market in the future as it has an oncolytic function and a prime function to increase the sensitivity to immune cells that kill cancer in the body, in particular, extensive activation of the anti-cancer immune system. However, the barriers to entry for anticancer virus immunotherapeutic drugs are very high due to the difficulty of development and production technology. Therefore, anti-cancer viruses that have excellent anti-cancer effects by themselves or that can greatly enhance the effects of drugs when combined with other anti-cancer agents are still insufficiently developed.

Republic of Korea Patent Publication No. 10-1585702

The present invention has been devised to solve the above problems, and a recombinant Myxoma virus into which a single or multiple anticancer genes are introduced not only induces tumor-selective cell destruction but also activates anticancer immunity to enhance the effect of immunotherapy. It was completed by confirming that it can be done.

Accordingly, it is an object of the present invention to provide a recombinant myxomavirus in which one or more anticancer genes are introduced into the genome.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising the recombinant myxomavirus as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for co-administration of an immune checkpoint inhibitor comprising the recombinant myxomavirus as an active ingredient.

However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned may be clearly understood by those of ordinary skill in the art to which the present invention belongs from the description below. There will be.

The present invention relates to a recombinant myxomavirus comprising at least one anticancer gene selected from the group consisting of an anticancer immunomodulatory gene, an antiviral immunomodulatory gene, and a tumor microenvironmental modifying gene,

The anti-cancer immunoregulatory gene is one or more genes selected from the group consisting of IFNg, PD-L1, FLT3L, IL-12, and GM-CSF ,

The antiviral immunoregulatory gene is CD47 ,

The tumor microenvironment modifying gene provides a recombinant myxomavirus, characterized in that PH20 .

In one embodiment of the present invention, the anti-cancer gene may be introduced between the M135 and M136 genes in the genome of the myxomavirus, but is not limited thereto.

In another embodiment of the present invention, the recombinant myxomavirus may further include one or more viral promoters, but is not limited thereto.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the recombinant myxomavirus according to the present invention as an active ingredient.

In one embodiment of the present invention, the cancer is squamous cell carcinoma, glioma, lung cancer, adenocarcinoma of the lung, peritoneal cancer, skin cancer, eye cancer, rectal cancer, perianal cancer, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, parathyroid cancer, adenocarcinoma Renal cancer, osteosarcoma, soft tissue sarcoma, urethral cancer, blood cancer, liver cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer, uterine cancer, salivary gland cancer, kidney cancer, prostate cancer It may be one or more selected from the group consisting of cancer, vulvar cancer, thyroid cancer, head and neck cancer, oral cancer, tongue cancer, brain cancer, and stromal tumor, but is not limited thereto.

In another embodiment of the present invention, the composition may satisfy one or more properties selected from the group consisting of, but is not limited thereto:

(a) increasing the level of CD8 ⁺ T cells in the tumor;

(b) reducing regulatory T cell levels in the tumor;

(c) increasing the level of macrophages in the tumor; and

(d) increasing memory T cell levels.

In another embodiment of the present invention, the composition may maintain a tumor suppressive effect even after complete remission of the tumor, but is not limited thereto.

In another embodiment of the present invention, the composition may be for direct intratumoral administration or intravenous administration, but is not limited thereto.

In another embodiment of the present invention, the composition may further include an immune checkpoint inhibitor as an active ingredient, but is not limited thereto.

In another embodiment of the present invention, the checkpoint inhibitor is a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an OX40 inhibitor, a CTLA-4 inhibitor, a 4-1BB inhibitor, a LAG-3 inhibitor, B7-H4 It may be one or more selected from the group consisting of inhibitors, HVEM inhibitors, TIM4 inhibitors, GAL9 inhibitors, VISTA inhibitors, KIR inhibitors, TIGIT inhibitors, and BTLA inhibitors, but is not limited thereto.

In another embodiment of the present invention, the composition may be in the form of a mixture in which the recombinant myxomavirus and the immune checkpoint inhibitor are mixed, but is not limited thereto.

In another embodiment of the present invention, the composition may be in a form in which the recombinant myxomavirus and the immune checkpoint inhibitor are each formulated and administered simultaneously or sequentially, but is not limited thereto.

In addition, the present invention provides a kit for preventing or treating cancer comprising the recombinant myxomavirus according to the present invention as an active ingredient.

In one embodiment of the present invention, the kit may further include an immune checkpoint inhibitor, but is not limited thereto.

In addition, the present invention provides a pharmaceutical composition for co-administration of an immune checkpoint inhibitor comprising the recombinant myxomavirus according to the present invention as an active ingredient.

In one embodiment of the present invention, the composition may be administered simultaneously, separately, or sequentially with the immune checkpoint inhibitor, but is not limited thereto.

In addition, the present invention provides the use of the recombinant myxomavirus according to the present invention for preventing or treating cancer.

In addition, the present invention provides a method for preventing or treating cancer comprising administering the recombinant myxomavirus according to the present invention to an individual in need thereof. The method may further include the step of administering the immuno-cancer agent together or separately.

In addition, the present invention provides the use of the recombinant myxomavirus for the manufacture of a medicament for the treatment of cancer.

In addition, the present invention provides a use for co-administration of the recombinant myxomavirus according to the present invention with an immuno-cancer agent.

In addition, the present invention provides the use of the recombinant myxomavirus for the manufacture of a medicament for combined administration of an immuno-cancer agent.

The present invention relates to a recombinant myxomavirus and its use, and has been completed by confirming that the recombinant myxomavirus into which multiple anticancer genes are introduced not only has an excellent anticancer effect, but can also enhance the effect of an immune anticancer agent. The myxomavirus selected in the present invention is an anticancer virus having tumor selectivity, and since it does not cause pathology in species other than rabbits, it has the advantage of not causing disease in humans. Therefore, myxomavirus can be administered intravenously at high doses for a long period of time, and when administered in the body, dendritic cells are activated, so it has the effect of enhancing immune function. The present inventors prepared a recombinant myxomavirus by introducing a single or multiple anticancer genes into the genome of the myxomavirus, and it was confirmed that the recombinant virus exerts a stronger anticancer effect than the wild-type virus. In particular, it was confirmed that the recombinant myxomavirus according to the present invention can enhance the anticancer effect of the drug and activate the anticancer immune function in the long term when combined with an immune checkpoint inhibitor. Therefore, the recombinant myxomavirus according to the present invention is expected to be used as a new anticancer therapy for treating intractable cancer, etc. and as a combined drug for immunotherapy.

1A shows the sequence of a shuttle vector for producing a recombinant myxomavirus according to an embodiment of the present invention.
Figure 1b shows a schematic diagram showing the production process of a recombinant myxomavirus according to the present invention, and a gene cleavage map of the recombinant myxomavirus into which a single gene or multiple genes are introduced.
2 is a result of confirming the IFNg and/or CD47 gene introduced into the genome of each recombinant myxomavirus through agarose gel electrophoresis.
Figure 3a is a result of confirming the components of the cell culture medium by ELISA analysis to confirm whether the cell line infected with MC509-IFNg produces and secretes IFNg.
Figure 3b is the result of confirming the CD47 expression in cell lines infected with MC509-CD47 or MC509-IFNg_CD47 by Western blotting.
3c is a result of confirming the expression of CD47 on the cell surface of a cell line infected with MC509-CD47 through flow cytometry.
3D is a result of confirming the expression of PD-L1 and CD47 on the cell surface of a cell line infected with MC509-IFNg_CD47 through flow cytometry.
FIG. 4a shows the results of confirming cancer cell viability by WST analysis after treating various mouse-derived cancer cell lines with MC509, MC509-CD47, MC509-IFNg, or MC509-IFNg_CD47 at various concentrations.
FIG. 4b shows the results of confirming cancer cell viability by WST analysis after treating various human-derived cancer cell lines with MC509, MC509-CD47, MC509-IFNg, or MC509-IFNg_CD47 at various concentrations.
Figure 5a is a diagram schematically showing the experimental procedure to confirm the effect of MC509, MC509-CD47, MC509-IFNg, and MC509-IFNg_CD47 in a mouse tumor model.
Figure 5b is a graph showing the tumor volume over time in a mouse tumor model administered with MC509, MC509-CD47, MC509-IFNg, or MC509-IFNg_CD47.
Figure 5c is a graph showing the survival rate over time of a mouse tumor model administered with MC509, MC509-CD47, MC509-IFNg, or MC509-IFNg_CD47.
6a is an experimental procedure for confirming the combined effect of a recombinant myxomavirus (MC509, MC509-CD47, MC509-IFNg, or MC509-IFNg_CD47) and an immune checkpoint inhibitor (anti-PD-L1 antibody, aPDL1) in a mouse tumor model. is a brief representation of
6B is a graph showing the average tumor volume for each group according to time of a mouse tumor model administered alone or in combination with an immune checkpoint inhibitor or recombinant myxomavirus.
6c is a graph showing the survival rate over time in a mouse tumor model administered alone or in combination with a recombinant myxomavirus, an immune checkpoint inhibitor.
7A is a graph showing the average tumor volume for each group over time in a mouse tumor model in which an immune checkpoint inhibitor (anti-PD-L1 antibody) and recombinant myxomavirus (MC509-IFNg) were administered alone or in combination (top) and each It is a graph (bottom) showing the tumor volume for each individual.
7B is a graph showing the survival rate over time in a mouse tumor model in which an immune checkpoint inhibitor (anti-PD-L1 antibody) and recombinant myxomavirus (MC509-IFNg) were administered alone or in combination.
7c is a comparison of tumor growth by re-transplanting primary tumors, the B16F10 cell line (left flank) and MC38 cell line (right flank), into mice whose skin cancer has completely regressed through the combined administration of recombinant myxomavirus and an immune checkpoint inhibitor.
Figure 7d is flow cytometry the ratio of memory T cells (CD44 ⁺ CD62 ⁺ CD8 ⁺ ) and IFNg ⁺ CD8 ⁺ T cells in the spleen by collecting the spleen of a mouse in which skin cancer has completely remitted by the combined administration of recombinant myxomavirus and an immune checkpoint inhibitor. The results measured by analysis are shown.
8A shows the T cell profiling results of tumor tissues collected from mice administered with recombinant myxomavirus (MC509, MC509-CD47, MC509-IFNg, or MC509-IFNg_CD47).
8B shows the results of macrophage profiling of tumor tissues collected from mice administered with recombinant myxomavirus (MC509, MC509-CD47, MC509-IFNg, or MC509-IFNg_CD47).
9 is a graph showing the measurement of tumor volume over time after intratumoral direct (IV) or intravenous (IT) administration of recombinant myxomavirus (MC509 or MC509-CD47) to a mouse tumor model (top) and time It is a graph (bottom) shown by measuring the survival rate.
10 is a graph showing the average tumor volume for each group over time after administration of recombinant myxomavirus (MC509 or MC509-IFNg_CD47) to a mouse tumor model (top) and a graph showing the survival rate over time (bottom) )to be.
11 is a result of confirming the PD-L1 gene introduced into the genome of each recombinant myxoma virus through agarose gel electrophoresis.
12A shows the result of confirming the expression of PD-L1 on the cell surface of a cell line infected with mC-PD-L1 through flow cytometry (top, mCherry detection result; bottom: PD-L1 detection result).
12B shows the results of confirming the expression of CD47 on the cell surface of a cell line infected with mC-CD47 through flow cytometry.
Figure 13a is a diagram schematically showing the experimental procedure for confirming the combined effect of recombinant myxomavirus (MC509, mC-CD47, or mC-PD-L1) and an immune checkpoint inhibitor (anti-PD-L1 antibody) in a mouse tumor model to be.
13B is a graph showing the average tumor volume for each group over time after administration of recombinant myxomavirus (MC509, mC-CD47, or mC-PD-L1) to a mouse tumor model. In the figure, MC509-CD47 denotes a group administered with mC-CD47, and MC509-PD-L1 denotes a group administered with mC-PD-L1.
13c shows the average tumor volume for each group over time after administration of recombinant myxomavirus (MC509 or mC-PD-L1) and/or immune checkpoint inhibitor (anti-PD-L1 antibody) to a mouse tumor model. It is a graph. MC509-PD-L1 represents the mC-PD-L1 administration group.
14 is a graph showing the measurement of survival rates for each group after administration of recombinant myxomavirus (MC509, mC-CD47, or mC-PD-L1) and/or an immune checkpoint inhibitor to a mouse tumor model.
15 shows the results of confirming the expression of PD-L1 or CD47 in cells infected with MC509-TG1 (top) or MC509-TG2 (bottom) through flow cytometry.
16A shows the mean tumor volume for each group over time (left) after administration of MC509-TG1, MC509-TG2, MC509-TG3, or MC509-TRIO to a mouse tumor model and the mean tumor volume for each group on the 13th day after virus administration. (right) is a graph showing.
16B is a graph showing the time-dependent tumor volume of individual mice for each group after administration of MC509-TG1, MC509-TG2, MC509-TG3, or MC509-TRIO to a mouse tumor model.
Figure 17a shows the mean tumor volume (left) and virus administration by group over time after MC509-TRIO and an immune checkpoint inhibitor (anti-PD-L1 antibody, denoted as ICI in the figure) were administered alone or in combination to a mouse tumor model. It is a graph showing the average tumor volume by group (right) on the 13th day after.
17B is a graph showing the time-dependent tumor volume of individual mice for each group after MC509-TRIO and an immune checkpoint inhibitor were administered alone or in combination to a mouse tumor model.
17c is a graph showing the survival rate of mice over time after MC509-TRIO and an immune checkpoint inhibitor were administered alone or in combination to a mouse tumor model.
17D is a graph showing tumor growth after re-implantation of melanoma in a mouse model in which complete remission occurred after co-administration of MC509-TRIO and an immune checkpoint inhibitor or MC509-CD47 alone (MC509-TRIO+ICI: MC509-TRIO) and a mouse model in which complete remission occurred after co-administration of an immune checkpoint inhibitor, MC509-TG2: a mouse model in which complete remission occurred after mono-administration of MC509-CD47).
18A is a result of confirming cancer cell survival rate by WST analysis after MC509 treatment on various human-derived skin cancer cell lines (top) and colon cancer cell lines (bottom).
18B shows the results of confirming the cancer cell survival rate by WST analysis after treatment with MC509 in various cancer cell lines derived from mice.
19 shows the results of scoring the tumor microenvironment of the tumor tissue after administration of recombinant myxomavirus (MC509) to a mouse tumor model.
Figures 20a to 20d show the results of histopathological examination (H&E staining) of rats administered with MC509 (Figure 20a, cross-sectional staining results of administration site (granulation tissue); Figure 20b, cross-section staining results of prostate tissue; Figure 20c, lung tissue Cross-sectional staining results; and FIG. 20D, lung tissue cross-section staining results).

The present invention relates to a recombinant myxomavirus and its use, and has been completed by confirming that a recombinant myxomavirus into which multiple anticancer genes are introduced can not only selectively cause cell destruction but also enhance the effect of an immune anticancer agent.

Specifically, in an embodiment of the present invention, a recombinant myxomavirus into which an anticancer immunomodulatory gene ( IFNg gene) and/or an antiviral immunomodulatory gene ( CD47 gene) was introduced was prepared and its anticancer effect was confirmed (Example 1) ). The recombinant myxomavirus not only exerted an excellent apoptosis effect on various cancer cell lines derived from humans and mice, but also inhibited tumor growth in a mouse tumor model and improved the survival rate of mice. In addition, as a result of co-administration of the recombinant myxomavirus with an immune checkpoint inhibitor (anti-PD-L1 antibody) to a mouse tumor model, tumor growth was further inhibited and survival rate was improved compared to when each was administered alone Confirmed.

Furthermore, tumor growth was inhibited even when a primary tumor was re-transplanted into a mouse subject in complete remission through the combination of a recombinant myxomavirus and an immune checkpoint inhibitor. The recombinant myxomavirus according to the present invention can activate long-term anticancer immunity confirmed that there is. As a result of profiling the immune cells of the mouse model administered with the recombinant myxomavirus, it was confirmed that memory T cells and CD8 ⁺ T cells in the spleen increased, and CD8 ⁺ T cells and macrophages that infiltrated the tumor tissue also increased. . Furthermore, it was confirmed that the recombinant myxomavirus exhibited excellent anticancer effects when administered intravenously as well as intratumorally.

In another embodiment of the present invention, a recombinant myxomavirus into which the antiviral immunomodulatory gene CD47 or anticancer immunoregulatory gene PD-L1 was introduced was prepared and its anticancer effect was confirmed (Example 2). When the recombinant myxomavirus was administered alone to a mouse tumor model, tumor growth was inhibited and mouse survival rate was increased, and when combined with an immune checkpoint inhibitor (anti-PD-L1 antibody), the anticancer effect was further enhanced.

In another embodiment of the present invention, a recombinant myxomavirus TRIO into which an anticancer immunoregulatory gene ( IFNg gene), an antiviral immunomodulatory gene ( CD47 or PD-L1 gene), and a tumor microenvironment modifying gene (PH20 gene) is introduced was prepared and its anticancer effect was confirmed (Example 3). As a result of comparing the effects of administration to a mouse tumor model, the recombinant myxomavirus into which each gene was introduced also showed excellent anticancer effect, but the recombinant myxomavirus TRIO inhibited tumor growth more remarkably. In addition, as a result of comparing the combined effect with an immune checkpoint inhibitor (anti-PD-L1 antibody), the anticancer effect was the best when combined with the recombinant myxomavirus TRIO, and the anticancer effect was maintained even after complete remission of the tumor.

Through the above examples, the present inventors have found that recombinant myxomaviruses in which anticancer immunoregulatory genes, antiviral immunoregulatory genes, and/or tumor microenvironmental modifying genes are introduced alone or in combination in the genome, have excellent anticancer effects against various cancers. It was confirmed that not only has it, but it can also significantly enhance the effect of anticancer drugs by activating anticancer immunity. Therefore, the recombinant myxomavirus according to the present invention is expected to be utilized as a combination drug for a novel anticancer therapy and immunotherapy for the treatment of intractable cancer.

Hereinafter, the present invention will be described in detail.

The present invention provides a recombinant myxomavirus comprising at least one anticancer gene selected from the group consisting of an anticancer immunomodulatory gene, an antiviral immunomodulatory gene, and a tumor microenvironmental modifying gene.

In the present invention, “Myxoma virus” is a pox virus also referred to as “myxoma virus”. Myxomavirus is a rabbit-specific virus that causes a fatal disease called myxomatosis in European rabbits ( Oryctalagus cuniculus ), but is non-pathogenic to all other vertebrates, including humans. In particular, it has been reported that myxomavirus is an oncolytic virus that can selectively infect various cancer cell lines. Therefore, the myxoma virus according to the present invention has the advantage of having low side effects and the like because it can induce apoptosis by specifically infecting cancer cells without affecting normal cells. Furthermore, the myxoma virus that infects cancer cells can induce a secondary anticancer immune response to induce more powerful cancer cell death. However, despite the strong anticancer effect, wild-type myxomavirus may be inactivated by the body's immune response when injected into the body, and there is a risk that the anticancer immunity caused by myxomavirus may be suppressed by the tumor microenvironment of cancer cells. Accordingly, the present inventors studied a technology that can enhance the anticancer effect of myxomavirus. As a result, the recombinant myxomavirus into which a specific anticancer gene is inserted avoids the body's immune response and at the same time significantly improves oncolytic activity and anticancer immune activation function. The present invention was completed by confirming that the

Myxomaviruses have a double-stranded DNA genome of about 25 kb containing over 170 open reading frames, which allows for the potential insertion and expression of eukaryotic genes. In particular, since myxomavirus has a large amount of genetic material, it can be engineered so that multiple transgenic genes can be inserted and expressed in the genome. In the present invention, "recombinant (recombinant) myxomavirus" refers to a myxomavirus in which one or more foreign genes are inserted (introduced) into the genome. There is no restriction on the position in the genome into which the foreign gene is inserted, but preferably, the recombinant myxomavirus according to the present invention is inserted downstream of the cell surface protein M135 coding gene. More preferably, the recombinant myxomavirus according to the present invention is characterized in that it comprises a foreign gene between the M135 coding gene and the M136 coding gene. In the present invention, the genetically modified myxomavirus may be wild-type, and some sequences may be deleted to enhance infection efficiency, replication function, anticancer effect, and the like. On the other hand, the recombinant myxomavirus according to the present invention is characterized in that it has replication competent in infected cells like wild-type myxomavirus.

Preferably, the recombinant myxomavirus according to the present invention comprises at least one anticancer gene selected from the group consisting of an anticancer immunomodulatory gene, an antiviral immunomodulatory gene, and a tumor microenvironmental modifying gene (ie, a gene in the genome). introduced) is characterized.

In the present invention, the term “anticancer immunomodulator genes” refers to genes encoding proteins or RNAs that regulate immune responses to tumors. The anticancer immunomodulatory gene according to the present invention includes both a gene that promotes cancer cell death by stimulating an immune response against cancer cells and a gene that suppresses the immune response. The anticancer immunoregulatory gene according to the present invention is not limited to a specific type, but preferably IFNg (interferon gamma), PD-L1 (Programmed Death-Ligand 1), FLT3L (FMS-like tyrosine kinase 3 ligand), IL-12 (interleukin-12), and GM-CSF (Granulocyte-macrophage colony-stimulating factor) may be selected from the group consisting of. Most preferably, the anticancer immunomodulatory gene according to the present invention may be an IFNg and/or a PD-L1 gene. In the present specification, the recombinant myxomavirus into which the IFNg gene is introduced alone may be referred to as MC509-IFNg or MC509-TG1, and the recombinant myxomavirus into which the PD-L1 gene is introduced alone is MC509-PD- It may be referred to as L1 or mC-PD-L1 or the like. In a specific example, the present inventors found that recombinant myxomavirus into which the IFNg gene or PD-L1 gene was introduced induces the expression of the PD -L1 gene or directly expresses the PD-L1 gene for tumor anti-PD-L1 antibody. By increasing the sensitivity, it was confirmed that the anti-cancer effect of the immuno-cancer agent was enhanced.

In the present invention, the IFNg gene refers to a gene encoding an interferon gamma (IFNg or IFNγ) protein or RNA. IFNg is a protein that plays a role as a regulator in the center of anticancer immune response. It is a protein that activates cellular immunity against cancer cells, thereby inducing inhibition of cancer cell proliferation and promotion of cancer cell death. In the present invention, the IFNg gene may consist of the nucleotide sequence represented by SEQ ID NO: 1 or 2, but is not limited thereto, and variants of the nucleotide sequence are included within the scope of the present invention. The nucleic acid molecule of the nucleotide sequence represented by SEQ ID NO: 1 or 2 of the present invention is a functional equivalent of a nucleic acid molecule constituting it, for example, a partial nucleotide sequence of the nucleic acid molecule is deleted, substituted or inserted ( insertion), but it is a concept that includes variants that are functionally identical to nucleic acid molecules. Specifically, the IFNg gene has at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% sequence homology to the nucleotide sequence represented by SEQ ID NO: 1 or 2, respectively. It may include a nucleotide sequence having For example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85 %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence homology It includes a polynucleotide having The “% of sequence homology” for a polynucleotide is determined by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion of additions or deletions) to the optimal alignment of the two sequences. may include additions or deletions (ie, gaps) compared to (not including).

In the present invention, the PD-L1 gene means a gene encoding Programmed Death-Ligand 1 (PD-L1) or RNA. PD-L1 is a protein expressed on the surface of cancer cells. When PD-L1 binds to PD-1, a ligand protein on the surface of T cells, T cells cannot attack the cancer cells. That is, PD-L1 plays an important role in the survival of cancer cells by evading immune responses. Therefore, the use of an immune checkpoint inhibitor targeting PD-L1 can block immune evasion of cancer cells. In a specific example, the present inventors showed that myxomaviruses into which the PD-L1 gene is introduced can treat tumors and anti-PD-L1 antibodies. It was confirmed that the effect of the immuno-cancer agent was further increased by enhancing the interaction between the liver. In the present invention, the PD-L1 gene is encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3, and most preferably, it may be encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3, but is not limited thereto. . That is, the PD-L1 gene has at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% sequence homology with the nucleotide sequence represented by SEQ ID NO: 3, respectively. It may include a nucleotide sequence.

In the present invention, the FLT3L gene is encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 16 or 17, and most preferably, it may be encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 16 or 17. not limited That is, the FLT3L gene has at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% sequence homology with the nucleotide sequence represented by SEQ ID NO: 16 or 17, respectively. It may include a nucleotide sequence.

In the present invention, the IL-12 gene is encoded by a polynucleotide comprising the base sequence of SEQ ID NO: 18 or 19, and most preferably, it may be encoded by a polynucleotide comprising the base sequence of SEQ ID NO: 18 or 19. , but not limited thereto. That is, the IL-12 gene has at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% sequence homology with the nucleotide sequence represented by SEQ ID NO: 18 or 19, respectively. It may include a nucleotide sequence having

In the present invention, the GM-CSF gene is encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 20 or 21, and most preferably, it may be encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20 or 21. , but not limited thereto. That is, the GM-CSF gene has at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% sequence homology with the nucleotide sequence represented by SEQ ID NO: 20 or 21, respectively. It may include a nucleotide sequence having

In the present invention, "antivirus immunomodulator genes" means genes that control the body's immune response to viruses. That is, the antiviral immunoregulatory gene according to the present invention serves to help the recombinant myxomavirus avoid innate or acquired immune responses that can attack it. The antiviral immunomodulatory gene according to the present invention is not limited to a specific type, but may preferably be CD47 . In the present specification, the recombinant myxomavirus into which the CD47 gene is introduced alone may be referred to as MC509-CD47, mC-CD47, or MC509-TG2.

In the present invention, the CD47 gene refers to a gene encoding a Cluster of Differentiation 47 (CD47) protein or RNA. CD47, a protein belonging to the immunoglobulin family, transmits an aggression stop signal to activated macrophages, allowing them to evade attack by macrophages. In the present invention, the CD47 gene is encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 4 or 5, and most preferably, it may be encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 4 or 5, but is limited thereto doesn't happen That is, the CD47 gene has at least 70%, more preferably at least 80%, still more preferably at least 90%, most preferably at least 95% sequence homology to the nucleotide sequence represented by SEQ ID NO: 4 or 5, respectively. It may include a nucleotide sequence.

In the present invention, the term “tumor microenvironment matrix modifier genes” refers to genes that induce changes in the tumor microenvironment so as to favor the anticancer effect of the recombinant myxomavirus and/or immune checkpoint inhibitor according to the present invention. refers to The tumor microenvironment (tumor microenvironment) is cancer cells present in the tumor, surrounding tissue cells that directly or indirectly affect the formation and progression of cancer (immune cells, fibroblasts, vascular cells, etc.), and their extracellular matrix It is a comprehensive concept that collectively refers not only to the constituent cell groups such as (extracellular matrix), but also to their environment (weak acidification, hypoxia, etc.). Therefore, the tumor microenvironment-modifying gene according to the present invention can contribute to enhancing the infectivity and duration of efficacy of myxomavirus by inducing the activation of anti-tumor immune cells, inhibition of angiogenesis, and the like. The gene for modifying the tumor microenvironment according to the present invention is not limited to a specific type, but may preferably be a PH20 gene. Throughout this specification, the recombinant myxomavirus into which the PH20 gene is introduced alone may be referred to as MC509-TG3.

In the present invention, the PH20 gene refers to a gene encoding hyaluronidase PH20 protein or RNA. Hyaluronidase PH20 is a hyaluronic acid-digesting protein located in both the plasma membrane and the acrosomal membrane of sperm. It decomposes the hyaluronic acid surrounding the cumulus cell, and the sperm passes through the cumulus cell layer and enters the transparent layer (egg zona pellucida) of the egg. make it possible to reach In the present invention, the PH20 gene is encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6 or 7, and most preferably may be encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6 or 7, but limited thereto doesn't happen That is, the PH20 gene has at least 70%, more preferably at least 80%, still more preferably at least 90%, most preferably at least 95% sequence homology with the nucleotide sequence represented by SEQ ID NO: 6 or 7, respectively. It may include a nucleotide sequence.

The recombinant myxomavirus according to the present invention may include, without limitation, a known anticancer gene sequence, as long as the purpose and function of the recombinant myxomavirus are maintained in addition to the above-described anticancer genes.

The anticancer genes according to the present invention may be introduced using a vector between the M135 and M136 genes in the genome of the myxomavirus. That is, in the present invention, the vector may include M135 and M136 genes so that homologous recombination with the myxomavirus genome can occur. In the present invention, the M135 gene includes the nucleotide sequence of SEQ ID NO: 9, and most preferably, may consist of the nucleotide sequence of SEQ ID NO: 9, but is not limited thereto. That is, M135 is a nucleotide sequence having at least 70%, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more sequence homology to the nucleotide sequence represented by SEQ ID NO: 9. may include In the present invention, the M136 gene includes the nucleotide sequence of SEQ ID NO: 10, and most preferably, it may consist of the nucleotide sequence of SEQ ID NO: 10, but is not limited thereto. That is, the M136 gene is a nucleotide sequence having at least 70%, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more sequence homology to the nucleotide sequence represented by SEQ ID NO: 10, respectively. may include Preferably, the anticancer genes according to the present invention are introduced by cloning into a multicloning site (MCS; for example, SEQ ID NO: 12) that exists between the M135 and M136 genes in the genome of the myxomavirus and between the M135 and M136 genes of the vector. can be

The method for modifying the genome of the recombinant myxoma virus according to the present invention is not limited, and it can be produced using known genetic recombination techniques. Preferably, in the recombinant myxomavirus according to the present invention, a foreign gene (ie, an anticancer gene) can be inserted into the genome through homologous endjoining. Homologous end ligation is one of the methods of repairing double-strand breaks in DNA. It is characterized in that the cut DNA is synthesized using a sequence having homology as a template during DNA repair, and non-homologous ends in which the cut DNA strands are linked as they are. It is distinct from non-homologous endjoining. Preferably, the recombinant myxomavirus according to the present invention can be produced by linking the M135 and M136 genes in the genome of the virus with the M135 and M136 genes of the shuttle vector at the end of homologous ligation.

When a recombinant myxomavirus according to the present invention is to be prepared, a cell is infected with a wild-type myxomavirus, and then a vector containing a gene to be inserted into the virus genome is introduced into the cell, and the myxomavirus genome is A modification (ie, insertion of a gene) may be induced to occur. Transduction of the vector into cells and infection with wild-type myxomavirus is not limited in order, and may be performed simultaneously or sequentially. Introduction of a vector into a cell, i.e., transfection or transfection of the vector, includes various techniques commonly used to introduce exogenous nucleic acids (DNA or RNA) into prokaryotic or eukaryotic host cells, for example electroporation, calcium phosphate. Precipitation, DEAE-dextran transfection, or lipofection may be performed.

Preferably, the recombinant myxomavirus according to the present invention may further include a promoter operably linked to a foreign gene sequence. In particular, when the recombinant myxomavirus according to the present invention uses a eukaryotic cell as a host, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter) or a promoter derived from a mammalian virus (eg, a For example, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used. Preferably, the recombinant myxomavirus according to the present invention may further include a viral promoter. More preferably, the recombinant myxomavirus according to the present invention may further include a synthetic early/late (synthetic E/L, sE/L) poxvirus promoter.

In the present invention, the sE/L promoter may be encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 11, and most preferably, may be encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 11, but is not limited thereto. . in other words, The sE/L promoter is a nucleotide sequence having at least 70%, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more sequence homology to the nucleotide sequence represented by SEQ ID NO: 11, respectively. may include

The gene introduced into the recombinant myxomavirus according to the present invention may be under the control of one or more viral promoters. That is, two or more anticancer genes inserted into the genome of the recombinant myxomavirus according to the present invention may be expressed by a promoter operably linked to each gene, or may be expressed simultaneously by one promoter. As used herein, the term “operatively linked” refers to a functional linkage between a nucleotide expression control sequence, such as a promoter sequence, and another nucleotide sequence, whereby the control sequence is transcribed from the other nucleotide sequence. and/or control detoxification.

In addition, the recombinant myxomavirus according to the present invention may further include a marker gene for selecting transformants. The marker gene may be included without limitation as long as it is expressed simultaneously with the anticancer gene inserted together in the genome of the myxomavirus to confer a phenotype that enables the identification of a virus or transformant. Preferably, the recombinant myxomavirus according to the present invention may include a fluorescent protein coding gene as a marker gene. The fluorescent protein refers to a protein that emits light of a specific wavelength to the outside in the process of absorbing light of a specific wavelength to be activated and then returning to a normal state, thereby emitting light with a unique color. Examples of the fluorescent protein include a gene coding for a green fluorescent protein (GFP), a gene coding for a red fluorescent protein (RFP) protein, and a gene coding for mCherry. Preferably, the recombinant myxomavirus according to the present invention may further include an mCherry coding gene (eg, SEQ ID NO: 8) as a marker gene. The location of the marker gene in the genome is not limited, but may preferably exist between the M135 coding gene and the M136 coding gene, and more preferably located upstream of the anticancer gene inserted into the genome of the recombinant myxomavirus. can do. In the present specification, a recombinant myxomavirus into which only the mCherry coding gene is introduced without an anticancer gene may be referred to as MC509 or MC509-mC.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the recombinant myxomavirus according to the present invention as an active ingredient.

As used herein, the term “cancer” is characterized by uncontrolled cell growth, and by this abnormal cell growth, a cell mass called a tumor is formed, penetrates into surrounding tissues, and in severe cases metastasizes to other organs of the body. say that it can be In the present invention, the cancer may be a solid cancer or a blood cancer, and non-limiting examples thereof include squamous cell carcinoma, glioma, lung cancer, adenocarcinoma of the lung, peritoneal cancer, skin cancer, eye cancer, rectal cancer, perianal cancer, esophageal cancer, and small intestine. Cancer, endocrine adenocarcinoma, parathyroid cancer, adrenal cancer, osteosarcoma, soft tissue sarcoma, urethral cancer, hematologic cancer, liver cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer, It may be selected from the group consisting of uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, head and neck cancer, oral cancer, tongue cancer, brain cancer, and stromal tumor. The hematologic cancer may be leukemia, lymphoma, multiple myeloma, or the like. Preferably, the skin cancer may be selected from squamous cell carcinoma, basal cell carcinoma, and melanoma. Preferably, the melanoma may be metastatic melanoma. In one embodiment of the present invention, the cancer may be a cancer that expresses or does not express PD-L1.

The content of the recombinant myxomavirus in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 50, based on the total weight of the composition. It may be a weight %, but is not limited thereto. The content ratio is a value based on the dry amount from which the solvent is removed.

The pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions. The excipient may be, for example, at least one selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a humectant, a film-coating material, and a controlled-release additive.

The pharmaceutical composition according to the present invention can be prepared according to a conventional method, respectively, in powders, granules, sustained-release granules, enteric granules, liquids, eye drops, elsilic, emulsions, suspensions, alcohols, troches, fragrances, and limonaade. , tablets, sustained release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusates, Warnings, lotions, pasta, sprays, inhalants, patches, sterile injection solutions, or external preparations such as aerosols can be formulated and used, and the external preparations are creams, gels, patches, sprays, ointments, warning agents , lotion, liniment, pasta, or cataplasma.

Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. The pharmaceutical composition according to the present invention may be formulated so that the recombinant myxomavirus contained in the composition is bioavailable when administered into a subject. After administration, the myxomavirus present in tumor tissue, blood, and other tissues can be monitored through a detection method such as ELISA.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.

Preferably, when the pharmaceutical composition is administered once, the recombinant myxomavirus according to the present invention is 1×10 ² to 1×10 ²⁰ , 1×10 ² to 1×10 ¹⁹ , 1×10 ² to 1×10 ¹⁸ , 1×10 ² to 1×10 ¹⁷ , 1×10 ² to 1×10 ¹⁶ , 1×10 ² to 1×10 ¹⁵ , 1×10 ² to 1×10 ¹⁴ , 1×10 ² to 1×10 ¹³ , 1×10 ² to 1×10 ¹² , 1×10 ² to 1×10 ¹¹ , 1×10 ² to 1×10 ¹⁰ , 1×10 ² to 1×10 ⁹ , 1×10 ² to 1×10 ⁸ , 1×10 ² to 1×10 ⁷ , 1×10 ² to 1×10 ⁶ , 1×10 ² to 1×10 ⁵ , 1×10 ³ to 1×10 ²⁰ , 1×10 ⁴ to 1×10 ²⁰ , 1×10 ⁵ to 1×10 ²⁰ , 1×10 ⁶ to 1×10 ²⁰ , 1×10 ⁷ to 1×10 ²⁰ , 1×10 ⁸ to 1×10 ²⁰ , 1×10 ⁹ to 1×10 ²⁰ , 1×10 ¹⁰ to 1×10 ²⁰ , 1×10 ⁵ to 1×10 ¹⁸ , 1×10 ⁶ to 1×10 ¹⁵ , 1×10 ⁶ to 1×10 ¹² , 1×10 ⁶ to 1×10 ¹⁰ , 1×10 ⁷ to 1×10 ¹⁵ , 1×10 ⁷ to 1×10 ¹² , or 1×10 ⁷ to 1×10 10 may be administered in a dosage of 1×10 ¹⁰ FFU (Focus-forming unit), but this is an example However, the present invention is not limited thereto, and may vary depending on the size of the tumor. That is, the effective dose of the pharmaceutical composition according to the present invention may be a dose in which the recombinant myxomavirus is administered 1×10 ² to 1×10 ²⁰ FFU. In other words, the recombinant myxomavirus according to the present invention may contain 1×10 ² to 1×10 ²⁰ FFU in the composition.

The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention pertains. Preferably, the pharmaceutical composition according to the present invention may be administered once or repeatedly administered twice or more to an individual in need thereof, and may be administered repeatedly until the tumor decreases or disappears. For example, the pharmaceutical composition according to the present invention may be administered 1 to 10 times, 2 to 10 times, 3 to 10 times, 4 to 10 times, 5 to 10 times, 6 to 10 times, 7 times. to 10 times, 8 to 10 times, 1 to 9 times, 1 to 8 times, 1 to 7 times, 1 to 6 times, 1 to 5 times, 1 to 4 times, or 1 to It may be administered three times.

In addition, the repeated administration may be performed at intervals of 1 to 100 days. For example, the repeated administration is 1 day to 100 days, 1 day to 90 days, 1 day to 80 days, 1 day to 70 days, 1 day to 60 days, 1 day to 50 days, 1 day to 40 days, 1 to 30 days, 1 to 20 days, 1 to 15 days, 1 to 10 days, 1 to 9 days, 1 to 8 days, 1 to 7 days, 1 to 6 days, or 1 It may be performed at intervals of one to five days, but this is only an example and is not limited thereto.

The pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration can be contemplated, for example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, rectal insertion, vaginal It can be administered according to internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, skin administration, transdermal administration, and the like. Preferably, the recombinant myxomavirus according to the present invention may be administered through direct intratumoral administration or intravenous administration, and an appropriate administration method may be selected according to the condition and type of the tumor.

The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with several related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease.

In the present invention, "individual" means a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cattle, etc. means the mammals of

In the present invention, "administration" means providing a predetermined composition of the present invention to an individual by any suitable method.

In the present invention, “prevention” means any action that suppresses or delays the onset of a target disease, and “treatment” means that the target disease and its metabolic abnormalities are improved or It means all actions that are beneficially changed, and “improvement” means all actions that reduce the desired disease-related parameters, for example, the degree of symptoms by administration of the composition according to the present invention.

In addition, the pharmaceutical composition according to the present invention may satisfy one or more properties selected from the group consisting of: (a) increasing the level of CD8 ⁺ T cells (eg, IFNg ⁺ CD8 ⁺ T cells) in the tumor; (b) reducing regulatory T cell (eg, FoxP3 ⁺ Treg) levels in the tumor; (c) increasing the level of macrophages in the tumor; and (d) increasing memory T cell (eg, CD44 ⁺ CD62 ⁺ CD8 ⁺ T cells) levels.

In addition, the pharmaceutical composition according to the present invention is characterized in that the tumor suppressive effect by the recombinant myxomavirus is maintained even after a complete response of the tumor, that is, even after the tumor is cured. The "tumor suppression effect" includes an anticancer effect that results in suppression of tumor growth, development, and recurrence, as well as an anticancer immune activation effect.

The pharmaceutical composition according to the present invention may further include an immuno-oncology agent as an active ingredient in addition to the recombinant myxomavirus. Immunotherapy is an anticancer agent that activates the immune system and exerts anticancer effects by enhancing specificity, memory, and adaptiveness. The present inventors confirmed that, through specific examples, the recombinant myxomavirus according to the present invention enhances the anti-cancer immune activation effect by the immuno-cancer agent and sustains the effect. In the present invention, the immune anticancer agent may be selected from immune checkpoint inhibitors, immune cell therapy, anticancer vaccine, antibody-drug conjugate, etc. It is not limited.

Preferably, the immuno-oncology agent is an immune checkpoint inhibitor. Immune checkpoint is a protein that regulates immune response expressed on the surface of normal cells. It is a protein that protects normal tissues by suppressing harmful and indiscriminate autoimmune responses by weakening excessive immune responses. However, some cancer cells express immune checkpoint proteins, interact with immune cells, and inactivate their immune functions, thereby neutralizing the anticancer immune response. Immune checkpoint inhibitors target immune checkpoint proteins expressed in cancer cells and interfere with their interaction with immune cells, so they can block immune evasion of cancer cells.

Specific types of immune checkpoint inhibitors are not limited, but are preferably PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, OX40 inhibitors, CTLA-4 inhibitors, 4-1BB inhibitors, LAG-3 inhibitors, and B7-H4 inhibitors. inhibitors, HVEM inhibitors, TIM4 inhibitors, GAL9 inhibitors, VISTA inhibitors, KIR inhibitors, TIGIT inhibitors, and BTLA inhibitors. Preferably, the immune checkpoint inhibitor according to the present invention may be small molecules, ligands, macromolecules, etc. targeting the immune checkpoint protein, preferably antibodies targeting the immune checkpoint protein (antibodies) ) can be Alternatively, the immune checkpoint inhibitor according to the present invention may be selected from Ipilimumab, Pembrolizumab, Nivolumab, Cemiplimab, Atezolizumab, Avelumab, Durvalumab, and the like.

The composition according to the present invention may be in the form of a mixture in which the recombinant myxomavirus and the immune checkpoint inhibitor are mixed, and may be in a form for simultaneous administration of the two components.

Alternatively, the composition according to the present invention may be in a form in which the recombinant myxomavirus and the immune checkpoint inhibitor are formulated and administered simultaneously (simultaneously) or sequentially (sequentially). In this case, the composition comprises a first pharmaceutical composition comprising a pharmaceutically effective amount of the recombinant myxomavirus; And it may be a pharmaceutical composition for co-administration for simultaneous or sequential administration, including a second pharmaceutical composition comprising a pharmaceutically effective amount of an immune checkpoint inhibitor. At this time, in the case of sequential administration, the administration sequence is not limited, and the administration regimen may be appropriately adjusted according to the condition of the patient. That is, when the pharmaceutical composition is a pharmaceutical composition for co-administration for sequential administration, the composition is administered with the recombinant myxomavirus (“first component”) first, and then the immune checkpoint inhibitor (“second component”) is administered. may be administered, and vice versa. The recombinant myxomavirus and the immune checkpoint inhibitor according to the present invention may be administered by independent routes. For example, the recombinant myxomavirus according to the present invention may be administered directly into a tumor or intravenously, and the immune checkpoint inhibitor may be administered directly intraperitoneally.

In addition, the present invention provides a kit for preventing or treating cancer comprising the recombinant myxomavirus according to the present invention as an active ingredient. The kit may further include an immuno-oncology agent. The Sangki kit refers to a combination of materials or devices that can be used to prevent or treat cancer, and may be in any form capable of producing, storing, or administering the recombinant myxoma virus, and there is no specific limitation on the form. Therefore, the kit according to the present invention may include, without limitation, recombinant myxomavirus and immunotherapy as well as components known in the art as a component of a kit for the treatment of specific diseases.

In addition, the present invention provides a pharmaceutical composition for co-administration of an immuno-cancer agent comprising the recombinant myxoma virus according to the present invention as an active ingredient. The immuno-oncology agent is preferably an immune checkpoint inhibitor.

As used herein, the term “concomitant administration” may be achieved by administering the individual components of a treatment regimen simultaneously, sequentially, or separately. To obtain a combination treatment effect by administering two or more drugs simultaneously or sequentially, or alternately administering at regular or non-determined intervals, the combination therapy is not limited thereto , defined as being capable of providing a synergistic effect while being therapeutically superior to the efficacy obtained by administering one or the other of the components of the combination therapy at conventional doses, as measured through the period to disease progression or survival. can

The pharmaceutical composition for co-administration according to the present invention can enhance the anti-cancer effect of the immuno-cancer agent and maintain the effect. Here, “enhancing the anticancer effect” refers to all effects that can enhance the function of the immuno-oncology agent as a result. Of course, it is a concept that includes all of the enhancement of the anticancer effect as a result of further enhancing the anticancer immune response or suppressing the formation of resistance or resistance of cancer cells to the immunotherapy. Also, “sustaining the effect” is a concept that includes maintaining the anticancer immune effect on cancer cells even after complete remission of the tumor.

In the present invention, the pharmaceutical composition for co-administration may be administered simultaneously (simultaneously), separately (separately) or sequentially (sequentially) with the immuno-cancer agent, and even when administered sequentially with the immuno-cancer agent, the administration sequence is limited However, depending on the type of cancer and the type of anticancer agent, the patient's condition, etc., the administration regimen may be appropriately adjusted.

Throughout the specification of the present invention, when a part "includes" a certain component, it means that other components may be further included, rather than excluding other components, unless otherwise stated. The terms "about", "substantially", etc. to the extent used throughout the specification of the present invention are used in or close to the numerical value when the manufacturing and material tolerances inherent in the stated meaning are presented, and the present invention It is used to prevent an unconscionable infringer from using the disclosure in which exact or absolute figures are mentioned to help the understanding of the

Throughout the specification of the present invention, the term "combination of these" included in the expression of the Markush form means one or more mixtures or combinations selected from the group consisting of the components described in the expression of the Markush form, It means to include one or more selected from the group consisting of components.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

<Example 1> Confirmation of anticancer effect of myxomavirus into which anticancer immunoregulatory gene and/or antiviral immunomodulatory gene is introduced

A recombinant myxomavirus into which the anticancer immunoregulatory gene, Interferon gamma, IFNγ, or IFNg, and/or, the antiviral gene, CD47, was introduced was prepared and its anticancer effect was confirmed.

1-1. Preparation of recombinant myxomavirus into which anticancer immunoregulatory gene and/or antiviral immunoregulatory gene are introduced

(1) Plasmid production for recombinant myxomavirus production

Shuttle vector for MC509 construction is a synthetic early / late (synthetic E / L, sE / L) poxvirus promoter between the M135 and M136 nucleotide sequences of myxomavirus; mCherry gene coding region; promoters that can be used for further gene cloning and expression; And after chemically synthesizing the gene sequence designed to include the multicloning site, the gene sequence was cloned into the multicloning site of the pUC57Amp vector and produced.

In addition, plasmids for the production of recombinant myxomaviruses expressing CD47, IFNg, PD-L1, and PH20, etc. individually or simultaneously, synthesize the coding region sequence of each gene, and then a multicloning site on the shuttle vector. It was created by cloning in Each plasmid sequence according to a preferred embodiment of the present invention is shown in Fig. 1A.

(2) Preparation of recombinant myxomavirus

A recombinant myxomavirus into which the anticancer immunoregulatory genes IFNg and/or CD47 genes were introduced was prepared using the recombinant plasmid prepared as described above. The gene cleavage map of the recombinant plasmids is shown in Fig. 1b. Specifically, the RK13 cell line was suspended in DMEM medium containing 10% fetal bovine serum and then seeded in a 24-well plate at a density of 0.5 ml/well and cultured overnight. Cells grown to a density of 30 to 50% were infected with a wild-type myxomavirus (MYXV, ATCC, VR-1829) of 0.1 MOI (multiplicity of infection). After 4 hours, recombinant plasmids were introduced into cells using Lipofectamine 2000 to induce homologous recombination. After the recombinant plasmid-treated cells were further cultured for 2 days, the culture medium was removed and 0.5% agar containing DMEM medium was overlaid. Recombinant virus was isolated by selecting myxomavirus lesions expressing mCherry, a red fluorescent protein. The collected lesions were suspended in a small amount of medium, frozen and thawed three times, and then re-infected with freshly cultured RK13 cells in a 6-well plate. This process was repeated three or more times to isolate and use the cloned recombinant virus. The four recombinant myxomaviruses prepared were as follows: MC509 (MYXV in which only the mCherry gene was introduced), MC509-IFNg (MYXV in which the interferon gamma gene was introduced), MC509-CD47 (MYXV in which the CD47 gene was introduced), and MC509 -IFNg_CD47 (MYXV into which both the interferon gamma gene and the CD47 gene were introduced).

1-2. Confirmation of gene introduction into the genome of recombinant myxomavirus

It was confirmed whether foreign genes IFNg and CD47 genes were normally inserted into the genome of the recombinant myxomavirus prepared in Example 1-1. First, after the recombinant myxomavirus was isolated in clonal form, viral DNA was extracted and PCR (polymerase chain reaction) was performed using primers specific to the inserted gene. The DNA amplified through PCR was subjected to electrophoresis on a 10% agarose gel to confirm the presence of the desired gene band. As a result, as shown in FIG. 2 , it was confirmed that the virus into which the CD47 and/or IFNg gene was introduced had bands of the corresponding genes on the agarose gel, indicating that the CD47 and/or IFNg gene DNA was normally inserted into the viral genome. Confirmed.

1-3. Confirmation of expression of transgene of recombinant myxomavirus

Since it was confirmed that the IFNg and CD47 genes were introduced into the genome of the recombinant myxomavirus through Example 1-2, it was confirmed whether the transgenes were normally expressed from the infected cells when the cells were infected with the recombinant virus. For the experiment, RK13 and B16F10 cell lines were cultured in DMEM medium containing 10% fetal bovine serum and cultured in a 6-well plate at a density of 3.3 × 10 ⁵ cells/well. After 24 hours of incubation, cells were treated with MC509, MC509-IFNg, MC509-CD47 or MC509-IFNg/CD47 to an MOI of 0.01 or 0.1. Incubation was performed for an additional 48 hours.

(1) Confirmation of transgene expression of recombinant myxomavirus using ELISA

First, after collecting the cell culture medium of cells infected with the recombinant myxomavirus into which the IFNg gene was introduced, IFN-gamma ELISA analysis was performed to confirm whether IFNg was produced and secreted from the infected cells. Analysis was performed according to the manufacturer's protocol using RnD Systems' Mouse IFN-gamma Quantikine ELISA Kit.

As a result, as shown in FIG. 3A , IFNg was present at a very low level in the culture medium of cells not infected with the virus and cells infected with MC509, but IFNg concentration in the culture medium of cells infected with MC509-IFNg at an MOI of 0.01 or 0.1. was found to increase significantly. The above results show that cells infected with recombinant myxomavirus into which the IFNg gene is introduced can produce high levels of IFNg.

(2) Confirmation of transgene expression of recombinant myxomavirus using Western blotting

Next, the expression of the transgenes was confirmed by western blotting. After additional incubation for 48 hours after infection with the recombinant virus, the cells were washed twice with cold PBS, followed by a lysis solution (150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate, 10 mM NaF, 1 mM orthovandadate, 10% glycerol, protease cocktail) and then the protein was extracted. 30 μg of the protein was analyzed by SDS/PAGE and a conventional western blot method. The CD47 antibody used for the analysis was purchased from Abcam (Cambridge, UK, Cat No: ab175388), and the beta-actin antibody was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA, Cat No: sc47778). .

As a result, the CD47 protein band was not detected in non-virus-infected cells and cells infected with MC509, but a distinct CD47 protein band was detected in cells infected with MC509-CD47 or MC509-IFNg_CD47 (Fig. 3b). The above results show that cells infected with recombinant myxomavirus into which the CD47 gene has been introduced can produce high levels of CD47.

(3) Confirmation of transgene expression of recombinant myxomavirus using flow cytometry

When cells infected with myxomavirus express INFg, the resulting IFNg protein induces PD-L1 expression on the cell surface through various signaling pathways. Therefore, it was confirmed whether the cells infected with the recombinant myxomavirus according to the present invention expressed CD47 and PD-L1 on the cell surface through flow cytometry. After infection with the recombinant virus, the medium was removed from the cells after additional incubation for 48 hours, washed once with PBS phosphate buffer, and then treated with 0.5 mL of TrypLE solution per well to separate the cells from the plate. An equal amount of FACS buffer (phosphate buffer solution containing 2% fetal bovine serum; PBS+2% FBS) was added thereto, incubated for 3 to 5 minutes, homogenized with a pipette, and collected in a 1.5 ml tube. The collected samples were centrifuged at 4°C and 600 g for 5 minutes to precipitate cells. After harvesting the pellet, 100 μl of FACS buffer to which 0.25 μg of PD-L1 antibody (eBioscience, Cat No: 62-5982-80) or CD47 antibody (eBiosciences, Cat No: 11-0479-42) was added per sample was treated to resuspend the cells, and after blocking light, they were incubated for 30 minutes under refrigerated conditions. 900 μl of FACS buffer was added thereto, followed by centrifugation at 4° C. and 600 g for 5 minutes. After removing the supernatant, the recovered cell precipitate was resuspended in 1000 μl of FACS buffer. BL1, YL2, and VL1 channels used for detection of mCherry, PD-L1, and CD47 Flow cytometry was performed using Attune™ NxT software.

As a result, CD47 was not detected in RK13 cells infected with MC509, whereas CD47 protein was specifically expressed on the surface of RK13 cells infected with MC509-CD47 ( FIG. 3c ). In addition, it was shown that IFNg-induced PD-L1 and CD47 proteins were specifically expressed on the surface of RK13 and B16F10 cells infected with MC509-IFNg_CD47 ( FIG. 3D ).

All of the above results show that the recombinant myxomavirus into which the anticancer immunoregulatory gene and the antiviral immunoregulatory gene are introduced can normally express the transgenes during cell infection.

1-4. Confirmation of cancer cell growth inhibitory effect of recombinant myxomavirus

In order to confirm the anticancer effect of the recombinant myxomavirus according to the present invention, various cancer cell lines were treated with the recombinant myxomavirus, and then the cancer cell survival rate was confirmed by WST analysis.

Specifically, colorectal cancer cell lines (MC38, CT26, LoVo), melanoma cell lines (B16F10), liver cancer cell lines (Hep3B), and lung cancer cell lines (A549) were cultured in DMEM medium containing 10% fetal bovine serum and 3,000 in 96-well plates. It was seeded at a density of cells/well and incubated for 24 hours at 37 °C and 5% CO ₂ conditions. The prepared cells were treated with MC509, MC509-IFNg, MC509-CD47 or MC509-IFNg_CD47 serially diluted to a concentration of 0.008 to 100 MOI, and cultured at 37 ° C. and 5% CO ₂ conditions for an additional 3 days, followed by WST (DoGen , Seoul, South Korea, Cat No: EZ-3000) was used to measure the level of viable cells according to the method suggested by the manufacturer. Using the measured results, IC ₅₀ values were calculated using nonlinear regression of Prism GraphPad version 9.1.0.

As a result, as shown in FIGS. 4A and 4B , tumor cell inhibitory effects were exhibited in all cancer cell lines, and the confirmed cytotoxicity was proportional to the treatment concentration of the recombinant myxomavirus, and it was confirmed that there was no non-responsive cell line. In particular, the tumor cell killing effect in mouse-derived melanoma cell lines and colon cancer cell lines showed IC ₅₀ values similar to those of human-derived tumor cell lines. On the other hand, in the normal cell lines RK13 and MRC5, there was no significant difference in survival rate between the control group and the recombinant myxomavirus-treated group. The above results show that the recombinant myxomavirus according to the present invention exerts an excellent apoptosis effect on various types of cancer cells without affecting normal cells.

1-5. Confirmation of anticancer effect in mouse tumor model of recombinant myxomavirus

(1) Preparation of mouse tumor model and administration of recombinant myxomavirus

Then, after constructing a mouse tumor model, it was confirmed whether the recombinant myxomavirus exerts an anticancer effect in the in vivo model. Animals used in the experiment were 6-week-old female C57BL/6 mice, which were purchased from Nara Biotech., Seoul, South Korea. The mice were tested after 7 days of adaptation in the animal laboratory, and water and feed were not restricted during the adaptation period. A standardized environment was provided to the experimental animals, and the day and night were maintained at 12 hour intervals, and the room temperature (23±2° C.) was maintained at an appropriate level. A melanoma cell line (B16F10 cells, 1×10 ⁵ cells/50 μl PBS) was subcutaneously injected into the right flank of the mouse. In order to confirm the anticancer effect of the recombinant myxomavirus, the experiment was conducted by dividing the group into a vehicle and 1X PBS administered control group, MC509 administration group, MC509-IFNg administration group, MC509-CD47 administration group, or MC509-IFNg_CD47 administration group. Each virus was administered to the melanoma animal model using intratumoral injection. Figure 5a shows a schematic diagram of the in vivo experiment of this example. 6 days after transplantation of B16F10 cells into mice, when the tumor volume reached approximately 100 mm ³ , 100 μl phosphate buffer solution or 1×10 ⁷ TCID50 (50% tissue culture infective dose)/100 μl PBS was administered 3 times on 0, 2, 4 days.

(2) Changes in tumor growth after administration of recombinant myxomavirus

After administering the recombinant virus to the mice, the tumor size was measured 2-3 times a week with a caliper, and when the tumor volume exceeded 2,000 mm ³ , the mice were euthanized. The length and width of the tumor were measured, and the volume was calculated as follows: volume = length × width × width × 0.5. Tumor volume over time is shown in Figure 5b. In this skin cancer animal model, it was confirmed that the untreated control group continued to grow after tumors were generated in mice. On the other hand, the cancer growth retardation effect was observed in the MC509, MC509-IFNg, or MC509-CD47 administration group compared to the control group. In particular, cancer growth was significantly inhibited in the MC509-IFNg_CD47 administration group, which co-expressed two recombinant genes.

(3) Change in mouse survival rate after administration of recombinant myxomavirus

As a result of measuring the survival rate of mice according to disease progression, the untreated control group died around 20 days after virus administration, whereas the MC509-administered group had a longer average survival period of about 30 days, MC509-IFNg, MC509 -CD47, and MC509-IFNg_CD47 treatment group showed that the survival rate was further improved (Fig. 5c). In particular, the MC509-IFNg_CD47 treatment group maintained a survival rate close to 50% even after 30 days.

The above experimental results show that the recombinant myxomavirus according to the present invention exhibits excellent tumor suppression effect even in vivo and can improve the survival rate.

1-6. Confirmation of the combined effect of recombinant myxomavirus and immune checkpoint inhibitor

(1) Single or combined tour of recombinant myxomavirus and immune checkpoint inhibitor

Next, the anticancer effect of the combination of the recombinant myxomavirus according to the present invention and an immune checkpoint inhibitor was confirmed. Animals used in the experiment were 6-week-old female C57BL/6 mice, which were purchased from Nara Biotech., Seoul, South Korea. Mice were tested after 7 days of adaptation in the animal laboratory of ViroCure Research Institute, and water and feed were not restricted during the adaptation period. A standardized environment was provided to the experimental animals, and the day and night were maintained at 12 hour intervals, and the room temperature (23±2 ℃) was maintained at an appropriate level. A melanoma cell line (B16F10 cells, 1×10 ⁵ cells/50 μl PBS) was subcutaneously injected into the right flank of the mouse. To confirm the combined effect of recombinant myxomavirus and immune checkpoint inhibitor, vehicle and 1X PBS administered control group, immune checkpoint inhibitor (anti-PD-L1 antibody) intraperitoneally administered group, four recombinant viruses (MC509, MC509-IFNg, MC509-CD47, or MC509-IFNg_CD47) and an immune checkpoint inhibitor were administered in combination, and the experiment was conducted. The recombinant virus was administered to the melanoma animal model using an intratumoral direct administration method, and the antibody administration method was performed using an intraperitoneal direct administration method (Intraperitoneal injection). Figure 6a shows a schematic diagram of the in vivo experiment of this example. 7 days after B16F10 cell transplantation, when the tumor volume reached about 100 mm ³ , 100 μl phosphate buffer solution or 0 with 1×10 ⁷ TCID50/100 μl PBS It was administered 3 times on 2, 4 days. Anti-PD-L1 antibody (Bioxcell, Cat# BE0101) was administered intraperitoneally at 10 mg/kg every other day, 3 times on 2, 4, and 6 days.

(2) Changes in tumor growth after administration of recombinant myxomavirus and immune checkpoint inhibitor

After administering the recombinant virus to the mice, the tumor size was measured 2-3 times a week with a caliper, and when the tumor volume exceeded 2,000 mm ³ , the mice were euthanized. The length and width of the tumor were measured, and the volume was calculated as follows: volume = length × width × width × 0.5. Tumor volume over time is shown in Figure 6b. In this skin cancer animal model, it was confirmed that the untreated control group continued to grow after tumors were generated in mice. As the disease progressed, the cancer growth retardation effect was partially observed in the antibody (immune checkpoint inhibitor) alone group compared to the control group. However, in the group in which the recombinant myxomavirus according to the present invention was co-administered together with the antibody, cancer growth was significantly inhibited compared to the group in which the antibody was administered alone. In particular, MC509-CD47 expressing CD47 alone or concurrently with other transgenes ( IFNg ), and MC509-IFNg_CD47, which were administered in combination with an antibody, showed that cancer growth was significantly inhibited.

(3) Change in survival rate after administration of recombinant myxomavirus and immune checkpoint inhibitor

In addition, as a result of measuring the survival rate of mice according to disease progression, the untreated control group all died when about 20 days passed after administration of the virus, whereas the survival rate increased when the anti-PD-L1 antibody was administered. However, when the recombinant myxomavirus according to the present invention was co-administered together with the antibody, the survival rate was significantly increased even when compared to the case where the antibody was administered alone. In particular, the group in which MC509-IFNg, MC509-CD47, or MC509-IFNg_CD47 was co-administered with an anti-PD-L1 antibody maintained a survival rate of 50% or more even after 30 days ( FIG. 6c ).

The above experimental results show that when the recombinant myxomavirus according to the present invention is used in combination with an immune checkpoint inhibitor, it exhibits a more excellent anticancer effect than when the immune checkpoint inhibitor is administered alone.

1-7. Confirmation of long-term anticancer immunity induction effect for prevention of cancer recurrence after chemotherapy of recombinant myxomavirus

It was confirmed whether the anticancer effect of the recombinant myxomavirus confirmed in the above Example could induce long-term anticancer immunity.

(1) Confirmation of the effect of co-administration of recombinant myxomavirus (MC509-IFNg) and immune checkpoint inhibitor

First, 1×10 ⁵ B16F10 cells were subcutaneously injected into the right flank of 6-week-old C57BL/6 female mice. After 6-7 days, when the tumor volume reached about 100 mm ³ , 1×10 ⁷ TCID50 of recombinant MC509-IFNg virus was administered intratumorally (IT) three times on days 0, 2 and 4 (IT). In addition, anti-PD-L1 antibody (Bioxcell, Cat# BE0101) was administered intraperitoneally at 10 mg/kg 2, 4, 6 3 times every other day.

Tumor size was measured with a caliper 2-3 times a week and mice were euthanized when the tumor volume exceeded 2,000 mm ³ . Tumor volume was measured in the same manner as in the previous example. As a result of time-dependent tumor size analysis, tumor growth was inhibited when the antibody alone or MC509-IFNg was administered alone compared to the control group (Fig. 7a), and the tumor growth inhibitory effect was sharply increased when the anti-PD-L1 antibody and MC509-IFNg were administered in combination. improved In addition, even when the survival rate over time was measured, when the antibody alone or MC509-IFNg was administered alone, the effect was improved compared to the control group, but when administered in combination with the MC509-IFNg and anti-PD-L1 antibody, the survival rate improved more rapidly. , a cured individual was also observed (Fig. 7b). The above results show that the recombinant myxomavirus into which the IFNg gene is introduced not only has an excellent anticancer effect, but also dramatically improves the response rate when combined with an immune checkpoint inhibitor.

(2) Long-term anticancer immunity activation effect of recombinant myxomavirus in fully remission individuals

We observed tumor growth patterns by re-transplanting primary tumors, B16F10 (left flank) and mouse rectal cancer MC38 cell line (right flank), into individuals whose skin cancer was completely remitted by treatment with MC509-IFNg and PD-L1 antibodies. As a result, it was confirmed that the primary cancer, B16F10, did not grow, and tumor growth was partially suppressed in MC38 rectal cancer ( FIG. 7c ). This means that the anticancer immune effect by the recombinant myxomavirus is continued. That is, this means that the combined administration of the composition containing the recombinant myxomavirus according to the present invention and an immune checkpoint inhibitor (eg, anti-PD-L1 antibody, anti-PD-1 antibody, anti-CTLA4 antibody) is clinically long-term. This shows that it can activate anti-cancer immunity.

(3) Immune cell profiling in the tissue of a fully remitted individual

Then, spleens were collected from mice that had undergone complete remission, and the proportion of immune cells in the spleens was measured through flow cytometry. Specifically, spleens were collected from mice in complete remission, shredded, and filtered through a 70 μm cell strainer. Then, the sample was recovered by centrifugation at 300 to 400 g for 5 minutes. After removing the supernatant, 1 to 2 mL of ACK lysis buffer (Lonza cat no. 10-548E) was added, and incubated at room temperature for 1 minute, then 10 ml of FACS buffer was added and mixed, followed by centrifugation at 300 to 400 g for 5 minutes. and recovered. After resuspension with an appropriate amount of FACS buffer, CD8 monoclonal antibody (Thermofisher, Cat no. 64-0081-82), CD44 antibody (Thermofisher, Cat no. 12-0441-82), CD62 antibody (Thermofisher, Cat no. 78-) 0621-80) and flow cytometry was performed using Attune™ NxT software.

As a result, as shown in FIG. 7D , it was confirmed that the memory T cell (CD44 ⁺ Cd62 ⁺ CD8 ⁺ ) ratio was increased in the spleen of the mouse transplanted with the skin cancer cell line. Based on the above results, it was determined that the memory T cell was involved in the long-term anticancer immunity of the recombinant myxomavirus according to the present invention. That is, through the increase of memory T cells (CD44 ⁺ Cd62 ⁺ CD8 ⁺ ) and IFNg ⁺ CD8 ⁺ T cells in the spleen by the recombinant myxomavirus according to the present invention, the tumor-suppressive effect of the immuno-oncology agent is effective for long-term, such as prevention of cancer recurrence. It is expected to be able to activate anti-cancer immunity.

1-8. Immune Cell Profile Analysis of Recombinant Myxomavirus on Cancer-treated Tumors

Immune cell types of tumors treated with recombinant myxomaviruses (MC509, MC509-IFNg, MC509-CD47, and MC509-IFNg_CD47) according to the present invention were analyzed.

1×10 ⁵ B16F10 cells were subcutaneously injected into the right flank of 6-week-old C57BL/6 female mice. After 6 days, when the tumor volume reached approximately 100 mm ³ , recombinant MC509, MC509-IFNg, MC509-CD47 and MC509-IFNg_CD47 viruses were intratumoral 3 times on days 0, 2 and 4 with 1 x 10 ⁷ TCID50. (IT) injection.

After 7 days of initial administration, tumors were collected from mice, washed with PBS, cut into pieces of 2 to 4 mm, and then 1 ml of PBS containing 0.1 to 0.5% type I collagenase (Gibco, Cat No. P2031) was added at 37 ° C. minutes to 1 hour. Here, 10 ml of FACS buffer (0.1% BSA + 0.01% sodium azide in PBS) is added and mixed, centrifuged at 300 to 400 g for 5 minutes to remove the supernatant, and the precipitate is recovered with 7 ml FACS buffer to 70 It was filtered through a μm cell strainer. After adding and mixing 10 ml of FACS buffer to the filtered single cells, the precipitate was recovered by centrifugation at 300 to 400 g for 5 minutes. After removing the supernatant, 1 to 2 ml of ACK lysis buffer (Lonza cat no. 10-548E) was added, left at room temperature for 1 minute, 10 ml of FACS buffer was added and mixed, and then centrifuged at 300 to 400 g for 5 minutes to recover. After resuspension with an appropriate amount of FACS buffer, T cell profile antibody (eBioscience's anti-CD3 antibody (Cat: 47-0032-82), anti-CD4 antibody (Cat: 11-0041-82), anti-CD8 antibody (Cat: 64-0081-82), anti-FoxP3 antibody (Cat: 48-5773-82)) or macrophage profile antibody (eBioscience's anti-CD45 antibody (Cat: 78-0451-82), anti-Ly-6C antibody ( Cat: 12-5932-82) and anti-Ly-6G antibody (Cat: 17-9668-82)) were stained to confirm the immune cell profile, and flow cytometry was performed using Attune™ NxT software.

T cell profiling results are shown in Figure 8a. It was confirmed that the level of CD8 ⁺ T cells infiltrating the tumor 7 days after the start of dosing increased more than 4 times in the group administered with four recombinant myxomaviruses (MC509, MC509-IFGg, MC509-CD47, and MC509-IFNg_CD47). . In addition, in the MC509-CD47 and MC509-IFNg/CD47 administration groups, which express CD47 either alone or as two recombinant genes, the increase in FoxP3-positive regulatory T cells (Tregs) was suppressed, so that the CD8/Treg ratio was different in the treatment group. was found to be significantly higher than that of

The macrophage profiling results are shown in Figure 8b. Three recombinant myxomaviruses (MC509-IFGg, MC509-CD47, and MC509) expressing either IFNg or CD47 introduced as immunomodulatory genes in the amount of macrophages (macrophages) infiltrating into the tumor 7 days after the start of administration -IFNg_CD47) was confirmed to increase more than twice in the administered group.

The above experimental results suggest that the recombinant myxomavirus according to the present invention contributes to cancer treatment by activating anticancer immunity through an increase in tumor invasion of CD8 ⁺ T cells and macrophages, which are representative biomarkers of anticancer mechanisms by immunotherapy drugs. .

1-9. Confirmation of tumor treatment effect through intravenous administration of recombinant myxomavirus

1×10 ⁵ B16F10 cells were subcutaneously injected into the right flank of 6-week-old C57BL/6 female mice. After 6 to 7 days, when the tumor volume reached approximately 100 mm ³ , MC509, MC509-CD47, or MC509-IFNg_CD47 was administered at 1×10 ⁷ TCID50 for intratumoral administration (IT) or intravenous (IV) administration. The doses of 1×10 ⁸ TCID50 were administered three times on days 0, 2, and 4. Tumor size was measured with a caliper 2-3 times a week and mice were euthanized when the tumor volume exceeded 2,000 mm ³ . Tumor volume was calculated as follows: volume = length x width x width x 0.5.

The anticancer effect of intravenous or intratumoral administration of MC509-CD47 is shown in FIG. 9 , and the anticancer effect of intravenous administration of MC509-IFNg_CD47 is shown in FIG. 10 . In this skin cancer animal model, it was confirmed that the untreated control group continued to grow after tumors were generated in mice. On the other hand, cancer growth was significantly inhibited in the treatment group (recombinant myxomavirus administration group) according to the progression of the disease. In particular, the MC509-CD47 or MC509-IFNg_CD47 administration group, which expresses CD47 as a recombinant gene alone or simultaneously with other recombinant genes, significantly inhibited cancer growth compared to MC509 in intratumoral as well as intravenous administration. In addition, both intratumoral and intravenous administration of the recombinant myxomavirus were found to significantly improve the survival rate compared to the control group.

The above results show that the recombinant myxomavirus according to the present invention exhibits excellent anticancer effects not only by intratumoral administration but also by intravenous administration.

<Example 2> Antiviral immunomodulatory gene CD47 or anti-cancer immunoregulatory genes PD-L1 Confirmation of anticancer effect of this introduced myxomavirus

A recombinant myxomavirus into which the CD47 and/or PD-L1 gene was introduced was prepared and its anticancer effect was confirmed. The preparation method of the recombinant myxomavirus into which the CD47 gene is introduced is the same as in Example 1-1 (referred to as mC-CD47).

2-1. PD-L1 Preparation of recombinant myxomavirus into which the gene is introduced

The gene cleavage map of the recombinant plasmid used for the preparation of the recombinant myxomavirus into which the PD-L1 gene was introduced is shown in FIG. 1B (MC509-PD-L1). Specifically, the RK13 cell line was suspended in DMEM medium containing 10% fetal bovine serum and then seeded in a 24-well plate at a density of 0.5 ml/well and cultured overnight. Cells grown to a density of 30 to 50% were infected with a wild-type myxomavirus (MYXV, ATCC, VR-1829) of 0.1 MOI (multiplicity of infection). After 4 hours, the vector plasmid was introduced into the cells using Lipofectamine 2000. After the recombinant plasmid-treated cells were further cultured for 2 days, the culture medium was removed and 0.5% agar containing DMEM medium was overlaid. Recombinant virus was isolated by selecting myxomavirus lesions expressing mCherry, a red fluorescent protein. The collected lesions were suspended in a small amount of medium, frozen and thawed three times, and then re-infected with freshly cultured RK cells in a 6-well plate. This process was repeated three or more times to isolate and use the cloned recombinant virus. The prepared recombinant myxomavirus was designated as MC509-PD-L1 or mC-PD-L1.

2-2. Confirmation of gene introduction into the genome of recombinant myxomavirus

It was confirmed whether the PD-L1 gene introduced into the genome of the recombinant myxoma virus was normally inserted in the same manner as in Example 1-2. As a result, as shown in FIG. 11 , it was confirmed that bands of the corresponding genes were present on the agarose gel in the virus into which the PD-L1 gene was introduced, confirming that the PD-L1 gene was normally introduced into the virus genome.

2-3. Confirmation of expression of transgene of recombinant myxomavirus

Since it was confirmed that the PD- L1 gene was introduced into the genome of the recombinant myxomavirus through Example 2-2, the transgenes were normally expressed from the infected cells when the cells were infected with the recombinant virus into which the PD-L1 or CD47 gene was introduced. It was confirmed that For the experiment, CT26 and B16F10 cell lines were cultured in DMEM medium containing 10% fetal bovine serum and cultured in a 6-well plate at a density of 3.3 × 10 ⁵ cells/well. After 24 hours of incubation, cells were treated with MC509, mC-CD47, or mC-PD-L1 to obtain an MOI of 0.5, 0.05, or 0.005. Incubation was performed for an additional 48 hours.

By performing flow cytometry in the same manner as in Example 1-3, it was confirmed whether cells infected with the recombinant myxomavirus according to the present invention expressed CD47 and PD-L1 on the cell surface. As a result, PD-L1 was not detected in the untreated control group, whereas the PD-L1 protein was specifically expressed on the surface in the cell group treated with mC-PD-L1 at an MOI of 0.5 or 0.05 ( FIG. 12a ). Likewise, cells infected with MC509 did not express CD47, but cells infected with mC-CD47 appeared to express CD47 on their surface (Fig. 12b). The above results show that the recombinant myxomavirus into which the antiviral immunoregulatory gene CD47 or the anticancer immunoregulatory gene PD-L1 has been introduced can normally express the transgenes upon cell infection.

2-4. Confirmation of anticancer effect and combination effect with immune checkpoint inhibitor in mouse tumor model of recombinant myxomavirus

Then, after constructing a mouse tumor model, it was confirmed whether the recombinant myxomavirus exerts an anticancer effect in the in vivo model. CD47 is a glycoprotein that plays a role in immune evasion from macrophages, and PD-L1 is a glycoprotein that inactivates activated T cells. The experiment was conducted under the assumption that PD-L1 would enhance the anti-cancer effect of anti-PD-L1 antibody treatment by increasing interferon gamma and inducing a uniform tumor microenvironment (ie, all cells expressing PD-L1). .

(1) Single or combined tour of recombinant myxomavirus and immune checkpoint inhibitor

In the same manner as in Example 1-5, melanoma cell lines (B16F10 cells, 1×10 ⁵ cells/50 μl PBS) were subcutaneously injected into 5-week-old female C57BL/6 mice. In order to confirm the anticancer effect of the recombinant myxomavirus and the combined effect with the immune checkpoint inhibitor, Vehicle and 1X PBS administered control group, MC509 administration group, mC-CD47 administration group, mC-PD-L1 administration group, anti-PD-L1 antibody ( aPD-L1) alone, a group in which MC509 and an anti-PD-L1 antibody were administered, and a group in which mC-PD-L1 and an anti-PD-L1 antibody were administered in combination. Viruses were administered to melanoma animal models using intratumoral injection, and antibodies were administered by intraperitoneal injection. 13A shows a schematic diagram of the in vivo experiment of this example. 8 days after transplantation of B16F10 cells into mice, when the tumor volume reached about 100 mm ³ , 100 μl phosphate buffer solution or 1×10 ⁶ TCID50/100 μl PBS It was administered 3 times on days 1, 3, and 5. Anti-PD-L1 antibody (Bioxcell, Cat# BE0101) was administered intraperitoneally with 200 μg/100 μl PBS every other day, 3 times on 7, 9, and 11 days.

(2) Change in mouse body weight after administration of recombinant myxomavirus and/or immune checkpoint inhibitor

At the start of administration of recombinant myxomavirus, the body weight of the mice was recorded to range from 16.1 g (lowest) to 19.17 g (highest). No significant body weight change was observed in the course of treatment with recombinant myxomavirus and antibody. However, the weight of the mice after the transplanted tumors were grown varied depending on the size of the tumor and the characteristics of the tumor. Most of the mice with tumor necrosis were found to have lower body weight. At the end of the experiment, the mouse weight was recorded between 16.41 g (lowest) and 26.34 g (highest). These results show that neither MC509 nor the antibody, either alone or in combination, are toxic enough to cause weight loss.

(3) Changes in tumor growth after administration of recombinant myxomavirus and/or immune checkpoint inhibitor

Eight days after transplantation of B16F10 cells, while recombinant myxomavirus was administered, tumor size was measured twice a week with a caliper for 19 days. The results are shown in Figures 13b and 13c. The difference in tumor size was observed 5 days after administration. The tumor size in the Vehicle group increased dramatically, and some mice died before the end of the experiment. After observation for 19 days, the MC509-administered group showed a semi-effect (p-value was not significant, Mann Whitney test). On the other hand, the mice administered with CD47 or PD-L1 introduced myxomavirus significantly reduced tumor growth compared to the MC509-administered group ( FIG. 13b ). The anti-PD-L1 antibody-administered group slightly suppressed tumor growth on days 9 to 15, but before and after that, it was confirmed that the tumor size was equivalent to that of the vehicle group. In addition, the co-administration of MC509 and anti-PD-L1 antibody did not show a particularly improved effect compared to the single-administered group, but the group administered with mC-PD-L1 and anti-PD-L1 antibody co-administered MC509 or mC-PD -L1 virus was significantly reduced compared to the group administered alone (Fig. 13c). This suggests that overexpression of PD-L1 improves the binding or interaction between the anti-PD-L1 antibody and the tumor site. In addition, mice administered alone mC-CD47 (Fig. 13b); And mC-PD-L1 and anti-PD-L1 antibody was co-administered in mice (FIG. 13c), a complete response (complete response) of the tumor was confirmed.

(4) Change in mouse survival rate after administration of recombinant myxomavirus and/or immune checkpoint inhibitor

The survival rate was calculated by GraphPad Prism software and shown in FIG. 14 . Mice were euthanized when the tumor volume exceeded 2,000 mm ³ . In the case of the vehicle administration group, the survival rate was 0% on the 17th day of the experiment, the anti-PD-L1 antibody administration group on the 21st day, the MC509 administration group on the 22nd day, the mC-PD-L1 administration group on the 26th day, MC509 and anti-PD-L1 antibody In the combination administration group, all mice died by the 27th day, and it was confirmed that the survival rate was increased compared to the untreated control group. In particular, on the 36th day of the experiment, the survival rate of the mC-CD47 administration group was 28.5%, and the survival rate of the mC-PD-L1 and anti-PD-L1 antibody combination administration group reached 42.9%, which significantly increased the survival rate of mice.

All of the above results show that the recombinant myxomavirus into which the CD47 gene or the PD-L1 gene is introduced can exert an excellent tumor growth inhibitory effect and improve patient survival. It shows that when co-administered with an anti-PD-L1 antibody, it can exert a synergistic anticancer effect.

<Example 3> Confirmation of anticancer effect of myxomavirus TRIO into which anticancer immunoregulatory gene, antiviral immunoregulatory gene, and tumor microenvironmental modifying gene are introduced

interferon gamma, PD-L1, FLT3L, IL-12, or GM-CSF genes as anticancer immunoregulatory genes; CD47 gene as an antiviral immunoregulatory gene; And a recombinant myxomavirus (MYXV-TRIO) into which the PH20 gene was introduced as a tumor microenvironment-modifying gene was prepared and its anticancer effect was confirmed.

3-1. Preparation of myxomavirus TRIO into which anticancer immunoregulatory gene, antiviral immunoregulatory gene, and tumor microenvironmental modifying gene are introduced

A recombinant myxomavirus into which the anticancer immunoregulatory gene (TG1) IFNg gene, the antiviral immunoregulatory gene (TG2) CD47 gene, and/or the tumor microenvironment gene (TG3) PH20 was introduced was prepared. The gene cleavage map of the recombinant myxomavirus TRIO (referred to as MYXV-TRIO, or MC509-TRIO) into which all three genes have been introduced is shown in FIG. A recombinant myxomavirus was prepared. The four recombinant myxomaviruses prepared were as follows: MC509-TRIO ( MYXV with IFNg, CD47, and PH20 genes introduced), MC509-TG1 ( MYXV with IFNg introduced), MC509-TG2 ( CD47 introduced) MYXV), and MC509-TG3 (MYXV with PH20 introduced).

Expression of the transgenes of MC509-TG1 and MC509-TG2 was confirmed by flow cytometry analysis according to the method described in Examples 1-3 (FIG. 15). IFNg was not detected in the control group (cells infected with the virus into which only the mCherry gene was introduced), but it was confirmed that RK13 and B16F10 cells infected with the MC509-TG1 introduced with the gene expressed PD-L1 on the surface as IFNg was expressed. . Similarly, CD47 was not detected in the control group, but it was confirmed that the cells infected with MC509-TG2 into which the CD47 gene was introduced expressed CD47 on the cell surface. The above results show that the recombinant myxomavirus according to the present invention can normally express the transgene.

3-2. Confirmation of anticancer effect in mouse tumor model of recombinant myxomavirus TRIO

By constructing a melanoma mouse model, it was confirmed whether the recombinant myxomavirus TRIO showed an effective anticancer effect in vivo . The experiment was carried out in the same manner as in Examples 1-5, and to confirm the anticancer effect of the recombinant myxomavirus TRIO, a vehicle and 1X PBS-administered control group, MC509-TG1 introduced with a single gene; MC509-TG2; Alternatively, the experiment was conducted by dividing the group into MC509-TG3 administration group and MC509-TRIO administration group. Each virus was directly administered intratumorally to a mouse model implanted with B16F10 cells to measure the change in tumor volume over time.

As shown in FIG. 16A , it was confirmed that the untreated control group continued to grow after tumors were generated in mice. In comparison, the mice administered with the recombinant myxomavirus according to the present invention significantly reduced tumor growth. In particular, the MC509-TRIO administration group showed the most excellent tumor suppression effect compared to MC509-TG1, TG2, and TG3 introduced with a single gene. Even when the tumor volume of each individual was compared by group, it was confirmed that, unlike the rapid tumor growth observed in the untreated control group, the tumor growth was relatively delayed in the recombinant myxomavirus administered group. It was confirmed that it was very slow (Fig. 16b).

3-3. Confirmation of Combination Effect of Recombinant Myxomavirus TRIO and Immune Checkpoint Inhibitor

Next, the anticancer effect of the combination of the recombinant myxomavirus TRIO and the immune checkpoint inhibitor according to the present invention was confirmed. A tumor animal model was prepared by transplanting B16F10 cells, and a control group administered with vehicle and 1X PBS, a group administered with MC509-TRIO alone, a group administered with an immune checkpoint inhibitor (anti-PD-L1 antibody) alone, and a combination of MC509-TRIO and an immune checkpoint inhibitor The experiment was conducted by dividing into administration groups. In the same manner as in Experimental Examples 1-6, the degree of tumor growth and survival rate for each group according to time were measured.

As shown in FIGS. 17A and 17B , it was confirmed that the untreated control group rapidly grew after tumors were generated in mice. The antibody monotherapy group showed a decrease in tumor growth compared to the untreated control group. In particular, the MC509-TRIO and antibody co-administered group showed almost no tumor growth. As a result of confirming the survival rate, as shown in FIG. 17c , in the untreated control group, all mice died before less than 20 days after virus administration, but the antibody-only group had a slightly increased survival rate, and the MC509-TRIO single-administered group further increased the survival rate. did In the group treated with MC509-TRIO and anti-PD-L1 antibody, more than 50% survived after 40 days, and complete tumor remission was observed in 50% of mice.

In addition, in the same manner as in Example 1-17, melanoma was re-treated in mouse subjects in which complete remission was achieved by co-administration of MC509-TRIO and anti-PD-L1 antibody or MC509-CD47 (MC509-TG2) alone. When transplanted, it was confirmed that tumor growth was inhibited ( FIG. 17D ). The above results show that the anticancer immune effect of the recombinant myxomavirus and the immune checkpoint inhibitor according to the present invention can activate long-term anticancer immunity.

<Example 4> Confirmation of tumor selectivity, tumor microenvironment control effect, and toxicity profile of recombinant myxomavirus

4-1. Confirmation of tumor selectivity of recombinant myxomavirus

The present inventors confirmed that the gene expression and particle proliferation of recombinant myxomaviruses were increased in a tumor cell environment in which tumor suppressors such as p53 or ATM were modified or lost through previous studies. Therefore, the recombinant myxomavirus according to the present invention was treated with various cancer cell lines derived from human and mouse, and the anticancer effect was confirmed, and it was confirmed whether the recombinant myxomavirus had a tumor suppressive effect. The specific experimental method is the same as in Examples 1-4, and the survival rate of cancer cells was confirmed by treating MC509 in human melanoma cell lines, human colon cancer cell lines, and mouse cancer cell lines.

As a result, as shown in FIGS. 18A and 18B , the recombinant myxomavirus MC509 exerted an anticancer effect on all cancer cell lines, and it was confirmed that there was no non-responsive cell line. The above results show that recombinant myxomavirus can inhibit the growth of tumor cells in various cancers.

4-2. Confirmation of changes in tumor microenvironment by recombinant myxomavirus

Then, in order to analyze the change in the tumor microenvironment caused by the recombinant myxomavirus (MC509) according to the present invention in a mouse tumor model using a melanoma cell line, MC509 and anti-PD-L1 antibody were administered alone or in combination to the mouse. Then, the expression levels of CD4, CD8, and FoxP3 in the tumor microenvironment were measured and scored.

As a result, as shown in FIG. 19 , the expression of CD4, CD8, and FoxP3 was significantly increased when MC509 and anti-PD-L1 antibody were administered in combination, compared to when administered alone. The above results show that when MC509 and anti-PD-L1 antibody are co-administered, their anti-tumor immune cell activation effect is further enhanced.

4-3. Toxicity Profiling and Toxic Dose Setting of Recombinant Myxomaviruses

After administration of recombinant myxomavirus MC509 to SD (Sprague Dawley) rats, the toxic effects and biodistribution of MC509 were confirmed. SD rat is one of the most widely used animals for various laboratory animal tests, including toxicity tests. Five-week-old male and female animals were obtained from Orient Bio and kept in a breeding room at 23±2 ℃, 55±5%, 150 to 300 until the start of the test. They were bred under breeding conditions lit for 12 hours in the Lux range, and after 1 to 2 weeks of acclimatization, administration was started by dividing groups as shown in Tables 1 and 2 below in the infected animal room. The route of administration was subcutaneous administration, and the single administration group (G1, G5) was administered once on the 0th day, and the repeated administration group (G2, G3, G4, G6) was administered 3 times in total on the 0th, 5th, and 10th days.

Separation of male groups Group Treatment Dose
(TCID ₅₀ /rat) No. of dosing Volume
(mL/kg) No. of animals Animal ID G1 Vehicle - One 200 3 1M01~1M03 G2 Vehicle - 3 200 3 2M01~2M03 G3 Test article-Low dose 1x10 ⁶ 3 200 3 3M01~3M03 G4 Test article-Mid dose 1x10 ⁷ 3 200 3 4M01~4M03 G5 Test article-High dose 1x10 ⁸ One 200 3 5M01~5M03 G6 Test article-High dose 1x10 ⁸ 3 200 3 6M01~6M03

Separation of female groups Group Treatment Dose
(TCID ₅₀ /rat) No. of dosing Volume
(mL/kg) No. of animals Animal ID G1 Vehicle - One 200 3 1F01~1F03 G2 Vehicle - 3 200 3 2F01~2F03 G3 Test article-Low dose 1x10 ⁶ 3 200 3 3F01~3F03 G4 Test article-Mid dose 1x10 ⁷ 3 200 3 4F01~4F03 G5 Test article-High dose 1x10 ⁸ One 200 3 5F01~5F03 G6 Test article-High dose 1x10 ⁸ 3 200 3 6F01~6F03

Clinical symptoms were recorded immediately before drug administration and within 1 to 4 hours immediately after administration on the day of administration, and in other cases, the condition and mortality of the animals were checked and observed until just before euthanasia at a frequency of once a day. For autopsy, animals were exsanguinated into the posterior vena cava under respiratory anesthesia with isoflurane, followed by euthanasia. The single administration group (G1, G5) was administered once on day 0, animals 1 and 2 were necropsied on day 2 (about 48 hours after administration), and animals number 3 on day 3 (about 72 hours after administration) In the repeated administration group (G2, G3, G4, G6), a total of three doses were administered on days 0, 5, and 10, and then all subjects of G3 and G4 were autopsied on the 11th day. In the repeated administration group, G2 and G6 animals were necropsied 1 to 2 times on the 12th day (about 48 hours after the last administration), and 3 times on the 13th day (about 72 hours after the last administration). At autopsy, the appearance was visually observed, and the gross features of the organs in the abdominal and thoracic cavities were observed.

Hematological tests, serum biochemical tests, and histopathological tests were performed on animals in the repeated administration group (G2, G3, G4, G6). For hematological examination, about 0.5 ml of blood collected from the posterior vena cava under anesthesia is placed in a container containing EDTA, and then Total leukocyte count, Differential leukocyte count, Erythrocyte count, Hematocrit, Hemoglobin, Hemoglobin are performed using a hemocytometer (ADIVA 2120i, SIEMENS, Germany). Distribution width, Mean corpuscular hemoglobin, Mean corpuscular hemoglobin concentration, Mean corpuscular volume, Platelet count, and Red cell distribution width were measured.

For the serum biochemical test, about 0.7 ml of blood, excluding blood for hematological tests, is placed in an SST container and left at room temperature for at least 30 minutes, and then centrifuged at 4 ° C and 3,000 rpm for 10 minutes to collect serum, , Alkaline phosphatase, Aspartate aminotransferase Total bilirubin, Glucose, and Albumin were tested using a blood biochemical analyzer (HITACHI 7180, Hitachi Co., Ltd., Japan).

Histopathological examination was performed for the repeated administration groups (G2, G3, G4, G6). Specifically, tissues and organs obtained through autopsy were fixed in 10% neutral buffered formalin solution, and general tissue processing processes such as trimming, dehydration, and paraffin infiltration were performed to produce paraffin blocks and sectioned them. H&E (Hematoxylin and Eosin) staining was performed using automated equipment (Autostainer XL, Leica).

Virus biodistribution assay was performed using blood, faces, liver, lungs, spleen, kidneys, brain, heart, thymus, lymph nodes, and colon from G1, G2, G5, and G6 animals. , ovary, testis, and the administration site using the DNeasy Blood & Tissue Kit (Qiagen) to extract DNA and add 5 pmol each of a primer pair that specifically detects MC509 and 2 pmol of Taqman probe in TOPreal™ qPCR 2x PreMIX reaction solution ( Enzynomics, Korea) with 20 μl reaction solution in Bio-Rad's CFX96 REAL-TIME PCR equipment for 10 minutes at 95 ° C. After performing 1 cycle of initial denaturation, denaturation at 95 ° C. for 10 seconds, 60 seconds at 60 ° C. During annealing and elongation, the DNA was amplified by 40 cycles, and a qPCR test was performed to quantify the amplified DNA.

Histopathological examination results are shown in Figures 20a to 20d. No systemic toxic effect by MC509 was observed, and inflammation in the skin at the site of administration was judged to be a change due to pharmacological effects.

The results of evaluation of the biodistribution of recombinant myxomavirus and the evaluation of release ability using fecal samples are shown in Tables 3 and 4 (Table 3, qPCR Ct values for each individual in the single administration group; Table 4, qPCR Ct values for each individual in the repeated administration group) ). No significant levels of vector DNA were detected in 9 organs (liver, spleen, kidney, heart, brain, lung, lymph node, colon, ovary, or testis) except for the administration site in both the single administration group and the repeated administration group. It was confirmed that the recombinant myxomavirus acts specifically for tumors. As a result of evaluation of release ability using fecal samples (last row of each table), a significant level of vector DNA was not detected, confirming that the risk of viral shedding of the recombinant myxomavirus according to the present invention was very low.

As described above, the present inventors have found that a recombinant myxomavirus into which an anticancer immunoregulatory gene, an antiviral immunomodulatory gene, and/or a tumor microenvironmental modifying gene is introduced alone or in combination in the genome has excellent anticancer effects against various cancers. It was confirmed that not only has it, but it can significantly enhance the effect of the immuno-oncology agent. Therefore, the recombinant myxomavirus according to the present invention is expected to be utilized as a combination drug for a novel anticancer therapy and immunotherapy for the treatment of intractable cancer.

The description of the present invention described above is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Virocure Inc. <120> Novel recombinant Myxoma virus and the uses thereof <130> MP20-263P1 <150> KR 10-2020-0180823 <151> 2020-12-22 <150> KR 10-2021-0038623 <151> 2021-03- 25 <160> 21 <170> KoPatentIn 3.0 <210> 1 <211> 465 <212> DNA <213> Artificial Sequence <220> <223> Mouse_IFNg <400> 1 atgaacgcta cacactgcat cttggctttg cagctcttcc tcatggctgt ttctggctgt 60 tactatttt acg gatacagtactcat t gaaagccgt taactcaagt 120 ggcatagatg tggaagaaaa gagtctcttc ttggatatct ggaggaactg gcaaaaggat 180 ggtgacatga aaatcctgca gagccagatt atctctttct acctcagact ctttgaagtc 240 ttgaaagaca atcaggccat cagcaacaac ataagcgtca ttgaatcaca cctgattaca 300 aacttcttca gcaacagcaa ggcgaaaaag gatgcattca tgagcatcgc caagtttgag 360 gtcaacaacc cacaggtcca gcgccaagca ttcaatgagc tcatccgagt ggtccaccag 420 ctgtcgccgg aatccagcct caggaagcgg aaaaggagtc gctgc 465 <210> 2 <211> 501 <212> DNA <213> Artificial Sequence <220> <223> Human_IFNg <400> 2 atgaaatata caagttatat cttggctttt cagctctgca tcgttttggg ttctcttggc 60 tgttactgcc aggacccata tgtaaaa gaa gcagaaaacc ttaagaaata ttttaatgca 120 ggtcattcag atgtagcgga taatggaact cttttcttag gcattttgaa gaattggaaa 180 gaggagagtg acagaaaaat aatgcagagc caaattgtct ccttttactt caaacttttt 240 aaaaacttta aagatgacca gagcatccaa aagagtgtgg agaccatcaa ggaagacatg 300 aatgtcaagt ttttcaatag caacaaaaag aaacgagatg acttcgaaaa gctgactaat 360 tattcggtaa ctgacttgaa tgtccaacgc aaagcaatac atgaactcat ccaagtgatg 420 gctgaactgt cgccagcagc taaaacaggg aagcgaaaaa ggagtcagat gctgtttcga 480 ggtcgaagag catcccagta a 501 <210> 3 <211> 873 <212> DNA <213> Artificial Sequence <220> <223> Human_PD-L1 <400> 3 atgaggatat ttgctgtctt tatattcatg acctactggc atttgctgaa cgcatttact 60 gtcacacaattatagttagattagattagattattagattacctagatta 120 agtattatg ggaaatggag 180 gataagaaca ttattcaatt tgtgcatgga gaggaagacc tgaaggttca gcatagtagc 240 tacagacaga gggcccggct gttgaaggac cagctctccc tgggaaatgc tggcacttcag 300 atcachatg accacttcag 300 atcagtgatca acctg ctgaaattg taca agcgaattac tgtgaaagtc aatgccccat acaacaaaat caaccaaaga 420 attttggttg tggatccagt cacctctgaa catgaactga catgtcaggc tgagggctac 480 cccaaggccg aagtcatctg gacaagcagt gaccatcaag tcctgagtgg taagaccacc 540 accaccaatt ccaagagaga ggagaagctt ttcaatgtga ccagcacact gagaatcaac 600 acaacaacta atgagatttt ctactgcact tttaggagat tagatcctga ggaaaaccat 660 acagctgaat tggtcatccc agaactacct ctggcacatc ctccaaatga aaggactcac 720 ttggtaattc tgggagccat cttattatgc cttggtgtag cactgacatt catcttccgt 780 ttaagaaaag ggagaatgat ggatgtgaaa aaatgtggca tccaagatac aaactcaaag 840 aagcaaagtg atacacattt ggaggagacg taa 873 <210> 4 <211> 711 <212> DNA <213> Artificial Sequence <220> <223> Mouse_CD47 <400> 4 atggtgagca agggcgagga ggacaacatg gccatcatca aggagttcat gcgcttcaag 60 gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120 cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggcgg ccccctgccc 180 ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgt cctagcacc t c cc gcctagcac t cg agggcttcaa gtgggagcgc 300 gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360 ggcgagttca tctacaaggt gaagctgcgc ggcaccaact tcccctccga cggccccgta 420 atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480 gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgcc 540 gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600 aacatcaagc tggacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgag 660 cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaagtg a 711 <210> 5 <211> 918 <212> DNA <213> Artificial Sequence <220> <223> Human_CD47 <400> 5 atgtggcccc tggtagcggc gctgttgctg ggctcggcgt gctgcggatc agctcagcta 60 ctatttaata aaacaaaatc tgtagaattc acgttttgta atgacactgt cgtcattcca 120 tgctttgtta ctaatatgga ggcacaaaac actactgaag tatacgtaaa gtggaaattt 180 aaaggaagag atatttacac ctttgatgga gctctaaaca agtccactgt ccccactgac 240 tttagtagtg caaaaattga agtctcacaa tactaaaaag gagatgcctc tacttgaagatg aactttgaagatg aactacttagagtag atgcttagt gaattaacc 360 agagaaggtg aaacgatcat cgagctaaaa tatcgtgttg tttcatggtt ttctccaaat 420 gaaaatattc ttattgttat tttcccaatt tttgctatac tcctgttctg gggacagttt 480 ggtattaaaa cacttaaata tagatccggt ggtatggatg agaaaacaat tgctttactt 540 gttgctggac tagtgatcac tgtcattgtc attgttggag ccattctttt cgtcccaggt 600 gaatattcat taaagaatgc tactggcctt ggtttaattg tgacttctac agggatatta 660 atattacttc actactatgt gtttagtaca gcgattggat taacctcctt cgtcattgcc 720 atattggtta ttcaggtgat agcctatatc ctcgctgtgg ttggactgag tctctgtatt 780 gcggcgtgta taccaatgca tggccctctt ctgatttcag gtttgagtat cttagctcta 840 gcacaattac ttggactagt ttatatgaaa tttgtggctt ccaatcagaa gactatacaa 900 cctcctagga ataactga 918 <210> 6 <211> 1539 <212> DNA <213> Artificial Sequence <220> <223> Mouse_PH20 <400> 6 atgggagagt tgagatttaa gcacctcttt tgggggagct ttgttgaatc tgggggcaca 60 ttccaaacag tgttaatctt ccttttgatt ccatgctcct tgactgtgga ttatagggca 120 gcaccaattt tatcaaatac aactttgaatt tggatttgga atgtcccat 180 gctgaacgttgt a gctgaacgttgt tcttct ctttaattgg aagcccccgg 240 aaaactgcca cagggcaacc tgtcacatta ttttatgttg atcgacttgg tttgtatcct 300 cacatagatg caaaccaagc agaacattat ggaggaatac ctcagagggg cgattatcaa 360 gctcatttgc gcaaagctaa gactgacata gagcattaca ttccagacga caaattgggc 420 ttagctatca ttgactggga agaatggagg cctacctggt tgagaaactg gaaacctaag 480 gataactaca ggaataagtc tattgaattg gtccaatcaa ctaatccagg acttagtatc 540 acagaagcca cccagaaagc catacaacaa tttgaagagg caggaaggaa gtttatggaa 600 ggaactttac acctggggaa attccttcga ccaaaccagc tatggggtta ttatctattt 660 cctgattgtt ataacaataa gtttcaagac cctaagtatg atgggcagtg ccctgctgtg 720 gaaaagaaaa gaaatgataa tcttaaatgg ctatggaaag caagcaccgg cctttaccca 780 tctgtctatt tgaagaaaga cttgaagtcc aatcgacaag ctaccctcta tgtccgctac 840 cgagttgtgg aagctatcag agtgtccaag gttgggaatg catcggatcc agtcccgatt 900 tttgtctata tccgtcttgt ttttactgat cgtacctctg aataccttct agaggatgac 960 cttgtgaata caattggtga aattgttgct ctgggtacct ctggaattat aatatgggat 1020 gctatgagtt tagcacaacg tgcggcaggt tgcccaatcc tacataaata c atgcagacg 1080 accctgaatc catacatagt caatgttacc ctagcagcca aaatgtgcag ccaaacactt 1140 tgtaatgaga aaggcatgtg ttcaagaaga aaagaaagtt cagatgtata tcttcacttg 1200 aacccaagtc attttgatat tatgttaacg gaaactggaa agtacgaagt tcttggcaac 1260 cccagggttg gagacttaga atacttttct gaacatttta aatgcagctg ttttagcaga 1320 atgacatgta aggagacatc tgatgtaaaa aatgtacaag acgtgaatgt gtgcgtcggt 1380 gacaatgttt gtataaaagc caaggtagaa cccaacccag ccttctacct cctacctggc 1440 aaaagccttc tatttatgac aacacttggt catgtgctgt accatctgcc acaagatatt 1500 tttgtttttc cacggaagac actagtcagt actccttag 1539 <210> 7 <211> 1530 <212> DNA <213> Artificial Sequence <220> <223> Human_PH20 <400> 7 atgggagtgc taaaattcaa gcacatcttt ttcagaagct ttgttaaatc aagtggagta 60 tcccagatag ttttcacctt ccttctgatt ccatgttgct tgactctgaa tttcagagca 120 cctcctgtta ttccaaatgt gcctttcctc tgggcctgga atgccccaag tgaattttgt 180 cttggaaaat ttgatgagcc actagatatg agcctcttct ctttcatagg aagcccccga 240 ataaacgcca ccgggcaagg tgttacaata 300 ttttatgg agatt caatcacagg agtaactgtg aatggaggaa tcccccagaa gatttcctta 360 caagaccatc tggacaaagc taagaaagac attacatttt atatgccagt agacaatttg 420 ggaatggctg ttattgactg ggaagaatgg agacccactt gggcaagaaa ctggaaacct 480 aaagatgttt acaagaatag gtctattgaa ttggttcagc aacaaaatgt acaacttagt 540 ctcacagagg ccactgagaa agcaaaacaa gaatttgaaa aggcagggaa ggatttcctg 600 gtagagacta taaaattggg aaaattactt cggccaaatc acttgtgggg ttattatctt 660 tttccggatt gttacaacca tcactataag aaacccggtt acaatggaag ttgcttcaat 720 gtagaaataa aaagaaatga tgatctcagc tggttgtgga atgaaagcac tgctctttac 780 ccatccattt atttgaacac tcagcagtct cctgtagctg ctacactcta tgtgcgcaat 840 cgagttcggg aagccatcag agtttccaaa atacctgatg caaaaagtcc acttccggtt 900 tttgcatata cccgcatagt ttttactgat caagttttga aattcctttc tcaagatgaa 960 cttgtgtata catttggcga aactgttgct ctgggtgctt ctggaattgt aatatgggga 1020 accctcagta taatgcgaag tatgaaatct tgcttgctcc tagacaatta catggagact 1080 atactgaatc cttacataat caacgtcaca ctagcagcca aaatgtgtag ccaagtgctt 1140 tgccaggagc aaggagtgtgtataaggaaa aactggaatt caagtgacta tcttcacctc 1200 aacccagata attttgctat tcaacttgag aaaggtggaa agttcacagt acgtggaaaa 1260 ccgacacttg aagacctgga gcaattttct gaaaaatttt attgcagctg ttatagcacc 1320 ttgagttgta aggagaaagc tgatgtaaaa gacactgatg ctgttgatgt gtgtattgct 1380 gatggtgtct gtatagatgc ttttctaaaa cctcccatgg agacagaaga acctcaaatt 1440 ttctacaatg cttcaccctc cacactatct gccacaatgt tcattgttag tattttgttt 1500 cttatcattt cttctgtagc gagtttgtaa 1530 <210> 8 <211 > 711 <212> DNA <213> Artificial Sequence <220> <223> mCherry <400> 8 atggtgagca agggcgagga ggacaacatg gccatcatca aggagttcat gcgcttcaag 60 gtgcacatgg agggctccgt gaacggccac gagttcgaga tcgagggcga gggcgagggc 120 cgcccctacg agggcaccca gaccgccaag ctgaaggtga ccaagggcgg ccccctgccc 180 ttcgcctggg acatcctgtc ccctcagttc atgtacggct ccaaggccta cgtgaagcac 240 cccgccgaca tccccgacta cttgaagctg tccttccccg agggcttcaa gtgggagcgc 300 gtgatgaact tcgaggacgg cggcgtggtg accgtgaccc aggactcctc cctgcaggac 360 ggcgacttcc gaagctgcg c ggcaggac 360 ggcgagttcc acc acctacaaggt gccccgta 420 atgcagaaga agaccatggg ctgggaggcc tcctccgagc ggatgtaccc cgaggacggc 480 gccctgaagg gcgagatcaa gcagaggctg aagctgaagg acggcggcca ctacgacgcc 540 gaggtcaaga ccacctacaa ggccaagaag cccgtgcagc tgcccggcgc ctacaacgtc 600 aacatcaagc tggacatcac ctcccacaac gaggactaca ccatcgtgga acagtacgag 660 cgcgccgagg gccgccactc caccggcggc atggacgagc tgtacaagtg a 711 <210> 9 <211> 563 <212> DNA < 213> Artificial Sequence <220> <223> M135 <400> 9 atggtgttta tatttattat cacctgtgta tgtttggtga cgagatcctg tgggggtggg 60 ttagaagacg atatagatcg catatttcaa aaacgataca acgaactgag ccagccgatt 120 aagcgcaata tgcgtacact gtgcaagttt agaggaatta ccgcgactat gtttacggaa 180 ggagaatctt accttattca atgtcccata attcacgatt acgtgctacg ggcgctgtat 240 gacttagtgg aaggaagtta cacggtacgc tgggaacgcg aaacggaaga cgatgttgag 300 tcggtagatc cgaagttagt caaagggacg ctattatacc tccaacctaa cgcgtccagt 360 ataggaacgt atctatgtac cttacacgat aaccgaggta tgtgttatca atctgtcgcg 420 cacgtccatcc gacgtccacgaa gatgaaccatgc gatgacaatgc gatgacaatgc ga tatacctcgc cattttagca gttttgatat ccttaggcgt cctgtaaagg 540 aaacgcgcca gactccggaa cta 563 <210> 10 <211> 611 <212> DNA <213> Artificial Sequence <220> <223> M136 <400> 10 cgaaggataa tcacgacgta actccgaact atgaagtaac attttttaaa acaatttcgt 60 tatgttaaat tatggaacgg tcgcccactt acacggtaca cgataaacgc ttttctatcg 120 tcgcactaaa cggacaatac gacatggtgg acgattttgg tcttagtttt tcttacacag 180 cgatcgacga tatttctaaa aatcattcca tcaaacacgt tttagaagaa tacttttcat 240 ggcgcgcgta tataggccgg gtatgtatca taccgaatca cgtgggaaag ctctacatca 300 aacttacaaa gttggacacc acggcgaaga acaaactagg caatctagat atattgttat 360 gcgacgtgtt aaaaatagac gaggacggag gcaacgagaa actgtttcaa ttcatacggt 420 cgctgaacct acacaagaat aaagagaaca cgttgacgtt gataggatta ctagcctacg 480 cgtgcaactt ctggggcagt caaaaaataa ataaatacat tccttccatc atgccgtttt 540 tcttaaaaca aacgaccgag tctatacttt ccgaactgtg tgttattttg aactataaca 600 aattgtatta a 611 <210> 11 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> sE/L promoter <400> 11 taaaaaattt tttttttttg gaatataaat aa 42 <210> 12 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> MCS <400> 12 ttaattaagg atccatcgat accggtctcg agtttaaacc aattggcatg cccgcggccg 60 ccgtacg < 67 <210> 212> DNA <213> Artificial Sequence <220> <223> LoxP <400> 13 ataacttcgt ataatgtatg ctatacgaag ttat 34 <210> 14 <211> 122 <212> DNA <213> Artificial Sequence <220> <223> SV40 polA < 400> 14 taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta 60 tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag 120 tt 122 <210> 15 <211> 2311 <212> DNA <213> Artificial Sequence <220> <223> Shuttle vector <400> 15 atggtgttta tatttattat cacctgtgta tgtttggtga cgagatcctg tgggggtggg 60 ttagaagacg atatagatcg catatttcaa aaacgataca acgaactgag ccagccgatt 120 aagcgcaata tgcgtacact gtgcaagttt agaggaatta ccgcgactat gtttacggaa 180 ggagaatctt accttattca atgtcccata attcacgatt acgtgctacg ggcgctgtat 240 gacttagtgg aaggaagtta cacggtacgc tgggaacgcg aaacggaaga cgatgttgag 300 tcggtagatc cgaagtta gt caaagggacg ctattatacc tccaacctaa cgcgtccagt 360 ataggaacgt atctatgtac cttacacgat aaccgaggta tgtgttatca atctgtcgcg 420 cacgtcatcc gacgtccgaa gatgcaatgc gtgaaacatg cacatacgac atcggacagc 480 aacctgtgga tatacctcgc cattttagca gttttgatat ccttaggcgt cctgtaaagg 540 aaacgcgcca gactccggaa ctaataacta gtgacataac ttcgtataat gtatgctata 600 cgaagttatc caaagtcagt cgacgtaaaa attgaaattt tatttttttt ttttggaata 660 taaataagag agctcgccac catggtgagc aagggcgagg aggacaacat ggccatcatc 720 aaggagttca tgcgcttcaa ggtgcacatg gagggctccg tgaacggcca cgagttcgag 780 atcgagggcg agggcgaggg ccgcccctac gagggcaccc agaccgccaa gctgaaggtg 840 accaagggcg gccccctgcc cttcgcctgg gacatcctgt cccctcagtt catgtacggc 900 tccaaggcct acgtgaagca ccccgccgac atccccgact acttgaagct gtccttcccc 960 gagggcttca agtgggagcg cgtgatgaac ttcgaggacg gcggcgtggt gaccgtgacc 1020 caggactcct ccctgcagga cggcgagttc atctacaagg tgaagctgcg cggcaccaac 1080 ttcccctccg acggccccgt aatgcagaag aagaccatgg gctgggaggc ctcctccgag 1140 cggatgtacc ccgaggacgg cgccctgaag ggc gagatca agcagaggct gaagctgaag 1200 gacggcggcc actacgacgc cgaggtcaag accacctaca aggccaagaa gcccgtgcag 1260 ctgcccggcg cctacaacgt caacatcaag ctggacatca cctcccacaa cgaggactac 1320 accatcgtgg aacagtacga gcgcgccgag ggccgccact ccaccggcgg catggacgag 1380 ctgtacaagt gacctagggt cgataacttc gtataatgta tgctatacga agttatgtag 1440 ggcccggtac cgactaaaaa ttgaaatttt attttttttt tttggaatat aaataagtag 1500 acttaattaa ggatccatcg ataccggtct cgagtttaaa ccaattggca tgcccgcggc 1560 cgccgtacgt aagatacatt gatgagtttg gacaaaccac aactagaatg cagtgaaaaa 1620 aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt ataagctgca 1680 ataaacaagt tgactagtaa cgaaggataa tcacgacgta actccgaact atgaagtaac 1740 attttttaaa acaatttcgt tatgttaaat tatggaacgg tcgcccactt acacggtaca 1800 cgataaacgc ttttctatcg tcgcactaaa cggacaatac gacatggtgg acgattttgg 1860 tcttagtttt tcttacacag cgatcgacga tatttctaaa aatcattcca tcaaacacgt 1920 tttagaagaa tacttttcat ggcgcgcgta tataggccgg gtatgtatca taccgaatca 1980 cgtgggaaag ctctacatca aacttacaaa gttggacac c acggcgaaga acaaactagg 2040 caatctagat atattgttat gcgacgtgtt aaaaatagac gaggacggag gcaacgagaa 2100 actgtttcaa ttcatacggt cgctgaacct acacaagaat aaagagaaca cgttgacgtt 2160 gataggatta ctagcctacg cgtgcaactt ctggggcagt caaaaaataa ataaatacat 2220 tccttccatc atgccgtttt tcttaaaaca aacgaccgag tctatacttt ccgaactgtg 2280 tgttattttg aactataaca aattgtatta a 2311 <210> 16 <211> 699 <212> DNA < 213> Artificial Sequence <220> <223> Mouse_FLT3L <400> 16 atgacagtgc tggcgccagc ctggagccca aattcctccc tgttgctgct gttgctgctg 60 ctgagtcctt gcctgcgggg gacacctgac tgttacttca gccacagtcc catctcctcc 120 aacttcaaag tgaagtttag agagttgact gaccacctgc ttaaagatta cccagtcact 180 gtggccgtca atcttcagga cgagaagcac tgcaaggcct tgtggagcct cttcctagcc 240 cagcgctgga tagagcaact gaagactgtg gcagggtcta agatgcaaac gcttctggag 300 gacgtcaaca ccgagataca ttttgtcacc tcatgtacct tccagcccct accagaatgt 360 ctgcgattcg tccagaccaa catctcccac ctcctgaagg acacctgcac acagctgctt 420 gctctagaagc cctggtagtgcc g tag ggtgtgcc ga tag tgccagccgg actcctccac cctgctgccc ccaaggagtc ccatagccct agaagccacg 540 gagctcccag agcctcggcc caggcagctg ttgctcctgc tgctgctgct gctgcctctc 600 acactggtgc tgctggcagc cgcctggggc cttcgctggc aaagggcaag aaggaggggg 660 gagctccacc ctggggtgcc cctcccctcc catccctag 699 <210> 17 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> Human_FLT3L <400> 17 atgacagtgc tggcgccagc ctggagccca acaacctatc tcctcctgct gctgctgctg 60 agctcgggac tcagtgggac ccaggactgc tccttccaac acagccccat ctcctccgac 120 ttcgctgtca aaatccgtga gctgtctgac tacctgcttc aagattaccc agtcaccgtg 180 gcctccaacc tgcaggacga ggagctctgc gggggcctct ggcggctggt cctggcacag 240 cgctggatgg agcggctcaa gactgtcgct gggtccaaga tgcaaggctt gctggagcgc 300 gtgaacacgg agatacactt tgtcaccaaa tgtgcctttc agcccccccc cagctgtctt 360 cgcttcgtcc agaccaacat ctcccgcctc ctgcaggaga cctccgagca gctggtggcg 420 ctgaagccct ggatcactcg ccagaacttc tcccggtgcc tggagctgca gtgtcagccc 480 gactcctcaa ccctgccacc cccatggagt c ccccggcccc tggaggccc ctgccccgaca 540 cctctgctgca ctactg ctgctgcccg tgggcctcct gctgctggcc 600 gctgcctggt gcctgcactg gcagaggacg cggcggagga caccccgccc tggggagcag 660 gtgccccccg tccccagtcc ccaggacctg <220cccagtcc tccccagtcc ccaggacctg> 18 DNA <c213-12IL <212> Artificial Sequence <ctg223 < 708 ccaggacctg a <400> 18 atgtgtcaat cacgctacct cctctttttg gccacccttg ccctcctaaa ccacctcagt 60 ttggccaggg tcattccagt ctctggacct gccaggtgtc ttagccagtc ccgaaacctg 120 ctgaagacca cagatgacat ggtgaagacg gccagagaaa aactgaaaca ttattcctgc 180 actgctgaag acatcgatca tgaagacatc acacgggacc aaaccagcac attgaagacc 240 tgtttaccac tggaactaca caagaacgag agttgcctgg ctactagaga gacttcttcc 300 acaacaagag ggagctgcct gcccccacag aagacgtctt tgatgatgac cctgtgcctt 360 ggtagcatct atgaggactt gaagatgtac cagacagagt tccaggccat caacgcagca 420 cttcagaatc acaaccatca gcagatcatt ctagacaagg gcatgctggt ggccatcgat 480 gagctgatgc agtctctgaa tcataatggc gagactctgc gccagaaacc tcctgtggga 540 gaagcagacc cttacagagt gaaaatgaag ctctgcatcc tgcttcacgc cttcagcacc 600 cgcgtcgtga ccatcaacag ggtgatgggc tatctgagct ccgccgccac gaacttctct 660 ctgttaaagc aagcaggaga cgtggaagaa aaccccggtc ctatgtgtcc tcagaagcta 720 accatctcct ggtttgccat cgttttgctg gtgtctccac tcatggccat gtgggagctg 780 gagaaagacg tttatgttgt agaggtggac tggactcccg atgcccctgg agaaacagtg 840 aacctcacct g tgacacgcc tgaagaagat gacatcacct ggacctcaga ccagagacat 900 ggagtcatag gctctggaaa gaccctgacc atcactgtca aagagtttct agatgctggc 960 cagtacacct gccacaaagg aggcgagact ctgagccact cacatctgct gctccacaag 1020 aaggaaaatg gaatttggtc cactgaaatt ttaaaaaatt tcaaaaacaa gactttcctg 1080 aagtgtgaag caccaaatta ctccggacgg ttcacgtgct catggctggt gcaaagaaac 1140 atggacttga agttcaacat caagagcagt agcagttccc ctgactctcg ggcagtgaca 1200 tgtggaatgg cgtctctgtc tgcagagaag gtcacactgg accaaaggga ctatgagaag 1260 tattcagtgt cctgccagga ggatgtcacc tgcccaactg ccgaggagac cctgcccatt 1320 gaactggcgt tggaagcacg gcagcagaat aaatatgaga actacagcac cagcttcttc 1380 atcagggaca tcatcaaacc agacccgccc aagaacttgc agatgaagcc tttgaagaac 1440 tcacaggtgg aggtcagctg ggagtaccct gactcctgga gcactcccca ttcctacttc 1500 tccctcaagt tctttgttcg aatccagcgc aagaaagaaa agatgaagga gacagaggag 1560 gggtgtaacc agaaaggtgc gttcctcgta gagaagacat ctaccgaagt ccaatgcaaa 1620 ggcgggaatg tctgcgtgca agctcaggat cgctattaca attcctcatg cagcaagtgg 1680 gcatgtgttc cctgcaggg t ccgatcctag 1710 <210> 19 <211> 1803 <212> DNA <213> Artificial Sequence <220> <223> Human_IL-12 <400> 19 atgtggcccc ctgggtcagc ctcccagcca ccgccctcac ctgccgcggc cacaggtg tgctg 60 catccagcgg gt gcct cctcct cc gt ccggct 60 catccagcgg gaccacctca gtttggccag aaacctcccc 180 gtggccactc cagacccagg aatgttccca tgccttcacc actcccaaaa cctgctgagg 240 gccgtcagca acatgctcca gaaggccaga caaactctag aattttaccc ttgcacttct 300 gaagagattg atcatgaaga tatcacaaaa gataaaacca gcacagtgga ggcctgttta 360 ccattggaat taaccaagaa tgagagttgc ctaaattcca gagagacctc tttcataact 420 aatgggagtt gcctggcctc cagaaagacc tcttttatga tggccctgtg ccttagtagt 480 atttatgaag acttgaagat gtaccaggtg gagttcaaga ccatgaatgc aaagcttctg 540 atggatccta agaggcagat ctttctagat caaaacatgc tggcagttat tgatgagctg 600 atgcaggccc tgaatttcaa cagtgagact gtgccacaaa aatcctccct tgaagaaccg 660 gatttttata aaactaaaat caagctctgc atacttctttc atgctagagttcag gtgcttactgggca at ac gtgacttccattg aacat 720 gt ctctctgtta 780 aagcaagcag gagacgtgga agaaaacccc ggtcctatgt gtcaccagca gttggtcatc 840 tcttggtttt ccctggtttt tctggcatct cccctcgtgg ccatatggga actgaagaaa 900 gatgtttatg tcgtagaatt ggattggtat ccggatgccc ctggagaaat ggtggtcctc 960 acctgtgaca cccctgaaga agatggtatc acctggacct tggaccagag cagtgaggtc 1020 ttaggctctg gcaaaaccct gaccatccaa gtcaaagagt ttggagatgc tggccagtac 1080 acctgtcaca aaggaggcga ggttctaagc cattcgctcc tgctgcttca caaaaaggaa 1140 gatggaattt ggtccactga tattttaaag gaccagaaag aacccaaaaa taagaccttt 1200 ctaagatgcg aggccaagaa ttattctgga cgtttcacct gctggtggct gacgacaatc 1260 agtactgatt tgacattcag tgtcaaaagc agcagaggct cttctgaccc ccaaggggtg 1320 acgtgcggag ctgctacact ctctgcagag agagtcagag gggacaacaa ggagtatgag 1380 tactcagtgg agtgccagga ggacagtgcc tgcccagctg ctgaggagag tctgcccatt 1440 gaggtcatgg tggatgccgt tcacaagctc aagtatgaaa actacaccag cagcttcttc 1500 atcagggaca tcatcaaacc tgacccaccc aagaacttgc agctgaagcc attaaagaat 1560 tctcggcagg tggaggtcag ctgggagtac cctgacacct ggagtactcc acattccta c 1620 ttctccctga cattctgcgt tcaggtccag ggcaagagca agagagaaaa gaaagataga 1680 gtcttcacgg acaagacctc agccacggtc atctgccgca aaaatgccag cattagcgtg 1740 cgggcccagg accgctacta tagctcatct tggagcgaat gggcatctgt gccctgcagt 1800 tag 1803 <210> 20 <211> 426 <212> DNA <213> Artificial Sequence <220> <223> Mouse_GM- CSF <400> 20 atgtggctgc agaatttact tttcctgggc attgtggtct acagcctctc agcacccacc 60 cgctcaccca tcactgtcac ccggccttgg aagcatgtag aggccatcaa agaagccctg 120 aacctcctgg atgacatgcc tgtcacattg aatgaagagg tagaagtcgt ctctaacgag 180 ttctccttca agaagctaac atgtgtgcag acccgcctga agatattcga gcagggtcta 240 cggggcaatt tcaccaaact caagggcgcc ttgaacatga cagccagcta ctaccagaca 300 tactgccccc caactccgga aacggactgt gaaacacaag ttaccaccta tgcggatttc 360 atagacagcc ttaaaacctt tctgactgat atcccctttg aatgcaaaaa accagtccaa 420 aaatga 426 <210> 21 <211> 435 <212> DNA <213> Artificial Sequence <220> <223> Human_GM-CSF <400> 21 atgtggctgc agagcctgct gctcttgggc actgtggccgcc gcccagcatctc agccctgg gagcatgtga atgccatcca ggaggcccgg 120 cgtctcctga acctgagtag agacactgct gctgagatga atgaaacagt agaagtcatc 180 tcagaaatgt ttgacctcca ggagccgacc tgcctacaga cccgcctgga gctgtacaag 240 cagggcctgc ggggcagcct caccaagctc aagggcccct tgaccatgat ggccagccac 300 tacaagcagc actgccctcc aaccccggaa acttcctgtg caacccagat tatcaccttt 360 gaaagtttca aagagaacct gaaggacttt ctgcttgtca tcccctttga ctgctgggag 420ccagtccagg agtga 435

Claims (16)

As a recombinant myxomavirus comprising one or more anticancer genes selected from the group consisting of anticancer immunomodulatory genes, antiviral immunomodulatory genes, and tumor microenvironmental modifying genes,
The anti-cancer immunoregulatory gene is one or more genes selected from the group consisting of IFNg, PD-L1, FLT3L, IL-12, and GM-CSF ,
The antiviral immunoregulatory gene is a CD47 gene,
The tumor microenvironment modifying gene is characterized in that PH20 , recombinant myxoma virus.
According to claim 1,
The anticancer gene is a recombinant myxomavirus, characterized in that introduced between the M135 and M136 genes in the genome of the myxomavirus.
According to claim 1,
The recombinant myxomavirus, characterized in that it further comprises one or more viral promoters.
A pharmaceutical composition for preventing or treating cancer comprising the recombinant myxomavirus of any one of claims 1 to 3 as an active ingredient.
5. The method of claim 4,
The cancer is squamous cell carcinoma, glioma, lung cancer, adenocarcinoma of the lung, peritoneal cancer, skin cancer, eye cancer, rectal cancer, perianal cancer, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, parathyroid cancer, adrenal cancer, osteosarcoma, soft tissue sarcoma, urethra Cancer, blood cancer, liver cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer, uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, two A pharmaceutical composition, characterized in that at least one selected from the group consisting of cervical cancer, oral cancer, tongue cancer, brain cancer, and stromal tumor.
5. The method of claim 4,
The composition is characterized in that it satisfies one or more properties selected from the group consisting of:
(a) increasing the level of CD8 ⁺ T cells in the tumor;
(b) reducing regulatory T cell levels in the tumor;
(c) increasing the level of macrophages in the tumor; and
(d) increasing memory T cell levels.
5. The method of claim 4,
The composition is characterized in that the tumor suppressive effect is maintained even after complete remission of the tumor, the pharmaceutical composition.
5. The method of claim 4,
The composition is characterized in that for direct intratumoral administration or intravenous administration, the pharmaceutical composition.
5. The method of claim 4,
The composition is characterized in that it further comprises an immune checkpoint inhibitor as an active ingredient, a pharmaceutical composition.
10. The method of claim 9,
The checkpoint inhibitor is a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an OX40 inhibitor, a CTLA-4 inhibitor, a 4-1BB inhibitor, a LAG-3 inhibitor, a B7-H4 inhibitor, an HVEM inhibitor, a TIM4 inhibitor, GAL9 Inhibitor, VISTA inhibitor, KIR inhibitor, TIGIT inhibitor, characterized in that at least one selected from the group consisting of a BTLA inhibitor, a pharmaceutical composition.
10. The method of claim 9,
The composition is a pharmaceutical composition, characterized in that the recombinant myxomavirus and the immune checkpoint inhibitor are mixed mixture form.
10. The method of claim 9,
The composition is a pharmaceutical composition, characterized in that the recombinant myxomavirus and the immune checkpoint inhibitor are each formulated and administered simultaneously or sequentially.
A kit for preventing or treating cancer comprising the recombinant myxomavirus of any one of claims 1 to 3 as an active ingredient.
14. The method of claim 13,
The kit, characterized in that it further comprises an immune checkpoint inhibitor.
A pharmaceutical composition for combined administration of an immune checkpoint inhibitor comprising the recombinant myxomavirus of any one of claims 1 to 3 as an active ingredient.
16. The method of claim 15,
The composition is a pharmaceutical composition for co-administration, characterized in that it is administered simultaneously, separately, or sequentially with the immune checkpoint inhibitor.

Images