KR20220077341A - Composition for preventing, ameliorating or treating prostate cancer comprising brassicasterol as effective component - Google Patents

Abstract

The present invention relates to a composition for preventing, improving, or treating prostate cancer containing brassicasterol as an active ingredient. Since the expression inhibitory effect is excellent, it can be usefully used as a composition for preventing, improving or treating prostate cancer containing it as an active ingredient.

Description

The composition for preventing, ameliorating or treating prostate cancer comprising brassicasterol as an active ingredient, ie, a composition for preventing, ameliorating or treating prostate cancer comprising brassicasterol as effective component

The present invention relates to a composition for preventing, improving, or treating prostate cancer containing brassicasterol as an active ingredient.

Prostate cancer is a malignant tumor that occurs in the prostate gland in men. Most of the gland cells in the prostate become cancerous and metastasize to lymph nodes and bones. . In the West, prostate cancer is the most common cancer among male cancers and shows a high incidence. Unlike in the past, when patients in their 70s were the mainstay of prostate cancer, the number of patients undergoing prostate cancer surgery in their 40s is increasing rapidly these days. Prostate cancer treatment methods include radical prostatectomy, radiation, chemotherapy, and hormone therapy. The most widely used treatment method is hormone therapy, which is a so-called androgen removal method that suppresses male hormone secretion or blocks hormone production through surgery, since a significant portion of prostate cancer cells proliferate in a male hormone-dependent manner. In more than 80% of patients, this method shows temporary therapeutic effects such as suppression of cancer growth or reduction of lesions. However, even in patients who have responded well to temporary hormone therapy, most of them can progress to hormone-refractory prostate cancer (HRPC) after a certain period of time. In the case of HRPC, existing anticancer drugs, chemotherapy, or radiation therapy do not show a great effect, so a new treatment method is required.

Brassicasterol is one of the sterols found in plants, and is a component of plant cell membranes. Phytosterols are natural substances present in vegetable oils, grains, fruits and vegetables, and are produced from deodorized distillates during the production of soybean oil, corn oil and rapeseed oil. Plant sterols such as beta-sitosterol, brassicasterol, stigmasterol and campesterol are known to have an effect of reducing blood cholesterol.

On the other hand, Korea Patent No. 1463428 discloses 'a composition for controlling plant diseases containing a mixture of beta-sitosterol, campesterol, stigmasterol and brassicasterol as an active ingredient and use thereof' is disclosed, and Korean Patent Application Publication No. 2019 -0065647 discloses 'a pharmaceutical composition and a health functional food composition for the prevention and treatment of kidney disease containing seahorse extract as an active ingredient', but the 'prevention of prostate cancer containing brassicasterol as an active ingredient, There is no description of 'composition for improvement or treatment'.

The present invention was derived from the above needs, and the present inventors isolated brassicasterol from hippocampus extract, and found that brassicasterol had an excellent effect of inhibiting the proliferation of prostate cancer cells and of inhibiting the expression of androgen receptors and prostate-specific antigens. By confirming, the present invention was completed.

In order to solve the above problems, the present invention provides a health functional food composition for preventing or improving prostate cancer containing brassicasterol as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating prostate cancer containing brassicasterol as an active ingredient.

In addition, the present invention provides a method for isolating brassicasterol (brassicasterol) from the hippocampus extract.

The present invention relates to a composition for preventing, ameliorating, or treating prostate cancer containing brassicasterol as an active ingredient, wherein the active ingredient has excellent effects of inhibiting prostate cancer cell proliferation, and inhibiting the expression of androgen receptors and prostate-specific antigens. , it can be usefully used as a composition for preventing, improving or treating prostate cancer.

1 is a gas chromatography-mass spectrometry (GC-MS) result of brassicasterol and hippocampal lipid extract (SHL). A is a total ion chromatogram result of brassicasterol, B is a mass spectrum result of brassicasterol, and C is a total ion chromatogram of a hippocampal lipid extract (SHL). ) result, and D is a mass spectrum result of hippocampal lipid extract (SHL).
Figure 2 is the result of confirming the survival inhibitory ability of brassicasterol prostate cancer cells (●: LNCaP cells, ■: PC-3 cells). ** and *** indicate a statistically significant decrease in cell viability of the experimental group compared to the control group not treated with anything, p<0.01 and p<0.001, respectively.
Figure 3 is the result of confirming the mRNA expression inhibitory ability of androgen receptor (Androgen Receptor, AR) in prostate cancer cells (LNCaP) of brassicasterol. N is the control group without any treatment.
Figure 4 is the result of confirming the protein expression inhibitory ability of androgen receptor (Androgen Receptor, AR) in prostate cancer cells (LNCaP) of brassicasterol. A is a western blot result of measuring androgen receptor expression after treatment with 10 μM brassicasterol, and B is a result showing the relative expression level of each experimental group based on the expression level of the control group that was not treated with anything. ## denotes a statistically significant increase in androgen receptor expression in the group treated with DHT alone compared to the control group not treated with anything, p<0.01, and * indicates the expression of androgen receptors in the brassicasterol treatment group compared to the group treated with DHT alone. This was a statistically significant decrease, p<0.05. DHT is dihydrotestosterone.
FIG. 5 is a result confirming the ability of brassicasterol to inhibit protein expression of prostate specific antigen (PSA) in prostate cancer cells (LNCaP). A is the result of Western blot measurement of prostate-specific antigen expression after treatment with 10 μM brassicasterol, and B is the result showing the relative expression level of each experimental group based on the expression level of the control group that was not treated with anything . ## indicates a statistically significant increase in the expression of prostate-specific antigen in the DHT-only treatment group compared to the untreated control group, p<0.01, and ** indicates the prostate-specificity in the brassicasterol-treated group compared to the DHT-only treatment group. The expression of antigen was statistically significantly decreased, p<0.01. DHT is dihydrotestosterone.

In order to achieve the object of the present invention, the present invention provides a health functional food composition for preventing or improving prostate cancer containing brassicasterol as an active ingredient.

Brasicasterol of the present invention may be isolated from the hippocampal lipid extract, but is not limited thereto.

In the health functional food composition for preventing or improving prostate cancer according to an embodiment of the present invention, the brassicasterol is preferably from a hippocampal lipid extract obtained by adding a mixed solution of chloroform and methanol to the hippocampus, gas chromatography-mass spectrometry It can be separated by (Gas Chromatography-Mass Spectrometry, GC-MS).

The breed of the hippocampus is preferably Big Valley hippocampus ( Hippocampus abdominalis ), but is not limited thereto.

The seahorse extract is preferably extracted using a C ₁ to C ₄ lower alcohol, water, or a mixture thereof as a solvent, and more preferably extracted using chloroform and methanol as solvents, but is not limited thereto.

In one embodiment of the present invention, the brassicasterol has an effect of inhibiting the expression of androgen receptor and prostate-specific antigen.

The health functional food composition of the present invention may be in one formulation selected from powder, granule, pill, tablet, capsule, candy, syrup and beverage, but is not limited thereto.

When the health functional food composition of the present invention is used as a food additive, the health functional food composition may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The active ingredient may be used appropriately depending on the purpose of its use (prevention or improvement). In general, in the production of food or beverage, the health functional food composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw material. However, in the case of long-term intake for health purposes, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

There is no particular limitation on the type of the health functional food. Examples of foods to which the health functional food composition can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea There are drinks, alcoholic beverages, vitamin complexes, etc., and includes all health foods in the ordinary sense.

In addition, the health functional food composition of the present invention may be prepared as a food, particularly a functional food. The functional food of the present invention may include ingredients that are commonly added. Examples include proteins, carbohydrates, fats, nutrients and seasonings. For example, when manufactured as a drink, natural carbohydrates or flavoring agents may be included as additional ingredients in addition to the active ingredient. The natural carbohydrates include monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, etc.), oligosaccharides, polysaccharides (eg, dextrin, cyclodextrin, etc.) or sugar alcohols (eg, , xylitol, sorbitol, erythritol, etc.) is preferable. As the flavoring agent, natural flavoring agents (eg, taumatine, stevia extract, etc.) and synthetic flavoring agents (eg, saccharin, aspartame, etc.) may be used.

In addition to the health functional food composition, various nutrients, vitamins, electrolytes, flavoring agents, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonic acid It may further contain a carbonation agent and the like used in beverages. The ratio of these added ingredients is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food composition of the present invention.

In addition, the present invention provides a pharmaceutical composition for preventing or treating prostate cancer containing brassicasterol as an active ingredient.

The pharmaceutical composition according to the present invention may be formulated in the form of oral dosage forms such as capsules, powders, granules, tablets, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injection solutions according to conventional methods, respectively. can

Carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate , cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil, and the like.

In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the pharmaceutical composition, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc. prepared by mixing In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, solutions, emulsions, syrups, etc., and various excipients, such as wetting agents, sweeteners, fragrances, preservatives, etc., in addition to water and liquid paraffin, which are commonly used simple diluents, may be included. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, Witepsol, Macrogol, Tween 61, cacao butter, laurin fat, glycerogelatin, etc. can be used.

A suitable dosage of the pharmaceutical composition of the present invention may be prescribed variously depending on factors such as formulation method, administration mode, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity of the patient. can

The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by topical application to the skin, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc.

Hereinafter, the present invention will be described in more detail using examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited thereto.

Example 1. Isolation and purification of brassicasterol

(1) Preparation of hippocampal lipid extract

100 g of hippocampus ( Hippocampus abdominalis, Australia) was put into 300 ml of a solvent mixed with chloroform and methanol in a ratio of 2:1, homogenized for 3 minutes, filtered, and homogenized again in 100 ml of chloroform solution and filtered. After adding 100 ml of 0.88% potassium chloride (KCL) and reacting for 24 hours in the dark condition of 4°C, 5 g of anhydrous sodium sulfate was added and reacted for 30 minutes in the dark condition of 4°C to remove moisture in the chloroform layer. Only the chloroform layer was recovered and concentrated under reduced pressure in a water bath at 40° C. to obtain a lipid, 50 μl methyl hydroxylamine chloride and 50 μl BSTFA solution were added to remove moisture, and then a hippocampal lipid extract (SHL) was obtained. did.

(2) Isolation of brassicasterol

Gas Chromatography-Mass Spectrometry (GC-MS) was performed to separate and purify the physiologically active material from the hippocampal lipid extract (SHL) prepared by the above method. ISO LT gas chromatography connected to a single quadrupole mass spectrometer (Thermo Scientific, USA) was used. GC-MS analysis was performed by mounting a DB-5MS column (60m×0.25mm inner diameter, 0.25mm film thickness, Agilent Technologies, USA) and reacting at 325°C for 3 minutes, and gradually increasing the temperature. N ₂ was used as a carrier gas, the total reaction time was 43 minutes, and the initial injection volume was 1 μℓ.

As a result, it was confirmed that the retention time and mass spectrum of the hippocampus lipid extract and the retention time and mass spectrum of brassicasterol coincide ( FIG. 1 ). In addition, it was confirmed that 35.5 mg of brassicasterol per 100 g of the hippocampus lipid extract was contained.

Example 2. Measurement of cancer cell survival inhibitory ability

LNCaP cells and PC-3 cells, which are human prostate cancer cell lines, were purchased from the Korea Cell Line Bank (KCLB, Korea) and used in 10% (v/v) fetal bovine serum (FBS) in RPMI (Roswell Park Memorial Institute)-1640 medium. ) and 2 μM L-glutamine and penicillin/streptomycin were added, and incubated at 37° C., 5% CO ₂ conditions. LNCaP cells and PC-3 cells were cultured in a 96-well plate at 1×10 ⁴ cells/well, and 0-100 μM brassicasterol was added to react for 24 hours. Then, 10 μl of CELLOMAX ^TM reagent was added, reacted for 2 hours at 37° C. under dark conditions, and absorbance was measured at 450 nm to calculate cell viability according to the following formula.

Cell viability (%) = {(S-B)/(C-B)}×100

(S: absorbance of sample, B: absorbance of blank, C: absorbance of control)

As a result, it was confirmed that the cell proliferation of prostate cancer cells (LNCaP cells and PC-3 cells) was inhibited by brassicasterol. In particular, when 100 μM brassicasterol was treated, the survival rate of LNCaP cells was reduced by 36%, and it was confirmed that the viability of PC-3 cells was reduced by 18% ( FIG. 2 ).

Example 3. Measurement of androgen receptor expression inhibitory ability

Androgen receptor (AR) is a protein expressed in prostate cells, and serves to accept androgens such as testosterone or dihydrotestosterone. Therefore, the expression pattern of androgen receptor by brassicasterol of the present invention was analyzed. LNCaP cells, a human prostate cancer cell line, were cultured in RPMI (Roswell Park Memorial Institute)-1640 medium, and then treated with 2 nM of dihydrotestosterone (DHT) to induce proliferation of prostate cancer cells. After that, 10 μM of brassicasterol was treated, reacted for 24 hours, and total RNA and protein were extracted and analyzed.

(1) RT-PCR analysis

Total RNA was isolated from cells using TRIzol (Invitrogen, USA) reagent and cDNA was synthesized using a high-efficiency cDNA reverse transcription kit (Promega, USA). qRT-PCR was performed using primers.

gene sequence (5'-3') SEQ ID NO: androgen receptor (F)CCTGGCTTCCGCAACTTACAC One (R)GGACTTGTGCATGCGGTACTCA 2 β-actin (F) AAGAGAGGCATCCTCACCCT 3 (R)ATCTCTTGCTCGAAGTCCAG 4

As a result, it was confirmed that the mRNA expression of androgen receptor in prostate cancer cells was decreased by about 75% compared to the control group untreated by 10 μM brassicasterol (FIG. 3).

(2) Western blot analysis

Anti-Western blotting was performed using an antibody against androgen receptor (Cell Signaling, USA) by extracting and quantifying the protein from the cells.

As a result, it was confirmed that the androgen receptor expression of the group treated with DHT alone increased by about 1.7 times compared to the control group, and the expression of the androgen receptor increased by DHT was decreased by about 24% by the treatment with brassicasterol (FIG. 4).

Example 4. Measurement of the ability to inhibit expression of prostate-specific antigen

Prostate specific antigen (PSA) is a proteolytic enzyme synthesized in prostate epithelial cells, and is a tumor marker used for screening and diagnosis of prostate cancer because it is hardly expressed in tissues other than the prostate. Therefore, the prostate-specific antigen expression pattern by brassicasterol of the present invention was analyzed.

LNCaP cells, a human prostate cancer cell line, were cultured in RPMI (Roswell Park Memorial Institute)-1640 medium, and then treated with 2 nM of dihydrotestosterone (DHT) to induce proliferation of prostate cancer cells. Thereafter, 10 μM of brassicasterol was treated, reacted for 24 hours, proteins were extracted, and Western blot was performed using an antibody against a prostate-specific antigen (Cell Signaling, USA).

As a result, it was confirmed that the expression of prostate-specific antigen in the DHT-only group increased 16-fold or more compared to the control group, and the expression of the prostate-specific antigen increased by DHT was reduced by about 25% by treatment with brassicasterol (FIG. 5).

<110> KIM, Kyung Ja <120> Composition for preventing, ameliorating or treating prostate cancer comprising brassicasterol as effective component <130> PN20317 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cctggcttcc gcaacttaca c 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ggacttgtgc atgcggtact ca 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 aagagaggca tcctcaccct 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ratctcttgc tcgaagtcca g 21

Claims (4)

A health functional food composition for preventing or improving prostate cancer containing brassicasterol as an active ingredient. The health functional food composition for preventing or improving prostate cancer according to claim 1, wherein the brassicasterol is isolated from the hippocampal lipid extract. The health functional food composition for preventing or improving prostate cancer according to claim 1, wherein the brassicasterol inhibits the proliferation of prostate cancer cells, and inhibits the expression of androgen receptors and prostate-specific antigens. A pharmaceutical composition for preventing or treating prostate cancer containing brassicasterol as an active ingredient.

Images