KR20220067190A - Novel Pseudoalteromonas sp. ArcC09 strain with high cellulolytic ability, the strain-derived cellulase, and its production method - Google Patents

Abstract

The present invention relates to a novel cellulase derived from Pseudoalteromonas isolated from Arctic seawater. The cellulose of the present invention is a low-temperature active enzyme having high cellulose-degrading activity even at low temperatures, and shows excellent activity even at a temperature of 15 ℃ or less. The cellulose of the present invention is characterized by having different optimal temperature and pH conditions compared to previously-reported cellulose. Accordingly, a reaction can be terminated or started simply by adjusting the temperature or pH conditions, and is particularly useful in industries where it is difficult to conduct a reaction outside a specific temperature or pH range. In addition, the cellulose according to the present invention is characterized in that the activity thereof significantly increases when metal ions or chemical reagents are added. As such, when the corresponding reaction solution is used, the cellulose-degrading activity can be significantly increased.

Description

Novel Pseudoalteromonas ArcC09 strain having high resolution of cellulose at low temperature, strain-derived cellulase and production method thereof {Novel Pseudoalteromonas sp. ArcC09 strain with high cellulolytic ability, the strain-derived cellulase, and its production method}

The present invention relates to a novel Pseudoalteromonas sp. strain having a high resolution of cellulose at a low temperature isolated from arctic seawater, a novel low-temperature active cellulase derived from the strain, and a production method thereof, wherein the cellulase is different from the previously reported cellulase. It has an active temperature (low-temperature activity) and pH characteristics, and in particular, it is characterized by having a very high activity in the presence of metal ions or SDS or EDTA.

Cellulose is a polysaccharide composed of glucose units linked through β-1,4,-glycosidic linkage. Cellulose is considered the world's most abundant renewable biomass. As the usefulness of lignocellulosic biomass, which is lignocellulosic, has been reported, interest in the development of highly efficient cellulase is increasing (Gomes et al. 2015). Cellulose has a wide range of applications in various fields such as the pulp and paper, detergent and biofuel industries (Srivastava et al. 2014). In many previous studies, 1,4-β-D-glucan-4-glucanohydrolases (EC 3.2.1.4, endoglucanases), 1,4-β-D-glucan glucanohydrolases (EC 3.2.1.74, exoglucanases), 1,4 Several types of cellulase have been reported, such as -β-D-glucan cellobiohydrolases (EC 3.2.1.91, cellobiohydrolases), and β-glucoside glucohydrolases (EC 3.2.1.21, β-glucosidases) (Lynd et al. 2002).

To hydrolyze cellulosic materials into fermentable sugars, three main cellulase systems are needed:

i) endoglucanase (Sharma et al. 2016),

ii) cellobiohydrolases (Zhu and McBride 2017);

iii) β-glycosidases (β-glucosidases; Parisutham et al. 2017).

Endoglucanase is an enzyme that randomly cleaves the internal bonds of disordered sites that make new chain ends, and cellobiohydrolase is produced and exposed by endoglucanase at the end of the chain, producing 2 to 4 units of sugar. It is an enzyme that cleaves to produce short polysaccharides such as cellobiose. β-glycosidase is an enzyme that hydrolyzes polysaccharides composed of 2 to 4 unit sugars produced by cellobiohydrolase into monosaccharides.

Cellulase is currently one of the largest industrial enzyme families on the enzyme market (Arbige et al. 2019; Trivedi et al. 2016). Cellulase has a broad range of useful uses in a wide range of industries, including biofuels, waste digestion, animal feed, laundry detergent, food and textiles.

Most of the cellulase producers reported to date are sources of terrestrial environments, such as Trichoderma reesei (Bischof et al. 2016), Neurospora crassa (Dogaris et al. 2013), Penicillium oxalicum. ( Penicillium oxalicum ; Li et al. 2017), and Aspergillus niger ; (Stricker et al. 2008), and fungi such as, and Clostridium acetobutylicum ; Kosugi 2004), Clostridium thermocellum ( Olson et al. 2010), Bacillus halodurans ( Annamalai et al. 2013), Acidothermus cellulolyticus ; Wang et al. al. 2015a), the genus Paenibacillus ( Paenibacillus sp .; Kanchanadumkerng et al. 2017), and bacteria such as Bacillus licheniformis (Marco et al. 2017). Cellulose reported above Most of the microorganisms exhibiting decomposition activity are characterized by producing cellulase exhibiting optimal activity at medium or high temperature, and a higher temperature (60 ~ 70 ° C) and more energy are required to saccharify the cellulose slurry.

Recently, various enzymes including cellulase in the marine environment exhibit different properties from enzymes in the terrestrial environment, such as low-temperature activity, alkali and halo resistance, and research as a new biocatalyst is being actively conducted (Jin et al. 2019).

Cold-active cellulases are enzymes that decompose cellulose using a relatively low temperature and low energy, and can saccharify a cellulose slurry at a lower temperature and less energy than the enzymes described above (Maharana and Ray 2015) ). According to a recent report, cold-activated enzymes produced by psychrophiles in the deep sea area are spotlighted as a very useful resource in industry, and it has been found that the flexible structure of the cold-activated enzyme helps to maintain activity even at low temperatures. there is a bar When a low-temperature active enzyme is used in various industries, the process time and energy required to promote the reaction can be saved, and the low-temperature reaction process performed at a low temperature reduces the occurrence of contamination and reduces the production of unwanted by-products. In addition, due to the low thermal stability, unwanted by-products can be prevented by controlling the temperature to a high temperature in a process that does not require an enzyme. Furthermore, low-temperature active cellulase can only remove unwanted fibers in the temperature-sensitive textile industry (Kumar et al. 2011).

Since reaction conditions such as temperature and pH of the process are very diverse in various industrial fields, it is very important to secure diversity of low-temperature-activated cellulase having different optimal activity conditions. Nevertheless, the types and characteristics of reported low-temperature bacteria are limited, and in particular, research on low-temperature active cellulase is extremely limited and the diversity is very limited. Diversity is very scarce (Caf et al. 2014; Souza et al. 2016; Wang et al. 2015b; Yang and Dang 2011).

With respect to low-temperature active cellulases, several cellulases from Pseudoalteromonas haloplanktis , Pseudoalteromonas sp. NO3, and Pseudoalteromonas sp. DY3 have been identified and characterized (Garsoux et al. 2004; Kim et al. 2009). ; Zeng et al. 2006). All of the Pseudoalteromonas-derived cellulase (molecular weight 38-52 kDa) exhibit optimal activity at 40° C., and at the optimal pH, about pH 8 ( Pseudoalteromonas haloplanktis ), about pH 8 ( Pseudoalteromonas sp. NO3), and about pH 4 ( Pseudoalteromonas sp. DY3). Since low-temperature-activated cellulase exhibits strong cellulase activity in a narrow temperature range or pH range, it is important to secure diversity of low-temperature-activated cellulase having various optimal conditions, but the types of low-temperature-activated cellulase currently reported are only a few.

Under this background, the present inventors made diligent efforts to secure diversity of low-temperature-active cellulase through the development of novel low-temperature-activated cellulase that exhibits optimal activity conditions in a previously unreported range. A novel Pseudoalteromonas sp. strain was identified, and a novel low-temperature active cellulase was isolated therefrom. It was confirmed that the novel low-temperature-activated cellulase exhibits high cellulase activity, and the reaction conditions (temperature, pH, and metal ion additives, etc.) that exhibit optimal activity are different from other previously reported low-temperature-activated cellulases, When the recombinant host cells to produce a novel low-temperature active cellulase are cultured at a low temperature to produce cellulase, it was confirmed that they exhibit a remarkably high cellulolytic activity, and thus the present invention has been completed.

The information described in the background section is only for improving the understanding of the background of the present invention, and it does not include information forming prior art known to those of ordinary skill in the art to which the present invention pertains. it may not be

It is an object of the present invention to provide a novel Pseudoalteromonas sp. strain having a high cellulolytic activity even at a low temperature.

Another object of the present invention is to provide a novel cellulase derived from the strain, its preparation method and use.

In order to achieve the above object, the present invention provides a Pseudoalteromonas sp. ArcC09 strain deposited with accession number KCTC 14216BP.

The present invention also provides a cellulase derived from Pseudoalteromonas sp. ArcC09 strain.

The present invention also provides a nucleic acid encoding the cellulase.

The present invention also provides a vector comprising the nucleic acid.

The present invention also provides a recombinant host cell into which the nucleic acid or recombinant vector is introduced.

The present invention also provides a method for producing cellulase comprising the steps of:

(a) culturing the recombinant host cell to produce a cellulase represented by the amino acid sequence of SEQ ID NO: 14;

(b) recovering the produced cellulase.

The present invention also provides a composition for hydrolysis of cellulose comprising the cellulase.

The strain of the present invention is a novel strain that exhibits high cellulolytic activity even at a low temperature of 15° C. or less, and exhibits significantly higher activity than other previously reported cellulolytic strains or Pseudoalteromonas sp. strains. In addition, the cellulase derived from the strain of the present invention is a low-temperature active enzyme having a high cellulolytic activity even at a low temperature, and exhibits excellent activity even at 15° C. or less, and has different optimal temperature and pH conditions from previously reported cellulase. , the reaction can be terminated or started simply by adjusting the temperature or pH conditions, and is particularly useful in industries where it is difficult to carry out outside a specific temperature or pH range. In addition, the cellulase according to the present invention exhibits a characteristic of significantly increasing the activity when metal ions or chemical reagents are added, and when the corresponding reaction solution is used, the cellulase activity can be further significantly increased.

1A is a phylogenetic tree of 10 strains finally identified based on cellulase activity. A phylogenetic tree was created with MEGA6 software using the neighbor-joining method and 1000 bootstrap replications. Scale bars represent substitutions of 0.02 per base position. Bacillus halodurans was used as an outgroup.
Figure 1b shows the cellulase activity measured in each cell culture reaction solution. Each data is the average of the test values performed at least three times, and the error bars represent the standard deviation.
Figure 2 shows the SDS-PAGE results of cellulase in each purification step. The information for each lane is as follows:
M lane: protein markers (BIORAD, Precision Plus Protein™ Standards);
lane 1: obtained supernatant (Crude supernatant);
lane 2: protein collected by ammonium sulfate precipitation method;
lane 3: enzyme fraction purified by hydrophobic interaction chromatography;
lane 4: enzyme fraction purified by size exclusion chromatography;
lane 5: Zymography of purified cellulase.
Figure 3 is an analysis of the activity (U / mg) of cellulase according to temperature and pH.
Figure 3a shows the activity of ArcC09-derived cellulase (○) measured at each temperature and the commercially available A.niger-derived cellulase (●) activity. The test was performed at the optimum pH condition for each enzyme.
Figure 3b shows the activity (○, △, □) of the cellulase derived from ArcC09 and the activity of the commercially available A.niger-derived cellulase (●, ▼, ■) measured at each pH condition. The test was performed under optimum temperature conditions for each enzyme (ArcC09: 55°C, A.niger: 65°C). Buffers for each pH condition are as follows:
50 mM sodium acetate buffer pH 3.0-6.0 (○/●);
50 mM potassium phosphate buffer pH 6.0-8.0 (Δ/▼); and
50 mM Tris-HCl buffer pH 7.0-9.0 (□/■).
4 is a result confirming the temperature and pH stability of cellulase. Each data is the average of the test values performed at least three times, and the error bars represent the standard deviation.
Figure 4a shows the activity of ArcC09-derived cellulase (○) and commercially available A.niger- derived cellulase (●) according to temperature (5-85° C.). The enzyme is incubated without a substrate at 5 ~ 85°C for 1 hour at the optimum pH condition, and then reacts with the substrate at the optimum temperature condition (ArcC09 at 55°C, A. niger cellulase at 65°C) to maintain enzyme activity. It was confirmed that
Figure 4b shows the activity of ArcC09-derived cellulase (○) and commercially available A. niger -derived cellulase (●) according to pH conditions (pH3-11). Enzymes were pre-incubated at 4°C and then measured at 55°C (derived from ArcC09) and 65°C (derived from A. niger ), respectively.
5 shows the activity of ArcC09-derived cellulase (a) and commercially available A. niger -derived cellulase (b) according to the addition of metal ions or chemical reagents. Standard conditions (enzyme reaction without addition, control) are indicated by dark gray bars. Each data is the average of the test values performed at least three times, and the error bars represent the standard deviation.
Fig. 6 is a schematic diagram of the ArcC09-derived cellulase gene.
7 is an SDS-PAGE result of the soluble and insoluble fractions and the concentrated supernatant of strains transformed with the catalytic module of ArcC09 cellulase or whole ORF.
Figure 7a shows the stained protein bands in the transformants of the whole ORF and catalytic module and fractions of the concentrated supernatant under 15 °C induction conditions.
Figure 7b shows the total ORF and the insoluble protein fraction of the transformant of the catalytic module under induction conditions at 37 °C.
S: soluble fraction, IS: insoluble fraction, M: protein marker.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art.
The present inventors identified 10 types of bacteria exhibiting high cellulolytic activity among more than 4600 microorganisms from soil and seawater collected from the Arctic Beaufort Sea. As a result of analyzing their 16S rRNA, it was confirmed that the new strain belongs to the genus Pseudoalteromonas (9 species) and the genus Paraglaciecola (1 species), and the genomic DNA library of the strain was built. In particular, it was confirmed that Pseudoalteromonas sp. ArcC09 exhibited significantly higher cellulolytic activity compared to other identified strains, and was deposited with the Korea Biological Resources Center (KCTC).
Therefore, in one aspect, the present invention relates to a Pseudoalteromonas sp. ArcC09 strain deposited with accession number KCTC 14216BP.
The strain of the present invention is characterized in that it exhibits high cellulolytic activity even at a low temperature of about 15° C. or less, and in particular, it exhibits higher low-temperature cellulolytic activity than other Pseudoalteromonas sp. strains or other strains having cellulosic activity. do.
The strain of the present invention may be used to hydrolyze cellulose in the form of a culture solution of the strain, a concentrate of the culture solution, a dried product of the culture solution, an extract of the culture solution, or a combination thereof.
In another embodiment of the present invention, Pseudoalteromonas sp. As a result of analyzing the characteristics of the cellulase derived from ArcC09, it was confirmed that it is a low-temperature active enzyme with an optimal activity condition (pH, temperature) in a range different from that of the existing strain, and when various metal ions or chemical reagents are added, higher cellulose It was confirmed that the degradation activity was confirmed, and the amino acid and nucleic acid sequences of the catalyst module (Catalytic module, SEQ ID NO: 13) and the entire ORF (Open Reading Frame, SEQ ID NO: 14) showing cellulolytic activity through sequencing were confirmed.
Accordingly, from another aspect, the present invention relates to a low-temperature active cellulase, characterized in that it is derived from the Pseudoalteromonas sp. ArcC09 strain deposited with the accession number KCTC 14216BP.
As used herein, the term “cellulase” refers to an enzyme capable of hydrolyzing cellulose, and may be used interchangeably in the same meaning as “cellulosic enzyme”.
In the present invention, the cellulase may be characterized in that it comprises a catalyst module represented by the amino acid sequence of SEQ ID NO: 13.
In the present invention, the cellulase may be characterized in that it is represented by the amino acid sequence of SEQ ID NO: 14.
In the present invention, the cellulase may be characterized in that it exhibits low-temperature activity.
In the present invention, the cellulase may be characterized in that it exhibits optimal cellulolytic activity at a temperature condition of about 45°C to 60°C, preferably at about 55°C.
The term "low temperature activity" of the present invention means that it can exhibit activity even at a low temperature at which most of the previously reported activity of cellulase is lost. means that it exhibits sufficient cellulolytic activity and temperature stability.
In the present invention, the cellulase may be characterized in that it exhibits optimal cellulolytic activity at a pH condition of about pH 6 to pH 7.5, preferably at about pH 7.
In the present invention, the cellulase may be characterized in that the endoglucanase (Endoglucanase).
In the present invention, although a specific amino acid sequence and base sequence have been described in the present invention, it will be apparent to those skilled in the art that the amino acid sequence substantially identical to the enzyme to be practiced in the present invention and the nucleotide sequence encoding the same are within the scope of the present invention. will be.
As used herein, the term “substantially identical” includes cases in which homology of amino acids or nucleotide sequences is very high, and in addition, they share structural features regardless of sequence homology or have the same function as used in the present invention. means protein. A fragment of an enzyme or a nucleotide sequence encoding the enzyme in which a sequence other than the sequence constituting the core of the present invention is partially deleted may also be included in the present invention, and therefore, the present invention is the same as used in the present invention regardless of the length of the fragment. All amino acids or nucleotide sequences having the same function are included.
In the present invention, the substantially identical amino acid sequence may include a cellulase in which one or more specific amino acids in the cellulase according to the present invention are conservatively substituted.
The term "conservative substitution" means a modification comprising substituting one or more amino acids with amino acids having similar biochemical properties that do not cause loss of biological or biochemical functions and/or properties of the cellulase.
A “conservative amino acid substitution” is a substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Classes of amino acid residues having similar side chains have been defined in the art and are well known. These classes include amino acids with basic side chains (eg lysine, arginine, histidine), amino acids with acidic side chains (eg aspartic acid, glutamic acid), amino acids with uncharged polar side chains (eg glycine) , asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains amino acids with aromatic side chains (eg, tyrosine, phenylalanine, tryptophan, histidine) and amino acids with aromatic side chains (eg, threonine, valine, isoleucine).
In another aspect, the present invention relates to a nucleic acid encoding the cellulase.
As used herein, “nucleic acid” may be present in a cell, a cell lysate, or may be present in a partially purified or substantially pure form. Nucleic acids can be removed from other cellular components or other contaminants, e.g., by standard techniques including alkali/SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis, and others well known in the art. It is "isolated" or "substantially pure" when it has been purified from the nucleic acid or protein of another cell. The nucleic acid of the invention may be, for example, DNA or RNA.
"Substantially pure" as used herein means that the polypeptides according to the invention and the DAN sequences encoding the polypeptides are substantially free of other proteins derived from bacteria.
In another aspect, the present invention relates to a vector comprising the nucleic acid.
For the expression of the cellulase fragment according to the present invention, DNA encoding the cellulase can be obtained by standard molecular biology techniques (eg, PCR amplification or cDNA cloning using a cellulase-expressing hybridoma, etc.), and the DNA is It can be "operably linked" to transcriptional and translational control sequences and inserted into an expression vector.
As used herein, the term "operably linked" means that a nucleic acid encoding a cellulase is introduced into a vector such that transcriptional and translational control sequences in the vector function to regulate the transcription and translation of the nucleic acid (gene) encoding the cellulase. can mean that The expression vector and expression control sequence may be selected to be compatible with the host cell used for expression. The cellulase-encoding nucleic acid is prepared by standard methods (e.g., ligation of a cellulase-encoding nucleic acid with a complementary restriction enzyme site on a vector, or blunt end ligation if no restriction enzyme site is present) into an expression vector can be inserted into
The vector may contain regulatory sequences for controlling the expression of a nucleic acid encoding a cellulase in a host cell. "Regulatory sequence" refers to a promoter that controls the transcription or translation of a nucleic acid encoding a cellulase, any operator sequence to regulate such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence that controls the termination of transcription and translation. include For example, regulatory sequences suitable for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. Regulatory sequences suitable for eukaryotes may include promoters, polyadenylation signals and enhancers.
Examples of regulatory sequences of the present invention include, in addition to the promoter, early and late promoters of, for example, SV40 or adenovirus, lac system, trp system, TAC or TRC system, T3 and T7 promoters, major operator of phage lambda and promoter regions, regulatory regions of fd coding proteins, promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, promoters of said phosphatases, such as Pho5, promoters of yeast alpha-crossing systems and prokaryotic or eukaryotic cells Other sequences of construction and induction known to regulate the expression of genes in cells or viruses thereof, and various combinations thereof are included. The T7 RNA polymerase promoter Φ10 can be usefully used to express proteins in E. coli .
A person skilled in the art can recognize that the design of the expression vector may vary by selecting different control sequences depending on factors such as the selection of a host cell to be transformed, the level of protein expression, and the like.
As used herein, the term “vector” refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host. A vector may be a plasmid, a phage particle, or simply a potential genomic insert. Upon transformation into an appropriate host, the vector may replicate and function independently of the host genome, or in some cases may be integrated into the genome itself. Since a plasmid is currently the most commonly used form of vector, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. However, the present invention includes other forms of vectors that have an equivalent function as known or coming to be known in the art. Examples of protein expression vectors used in E. coli include the pET family of Novagen (USA); pBAD family of Invitrogen (USA); pHCE or pCOLD from Takara (Japan); pACE family of Xenofocus (Korea USA); etc. can be used. In Bacillus subtilis, protein expression can be realized by inserting a target gene into a specific part of the genome, or a pHT-based vector from MoBiTech (Germany) can be used. In mold or yeast, protein expression is possible using genome insertion or self-replicating vectors. A plant protein expression vector can be used using a T-DNA system such as Agrobacterium tumefaciens or Agrobacterium rhizogenes . Typical expression vectors for expression in mammalian cell culture are, for example, based on pRK5 (EP 307,247), pSV16B (WO 91/08291) and pVL1392 (Pharmingen).
In another aspect, the present invention relates to a recombinant host cell into which the nucleic acid or vector is introduced.
In the present invention, the recombinant host cells include, but are not limited to, E. coli, Bacillus subtilis , Streptomyces sp., Pseudomonas sp., Proteus mirabilis. ( Proteus mirabilis ) or prokaryotic cells such as Staphylococcus sp.; Fungi such as Aspergillus sp., Pichia pastoris , Saccharomyces cerevisiae , Schizosaccharomyces sp. and Neurospora yeast or other lower eukaryotic cells such as Neurospora crassa ; It may be a eukaryotic cell such as a cell of a higher eukaryote such as a cell from an insect.
In the present invention, the recombinant host cell may be derived from a plant or a mammal. Preferably, monkey kidney cells 7 (COS7) cells, NSO cells, SP2/0, Chinese hamster ovary (CHO) cells, W138, baby hamster kidney (BHK: baby hamster kidney) cells, MDCK, myeloma cell lines, HuT 78 cells and HEK293 cells are available, but are not limited thereto. Particularly preferably, CHO cells may be used, but the present invention is not limited thereto.
The nucleic acid or the vector is “transfected” or transfected into a host cell. A variety of different techniques commonly used to introduce exogenous nucleic acids (DNA or RNA) into prokaryotic or eukaryotic host cells for “transfection” or “transfection” such as electrophoresis, calcium phosphate precipitation, DEAE-dextran transfection or lipofection may be used.
Various expression host/vector combinations can be used to express the cellulase according to the present invention. Expression vectors suitable for eukaryotic hosts include, but are not limited to, expression control sequences derived from SV40, bovine papillomavirus, adenovirus, adeno-associated virus, cytomegalovirus and retrovirus. Expression vectors that can be used for bacterial hosts include bacterial plasmids obtained from Escherichia coli, such as pET, pRSET, pBluescript, pGEX2T, pUC vectors, col E1, pCR1, pBR322, pMB9 and derivatives thereof, and a broader host such as RP4. plasmids with a range, phage DNA exemplified by a wide variety of phage lambda derivatives such as λgt10 and λgt11, NM989, and other DNA phages such as M13 and filamentous single-stranded DNA phages. Useful expression vectors for yeast cells are 2 μm plasmids and derivatives thereof. A useful vector for insect cells is pVL941.
When the nucleic acid encoding the cellulase according to the present invention is introduced into a host cell, it can be introduced into the genome of the host cell and introduced as a chromosomal factor, and can exist outside the genome of the host cell in the form of an independent plasmid or vector. have. For those skilled in the art to which the present invention pertains, it will be apparent that even when the cellulase-encoding nucleic acid is inserted into the genomic chromosome of the host cell, it will have the same effect as when the recombinant vector is introduced into the host cell.
In another embodiment of the present invention, the catalytic module (SEQ ID NO: 13) and ORF (SEQ ID NO: 14) of the cellulase gene derived from Pseudoalteromonas ArcC09 are cloned into a vector, and then introduced into E. coli BL21 (DE3) was expressed. It was confirmed that the cellulosic activity of the total ORF expressed at 15°C was about twice higher than that of the total ORF expressed at 37°C.
In another aspect, the present invention relates to a method for the production of cellulase comprising the steps of:
(a) culturing the recombinant host cell to produce a cellulase represented by the amino acid sequence of SEQ ID NO: 14;
(b) recovering the produced cellulase.
In the present invention, the step (a) may be characterized in that the cellulase is produced by culturing the strain of claim 1 or the recombinant host cell of claim 5 at a temperature of 15 to 37°C.
As confirmed in one embodiment of the present invention, when cellulase is produced by culturing recombinant host cells under low temperature conditions, the activity of E. Coli is about twice or more superior to that of cellulase produced by culturing at 37° C., which is the normal culture temperature. Therefore, in the present invention, step (a) may be characterized in that the cellulase is produced by culturing the strain of claim 1 or the recombinant host cell of claim 5 under a temperature condition of 10 to 25 °C. More preferably, it may be characterized in that the cellulase is produced by culturing the strain of claim 1 or the recombinant host cell of claim 5 at 15°C.
When a recombinant expression vector capable of expressing the cellulase of the present invention is introduced into a host cell, the cellulase is produced for a period sufficient for expression in the host cell, or more preferably, the cellulase of the present invention is introduced into the culture medium in which the host cell is cultured. It can be prepared by culturing the host cell for a period sufficient to allow it to be secreted.
The recovery of cellulase from the cultured recombinant host cells is carried out by conventional biochemical separation techniques, for example, treatment with a protein precipitating agent (salting-out method), centrifugation, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration). , adsorption chromatography, ion exchange chromatography, various chromatography such as affinity chromatography, etc. may be used, and a combination thereof may be used in order to isolate and purify a protein having high purity in general.
Meanwhile, while the present inventors were investigating the characteristics of the cellulase of the present invention, the low-temperature active cellulase of the present invention not only exhibits optimal temperature and pH conditions different from those of conventional cellulase, but also, in particular, metal ions or surfactants (SDS), metals It was confirmed that the activity was significantly increased during the reaction in a reaction solution to which a chemical reagent such as a sequestering agent (EDTA) was added.
Therefore, in another aspect, the present invention is Pseudoalteromonas sp. ArcC09 strain deposited with accession number KCTC 14216BP, the culture solution of the strain, the concentrate of the culture solution, the dried product of the culture solution, the extract of the culture solution, the It relates to a composition for hydrolysis of cellulose comprising, as an active ingredient, any one or more of strain-derived cellulase and the cellulase produced by the production method of claim 6.
As used herein, the term "culture medium", "concentrate" or "dry material" refers to the culture medium itself obtained by culturing the strain, the culture medium or the concentrate or freeze-dried product of the culture supernatant obtained by removing the strain therefrom, "Culture supernatant", "conditioned culture medium" or "conditioned medium" and the like can be used interchangeably.
In the present invention, the composition may be characterized in that it further comprises a metal ion, preferably Na ²⁺ , Ba ²⁺ , Mn ²⁺ , and any one or more selected from the group consisting of Zn ²⁺ It may be characterized in that it further comprises a metal, more preferably Mn ²⁺ and/or Zn ²⁺ .
In the present invention, the metal ion may be characterized in that it is included in the composition in an amount of 0.01mM to 0.1M, preferably 0.1mM to 0.01M, but is not limited thereto.
In the present invention, the composition may be characterized in that it further comprises SDS or EDTA.
The cellulase of the present invention or a composition comprising the same can be used without limitation for decomposition and/or removal of cellulose in various industrial fields. For example, the composition of the present invention may be used in biofuel, waste decomposition, animal feed, laundry detergent, food or textile fields, but is not limited thereto.

Example

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1. Materials and Methods

Example 1-1: Identification of cellulase-producing bacteria

More than 4600 microorganisms were identified from soil and seawater collected from CTD (conductivity, temperature and depth) membranes, box core samples, head sea water, and the Arctic Beaufort Sea. The identified strains were R2A (MB Cell), Marine Broth (2216, BD Difco), ZoBell, Super ZoBell (2% [w/v] glucose added to ZoBell media), ISP Medium 4 (BD Difco), and YPG medium ( 0.5% [w/v] yeast extract, 0.5% [w/v] peptone, 1% [w/v] glucose) plates were used for culture, and cellulase-producing bacteria were identified. The plate was incubated at 15° C. for 3 days, treated with 0.1% [w/v] Congo red for 10 minutes, and washed with 1 M NaCl to select bacteria exhibiting extracellular cellulolytic activity (Teather and Wood). 1982).

By observing the bright orange clear zone surrounding the colony, 54 strains were classified, and the size of the clear zone was measured and sequentially arranged according to the size. Ten bacterial strains exhibiting the largest clear zone were selected, and cellulolytic activity was tested using liquid culture broth (Table 1). As shown in FIG. 2 , Pseudoalteromonas ArcC09 exhibited significantly superior cellulolytic activity compared to other strains, and deposited it at the Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC) and conducted additional research (Accession No.: KCTC) 14216BP).

strain name location Depth (m) Source deposit number ArcC01 N 70.47.3328 W 135.34.0492 42 CTD membrane PAMC 28210 ArcC02 N 69.53.6405 W 138.16.4598 25 CTD membrane PAMC 28386 ArcC03 N 70.23.7278 W 135.18.7483 30 CTD membrane PAMC 28228 ArcC04 N 70.27.5440 W 134.33.6664 15 CTD membrane PAMC 28293 ArcC05 N 70.48.1111 W 136.05.9811 740 head sea water PAMC 28387 ArcC06 N 69.42.0681 W 137.32.3191 24 CTD membrane PAMC 28388 ArcC07 N 70.39.3456 W 138.21.1199 200 CTD membrane ArcC08 N 70.39.3456 W 138.21.1199 200 CTD membrane PAMC 28368 ArcC09 N 70.39.3456 W 138.21.1199 200 CTD membrane PAMC 28369 ArcC10 N 69.42.0681 W 137.32.3191 0 CTD membrane PAMC 28374

*All strains except Pseudoalteromonas ArcC07 were deposited with the Polar and Alpine Microbial Collection (PAMC) of the Korea Polar Data Center.

Example 1-2: Identification of cellulase-producing bacteria

The 10 strains in Table 1 were identified through 16S rRNA PCR using the 27F primer and the 1492R primer, and sequenced using the 518F and 800R primers (Table 2).

primer SEQ ID NO:5'-3' SEQ ID NO: 27F AGA GTT TGA TCC TGG CTC AG One 1492R TAC GGY TAC CTT GTT ACG ACT T 2 518F CCA GCA GCC GCG GTA ATA CG 3 800R TAC CAG GGT ATC TAA TCC 4

The sequenced contigs were aligned using the EzTaxon program (www.eztaxon.org, Chun et al. 2007) and the closest matched strains determined. A phylogenetic tree was constructed based on 16S rRNA gene sequence data using the neighbor-joining method (Saitou and Nei 1987) of the computer program MEGA6 (Mura et al. 2013). Bacillus halodurans was included as an outgroup.

Example 1-3: Bacterial culture and cellulolytic activity analysis

Liquid ZoBell medium (peptone 5 g/L, yeast extract 1 g/L, FePO ₄ 4H ₂ O 0.01 g/L, seawater water) at 750 mL/L, pH adjusted to 7.6) at 15° C. for 3 days. The supernatant was obtained by centrifugation (9,000xg, 30 minutes) of 10 microbial cultures, and the activity was measured by analyzing the CMC hydrolysis rate. Cellulolytic activity was analyzed by adding 0.1 ml of the culture supernatant to 0.5 mL CMC (1% [w/v]) in 50 mM sodium acetate buffer (pH 5.0) and incubating at 37° C. for 15 minutes. The reaction was stopped by adding 0.6 mL of 3,5-dinitrosalicylic acid (DNS) reagent, and the OD540 was measured using a Scinco S-3100 spectrophotometer (Scinco, Korea) (Caf et al. 2014). Units of activity per milligram (U/mg) were defined as the amount required to release 1 μmol of reducing sugar per 1 minute per milligram of protein. A commercially available cellulase (Cellulase from A. niger , C1184, Sigma, USA) was used as a standard cellulase.

Example 1-4: Purification of cellulase

The culture broth was centrifuged at 4° C., 9,000 × g for 30 minutes, and the supernatant was collected for protein precipitation. Ammonium sulfate ((NH ₄ ) ₂ SO ₄ ) was added with gentle stirring at 4° C. until the solution reached 70% [w/v] saturation. The solution was centrifuged at 9,000 × g for 30 minutes, and the precipitate was dissolved in 10 mL of 20 mM potassium phosphate buffer (pH 7.0). 2mL of crude enzyme extract was loaded on a Phenyl-Sepharose column (HiTrap, GE, USA; 5 × 5 ml). The enzyme was eluted using 20 mM potassium phosphate buffer (pH 7.0) added with 1% isopropanol at a flow rate of 1.0 mL/min. The active fractions were pooled and loaded onto a Superdex 75 (GE, USA) column with 20 mM potassium phosphate buffer (pH 7.0), then the active fractions were pooled and concentrated using Vivaspin 20 (10 kDa cut-off) (GE, USA). .

Example 1-5: Gel Electrophoresis and Zymography

The molecular weight and purity of cellulase were confirmed using SDS-PAGE and zymography. Protein bands were visualized by staining the SDS-PAGE gel with EZ-Gel staining solution (DoGenBio, South Korea). For zymography, SDS-PAGE gels washed with 50 mM Tris buffer were placed on a 15% [w/v] agar plate with 1% [w/v] CMC added thereto. Plates were incubated at 15°C for 4 hours and stained with 0.1% [w/v] Congo Red solution. After staining for 10 minutes, 1M sodium chloride was used to remove the stain.

Example 1-6: Characterization of purified cellulase

Enzyme activity was analyzed in the range of 5 to 85 °C at 10 °C intervals. After incubating the enzyme and CMC at each temperature for 30 minutes, the cellulosic activity according to the temperature was analyzed. The thermal stability of the enzyme was determined under standard analytical conditions after pre-incubation of the purified enzyme at the desired temperature for 1 hour.

The effect of pH on enzyme activity was analyzed in the range of pH3.0 to pH9.0. Activity was analyzed after pre-incubation of the purified enzyme with various buffer systems at the optimum temperature for 1 hour. The buffer systems (50 mM) used in this study were: sodium acetate (pH 3.0 to 6.0), potassium phosphate (pH 6.0 to 8.0), and Tris-HCl (pH 7.0 to 9.0).

Various additives such as metal ions (1 mM) and 1 mM chemical reagents were added as Cl ₂ and SO ₄ salts, and the effect on enzyme activity was investigated.

Example 1-7: Sequencing and cloning of pseudoaltero monas ArcC09 endoglucanase gene

The protein sequence was analyzed through N-terminal amino acid sequence analysis using the Edman degradation method at the Korea Institute of Basic Science. To find similar protein information, sequence results and amino acid sequences were searched through the NCBI database. With reference to the uploaded genome sequence, forward primer (5'-TTTAAGGAAATACGATG-3') and reverse primer (5'-TTACTTTATTAAACGCGC-3) were used for full-length endoglucanase gene sequencing. Cloned using the primers listed in Table 3 below listed to construct the entire ORF and Catalytic module Transformants. The estimated molecular weight of endoglucanase was calculated using the ExPASy, pl/Mw tool.

primer sequence (5'-3') SEQ ID NO: Full endoglucanase primer (Forward) TTTAAGGAAAATACGATG 5 Full endoglucanase primer (Reverse) TTACTTTATTAAAACGCGC 6 ORF-F ATGGATAACAGTTTAATTAAT 7 ORF-R TTAATTACAACTATAAAGAAG 8 Catalytic module-F GCTGTTGAGAAATTAACGGTT 9 Catalytic module-R GTTTTTATCATTAATAGACCA 10

Example 1-8: Expression of endoglucanase gene

The constructed whole ORF and catalytic module transformants were overexpressed at 15 and 37°C conditions. The strain was cultured until OD600=0.5, and 1 mM IPTG was added and harvested the next day. The supernatant was concentrated up to 50 times with a 10 kDa spin membrane (Pierce® Protein Concentrator PES, Cat. 88527). The harvested cells were sonicated and centrifuged at 13,000 rpm for 30 minutes to separate soluble and insoluble fractions. Each fraction was loaded on an 8-16% gradient pre-made SDS-PAGE gel (Mini-PROTEAN® TGX® Precast Gels, Cat. 4561104).

Example 2. Identification and selection of cellulase producing bacteria

As a result of culturing strains (more than 4,600 species) isolated from the Arctic Beaufort Sea on CMC (Carboxymethyl cellulose) plates at 15°C for a day, 54 bacterial strains formed halos around plate colonies to produce cellulase. was confirmed as Of these, 10 strains were selected as candidate strains that produced relatively large halos to produce low-temperature active cellulase. Nine of the obtained 10 candidate strains were identified as the genus Pseudoalteromonas , and the other strain was identified as belonging to the genus Paraglaciecola (Fig. 1a).

Phylogenetic analysis of Pseudoalteromonas sp. ArcC01 and Pseudoalteromonas . sp. ArcC06 showed 99.73 and 99.66% similarity to Pseudoalteromonas arctica in the monophylogenic clade, respectively, and ArcC03, ArcC04 and ArcC10 were Pseudoalteromonas fuliginea (99.86%) and Pseudoalteromonas fuliginea (99.86%) and Pseudoalteromonas fuliginea (99.86%) in the single phylogenetic clade, respectively. and Paraglaciecola mesophila (99.51%). The remaining isolated strains (ArcC02, 05, 07, 08 and 09) did not produce a single lineage with the previously reported strains.

CMC was used as a substrate to evaluate the activity of cellulase secreted by 10 candidate strains, and the resulting reducing sugar was quantified by measuring the optical density at 540 nm. Specific activity units (U/mg) were calculated as production of 1 μmol per minute reduction per milligram protein. It was confirmed that the cellulase of ArcC09 showed the highest activity (OD540=0.79), and the study was performed by selecting the cellulase of ArcC09 (FIG. 1b).

Example 3. Cellulase Purification from ArcC09

Cellulase was purified in ArcC09 using a protein precipitation method, and then a second orthogonal chromatography method was used. Proteins were collected from the culture supernatant exhibiting a specific activity of 2.3 U/mg by ammonium sulfate precipitation. Ammonium sulfate precipitation yielded 86.8% of total activity with a specific activity of 13.9 U/mg. When the ammonium sulfate precipitate was treated on a phenyl sepharose column, a peak showing cellulolytic activity was eluted with 1% isopropanol in 20 mM Tris-HCl (pH 7.0). The partially purified enzyme solution exhibited a specific activity of 17.5 U/mg in a purification fold of 7.6. After gel filtration chromatography, a total cellulase activity yield of 13.2% was obtained with a purification improvement of 10.6 fold (Table 4).

Purification steps Total protein (mg) Specific activity (U/mg) Total activity (unit) Yield (%) Purification (fold) Culture supernatant 134.0 2.3 310.0 100.0 1.0 (NH ₄ ) ₂ SO ₄ precipitation 19.4 13.9 269.2 86.8 6.0 Phenyl-Sepharose 4.4 17.5 77.0 24.8 7.6 Superdex 75 1.7 24.6 40.8 13.2 10.6

The purity of the enzyme was confirmed using SDS-PAGE in which a single protein band was observed, and the mass was estimated to be about 28 kDa through zymography (FIG. 2).

Example 4. Degradation activity and stability analysis of cellulase according to pH and temperature

Cellulolytic activity at various temperatures and pHs was analyzed using the purified enzyme, and a commercially available cellulase derived from A. niger was used as a control. Overall, the ArcC09-derived enzyme had the highest activity at 55°C and pH7, whereas the commercially available cellulase showed the greatest activity at 65°C and pH4 (Fig. 3). Specifically, the activity of ArcC09-derived purified cellulase was highest at about 55°C, and cellulose-degrading activity was rapidly decreased at 55°C or higher. The purified enzyme derived from ArcC09 showed relative activities of 10.3% (5.4 U/mg) and 36.4% (19.3 U/mg) at 5°C and 15°C, respectively, when comparing the activity at 55°C as 100%. In contrast, commercially available cellulase maintained a certain level of cellulosic activity in the temperature range tested, with an optimum temperature of 65°C. The absolute activity of the cellulase derived from ArcC09 under low temperature conditions (below 15°C) was higher than that of a commercially available enzyme (commercially available enzyme activity: 1.2 and 12.4 U/mg at 5°C and 15°C, respectively), which is It is to prove that the cellulase of the present invention is a low-temperature active enzyme that exhibits high activity at low temperature (FIG. 3).

The two types of cellulase show different properties with respect to temperature and pH stability (FIG. 4). When the ArcC09-derived cellulase was cultured at 55° C. or higher for 1 hour, the activity almost disappeared, whereas the commercially available cellulase derived from A. niger maintained 40% activity even after 1 hour incubation at 85° C. (FIG. 4a). In addition, it was confirmed that ArcC09-derived cellulase loses activity at both extremes of pH (acidic and basic), whereas commercially available cellulase derived from A. niger maintains activity up to pH 9.0 (Fig. b).

Example 5. Effect of metal ions and chemical reagents on the activity of cellulase

To evaluate the effect of metal ions and other additives on ArcC09-derived cellulase and commercial cellulase, their activity was measured under various conditions (FIG. 5). Parentheses next to each added substance indicate the relative activity when 100% is not added.

ArcC09 enzyme was found to lose most of its activity when Cu ²⁺ (7.9%) and linear alkylbenzene sulfonate (LAS) (2.7%) were added, and H ₂ O ₂ (80.8%) showed a slight decrease in activity. On the other hand, when Na ²⁺ (118.3%), Ba ²⁺ (114.8%), sodium dodecyl sulfate (SDS) (117.9%), and ethylenediaminetetraacetic acid (EDTA) (114.9%) are added, about 10 to 20% of It was confirmed that an increase in activity appeared. When Mn ²⁺ (142.9%) or Zn ²⁺ (129.1%) was added, it was confirmed that a strong activity improvement of about 29% to 43% was exhibited.

In contrast, commercially available cellulase derived from A. niger did not show a significant change when Cu ²⁺ (104%) was added, Ba ²⁺ (88.6%), Zn ²⁺ (77.6%), SDS (68.8%) , and H ₂ O ₂ When adding (76.9%), cellulosic activity was further reduced, and in the case of LAS (0%), it was confirmed that the activity completely disappeared. When Mn ²⁺ (123.0%) was added, the activity improvement was increased by about 20% (FIG. 5).

Example 6. Sequencing and Cloning of ArcC09-derived Cellulase (Endoglucanase)

AVEKLTVSGN sequence was analyzed through N-terminal sequencing, and Pseudoalteromonas sp. The sequence-matched genes from which they were derived are listed. The closest five genes were selected and PCR was performed using primers of published sequence information. The total ORF was a sequence of 1,479 bp in length starting with the ATG codon and ending with the TAA codon, and the calculated molecular weights of the total ORF and the catalytic module were 43 kDa and 29 kDa ( FIGS. 6 and 5 ).

order SEQ ID NO: Nucleic acid sequence (5'-3') catalyst module
Catalytic module GCTG TTGAGAAATT AACGGTTAGT GGTAATCAAA TTCTTGCTGG TGGTGAAAAT ACGAGCTTTG CAGGTACCAG CTTATTCTGG AGTAACACGG GGTGGGGGGC TGAAAAATTT TATACCGCAG AAACAGTAGC ACGTGCTAAG TCTGAATTTA ATGCAACATT GATTCGCGCG GCAATAGGCC ATGGGTCAAG TGCTGGTGGT AGCTTAAATT ATGACTGGGA TGGGAATATG AGCCGTCTTG ATACTGTTGT AAATGCTGCT ATTAGCGAAG ATATGTACGT TATTATTGAC TTTCATAGCC ATGAAGCACA TACAGATCAG GCTACTGCCG TTCGATTTTT TGAAGACGTA GCTACAAAGT ATGGGCAATA CGATAATGTT ATTTATGAGA TTTATAACGA GCCGTTACAA ATTTCATGGG CTAACGATAT TAAGCCTTAC GCCGAAACTG TAATTGATAA AATTAGAGCA ATCGATCCTG ATAATTTAAT TGTGGTTGGT ACACCAACAT GGTCTCAAGA CGTTGATGTG GCATCACAAG ATCCGATAGA TCGCGCCAAT ATTGCTTACA CTCTGCACTT TTATGCTGGC ACGCACGGAC AATCATATCG AAATAAAGCG CAAACAGCAC TCGACAACGG TATTGCATTG TTTGCTACAG AGTGGGGGAC AGTTAATGCT GATGGCAATG GTGGTGTTAA TGCTAATGAA ACAGATGCAT GGATGGCATT TTTTAAAACA AACAATATTA GTCACGCTAA CTGGTCTATT AATGATAAAA AC 11 full ORF ATGGATAACA GTTTAATTAA TCACAACAAA AGGAACTTTA AAGTGACGAG CTTATCGTTA GCTTTATTAT TAGGTTGTTC AACAATGGCT AATGCCGCTG TTGAGAAATT AACGGTTAGT GGTAATCAAA TTCTTGCTGG TGGTGAAAAT ACGAGCTTTG CAGGTACCAG CTTATTCTGG AGTAACACGG GGTGGGGGGC TGAAAAATTT TATACCGCAG AAACAGTAGC ACGTGCTAAG TCTGAATTTA ATGCAACATT GATTCGCGCG GCAATAGGCC ATGGGTCAAG TGCTGGTGGT AGCTTAAATT ATGACTGGGA TGGGAATATG AGCCGTCTTG ATACTGTTGT AAATGCTGCT ATTAGCGAAG ATATGTACGT TATTATTGAC TTTCATAGCC ATGAAGCACA TACAGATCAG GCTACTGCCG TTCGATTTTT TGAAGACGTA GCTACAAAGT ATGGGCAATA CGATAATGTT ATTTATGAGA TTTATAACGA GCCGTTACAA ATTTCATGGG CTAACGATAT TAAGCCTTAC GCCGAAACTG TAATTGATAA AATTAGAGCA ATCGATCCTG ATAATTTAAT TGTGGTTGGT ACACCAACAT GGTCTCAAGA CGTTGATGTG GCATCACAAG ATCCGATAGA TCGCGCCAAT ATTGCTTACA CTCTGCACTT TTATGCTGGC ACGCACGGAC AATCATATCG AAATAAAGCG CAAACAGCAC TCGACAACGG TATTGCATTG TTTGCTACAG AGTGGGGGAC AGTTAATGCT GATGGCAATG GTGGTGTTAA TGCTAATGAA ACAGATGCAT GGATGGCATT TTTTAAAACA AACAATATTA GTCACGCTAA CTGGTCTATT AATGATAAAA ACGAAGGGGC TTCGTTATTC ACCCCTGGCG GCAGTTGGAA TTCATTAACC GCTTCAGGCA CTAAAGTTAA AGAGATCATT CAAGGTTGGG GTGGCAGTAC CGTTGCTTTA GACTCTGATG GCGATGGTAT AAGTGACAGC CTTGATCAGT GTGATAATAC TCCTGCAGAT ACAGTGGTTG ATAGTATTGG TTGTGCGGTA ACTGATGCCG ATGCTGATGG TATTAGCGAT AGTGTTGATC AATGTCCAAA TACACCTGCA GGGGAAACTG TTAATGATGT GGGTTGTGCT GTTGAAGTAG TTGAACCACA AAGTGATGCG GATAATGATG GAGTGAATGA TGATATTGAT CAGTGCCCAG ATACACCCGC AGGTACAAAT GTTGATGCAA ATGGATGTAG TGTTGTGAGT TCAACCGATT GTAATGGTAT TAATACATAC CCTAATTGGG TGAAAAAGGA TTATTCGGCC GGTCCATTTA CACACAATAA CACCGACGAC AAAATACAAT ATCAAGGCAA TGCATACAGT GCAAATTGGT ATACAAACAG CCTTCCAGGA AGTGATGCTT CGTGGACGCT TCTTTATAGT TGTAATTAA 12 Amino acid sequence (N'-C') catalyst module AVEKLTVS GNQILAGGEN TSFAGTSLFW SNTGWGAEKF YTAETVARAK SEFNATLIRA AIGHGSSAGG SLNYDWDGNM SRLDTVVNAA ISEDMYVIID FHSHEAHTDQ ATAVRFFEDV ATKYGQYDNV IYEIYNEPLQ ISWANDIKPY AETVIDKIRA IDPDNLIVVG TPTWSQDVDV ASQDPIDRAN IAYTLHFYAG THGQSYRNKA QTALDNGIAL FATEWGTVNA DGNGGVNANE TDAWMAFFKT NNISHANWSI NDKN 13 full ORF MDNSLINHNK RNFKVTSLSL ALLLGCSTMA NAAVEKLTVS GNQILAGGEN TSFAGTSLFW SNTGWGAEKF YTAETVARAK SEFNATLIRA AIGHGSSAGG SLNYDWDGNM SRLDTVVNAA ISEDMYVIID FHSHEAHTDQ ATAVRFFEDV ATKYGQYDNV IYEIYNEPLQ ISWANDIKPY AETVIDKIRA IDPDNLIVVG TPTWSQDVDV ASQDPIDRAN IAYTLHFYAG THGQSYRNKA QTALDNGIAL FATEWGTVNA DGNGGVNANE TDAWMAFFKT NNISHANWSI NDKNEGASLF TPGGSWNSLT ASGTKVKEII QGWGGSTVAL DSDGDGISDS LDQCDNTPAD TVVDSIGCAV TDADADGISD SVDQCPNTPA GETVNDVGCA VEVVEPQSDA DNDGVNDDID QCPDTPAGTN VDANGCSVVS STDCNGINTY PNWVKKDYSA GPFTHNNTDD KIQYQGNAYS ANWYTNSLPG SDASWTLLYS CN 14

The catalyst module consists of amino acid sequences from 33 to 294. The catalytic module and the entire ORF domain were cloned into pET28 vector and expressed in E. coli BL21 (DE3). Expression induction of the strain was performed at 15 °C and 37 °C. The soluble fraction of the strain and the concentrated supernatant showed the band fraction of the SDS-PAGE gel. The total ORF was expressed at both 15°C and 37°C, but no bands of the estimated size were observed. On the other hand, the catalytic module showed a thick band at the expected size (Fig. 7).

The cellulosic activity of the whole ORF at 15°C or lower showed a higher Unit/mg than the 37°C condition. On the other hand, despite the very high expression rate, the catalytic module did not show activity at all temperatures (Table 6).

ORF Catalytic module 37°C soluble protein 45.29 U/mg NA 15°C soluble protein 84.24 U/mg NA 15°C sup. (x50) 150.58 U/mg NA

*NA: No Activity

As a specific part of the present invention has been described in detail above, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. will be. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

[Deposit information]

Name of deposit institution: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC14216BP

Deposit date: 20200616

<110> Korea Ocean Research & Development Institute <120> Novel Pseudoalteromonas sp. ArcC09 strain with high cellulolytic ability, the strain-derived cellulase, and its production method <130> P20-B269 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 27F primer <400> 1 agagtttgat cmtggctcag 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1492R primer <400> 2 tacggytacc ttgttacgac tt 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 518F primer <400> 3 ccagcagccg cggtaatacg 20 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 800R primer <400> 4 taccagggta tctaatcc 18 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Full endoglucanase primer (Forward) <400> 5 tttaaggaaa tacgatg 17 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Full endoglucanase primer (Reverse) <400> 6 ttactttatt aaacgcgc 18 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ORF primer (Forward) <400> 7 atggataaca gtttaattaa t 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ORF primer (Reverse) <400> 8 ttaattacaa ctataaagaa g 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Catalytic module primer (Forward) <400> 9 gctgttgaga aattaacggt t 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Catalytic module primer (Reverse) <400> 10 gtttttatca ttaatagacc a 21 <210> 11 <211> 786 <212> DNA <213> Artificial Sequence <220> <223> Catalytic module gene <400> 11 gctgttgaga aattaacggt tagtggtaat caaattcttg ctggtggtga aaatacgagc 60 tttgcaggta ccagcttatt ctggagtaac acggggtggg gggctgaaaa attttatacc 120 gcagaaacag tagcacgtgc taagtctgaa tttaatgcaa cattgattcg cgcggcaata 180 ggccatgggt caagtgctgg tggtagctta aattatgact gggatgggaa tatgagccgt 240 cttgatactg ttgtaaatgc tgctattagc gaagatatgt acgttattat tgactttcat 300 agccatgaag cacatacaga tcaggctact gccgttcgat tttttgaaga cgtagctaca 360 aagtatgggc aatacgataa tgttatttat gagatttata acgagccgtt acaaatttca 420 tgggctaacg atattaagcc tacgccgaa actgtaattg ataaaattag agcaatcgat 480 cctgataatt taattgtggt tggtacacca acatggtctc aagacgttga tgtggcatca 540 caagatccga tagatcgcgc caatattgct tacactctgc acttttatgc tggcacgcac 600 ggacaatcat atcgaaataa agcgcaaaca gcactcgaca acggtattgc attgtttgct 660 acagagtggg ggacagttaa tgctgatggc aatggtggtg ttaatgctaa tgaaacagat 720 gcatggatgg cattttttaa aacaaacaat attagtcacg ctaactggtc tattaatgat 780 aaaaac 786 <210> 12 <211> 1479 <212> DNA <213> Artificial Sequence <220> <223> Full ORF gene <400> 12 atggataaca gtttaattaa tcacaacaaa aggaacttta aagtgacgag cttatcgtta 60 gctttattat taggttgttc aacaatggct aatgccgctg ttgagaaatt aacggttagt 120 ggtaatcaaa ttcttgctgg tggtgaaaat acgagctttg caggtaccag cttattctgg 180 agtaacacgg ggtggggggc tgaaaaattt tataccgcag aaacagtagc acgtgctaag 240 tctgaattta atgcaacatt gattcgcgcg gcaataggcc atgggtcaag tgctggtggt 300 agcttaaatt atgactggga tgggaatatg agccgtcttg atactgttgt aaatgctgct 360 attagcgaag atatgtacgt tattattgac tttcatagcc atgaagcaca tacagatcag 420 gctactgccg ttcgattttt tgaagacgta gctacaaagt atgggcaata cgataatgtt 480 atttatgaga tttataacga gccgttacaa atttcatggg ctaacgatat taagccttac 540 gccgaaactg taattgataa aattagagca atcgatcctg ataatttaat tgtggttggt 600 acaccaacat ggtctcaaga cgttgatgtg gcatcacaag atccgataga tcgcgccaat 660 attgcttaca ctctgcactt ttatgctggc acgcacggac aatcatatcg aaataaagcg 720 caaacagcac tcgacaacgg tattgcattg tttgctacag agtgggggac agttaatgct 780 gatggcaatg gtggtgttaa tgctaatgaa acagatgcat ggatggcatt ttttaaaaca 840 aacaatatta gtcacgctaa ctggtctatt aatgataaaa acgaaggggc ttcgttattc 900 acccctggcg gcagttggaa ttcattaacc gcttcaggca ctaaagttaa agagatcatt 960 caaggttggg gtggcagtac cgttgcttta gactctgatg gcgatggtat aagtgacagc 1020 cttgatcagt gtgataatac tcctgcagat acagtggttg atagtattgg ttgtgcggta 1080 actgatgccg atgctgatgg tattagcgat agtgttgatc aatgtccaaa tacacctgca 1140 ggggaaactg ttaatgatgt gggttgtgct gttgaagtag ttgaaccaca aagtgatgcg 1200 gataatgatg gagtgaatga tgatattgat cagtgcccag atacacccgc aggtacaaat 1260 gttgatgcaa atggatgtag tgttgtgagt tcaaccgatt gtaatggtat taatacatac 1320 cctaattggg tgaaaaagga ttattcggcc ggtccattta cacacaataa caccgacgac 1380 aaaatacaat atcaaggcaa tgcatacagt gcaaattggt atacaaacag ccttccagga 1440 agtgatgctt cgtggacgct tctttatagt tgtaattaa 1479 <210> 13 <211> 262 <212> PRT <213> Artificial Sequence <220> <223> catalytic module-amino acid <400> 13 Ala Val Glu Lys Leu Thr Val Ser Gly Asn Gln Ile Leu Ala Gly Gly 1 5 10 15 Glu Asn Thr Ser Phe Ala Gly Thr Ser Leu Phe Trp Ser Asn Thr Gly 20 25 30 Trp Gly Ala Glu Lys Phe Tyr Thr Ala Glu Thr Val Ala Arg Ala Lys 35 40 45 Ser Glu Phe Asn Ala Thr Leu Ile Arg Ala Ala Ile Gly His Gly Ser 50 55 60 Ser Ala Gly Gly Ser Leu Asn Tyr Asp Trp Asp Gly Asn Met Ser Arg 65 70 75 80 Leu Asp Thr Val Val Asn Ala Ala Ile Ser Glu Asp Met Tyr Val Ile 85 90 95 Ile Asp Phe His Ser His Glu Ala His Thr Asp Gln Ala Thr Ala Val 100 105 110 Arg Phe Phe Glu Asp Val Ala Thr Lys Tyr Gly Gln Tyr Asp Asn Val 115 120 125 Ile Tyr Glu Ile Tyr Asn Glu Pro Leu Gln Ile Ser Trp Ala Asn Asp 130 135 140 Ile Lys Pro Tyr Ala Glu Thr Val Ile Asp Lys Ile Arg Ala Ile Asp 145 150 155 160 Pro Asp Asn Leu Ile Val Val Gly Thr Pro Thr Trp Ser Gln Asp Val 165 170 175 Asp Val Ala Ser Gln Asp Pro Ile Asp Arg Ala Asn Ile Ala Tyr Thr 180 185 190 Leu His Phe Tyr Ala Gly Thr His Gly Gln Ser Tyr Arg Asn Lys Ala 195 200 205 Gln Thr Ala Leu Asp Asn Gly Ile Ala Leu Phe Ala Thr Glu Trp Gly 210 215 220 Thr Val Asn Ala Asp Gly Asn Gly Gly Val Asn Ala Asn Glu Thr Asp 225 230 235 240 Ala Trp Met Ala Phe Phe Lys Thr Asn Asn Ile Ser His Ala Asn Trp 245 250 255 Ser Ile Asn Asp Lys Asn 260 <210> 14 <211> 492 <212> PRT <213> Artificial Sequence <220> <223> Full ORF-amino acid <400> 14 Met Asp Asn Ser Leu Ile Asn His Asn Lys Arg Asn Phe Lys Val Thr 1 5 10 15 Ser Leu Ser Leu Ala Leu Leu Leu Gly Cys Ser Thr Met Ala Asn Ala 20 25 30 Ala Val Glu Lys Leu Thr Val Ser Gly Asn Gln Ile Leu Ala Gly Gly 35 40 45 Glu Asn Thr Ser Phe Ala Gly Thr Ser Leu Phe Trp Ser Asn Thr Gly 50 55 60 Trp Gly Ala Glu Lys Phe Tyr Thr Ala Glu Thr Val Ala Arg Ala Lys 65 70 75 80 Ser Glu Phe Asn Ala Thr Leu Ile Arg Ala Ala Ile Gly His Gly Ser 85 90 95 Ser Ala Gly Gly Ser Leu Asn Tyr Asp Trp Asp Gly Asn Met Ser Arg 100 105 110 Leu Asp Thr Val Val Asn Ala Ala Ile Ser Glu Asp Met Tyr Val Ile 115 120 125 Ile Asp Phe His Ser His Glu Ala His Thr Asp Gln Ala Thr Ala Val 130 135 140 Arg Phe Phe Glu Asp Val Ala Thr Lys Tyr Gly Gln Tyr Asp Asn Val 145 150 155 160 Ile Tyr Glu Ile Tyr Asn Glu Pro Leu Gln Ile Ser Trp Ala Asn Asp 165 170 175 Ile Lys Pro Tyr Ala Glu Thr Val Ile Asp Lys Ile Arg Ala Ile Asp 180 185 190 Pro Asp Asn Leu Ile Val Val Gly Thr Pro Thr Trp Ser Gln Asp Val 195 200 205 Asp Val Ala Ser Gln Asp Pro Ile Asp Arg Ala Asn Ile Ala Tyr Thr 210 215 220 Leu His Phe Tyr Ala Gly Thr His Gly Gln Ser Tyr Arg Asn Lys Ala 225 230 235 240 Gln Thr Ala Leu Asp Asn Gly Ile Ala Leu Phe Ala Thr Glu Trp Gly 245 250 255 Thr Val Asn Ala Asp Gly Asn Gly Gly Val Asn Ala Asn Glu Thr Asp 260 265 270 Ala Trp Met Ala Phe Phe Lys Thr Asn Asn Ile Ser His Ala Asn Trp 275 280 285 Ser Ile Asn Asp Lys Asn Glu Gly Ala Ser Leu Phe Thr Pro Gly Gly 290 295 300 Ser Trp Asn Ser Leu Thr Ala Ser Gly Thr Lys Val Lys Glu Ile Ile 305 310 315 320 Gln Gly Trp Gly Gly Ser Thr Val Ala Leu Asp Ser Asp Gly Asp Gly 325 330 335 Ile Ser Asp Ser Leu Asp Gln Cys Asp Asn Thr Pro Ala Asp Thr Val 340 345 350 Val Asp Ser Ile Gly Cys Ala Val Thr Asp Ala Asp Ala Asp Gly Ile 355 360 365 Ser Asp Ser Val Asp Gln Cys Pro Asn Thr Pro Ala Gly Glu Thr Val 370 375 380 Asn Asp Val Gly Cys Ala Val Glu Val Val Glu Pro Gln Ser Asp Ala 385 390 395 400 Asp Asn Asp Gly Val Asn Asp Asp Ile Asp Gln Cys Pro Asp Thr Pro 405 410 415 Ala Gly Thr Asn Val Asp Ala Asn Gly Cys Ser Val Val Ser Ser Thr 420 425 430 Asp Cys Asn Gly Ile Asn Thr Tyr Pro Asn Trp Val Lys Lys Asp Tyr 435 440 445 Ser Ala Gly Pro Phe Thr His Asn Asn Thr Asp Asp Lys Ile Gln Tyr 450 455 460 Gln Gly Asn Ala Tyr Ser Ala Asn Trp Tyr Thr Asn Ser Leu Pro Gly 465 470 475 480 Ser Asp Ala Ser Trp Thr Leu Leu Tyr Ser Cys Asn 485 490

Claims (13)

Pseudoalteromonas sp. ArcC09 strain deposited with accession number KCTC 14216BP.
Cellulase Accession No. KCTC 14216BP Pseudoalteromonas ( Pseudoalteromonas sp.) Low-temperature active cellulase, characterized in that derived from the ArcC09 strain.
The low-temperature-active cellulase according to claim 2, wherein the low-temperature active cellulase is represented by the amino acid sequence of SEQ ID NO: 14.
A nucleic acid encoding the low temperature active cellulase of claim 2 .
A recombinant vector into which the nucleic acid of claim 4 is introduced.
A recombinant host cell into which the nucleic acid of claim 4 or the recombinant vector of claim 5 is introduced.
A method for producing cellulase comprising the steps of:
(a) generating cellulase by culturing the Pseudoalteromonas sp. ArcC09 strain deposited with accession number KCTC 14216BP or the recombinant host cell of claim 6;
(b) recovering the produced cellulase.
The method according to claim 7, wherein the cellulase is represented by the amino acid sequence of SEQ ID NO: 14.
The method according to claim 7, wherein in step (a), the cellulase is produced by culturing the recombinant host cell of claim 6 at a low temperature of 10 to 25°C.
Pseudoalteromonas sp. ArcC09 strain deposited with accession number KCTC 14216BP, the culture solution of the strain, the concentrate of the culture solution, the dried product of the culture solution, the extract of the culture solution, the cellulase derived from the strain, and the production method of claim 7 A composition for hydrolysis of cellulose comprising any one or more of the produced cellulase as an active ingredient.
11. The composition of claim 10, wherein the composition further comprises a metal ion.
The composition of claim 11, wherein the metal ion further comprises any one or more metal ions selected from the group consisting of Na ²⁺ , Ba ²⁺ , Mn ²⁺ , and Zn ²⁺ .
11. The composition of claim 10, further comprising SDS or EDTA.

Images