KR20220065611A - A transgenic plant in which cellulose synthase-like gene Solyc07g043390 is overexpressed with increased tolerance to tomato yellow leaf curl disease - Google Patents

Abstract

The present invention relates to a transgenic plant in which cellulose synthesis gene Solyc07g043390 is overexpressed with increased tolerance to tomato yellow leaf curl virus disease, and provides a transgenic plant which has overexpressed Solyc07g043390 to exhibit an inhibitory effect on leaf curling symptoms, leaf yellowing symptoms, plant atrophy symptoms, leaf size reduction symptoms, fruit yield reduction symptoms and/or fruit size reduction symptoms, seeds thereof, and a method for producing the plant.

Description

A transgenic plant in which cellulose synthase-like gene Solyc07g043390 is overexpressed with increased tolerance to tomato yellow leaf curl disease}

The present invention relates to a transgenic plant with enhanced resistance to tomato yellow leaf curl virus disease in which the cellulose synthesis gene Solyc07g043390 is overexpressed. , It provides a transgenic plant exhibiting an inhibitory effect on the symptom of a decrease in fruit yield and/or a symptom of a decrease in fruit size, a seed thereof, and a method for producing the plant.

Tomato yellow leaf curl virus (TYLCV) belongs to the genus Geminiviridae and Begomovirus, and the virus particles are double spherical with a diameter of 25 nm. It is a virus transmitted by tobacco powdery mildew, and it is a virus that is causing a problem in solanaceae crops such as tomatoes in 58 countries around the world. TYLCV was first confirmed in Korea in May 2008 in tomatoes grown in facilities in Tongyeong, Gyeongsangnam-do. The symptoms of TYLCV are the yellowing of the tomato leaf edge, the shriveling upward and smaller, and the atrophy and growth of the entire plant.

Accordingly, resistant varieties are being developed as breeding based on the resistance gene for TYLCV, but due to the frequent appearance of mutations due to the nature of the virus, the resistance of previously developed resistant tomato varieties is being overcome in a short period of time.

In the present invention, by overexpressing the cellulose synthesis gene Solyc07g043390, one of the genes whose expression is significantly reduced during TYLCV infection, in tomatoes, the effect of improving disease resistance through alleviation of symptoms caused by the virus was demonstrated.

The present invention has been devised to solve the above problems, and an object of the present invention is to provide a transgenic plant and seeds thereof with improved resistance to tomato yellow leaf curl virus disease using the cellulose synthesis gene Solyc07g043390.

Another object of the present invention is to provide a method for producing the above-described transgenic plant.

In order to solve the above problems, the present invention provides a transgenic plant with enhanced resistance to tomato yellow leaf curl virus disease in which the cellulose synthesis gene Solyc07g043390 is overexpressed.

According to a preferred embodiment of the present invention, the cellulose synthesis gene Solyc07g043390 may be derived from tomatoes.

According to another preferred embodiment of the present invention, the tomato-derived cellulose synthesis gene Solyc07g043390 may consist of the nucleotide sequence of SEQ ID NO: 1.

According to another preferred embodiment of the present invention, the transgenic plant is a kanamycin resistance selection gene containing a tomato-derived cellulose synthesis gene Solyc07g043390 and a cauliflower mosaic virus (CaMV) 35S promoter. Plant cells are transformed with the pBl121 vector. It can be prepared by performing the conversion step.

According to another preferred embodiment of the present invention, the plant may be a host plant of tomato yellow leaf curl virus.

According to another preferred embodiment of the present invention, the host plant of the tomato yellow leaf curl virus may be a tomato.

According to another preferred embodiment of the present invention, resistance to the tomato yellow leaf curl virus disease may exhibit any one or more characteristics selected from the group consisting of the following a) to f):

a) suppression of leaf curl symptoms; b) suppression of yellowing symptoms of leaves; c) suppression of symptoms of plant atrophy; d) suppression of leaf size reduction symptoms; e) suppression of symptoms of reduced fruit yield; and f) suppressing the symptoms of fruit size reduction.

The present invention also provides a seed of the aforementioned transgenic plant.

Furthermore, the present invention provides a method for producing a transgenic plant with improved resistance to tomato yellow leaf curl virus disease, comprising the following steps:

a) transforming plant cells with a pBl121 vector having a kanamycin resistance selection gene and a cauliflower mosaic virus (CaMV) 35S promoter, which includes the tomato-derived cellulose synthesis gene Solyc07g043390; and

b) redifferentiating the plant from the transformed plant cell.

The transgenic plant overexpressing the Solyc07g043390 gene according to the present invention has leaf curl symptoms, yellow leaf yellowing symptoms, plant atrophy symptoms, leaf size reduction symptoms, fruit yield reduction symptoms, and/or fruit size reduction due to tomato yellow leaf curl virus infection. Symptoms are suppressed, indicating enhanced resistance to tomato yellow leaf curl virus disease. Accordingly, it is possible to contribute to the increase in tomato productivity by developing tomato varieties having disease resistance or resistance to tomato yellow leaf curl virus disease overexpressing the Solyc07g043390 gene.

1 shows a schematic diagram of a vector (pBI121m) used for producing a transgenic tomato in which the Solyc07g043390 gene is overexpressed and a clone (pBI121m-Solyc07g043390) for the Solyc07g043390 gene overexpression.
2 is a photograph showing the phenotype of the Solyc07g043390 gene overexpression transgenic tomato T2 generation (OE#1 and OE#2).
3 shows the results of qRT-PCR analysis of the relative expression level of the Solyc07g043390 gene in the Solyc07g043390 gene overexpression transgenic tomato T2 generation (OE#1 and OE#2).
Figure 4a is a photograph comparing the systemic symptoms according to TYLCV infection of Solyc07g043390 gene overexpression transgenic tomato (OE#1) and non-transformed tomato (NT).
Figure 4b is a photograph comparing the symptoms in the leaves according to TYLCV infection of Solyc07g043390 gene overexpression transgenic tomato (OE#1) and non-transformed tomato (NT).
4c is a graph showing the results of qRT-PCR analysis of the Solyc07g043390 gene expression level according to TYLCV infection of Solyc07g043390 gene overexpression transgenic tomato (OE#1) and non-transgenic tomato (NT).
4D is a graph showing the results of qPCR analysis of TYLCV accumulation according to TYLCV infection of Solyc07g043390 gene overexpression transgenic tomato (OE#1) and non-transgenic tomato (NT).
4e is a graph showing the results of plant growth analysis according to TYLCV infection of Solyc07g043390 gene overexpression transgenic tomato (OE#1) and non-transformed tomato (NT).
4f is a graph showing the results of analysis of the fruit yield according to TYLCV infection of Solyc07g043390 gene overexpression transgenic tomatoes (OE#1) and non-transgenic tomatoes (NT).
4G is a graph showing the results of analysis of fruit size according to TYLCV infection of Solyc07g043390 gene overexpression transgenic tomatoes (OE#1) and non-transgenic tomatoes (NT).

As described above, resistant varieties are being developed as breeding based on the resistance gene for TYLCV, but due to the frequent appearance of mutations due to the nature of the virus, the resistance of the previously developed resistant tomato varieties is being overcome in a short period of time. Accordingly, the present inventors confirmed that tomatoes overexpressing the cellulose synthesis gene Solyc07g043390, one of the genes whose expression is significantly reduced during TYLCV infection, exhibits enhanced disease resistance to the symptoms caused by TYLCV infection, and provided a transgenic tomato using the same By doing so, a solution to the above-mentioned problem was sought.

Accordingly, the first aspect of the present invention relates to a transgenic plant with enhanced resistance to tomato yellow leaf curl virus disease in which the cellulose synthesis gene Solyc07g043390 is overexpressed.

In the transgenic plant of the present invention, the cellulose synthesis gene Solyc07g043390 may be derived from tomato.

In the transgenic plant according to an embodiment of the present invention, the Solyc07g043390 gene was amplified and used from the tomato variety Ailsa Craig, and the specific nucleotide sequence is as follows:

TGAAAGAGCAAGAGAGGGGAGAGGGAGTGCAGAGAGAAACCACACCATGAAAAAAACCATGGAGCTCAACAAAAGCACTGTTCCACAACCTATCACCACCGTATACCGACTCCACATGTTCATCCACTCAATAATCATGCTTGCATTAATATACTACCGTGTATCTAATTTGTTTAAATTCGAAAACATTCTCAGTTTACAAGCACTTGCTTGGGCGCTCATCACTTTTGGTGAATTTAGTTTCATTCTCAAGTGGTTCTTCGGACAAGGTACTCGTTGGCGCCCCGTTGAACGAGATGTTTTCCCTGAAAACATTACTTGCAAAGATTCCGATCTACCGCCAATTGACGTAATGGTATTCACTGCCAATCCTAAGAAAGAGCCAATTGTAGATGTCATGAACACTGTGATATCCGCAATGGCTCTTGATTATCCCACCGATAAATTGGCTGTGTATCTCGCTGATGATGGAGGATGTCCATTGTCGTTGTACGCCATGGAACAAGCGTGTTTGTTTGCAAAGCTATGGTTACCTTTCTGTAGAAACTATGGAATTAAAACGAGATGCCCAAAAGCATTTTTTTCTCCGTTAGGAGATGATGACCGTGTTCTTAAGAATGATGATTTTGCTGCTGAAATGAAAGAAATTAAATTGAAATATGAAGAGTTCCAGCAGAAGGTGGAACATGCTGGTGAATCTGGAAAAATCAATGGTAACGTAGTGCCTGATAGAGCTTCGCTTATTAAGGTAATAAACGAGAGGGAGAACGAAAAGAGTGTGGATGATATGACGAAAATGCCCTTGCTAGTTTATGTATCCCGTGAAAGAAGATTCAACCGTCTTCATCATTTCAAGGGTGGATCTGCAAATGCTCTACTTCGAGTTTCTGGAATAATGAGTAATGCCCCCTATGTACTGGTGTTAGATTGTGATTTCTTCTGTCATGATCCAATATCAGCTAGGAAGGCAATGTGTTTTCATCTTGATCCAAAGCTATCA TCTGATTTAGCCTATGTTCAGTTCCCTCAAGTCTTTTACAATGTCAGCAAGTCAGATATTTATGATGTCAAAATTAGACAGGCTTACAAGACAATATGGCATGGAATGGATGGTATCCAAGGCCCAGTGTTATCTGGGACTGGTTATTTTCTCAAGAGGAAAGCGTTATACACAAGTCCAGGAGTAAAAGAGGCGTATCTTAGTTCACCGGAAAAGCATTTTGGAAGGAGTAAAAGGTTTCTTGCTTCATTAGAGGAGAAAAATGGTTATGTTAAGGCAGATAAAGTCATATCAGAAGATATCATAGAGGAAGCTAAGATGTTAGCTACTTGTGCATATGAGGATGGCACACATTGGGGTCAAGAGATTGGTTATTCATACGATTGTCATTTGGAGAGCACTTTTACTGGTTATCTATTACACTGCAAAGGGTGGACATCTACTTATTTGTATCCAGACAGGCCATCTTTCTTGGGTTGTGCCCCAGTTGATATGCAAGGTTTCTCATCACAGCTCATCAAATGGGTTGCTGCACTTACACAAGCTGGTTTATCACATCTCAATCCCATCACTTATGGTTTGAGTAGTAGGATGAGGACTCTCCAATGCATGTGCTATGCCTATTTGATGTATTTCACTCTTTATTCTTGGGGAATGGTTATGTATGCTAGTGTTCCTTCTATTGGCCTTTTGTTTGACTTCCAAGTCTATCCTGAGGTACATGATCCGTGGTTTGCAGTGTATGTGATTGCTTTCATATCGACAATTTTGGAGAATATGTCGGAGTCAATTCCAGAAGGGGGATCAGTTAAAACGTGGTGGATGGAATACAGGGCATTGATGATGATGGGAGTTAGCGCAATATGGTTAGGAGGATTGAAAGCTATATATGACAAGATAGTCGGAACACAAGGAGAGAAATTGTATTTGTCGGACAAGGCAATTGACAAGGAAAAGCTCAAGAAATACGAGAAGGGCAAATTTGATTTCCAAGGAATAG GGATACTTGCTCTGCCACTGATAGCATTTTCCGTGTTGAACCTCGTAGGCTTCATTGTTGGAGCTAATCATGTCTTTATTACTATGAACTACGCAGGCGTGCTGGGCCAACTCCTCGTATCATCGTTCTTCGTCTTTGTTGTCGTCACTGTTGTCATTGATGTTGTATCTTTCTTAAAGGTTTCTTAAACATCATTATGTAATTCTCTAGTATTTAGACAGACCTACTATGTTTATCTCTCTTCAATAATAAGGCCTTCCGTCGAATTATTCAATGAAACAAAATTGTCTCTTTTGTCCCCCCTTTTGA (서열번호 1)

Variants of the nucleotide sequence are also included within the scope of the present invention. Specifically, the gene is 70% or more, preferably 80% or more, more preferably 90% or more, even more preferably 95% or more, and most preferably 99% or more of the nucleotide sequence of SEQ ID NO: 1. As long as it can express a protein having substantially the same activity as Solyc07g043390 as a nucleotide sequence showing homology, it may be included without limitation.

The transgenic plant of the present invention can be prepared by performing the step of transforming plant cells with the recombinant vector containing the Solyc07g043390 gene.

In the present invention, the term "vector" refers to a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the target protein operably linked to a suitable regulatory sequence so that the target protein can be expressed in a suitable host.

After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself. In the present invention, a vector means a bacterial plasmid, phage, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector, and generally any plasmid and Vectors can be used without restrictions. An important characteristic of the vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.

An expression vector including the Solyc07g043390 gene sequence and appropriate transcription/translation control signals can be constructed by methods well known to those skilled in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology. The DNA sequence can be effectively linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector may also include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a part of itself, the so-called T-region, into a plant cell when present in a suitable host such as Agrobacterium tumefaciens. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences into plant cells, or protoplasts from which new plants can be produced that properly insert the hybrid DNA into the genome of the plant and there is. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors such as those that can be derived from double-stranded plant viruses (eg CaMV) and single-stranded viruses, gemini viruses, etc. For example, it may be selected from an incomplete plant viral vector. The use of such vectors can be advantageous, especially when it is difficult to adequately transform a plant host.

In the present invention, "transformation" means introducing a vector including a polynucleotide encoding a target protein into a plant so that the protein encoded by the polynucleotide can be expressed in the plant. As long as the transformed polynucleotide can be expressed in a plant, it may include all of them regardless of whether it is inserted into the chromosome of the plant or located outside the chromosome. In addition, the polynucleotide includes DNA and RNA encoding a target protein. As long as the polynucleotide can be introduced and expressed into a plant, it does not matter which form is introduced. For example, the polynucleotide may be introduced into a plant in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression. The expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a plant in its own form and operably linked to a sequence required for expression in the plant, but is not limited thereto. The target protein is specifically a cellulose synthase family protein encoded by Solyc07g043390.

The expression vector preferably comprises one or more selectable markers. The marker is a nucleic acid sequence having a characteristic that can be selected by a conventional chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, Bleomycin, hygromycin, chloramphenicol resistance gene, aadA gene, and the like, but is not limited thereto.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, histone promoter, or Clp promoter, but is not limited thereto. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in a plant cell. A “constitutive promoter” is a promoter that is active under most environmental conditions and developmental states or cell differentiation. Constitutive promoters may be preferred in the present invention since the selection of transformants may be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In the recombinant vector of the present invention, a conventional terminator may be used, for example, nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens) ) of octopine (Octopine) gene terminator, E. coli rrnB1/B2 terminator, etc., but is not limited thereto.

The transgenic plant according to a preferred embodiment of the present invention comprises a tomato-derived cellulose synthesis gene Solyc07g043390, a kanamycin resistance selection gene and a cauliflower mosaic virus (CaMV) 35S promoter. The step of transforming the plant cells with pBl121 vector produced by performing The transformation may be mediated by, for example, Agrobacterium tumefiaciens.

Methods for injecting the vector of the present invention into host cells include microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene Bombardment.

More specifically, when a binary vector is used, Agrobacterium is used as a transformation strain for introducing the recombinant vector into a plant (Agrobacterium-mediated transformation), and at this time, Agrobacterium tumefaciens (Agrobacterium tumefaciens) ) or Agrobacterium rhizogenes can be used.

In the case of using a vector that does not contain a T-DNA region, electroporation, microparticle bombardment, polyethylene glycol-mediated uptake, etc. are used to introduce the recombinant plasmid into the plant. can be

The transgenic plant according to a preferred embodiment of the present invention is prepared by further performing the step of redifferentiating the transgenic plant from the transformed plant cells. Any method known in the art may be used for a method of redifferentiating a transgenic plant from a transgenic plant cell.

Transformed plant cells must be redifferentiated into whole plants. Techniques for the redifferentiation of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989 Momillan, N.Y.).

In the present invention, the term "plant" may be used interchangeably with "plant" or "crop", and includes whole plants, vegetative organs/structures (leaf, stem and tuber), roots, flowers and floral organs/structures (e.g. For example, bracts, calyxes, petals, stamens, carpels, anthers and ovules), seeds (pears, endosperm and seed coat), fruits, plant tissues (vascular tissue, basic tissue) and plant cells (guard cells, egg cells, etc.) may be doing Specifically, in the present invention, the plant may be a host plant of tomato yellow leaf curl virus, preferably a tomato.

In a transgenic plant overexpressing Solyc07g043390 according to a preferred embodiment of the present invention, at least about 5 times, preferably about 6.3 times, of the Solyc07g043390 gene is overexpressed during TYLCV infection compared to a non-transgenic plant, so that tomato yellow leaf curl virus disease indicates disease resistance.

As can be seen in Figure 4d, the accumulation of TYLCV according to TYLCV infection of Solyc07g043390 overexpressing transgenic tomato and non-transformed tomato showed similar levels to each other, indicating that there is no difference in the degree of virus proliferation. However, as a result of analyzing systemic symptoms, leaf symptoms, plant growth, fruit yield, and fruit size according to TYLCV infection, as shown in FIGS. 4A, 4B, and 4E to 4G, Solyc07g043390 overexpressing transgenic tomatoes were non-transgenic It can be seen that the symptoms of atrophy, leaf size reduction, leaf curling and yellowing of leaves were remarkably reduced, and the fruit size and yield were significantly increased compared to the converted tomato. As a result, it can be seen that, although overexpression of Solyc07g043390 did not inhibit the proliferation of TYLCV, it effectively suppressed symptoms caused by viral infection, thereby improving disease resistance.

A second aspect of the present invention relates to a seed of a transgenic plant in which the above-described cellulose synthesis gene Solyc07g043390 is overexpressed.

The seeds of the transgenic plant overexpressing Solyc07g043390 gene according to a preferred embodiment of the present invention can be specifically obtained by the following method:

a) Agrobacterium tumafaciens LBA4404 is transformed with the pBl121 vector having a kanamycin resistance selection gene and a cauliflower mosaic virus (CaMV) 35S promoter, including the tomato-derived cellulose synthesis gene Solyc07g043390.

b) After immersing the tomato cotyledon slices in the culture medium for transformation for 2 hours, symbiotic culture in MS medium for two days, transfer to kanamycin medium, and inducing callus formation. The formed callus is sequentially cultured in a stem induction medium and a root induction medium according to a tissue culture method to form an individual and transplanted into soil to obtain a first-generation seed.

c) Germination of first-generation seeds to analyze the expression level of the target gene, and obtain second-generation seeds from individuals with high expression levels.

A third aspect of the present invention relates to a method for producing a transgenic plant with enhanced resistance to tomato yellow leaf curl virus disease.

Specifically, the manufacturing method may include the following steps:

a) transforming plant cells with a pBl121 vector having a kanamycin resistance selection gene and a cauliflower mosaic virus (CaMV) 35S promoter, which includes the tomato-derived cellulose synthesis gene Solyc07g043390; and

b) redifferentiating the plant from the transformed plant cell.

In the method for producing a transgenic plant with enhanced resistance to tomato yellow leaf curl virus disease of the present invention, the specific descriptions of steps a) and b) are the same as those described in the first aspect of the present invention, omit the description.

Hereinafter, the present invention will be described in more detail through examples. However, since the present invention may have various changes and may have various forms, the specific examples and descriptions described below are only for helping the understanding of the present invention, and are intended to limit the present invention to specific disclosed forms. it is not It should be understood that the scope of the present invention includes all modifications, equivalents and substitutes included in the spirit and scope of the present invention.

Solyc07g043390 overexpression transgenic tomato production

1-1. Solyc07g043390 gene cloning

The pBI121m vector was used as a binary vector for transformation of Solyc07g043390 overexpressed tomato ( FIG. 1A ). pBI121m vector contains multiple cloning sites (MCS; XbaI, KpnI, SacI) and NOS terminator (NOSt) under the LB (left border) and RB (right border) of T-DNA and the 35S promoter (P35S) of CaMV, Neomycin phosphotransferase (neomycin phosphotransferase II, NPTII) gene expression under the NOS promoter (Pnos) can confer resistance to kanamycin, and can be used for Agrobacterium-mediated plant transformation.

The Solyc07g043390 gene was PCR amplified from tomato variety Ailsa Craig using High-Fidelity DNA Polymerase (NEB, USA) and the primer pair shown in Table 1. The nucleotide sequence of the Solyc07g043390 gene is as shown in SEQ ID NO: 1. The amplified gene fragment was cloned using the XbaI and KpnI restriction enzyme sites of the pBI121m vector (ThermoFisher, USA). The produced clone was named pBI121-Solyc07g043390 (FIG. 1).

Primer name sequence (5'→3') SEQ ID NO: 3390-Fw-XbaI GCTCTAGATGAAAGAGCAAGAGAGGGGA 2 3390-Rv-KpnI CAGAGGTACCTTAAGAAACCTTTAAGAAAGATACA 3

1-2. Agrobacterium-mediated penetration

After transforming the clone pBI121-Solyc07g043390 prepared in Example 1-1 into Agrobacterium strain LBA4404 by freeze-thaw method, LB agar containing kanamycin (100 μg/μl) Sorted on a Luria Bertani agar plate (1.5%) at 28° C. for two days.

1-3. Solyc07g043390 overexpression transgenic tomato production

The selected strain was transformed into tomatoes of the Ailsa Craig variety. For the preparation of transgenic plants, a known Agrobacterial transformation method (Tomato Transformation; Cold Spring Harb. Protoc.; 2008; doi: 10.1101/pdb.prot5084) was used. Cotyledon leaf sections of tomatoes grown under sterile conditions were immersed in a suspension of pBI121-Solyc07g043390-transformed Agrobacterium strain for 2 hours, then drained and transferred to MS medium for symbiotic culture for two days. Cotyledon slices were transferred to kanamycin MS medium to induce callus formation. The formed callus was sequentially cultured in a stem induction medium and a root induction medium according to a tissue culture method to form an individual and transplanted into soil to obtain a first-generation seed. The first-generation seeds were germinated, the expression level of the target gene was analyzed, and second-generation seeds were obtained from individuals with high expression levels. T2 generations (OE #1 and OE #2) that were homologously transformed by germination of second-generation seeds were selected, and subsequent experiments were performed on these plants.

1-4. Solyc07g043390 gene expression level analysis

In order to quantitatively analyze the expression level of the Solyc07g043390 gene in the transgenic tomato (OE#1) obtained in Example 1-3, qRT-PCR was performed as follows.

Total RNA was isolated from the leaves of 4-5 internodes from the lower part of the plant using a PureLink RNA mini kit (Invitrogen, USA) and treated with DNase I (NEB, UK). First strand cDNA was synthesized from 1 μg of total RNA using M-MulV reverse transcriptase (NEB, USA). Total RNA was denatured with 10 μM reverse primer at 65° C. for 5 min. The reverse transcription reaction was incubated at 42° C. for 1 hour. qRT-PCR was performed in a reaction volume of 20 μl (2 μl of diluted cDNA, 10 μl of real-time mix, 1 μl 20X EvaGreen and 1 μM of primer pair) using a 2X real-time PCR smart mix (Solgent, Korea). , primer information is shown in Table 2. All qRT-PCR reactions were performed in triplicate, and data were normalized using β-actin as a reference gene.

Primer name sequence (5'→3') SEQ ID NO: 3390-1390-Fw-qRT ACATTGGGGTCAAGAGGCAA 4 3390-1529-Rv-qRT TGGGGCACAACCCAAGAAAG 5 SlACT-Fw-qRT GGGATGGAGAAGTTTGGTGGTGG 6 SlACT-Rv-qRT CTTCGACCAAGGGATGGTGTAGC 7

As a result of the analysis, as shown in FIG. 3 , it was confirmed that the Solyc07g043390 gene was overexpressed by about 1.5 times compared to the non-transgenic (NT) control.

TYLCV disease resistance improvement effect of Solyc07g043390 overexpressed transgenic tomato

TYLCV was inoculated into T2 generation transgenic tomatoes (OE#1) in order to test the effect of improving the disease resistance of Solyc07g043390 overexpressing transgenic tomatoes against TYLCV. The intensity of symptoms after virus inoculation, the relative expression level of the Solyc07g043390 gene, the degree of virus proliferation (TYLCV accumulation), plant growth, fruit size and yield, etc. were compared and analyzed with the control group, and the analysis results are shown in FIGS. 4A to 4G .

4a is a comparison of systemic symptoms according to TYLCV infection of Solyc07g043390 overexpressed transgenic tomato (OE #1) and non-transgenic tomato (NT). In the case of NT tomato, severe atrophy symptoms appeared, whereas Solyc07g043390 overexpressing transgenic tomato was It was confirmed that even after TYLCV infection, symptoms of overall atrophy of the plant did not appear. Figure 4b is a comparison of the symptoms in the leaves, in the case of NT tomatoes, severe leaf size reduction, leaf curling, and yellowing of leaves after TYLCV infection, whereas the Solyc07g043390 overexpressing transgenic tomato almost reduced the leaf size even after TYLCV infection. It was confirmed that the yellowing of the leaves and the curling of the leaves also appeared at a very weak level compared to the NT tomatoes.

Figure 4c compares the results of qRT-PCR analysis of the expression level of Solyc07g043390. qRT-PCR was performed in the same manner as in Examples 1-4. As a result of the analysis, the expression level of Solyc07g043390 significantly decreased after TYLCV infection in NT tomatoes, but the expression level of Solyc07g043390 overexpression in Solyc07g043390 transgenic tomatoes was similar to that of uninfected NT tomatoes (NT healthy).

Figure 4d compares the results of qPCR analysis for TYLCV accumulation. To detect TYLCV accumulation, TYLCV DNA was PCR amplified using Q5 DNA polymerase (NEB, UK) and primers. PCR amplification was carried out at 95°C, 3 minutes after denaturation, at 95°C, 30 seconds; 58° C., 30 seconds; and 72° C., 35 cycles of 30 seconds. Primer information is shown in Table 3. Gene expression was determined with the AriaMX real-time PCR system (Agilent, USA).

Primer name sequence (5'→3') SEQ ID NO: TYLCV-Fw GGATTTCGTTGTATGTTAGC 8 TYLCV-Rv ATGATTATATCGCCTGGTC 9

As a result of the analysis, as confirmed in FIG. 4d, NT tomato and Solyc07g043390 overexpressing transgenic tomato did not show a significant difference in the degree of virus proliferation during TYLCV infection.

4e is a comparison of plant growth, and in the case of NT tomatoes, plant growth was significantly reduced after TYLCV infection, but Solyc07g043390 overexpressing transgenic tomatoes showed little decrease in plant growth even after TYLCV infection.

4f and 4g are a comparison of tomato yield and size. In the case of NT tomatoes, both yield and size were significantly reduced after TYLCV infection, but Solyc07g043390 overexpressing transgenic tomatoes were similar to non-infected individuals (OE#1 healthy) even after TYLCV infection. Levels of fruit yield and size are indicated.

In summary, it was confirmed that, although overexpression of Solyc07g043390 did not inhibit virus proliferation, the effect of improving disease resistance was induced through suppression of symptoms.

SEQUENCE LISTING <110> Seoul National University R&DB Foundation <120> A transgenic plant in which cellulose synthase-like gene Solyc07g043390 is overexpressed with increased tolerance to tomato yellow leaf curl disease <130> 1068134 <160> 9 <170> PatentIn version 3.2 <210> 1 <211> 2309 <212> DNA <213> <220> <223> cellulose synthase-like gene Solyc07g043390 <400> 1 tgaaagagca agagagggga gagggagtgc agagagaaac cacaccatga aaaaaaccat 60 ggagctcaac aaaagcactg ttccacaacc tatcaccacc gtataccgac tccacatgtt 120 catccactca ataatcatgc ttgcattaat atactaccgt gtatctaatt tgtttaaatt 180 cgaaaacatt ctcagtttac aagcacttgc ttgggcgctc atcacttttg gtgaatttag 240 tttcattctc aagtggttct tcggacaagg tactcgttgg cgccccgttg aacgagatgt 300 tttccctgaa aacattactt gcaaagattc cgatctaccg ccaattgacg taatggtatt 360 cactgccaat cctaagaaag agccaattgt agatgtcatg aacactgtga tatccgcaat 420 ggctcttgat tatcccaccg ataaattggc tgtgtatctc gctgatgatg gaggatgtcc 480 attgtcgttg tacgccatgg aacaagcgtg tttgtttgca aagctatggt tacctttctg 540 tagaaactat ggaattaaaa cgagatgccc aaaagcattt ttttctccgt taggagatga 600 tgaccgtgtt cttaagaatg atgattttgc tgctgaaatg aaagaaatta aattgaaata 660 tgaagagttc cagcagaagg tggaacatgc tggtgaatct ggaaaaatca atggtaacgt 720 agtgcctgat agagcttcgc ttattaaggt aataaacgag agggagaacg aaaagagtgt 780 ggatgatatg acgaaaatgc ccttgctagt ttatgtatcc cgtgaaagaa gattcaaccg 840 tcttcatcat ttcaagggtg gatctgcaaa tgctctactt cgagtttctg gaataatgag 900 taatgccccc tatgtactgg tgttagattg tgatttcttc tgtcatgatc caatatcagc 960 taggaaggca atgtgttttc atcttgatcc aaagctatca tctgatttag cctatgttca 1020 gttccctcaa gtcttttaca atgtcagcaa gtcagatatt tatgatgtca aaattagaca 1080 ggcttacaag acaatatggc atggaatgga tggtatccaa ggcccagtgt tatctgggac 1140 tggttatttt ctcaagagga aagcgttata cacaagtcca ggagtaaaag aggcgtatct 1200 tagttcaccg gaaaagcatt ttggaaggag taaaaggttt cttgcttcat tagaggagaa 1260 aaatggttat gttaaggcag ataaagtcat atcagaagat atcatagagg aagctaagat 1320 gttagctact tgtgcatatg aggatggcac acatggggt caagagattg gttattcata 1380 cgattgtcat ttggagagca cttttactgg ttatctatta cactgcaaag ggtggacatc 1440 tacttatttg tatccagaca ggccatcttt cttgggttgt gccccagttg atatgcaagg 1500 tttctcatca cagctcatca aatgggttgc tgcacttaca caagctggtt tatcacatct 1560 caatcccatc acttatggtt tgagtagtag gatgaggact ctccaatgca tgtgctatgc 1620 ctatttgatg tatttcactc tttattcttg gggaatggtt atgtatgcta gtgttccttc 1680 tattggcctt ttgtttgact tccaagtcta tcctgaggta catgatccgt ggtttgcagt 1740 gtatgtgatt gctttcatat cgacaatttt ggagaatatg tcggagtcaa ttccagaagg 1800 gggatcagtt aaaacgtggt ggatggaata cagggcattg atgatgatgg gagttagcgc 1860 aatatggtta ggaggattga aagctatata tgacaagata gtcggaacac aaggagagaa 1920 attgtatttg tcggacaagg caattgacaa ggaaaagctc aagaaatacg agaagggcaa 1980 atttgatttc caaggaatag ggatacttgc tctgccactg atagcatttt ccgtgttgaa 2040 cctcgtaggc ttcattgttg gagctaatca tgtctttatt actatgaact acgcaggcgt 2100 gctgggccaa ctcctcgtat catcgttctt cgtctttgtt gtcgtcactg ttgtcattga 2160 tgttgtatct ttcttaaagg tttcttaaac atcattatgt aattctctag tatttagaca 2220 gacctactat gtttatctct cttcaataat aaggccttcc gtcgaattat tcaatgaaac 2280 aaaattgtct cttttgtccc cccttttga 2309 <210> 2 <211> 28 <212> DNA <213> <220> <223> 3390-Fw-XbaI <400> 2 gctctagatg aaagagcaag agagggga 28 <210> 3 <211> 35 <212> DNA <213> <220> <223> 3390-Rv-KpnI <400> 3 cagaggtacc ttaagaaacc tttaagaaag ataca 35 <210> 4 <211> 20 <212> DNA <213> <220> <223> 3390-1390-Fw-qRT <400> 4 acattggggt caagaggcaa 20 <210> 5 <211> 20 <212> DNA <213> <220> <223> 3390-1529-Rv-qRT <400> 5 tggggcacaa cccaagaaag 20 <210> 6 <211> 23 <212> DNA <213> <220> <223> SlACT-Fw-qRT <400> 6 gggatggaga agtttggtgg tgg 23 <210> 7 <211> 23 <212> DNA <213> <220> <223> SlACT-Rv-qRT <400> 7 cttcgaccaa gggatggtgt agc 23 <210> 8 <211> 20 <212> DNA <213> <220> <223> TYLCV-Fw <400> 8 ggatttcgtt gtatgttagc 20 <210> 9 <211> 19 <212> DNA <213> <220> <223> TYLCV-Rv <400> 9 atgattatat cgcctggtc 19

Claims (7)

A transgenic plant with enhanced resistance to tomato yellow leaf curl virus disease in which the cellulose synthesis gene Solyc07g043390 is overexpressed. The transgenic plant according to claim 1, wherein the cellulose synthesis gene Solyc07g043390 is derived from tomato. The transgenic plant according to claim 2, wherein the tomato-derived cellulose synthesis gene Solyc07g043390 consists of the nucleotide sequence of SEQ ID NO: 1. The transformation according to claim 1, which is prepared by transforming plant cells with a pBl121 vector having a kanamycin resistance selection gene and a cauliflower mosaic virus (CaMV) 35S promoter, including the tomato-derived cellulose synthesis gene Solyc07g043390. plant body. The transgenic plant according to claim 1, wherein the plant is a tomato. The transgenic plant according to claim 1, wherein the resistance to the tomato yellow leaf curl virus disease shows any one or more characteristics selected from the group consisting of the following a) to f):
a) suppression of leaf curl symptoms; b) suppression of yellowing symptoms of leaves; c) suppression of symptoms of plant atrophy; d) suppression of leaf size reduction symptoms; e) suppression of symptoms of reduced fruit yield; and f) suppressing the symptoms of fruit size reduction. The seed of the transgenic plant according to any one of claims 1 to 6.

Images