KR20220059877A - Screening Method of a substance for treating noninfectious inflammatory diseases - Google Patents

Abstract

The present invention provides a screening method for a therapeutic agent for peritonitis, comprising the steps of: (a) administering a peritonitis-inducing substance to experimental animals other than humans; (b) administering a test substance to the test animal; and (c) determining the degree of phosphorylation of STAT6 in the cells of the experimental animals. In the method for screening a substance for treating non-infectious inflammatory diseases, especially peritonitis, it is possible to easily identify and obtain substances effective for treating peritonitis among a large number of treatment candidates, thereby being able to be usefully used for development and identification of novel drugs for the treatment of peritonitis.

Description

Screening method of a substance for treating noninfectious inflammatory diseases

The present invention relates to a method for screening a substance for treating non-infectious inflammatory diseases, and more particularly, to a method for screening a substance for treating peritonitis.

Peritonitis is an inflammation or irritation of the peritoneum, a thin membrane covering the abdominal cavity and internal organs, and may appear locally or throughout the abdominal cavity. In peritonitis, abdominal pain is the most obvious symptom, and other subjective symptoms include abdominal distension, vomiting, nausea, and breathing difficulties.

Peritonitis can be divided into infectious peritonitis and non-infectious peritonitis. In general, infectious peritonitis is lower esophagus, stomach (ulcer, gastric cancer), duodenum (ulcer), small and large intestine (appendicitis, large intestine diverticulum, Meckel's diverticulum, inflammatory bowel disease, intestinal Ischemia, confinement, colon and rectal cancer, meconium), gallbladder, etc., caused by perforation, or loss of peritoneal continuity, that is, trauma, surgical wounds, peritoneal dialysis, intraperitoneal chemotherapy, etc. It includes cases caused by traffic between the blocked intraperitoneal cavity and extraperitoneal cavity, or systemic infections such as spontaneous peritonitis or tuberculosis caused by bacterial growth in ascites.

On the other hand, non-infectious peritonitis is a condition in which sterile body fluids such as blood (endometriosis, trauma), bile (liver biopsy), urine (trauma), pancreatic fluid (pancreatitis), and ovarian cyst leak into the abdominal cavity, aseptic intraperitoneal surgery That is, it includes cases that occur due to a foreign body reaction or fibrous adhesion after surgery.

Peritonitis is caused by bacterial infection in the abdominal cavity due to perforation, which occurs frequently during abdominal endoscopy or gastrointestinal surgery, which is being performed rapidly with increasing interest in health. In severe cases, it can lead to sepsis and life-threatening.

Peritonitis is treated through non-surgical treatment and surgical treatment such as fasting, administration of drugs such as antibiotics and anti-inflammatory drugs, fluid supply, and endoscopic stent insertion, and the treatment method is different depending on the cause.

In the drug treatment of peritonitis, low delivery efficiency to the lesion site despite systemic toxicity (high blood concentration) by anti-inflammatory agents (inability to access blood vessels to inflamed sites, in the case of oral and intravenous antibiotic introduction); and rapid disappearance from the site of application of antibiotics [Most antibiotics use solubilized drugs to improve cell uptake, and even if antibiotics are directly introduced into the wound site (local delivery), they do not exist for a sufficient time and are easily washed away The low antibiotic effect caused by [exit] remains a problem to be solved.

That is, in non-infectious inflammatory diseases such as peritonitis, a therapeutic drug capable of essentially treating peritonitis-specific and disease other than general drugs including anti-inflammatory agents has not been developed.

However, in order to develop such a therapeutic drug, great efforts are required. For example, in new drug development, typically 5,000 to 20,000 new drug candidates are searched, 250 to 10 substances are selected from among them, and non-clinical tests are performed, and then fewer than 10 substances are selected again for phases 1 and 2 , It consists of a process of finally developing one substance as a new drug through a phase 3 clinical trial, obtaining approval for new drug sales, and marketing it. This process takes 10 to 15 years and requires a lot of manpower and money.

Accordingly, drug activity is clearly confirmed in the new drug candidate material selection stage, and there is a need to shorten the new drug development stage. In general, new drug candidates are either searched by checking the structure of the candidate material on a computer (in-silico), or by processing the candidate material in cells to check the effect and search (in-vitro). However, with respect to the drug screening method related to peritonitis, there are very few such methods developed.

Accordingly, in the development of a new drug, there is a need to develop an excellent screening method that can predict the efficacy of a drug for treating non-infectious inflammatory diseases such as peritonitis from the initial stage of new drug development. The process of developing new drugs, which is expensive and time consuming, will be made easier.

The present invention comprises the steps of (a) administering a peritonitis-inducing substance to experimental animals other than humans; (b) administering a test substance to the experimental animal; And (c) confirming the degree of STAT6 phosphorylation in the cells of the experimental animal; It provides a screening method for a therapeutic agent for peritonitis, comprising a.

In addition, the present invention comprises the steps of (a) contacting a test substance in peritonitis cells; (b) measuring the phosphorylation level of STAT6 protein in peritonitis cells in contact with the test substance; And (c) selecting a test substance with an increased degree of phosphorylation of STAT6 compared to the control sample; provides a screening method for treating peritonitis comprising a.

The present invention is to discover substances to be developed as new drugs for the treatment of peritonitis by more effectively screening substances having a therapeutic effect on peritonitis or acute peritonitis.

Under this background, the present inventors have researched and developed a treatment mechanism according to the treatment of apoptotic cells that can be used as a treatment for peritonitis. was completed.

The present invention comprises the steps of (a) administering a peritonitis-inducing substance to experimental animals other than humans;

(b) administering a test substance to the experimental animal; and

(c) confirming the degree of STAT6 phosphorylation in the cells of the experimental animal; It provides a screening method for a therapeutic agent for peritonitis, comprising a.

The present invention includes the step of (a) administering a peritonitis-inducing substance to an experimental animal. Any substance known to cause peritonitis can be used to prepare an animal model that induces the disease. Specifically, Zymosan, isoniazid, fructolol, sodium salicylate or intraperitoneal chemotherapy may be used to induce peritonitis, and preferably zymosan (Zymosan) may be an experimental animal with peritonitis induced by treatment. For example, zymosan may be treated as an experimental animal in any experimental animal commonly used in the art, and thus the animal model itself or cells isolated therefrom may be used in which the disease is induced. The experimental animal model may be, for example, a mouse, a hamster, a rat, a ferret, a guinea pig, a rabbit, a dog, a primate, a pig, and the like, and more preferably a mouse. Humans may be excluded for this experimental animal.

The isolated peritonitis cells may be used in the form of various samples such as tissue, peritoneal washing fluid (PLF), cell disruption solution, and the like, and include all types of peritoneal cells such as peritoneal macrophages (PM) and peritoneal cells. In addition to the peritonitis cells, spleen and plasma may be used.

In step (a), the peritonitis-inducing substance may be administered by a route suitable for characteristics, and more preferably, it may be administered via intraperitoneal injection. Substances expressed or activated in a state in which a peritonitis reaction is not induced and a state in which a peritonitis reaction is induced in vivo according to the present invention are different from each other. Therefore, in order to screen candidate substances for the prevention and treatment of peritonitis, it is necessary to induce peritonitis.

The screening method for a therapeutic agent for peritonitis according to the present invention includes (b) administering a test substance to the experimental animal.

In the present invention, the term 'test substance' refers to an unknown candidate substance used in screening to test whether it affects the expression level of a gene or affects the expression or activity of a protein. The sample includes, but is not limited to, chemicals, nucleotides, antisense-RNA, small interference RNA (siRNA), and natural product extracts.

The administration of these test substances may be administered through conventional routes of administration, including oral and parenteral administration. For example, it may be administered orally, and when administered parenterally, it may be selected from external or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection, but is not limited thereto.

The dosage of the test substance may be adjusted to an appropriate level according to the general knowledge of those skilled in the art according to the type of drug and drug efficacy.

The screening method for peritonitis according to the present invention includes (c) confirming the phosphorylation level of STAT6 in the cells of the experimental animal.

The measurement of the phosphorylation level can be confirmed by checking the change in STAT6 after treatment with a test substance, such as measuring the production level of phosphorylated STAT6, measuring the decrease in expression of STAT6, or measuring the expression ratio of phosphorylated STAT6 and STAT6. When phosphorylation is increased by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 100%, 2-fold, 3-fold or more compared to the negative control group by treatment with the test substance, peritonitis It can be judged as a drug having therapeutic efficacy for In addition, if it exhibits a phosphorylation level equivalent to that of the positive control group, it may be determined as a drug having therapeutic efficacy for peritonitis. In the present invention, the control sample refers to all sample groups that can compare and determine the degree of phosphorylation of STAT6 according to the treatment with the test substance, including the normal control group and the control substance known for the treatment of peritonitis.

The phosphorylation level of STAT6 can be measured by any one selected from the group consisting of enzyme immunoassay (ELISA), quantitative real-time polymerase chain reaction (qPCR), immunohistochemistry, Western blotting and efferocytosis analysis, but is limited thereto it is not going to be

By checking the phosphorylation level of STAT6, if phosphorylation is increased according to the treatment of the test substance, it can be determined as a drug having therapeutic efficacy.

For example, when phosphorylation is increased by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 100%, 2-fold, 3-fold or more compared to the negative control, therapeutic efficacy for peritonitis It can be considered as a drug with In addition, if the drug exhibits the same level of effect as compared to the positive control, it may be determined as a drug having therapeutic efficacy for peritonitis.

The present invention may further include measuring the degree of expression and activity of PPARγ in addition to the degree of phosphorylation of STAT6. As before, the expression level of PPARγ can be measured with any one selected from the group consisting of enzyme immunoassay (ELISA), quantitative real-time polymerase chain reaction (qPCR), immunohistochemistry, Western blotting and efferocytosis analysis, The present invention is not limited thereto, and when the expression and activity of PPARγ is increased according to treatment with the test substance, it may be determined as a drug having therapeutic efficacy for peritonitis.

In addition, the PPARγ target gene, for example, CD36, macrophage mannose receptor (MMR), Arg1 (arginase 1), and the like may further include measuring and confirming the expression level thereof. CD36, MMR, Arg1, etc. correspond to substances involved in the signaling pathway of PPARγ, and when the expression of CD36, MMR, Arg1, etc. increases according to the treatment of the test substance, it can be judged as a drug having therapeutic efficacy for peritonitis. .

In addition, the method may further include confirming the improvement of efferocytosis ability, which is a phagocytic ability to remove apoptotic cells required for suppression and treatment of inflammation.

Efferocytosis improvement is related to STAT6 phosphorylation, so if efferocytosis is improved according to test drug treatment, it can be judged as a drug having therapeutic efficacy for peritonitis.

The present invention comprises the steps of (a) contacting a test substance in peritonitis cells;

(b) measuring the phosphorylation level of STAT6 protein in peritonitis cells in contact with the test substance; and

(c) selecting a test substance having an increased degree of phosphorylation of STAT6 as compared to a control sample; provides a screening method for treating peritonitis comprising a.

The screening method for a therapeutic agent for peritonitis of the present invention includes the step of contacting a test substance with peritonitis cells. Preferably, the peritonitis cells include cells of a patient with peritonitis, animal cells, and tissues thereof. In addition, cells induced by a disease through a peritonitis-inducing substance can be used, and any substance known as a peritonitis-inducing substance can be used. Preferably, it may be a peritonitis cell induced by zymosan treatment. For example, zymosan may be treated as an experimental animal in any experimental animal commonly used in the art, and thus the animal model itself or cells isolated therefrom may be used in which the disease is induced. The experimental animal model may be, for example, a mouse, a hamster, a rat, a ferret, a guinea pig, a rabbit, a dog, a primate, a pig, and the like, and more preferably a mouse. The cells of peritonitis can be used in the form of various samples such as tissue, peritoneal lavage fluid (PLF), cell lysate, and the like, and may include all types of peritoneal cells such as peritoneal macrophages.

The contact of the test substance refers to all contact in vitro and in vivo , and includes all cases in which the test substance is treated to cells in vitro or administered to an animal or the like in vivo .

The screening method for the therapeutic agent for peritonitis of the present invention comprises the steps of: measuring the phosphorylation level of STAT6 protein in peritonitis cells in contact with the test substance; and selecting a test substance having an increased degree of phosphorylation of STAT6 as compared to a control sample.

Preferably, the phosphorylation level of the STAT6 protein is determined by any one selected from the group consisting of enzyme immunoassay (ELISA), quantitative real-time polymerase chain reaction (qPCR), immunohistochemistry, Western blotting and Efferocytosis analysis. can, but is not limited thereto. Preferably, the STAT6 may be any eukaryotic protein having STAT6 including mammals such as humans, cattle, goats, sheep, pigs, mice, and rabbits.

In the present invention, the control sample includes a normal control (eg, wild-type (WT) mouse) and a control substance known for the treatment of peritonitis. All samples that can compare and determine the phosphorylation level of STAT6 according to the treatment with the test substance. means group.

When it increases by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 100%, 2 times, 3 times or more compared to the negative control group, it is a drug with therapeutic efficacy for peritonitis. can be judged. In addition, if the drug exhibits the same level of effect as compared to the positive control, it may be determined as a drug having therapeutic efficacy for peritonitis. That is, a test substance that enhances phosphorylation of STAT6 can be selected as a therapeutic drug.

The present invention provides a method for screening a substance for the treatment of non-infectious inflammatory diseases, particularly peritonitis, by easily identifying and obtaining a substance effective for the treatment of peritonitis among a number of treatment candidate substances, so it is useful for developing and confirming new drugs for the treatment of peritonitis can be used

1 shows the results of confirming the change in STAT6 activity according to the pharmacological inhibition of STAT6.
Figure 2 shows the results of confirming the relationship between STAT6 activation and IL-4 and IL-13.
3 shows the results of confirming the decrease in the anti-inflammatory effect according to the pharmacological inhibition of STAT6.
Figure 4 shows the results of confirming the anti-inflammatory effect and cell regeneration effect according to the pharmacological inhibition of STAT6.
5 shows the results of confirming the inhibition of PPARγ expression and PPARγ target gene expression in peritoneal macrophages according to the pharmacological inhibition of STAT6.
6 shows the results of confirming the inhibition of PPARγ expression and PPARγ target gene expression in the spleen according to the pharmacological inhibition of STAT6.
7 shows the results of confirming that STAT6 is not expressed according to the genetic deficiency of STAT6.
Figure 8 shows the results of confirming the reduction in the anti-inflammatory effect according to the genetic deficiency of STAT6.
9 shows the results of confirming the decrease in PPARγ expression and PPARγ target gene expression in peritoneal macrophages according to STAT6 genetic deficiency.
10 shows the results of confirming the decrease in PPARγ expression and PPARγ target gene expression in the spleen according to STAT6 genetic deficiency.
11 shows the results of confirming the decrease in efferocytosis ability according to the pharmacological inhibition of STAT6.
12 shows the results of confirming the decrease in efferocytosis ability according to the genetic deficiency of STAT6.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

< Example >

animal model

Zymosan single-dose mice ( zym ), STAT6 Inhibitor-administered mice (AS+ zym ), STAT6 deficient mice ( STAT6 --/-) and WT control mice (WT)

Pathogen-free male BALB/C mice (Orient Bio, Sungnam, Korea), STAT6-/- (STAT6 deficient) and WT control mice (Jackson Laboratory, Bar Harbor, ME, USA) was used under the experimental protocol approved by the Animal Care Committee of Ewha Womans University Medical Research Institute.

In order to induce acute aseptic inflammation, a solution of 1 mg zymosan in 500 μl PBS was administered by intraperitoneal injection (i.p.).

In addition, for the pharmacological inhibition experiment, the STAT6 inhibitor AS1517499 (10 mg/kg, i.p.; dissolved in 20% DMSO in saline) was administered to mice one hour before the injection of zymosan. After the initial administration, AS1517499 or its vehicle was administered once more two days later.

All mice were sacrificed 6, 24 or 72 hours after zymosan injection.

Using sacrificed mice, peritoneal lavage was performed, and counting of neutrophils and peritoneal macrophages was performed with an electronic Coulter Counter fitted with a cell sizing analyzer (Coulter Model ZBI with a channelizer 256; Coulter Electronics, Bedfordshire, UK). was performed with After peritoneal lavage, the spleen was enucleated, immediately frozen in liquid nitrogen and stored at -70°C.

Meanwhile, peritoneal macrophages were cultured in serum-free X-VIVO medium for 60 minutes (5X10 ⁵ per well in 6-well plates). Non-adherent cells were removed prior to isolation of total RNA and protein. Approximately 90-95% of the plastic adherent cells were morphological macrophages.

In addition, the total protein concentration in the washing solution was measured by the method devised by Hartree using bovine serum albumin as a standard.

analysis method

(1) ELISA

For serum cytokine quantification, blood collected from mice via cardiac puncture was centrifuged at 1600 x g for 5 min at 4 °C to separate serum. The amounts of TNF-α, IL-6, MIP-2, IL-10 and HGF were measured in serum and primary cell-free PLFs according to ELISA (R & D Systems, Minneapolis, MN, USA) instructions. quantified.

(2) western blotting (Western blotting) analysis

Spleen tissue homogenate samples were isolated on 10% SDS polyacrylamide gels. The separated protein was transferred to nitrocellulose paper through electrophoresis. Membrane was treated with specific antibodies against phosho-STAT6/STAT6, CD36, MMR, Arg1 or β-actin (1:1000 dilution) followed by the addition of secondary antibody (1:1000) for 30 min, followed by a chemiluminescence detection kit (Thermo Scientific, Rockford, IL, USA) was confirmed by chemiluminescence.

(3) immunocytochemistry ( Immunocytochemistry )

Changes in STAT6 activity in peritoneal macrophages were analyzed using immunofluorescence. Specifically, peritoneal macrophages were fixed with 4% paraformaldehyde, permeabilized with Triton X-100, and mouse monoclonal anti-phospho-STAT6 (monoclonal anti phospho-STAT6), anti-STAT6 (anti-STAT6) Alternatively, anti-PPARγ antibody was stained overnight at 4°C.

Cells were then washed three times with phosphate buffer and incubated with fluorescent isothiocyanate-conjugated donkey anti-rabbit IgG (Jackson ImmunoReseach, West Grove, PA). Slides were mounted on a Vectashield (Vector Laboratories, Youngstown, OH) equipped with medium containing DAPI (4',6-diamidino-2-phenylindole). All slides were imaged using a confocal microscope (LSM5 PASCAL; Carl Zeiss, Jena, Germany) equipped with a filter set to 488/543 nm excitation.

In addition, phosphor-STAT6, STAT6 (green) and PPARγ (red or green) staining was quantified by generating a mask, and the mean fluorescence intensity was measured using LSM image inspection software (Carl Zeiss).

(4) Strategic real-time PCR analysis( qPCR )

Changes in the expression of PPARγ were confirmed using q-PCR. Gene expression was analyzed using real-time qPCR of the StepOnePlus system (Applied Biosystems, Life Technologies, Carlsbad, CA), and 50 ng of cDNA was used for the qPCR assay. The primers used were as follows:

Target gene (Mouse) Primer Sequence (5' to 3') PPARγ forward GCCCTTTGGTGACTTTATGG (SEQ ID NO: 1) reverse CAGCAGGTTGTCTTGGATGT (SEQ ID NO: 2) CD36 forward TTGTACCTATACTGTGGCTAAATGAGA (SEQ ID NO: 3) reverse CTTGTGTTTTGAACATTTCTGCTT (SEQ ID NO: 4) MMR forward AGAAAATGCACAAGAGCAAGC (SEQ ID NO: 5) reverse GGAACATGTGTTCTGCGTTG (SEQ ID NO: 6) Arg1 forward GTGGGGAAAGCCAATGAAG (SEQ ID NO: 7) reverse GCTTCCAACTGCCAGACTGT (SEQ ID NO: 8) IL-4 forward CGAGCTCACTCTCTGTGGTG (SEQ ID NO: 9) reverse TGAACGAGGTCACAGGAGAA (SEQ ID NO: 10) IL-13 forward CCTGGCTCTTGCTTGCCTT (SEQ ID NO: 11) reverse GGTCTTGTGTGATGTTGCTCA (SEQ ID NO: 12) HPRT forward CAGACTGAAGAGCTACTGTAATG (SEQ ID NO: 13) reverse CCAGTGTCAATTATATCTTCAAC (SEQ ID NO: 14)

mRNA levels were normalized relative to HPRT mRNA and reported as fold change of expression relative to control.

(5) Efferocytosis analysis

Peritoneal lavage cells were isolated and cytospun to evaluate the phagocytic index, and the phagocytic index was calculated from the following formula:

Phagocytic index: (number of apoptotic bodies) / (200 total macrophages)X100.

< Example 1> STAT6 According to the pharmacological inhibition of phosphorylation STAT6 Check activity change and anti-inflammatory effect

Example 1-1: STAT6 According to the pharmacological inhibition of phosphorylation Zymosan Post-injection in peritoneal macrophages and spleen STAT6 Check for active changes

To determine whether STAT6 activation is induced during acute aseptic inflammation, STAT6 phosphorylation in macrophages removed from the peritoneum after intraperitoneal administration of zymosan was analyzed.

The results of immunocytochemical analysis by confocal microscopy are shown in FIG. 1A . As can be seen in Figure 1a, STAT6 phosphorylation of peritoneal macrophages was found to be improved over time until 72 hours after injection of zymosan.

However, administration of the STAT6 inhibitor AS1517499 (AS+Zym) before zymosan injection did not result in STAT6 phosphorylation in peritoneal macrophages at each time point after zymosan injection.

In addition, as can be seen in FIG. 1b showing the results of western blot analysis of the spleen, which is an immune organ, a trend similar to that of the peritoneal macrophages was observed in the spleen.

That is, STAT6 phosphorylation was hardly detected in mice treated with saline, AS1517499 in peritoneal macrophages and spleen.

These results imply that STAT6 activation is enhanced at a relatively late time point after in vivo treatment with zymosan, and STAT6 inhibitors inhibit STAT6 activation in peritoneal macrophages and spleen.

Example 1-2: Zymosan Post-injection in peritoneal macrophages and spleen STAT6 Confirmation of activation and association of IL-4 and IL-13

In general, STAT6 activation is initiated by the binding of cytokines IL-4 and IL-13 to receptors, and is known to promote the anti-inflammatory process by inducing the development of M2-type macrophages.

However, as can be seen in Figure 2, at each time point, IL-4 and IL-13 mRNA and peritoneum in peritoneal macrophages and spleens of mice treated with zymosan alone (Zym) and mice administered with STAT6 inhibitors (AS+Zym) Protein levels in the wash (PLF) were found to be basal.

From these results, it was confirmed that the activation of STAT6 after zymosan injection was induced in an IL-4 / IL-13 independent manner.

Example 1-3: STAT6 According to the pharmacological inhibition of phosphorylation on Mt. Jimo Confirmation of reduction of anti-inflammatory effect on inflammation caused by

By confirming that the anti-inflammatory effect is reduced when STAT6 signaling is inhibited, it was confirmed that drugs that inhibit STAT6 signaling should be avoided.

Based on the animal model of the example, TNF-α, IL-6 and MIP-2 protein levels in the prepared peritoneal lavage fluid (PLF), neutrophil count and changes in total protein levels were analyzed, and the results are shown in FIG. 3 .

As can be seen in FIG. 3 , it was confirmed that the inflammatory factors TNF-α, IL-6 and MIP-2 protein levels increased after 6 hours in mice administered with zymosan. However, after administration of the STAT6 inhibitor AS1517499, it was confirmed that the zymosan-administered mice (AS+Zym) further increased the inflammatory factor protein level than the mice administered with zymosan alone (Zym) (FIG. 3a).

In addition, the neutrophil count and total protein amount in PLF were also higher in mice administered AS1517499, a STAT6 inhibitor (AS+Zym).

In addition, based on the animal model of Example, it was confirmed the change in the level of IL-10 and HGF protein, which are factors related to cell anti-inflammatory and regeneration in the prepared peritoneal lavage fluid (PLF), and the results are shown in FIG. 4 .

As can be seen in Figure 4, the increased amount of pro-resolving molecules such as IL-10 and HGF in mice administered with zymosan alone (Zym) was further reduced in mice administered with zymosan (AS+Zym), which was administered as a STAT6 inhibitor, AS1517499. was able to confirm that

From these results, it was confirmed that changes in inflammation-related factors are related to STAT6 signaling.

Example 1-4: STAT6 According to the pharmacological inhibition of phosphorylation PPARγ and confirmation of suppression of target gene expression

Based on the same animal experimental model as in Example, the expression of PPARγ and target genes in peritoneal macrophages and spleen according to STAT6 inhibitor treatment was confirmed.

Changes in the expression of PPARγ and target genes were confirmed through immunocytochemical analysis and qPCR analysis by confocal microscopy, and the results are shown in FIGS. 5 and 6 .

As can be seen in FIG. 5 , after zymosan injection, PPARγ protein expression and PPARγ mRNA levels in peritoneal macrophages gradually increased in a time-dependent manner up to 72 hours. On the other hand, in mice administered AS1517499 (AS+Zym), it was shown that the amount of PPARγ protein expression and PPARγ mRNA expression in peritoneal macrophages decreased at each time point after zymosan administration ( FIG. 5 a ).

In addition, as can be seen in FIG. 5b , the mRNA expression of CD36, MMR, and Arg1, which are target genes highly related to PPARγ, showed a pattern similar to that of PPARγ mRNA expression.

In addition, it was confirmed that the expression of PPARγ protein and PPARγ mRNA in the spleen, and the mRNA expression of CD36, MMR, and Arg1, which are target genes highly related to PPARγ, appear in the same trend as in peritoneal macrophages (FIG. 6).

From these results, it was confirmed that STAT6 phosphorylation not only affects the increase in PPARγ expression, but also affects the increase in the expression of target genes of PPARγ. Accordingly, it was confirmed that the screening of therapeutic substances is possible through the confirmation of STAT6 phosphorylation.

< Example 2> STAT6 due to genetic deficiency STAT6 Check activity change and anti-inflammatory effect

Example 2-1: of STAT6 genetic deficiency ( STAT6 -/-)In accordance jimosan Post-injection in peritoneal macrophages and spleen STAT6 Check for active changes

Inflammatory responses in peritoneal macrophages (PM) and spleen after zymosan injection using STAT6-/- mouse model and wild-type (WT) control mouse model were confirmed through immunocytochemical analysis and Western blot analysis, and the results were It is the same as FIG.

As can be seen in FIG. 7 , STAT6 protein expression was not confirmed in the peritoneum and spleen of STAT6-deficient (STAT6-/-) mice, confirming that STAT6 protein was deficient.

Example 2-2: of STAT6 genetic deficiency ( STAT6 -/-)In accordance on Mt. Jimo Confirmation of exacerbation of inflammation caused by

Changes in TNF-α, IL-6 and MIP-2 protein levels, neutrophil counts and total protein levels in peritoneal lavage fluid (PLF) after zymosan injection using STAT6-/- mouse model and wild-type (WT) control mouse model was analyzed, and the results are shown in FIG. 8 .

As can be seen in FIG. 8 , the amount of inflammatory factors after zymosan injection was further increased in the peritoneal lavage fluid of STAT6-/- mice compared to the WT control ( FIG. 8 a ). In addition, it was found that the number of neutrophils and the protein content in the peritoneal lavage fluid of STAT6-/- mice were increased compared to that of the WT control ( FIG. 8 b ).

From these results, it was confirmed that STAT6 deficiency (STAT6-/-) significantly worsened the inflammatory response.

Example 2-3: of STAT6 genetic deficiency ( STAT6 -/-)In accordance PPARγ and confirming the decrease in the expression of the target gene

Expression of PPARγ and target genes in peritoneal macrophages and spleen after zymosan injection was confirmed using a STAT6-/- mouse model and a wild-type (WT) control mouse model. Changes in the expression of PPARγ and target genes were confirmed by immunocytochemical analysis and qPCR analysis by confocal microscopy, and the results are shown in FIGS. 9 and 10 .

Referring to FIG. 9 , the expression level of PPARγ protein in peritoneal macrophages of STAT6-/- mice compared to WT mice was significantly lower than that at each time point after zymosan injection ( FIG. 9 a ). In addition, similarly, the mRNA expression of CD36, MMR, and Arg1, which are target genes highly related to PPARγ, was found to be lower in peritoneal macrophages of STAT6-/- mice compared to WT mice ( FIG. 9 b ).

Referring to Figure 10, the expression level of PPARγ mRNA and protein and target genes CD36, MMR, and Arg1 in the spleen of STAT6-/- mice compared to WT mice was significantly lower than that at each time point after zymosan injection. appear.

< Example 3> STAT6 Activation in macrophages efferocytosis Check the impact on performance improvement

In suppressing inflammation, the phagocytosis of macrophages to remove apoptotic cells is important. Therefore, in order to confirm the effect of STAT6 on the efferocytosis ability in peritoneal macrophages of acute peritonitis caused by zymosan, the efferocytosis ability of peritoneal macrophages was confirmed through a microscope based on the same animal experimental model as in Example, The results are shown in FIGS. 11 and 12 .

As can be seen in FIGS. 11 and 12 , efferocytosis detectable by macrophages in WT mice was gradually increased up to 72 hours after zymosan injection ( FIG. 12 ). After Zymosan injection, efferocytosis was observed in peritoneal macrophages of mice (AS+Zym) and STAT6-deficient mice (STAT-/-) administered with a STAT6 inhibitor compared to macrophages of zymosan alone (Zym), or wild-type mice (WT). appeared to be significantly lower.

Therefore, activation of STAT6 was confirmed to enhance the efferocytosis action of peritoneal macrophages in acute peritonitis caused by zymosan.

From these results, i) STAT6 is activated in peritoneal macrophages and spleen of zymosan-induced peritonitis, ii) STAT6 inhibition exacerbates zymosan-induced inflammatory response and reduces PPARγ expression, iii) STAT deficiency causes inflammation Reaction exacerbation and PPARγ expression were reduced, and iv) STAT6 activity was confirmed as a mechanism of action to enhance efferocytosis of peritoneal macrophages in peritonitis. Therefore, since STAT6 can be a target for impaired PPARγ activation and treatment of peritonitis, it was confirmed that STAT6 can be a major therapeutic target in the development of substances for the treatment of peritonitis. In addition, it was confirmed that a drug that activates STAT6 phosphorylation is appropriate for the treatment of acute peritonitis, and that a drug that inhibits STAT6 phosphorylation should be avoided.

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims to be described later and their equivalents.

<110> Ewha University - Industry Collaboration Foundation <120> Screening Method of a substance for treating noninfectious inflammatory diseases <130> EWHA198P-1 <150> KR 10-2020-0145339 <151> 2020-11-03 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARgamma Forward Primer <400> 1 gccctttggt gactttatgg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARgamma Reverse Primer <400> 2 cagcaggttg tcttggatgt 20 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CD36 Forward Primer <400> 3 ttgtacctat actgtggcta aatgaga 27 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CD36 reverse Primer <400> 4 cttgtgtttt gaacatttct gctt 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MMR Forward Primer <400> 5 agaaaatgca caagagcaag c 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMR Reverse Primer <400> 6 ggaacatgtg ttctgcgttg 20 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Arg1 Forward Primer <400> 7 gtggggaaag ccaatgaag 19 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Arg1 Reverse Primer <400> 8 gcttccaact gccagactgt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-4 Forward Primer <400> 9 cgagctcact ctctgtggtg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-4 Reverse Primer <400> 10 tgaacgaggt cacaggagaa 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> IL-13 Forward Primer <400> 11 cctggctctt gcttgcctt 19 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-13 Reverse Primer <400> 12 ggtcttgtgt gatgttgctc a 21 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HPRT Forward Primer <400> 13 cagactgaag agctactgta atg 23 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HPRT Reverse Primer <400> 14 ccagtgtcaa ttatatcttc aac 23

Claims (11)

(a) administering a peritonitis-inducing substance to experimental animals other than humans;
(b) administering a test substance to the experimental animal; and
(c) confirming the degree of STAT6 phosphorylation in the cells of the experimental animal; A screening method for a therapeutic agent for peritonitis comprising a. The method of claim 1, wherein the peritonitis-inducing substance in step (a) consists of Zymosan, isoniazid, practolol, sodium salicylate, and intraperitoneal chemotherapy. At least one selected from the group, a screening method for a therapeutic agent for peritonitis. The method of claim 1, wherein the peritonitis-inducing substance in step (a) is Zymosan. The method of claim 1, wherein the experimental animal in step (a) is a mouse. The method of claim 1, wherein the administration of the test substance in step (b) is case or parenteral administration. According to claim 1, wherein the phosphorylation degree of STAT6 in step (c) is an enzyme immunoassay (ELISA), quantitative real-time polymerase chain reaction (qPCR), immunohistochemistry, Western blotting (Western Blotting) and the group consisting of Efferocytosis analysis A screening method for a therapeutic agent for peritonitis, which is measured by any one selected from The method of claim 1, wherein the test substance with increased phosphorylation is selected according to the measurement of the phosphorylation level of STAT6 in step (c). The method of claim 1, further comprising (d) confirming an increase in the expression of PPARγ in the cells of the experimental animal; further comprising, a screening method for a therapeutic agent for peritonitis. The method of claim 1, further comprising: (d) confirming an increase in expression of at least one selected from the group consisting of CD36, MMR, and arginase-1 (Arg1) in the experimental animal; [Claim 2] The method of claim 1, further comprising: (d) confirming the improvement of efferocytosis ability in the cells of the experimental animal. (a) contacting the test substance in the peritonitis cells;
(b) measuring the phosphorylation level of STAT6 protein in peritonitis cells in contact with the test substance; and
(c) selecting a test substance with an increased degree of phosphorylation of STAT6 as compared to a control sample; screening method for treating peritonitis comprising a.

Images