KR20220058167A - Aptamer specifically binding to tranexamic acid and use thereof - Google Patents

Abstract

The present invention relates to an aptamer which specifically binds to tranexamic acid and a composition containing the aptamer as an active ingredient having skin whitening, skin aging prevention, wrinkle removal, or skin moisturizing effects.

Description

DNA aptamer that specifically binds to tranexamic acid and use thereof {APTAMER SPECIFICALLY BINDING TO TRANEXAMIC ACID AND USE THEREOF}

The present invention relates to a DNA aptamer that specifically binds to tranexamic acid and uses thereof.

A person's skin color is determined by the concentration and distribution of melanin inside the skin. In addition to genetic factors, it is also affected by environmental or physiological conditions such as UV rays, fatigue, and stress.

Melanin pigment is produced in melanocytes, which is a phenolic polymer having a complex form of black pigment and protein, and plays an important role in inhibiting skin damage caused by ultraviolet rays.

Melanin is produced by the action of an enzyme called tyrosinase present in pigment cells. Tyrosinase is found exclusively in melanocytes, which are pigment cells. Melanocytes are located in the basal layer of the epidermis and in the hair root.

Melanin pigment is produced and deposited in melanocyte-specific organs called melanosomes, and then is transported from melanocytes to surrounding keratinocytes and spreads through the skin epidermis or pores.

Several other enzymes involved in melanin biosynthesis are known, including TRP 1 (tyrosinase related protein 1) and TRP 2 (tyrosinase related protein 2) (Cohen, T, et al Nucleic Acids Res 18:2807-2808 (1990)) ); Jackson, I J, et al, EMBO J, 11:327-535 (1992))

According to research, tyrosinase, TRP 1 and TRP 2 interact to form a complex, and the activity of tyrosinase in these complexes is reduced, so it is speculated that the TRPs will act as inhibitors of tyrosinase activity. (Orlow, S J, et al, J Invest Dermatol, 103:196-201 (1994))

Melanin is biosynthesized through a non-enzymatic oxidation reaction after being converted from tyrosine, a type of amino acid, to dopa and dopaquinone by tyrosinase, TRP 1 and TRP 2. The produced melanin is transferred to keratinocytes through melanosomes, and the keratinocytes undergo keratinization for 28 days and come out to the skin surface.

However, in the keratinization process, melanin is excessively produced by certain factors, and if the melanin pigment is not completely eliminated by keratinization, pigmentation occurs.

On the other hand, the action of a whitening agent used in whitening cosmetics is shown in various ways.

First, as a method of removing the cause of melanin production by blocking ultraviolet rays, this method uses a light scattering agent or a light blocking agent.

Second, as a method of inhibiting the biosynthesis of tyrosinase, this method uses a substance that blocks signal transduction or inhibits gene expression.

Third, as a method of inhibiting the function of tyrosinase, this method uses a substance that competitively binds to the substrate of the enzyme or a substance that loses the activity of the enzyme by binding to the enzyme and changing its structure.

Fourth, it is a method of using a substance with specific toxicity to melanocytes.

Meanwhile, Korean Patent Laid-Open No. 2004-60157 discloses that tranexamic acid can exhibit a whitening effect by inhibiting the proliferation of melanocytes, which are skin pigment cells, thereby inhibiting melanin production. The tranexamic acid is trans-4-(aminomethyl)cyclohexanecarboxylic acid (trans-4-(aminomethyl)cyclohexanecarboxylic acid), and has a molecular formula of C ₈ H ₁₅ NO ₂ , and has a conventional antifibrinolytic effect. ), so it was used as a hemostatic agent or a thrombolytic agent.

The present invention has been devised in response to the above necessity, and an object of the present invention is to provide a novel aptamer.

Another object of the present invention is to provide a novel skin whitening composition.

In order to achieve the above object, the present invention provides an aptamer that specifically binds to tranexamic acid.

In one embodiment of the present invention, the aptamer that specifically binds to tranexamic acid preferably binds to an aminomethyl- or carboxylic acid group of tranexamic acid, but is not limited thereto.

In another embodiment of the present invention, the aptamer that specifically binds to tranexamic acid is preferably at least one aptamer selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 1 to 20, but is not limited thereto.

In another embodiment of the present invention, the aptamer preferably inhibits melanin production or inhibits the activity of tyrosinase, but is not limited thereto.

In another embodiment of the present invention, the aptamer preferably has a skin whitening, skin aging prevention, wrinkle removal, or moisturizing effect, but is not limited thereto.

The present invention also provides a composition comprising the aptamer of the present invention as an active ingredient, which has skin whitening, skin aging prevention, wrinkle removal, or skin moisturizing effects.

In the present invention, the 'whitening effect' refers to not only brightening skin tone by reducing the total amount of melanin pigment, but also improving skin hyperpigmentation such as spots or freckles caused by ultraviolet rays, hormones, or heredity.

The present invention provides a pharmaceutical composition, cosmetic composition or health food for skin whitening, skin aging prevention, wrinkle removal, or skin moisturizing comprising the aptamer of the present invention as an active ingredient.

The cosmetic composition according to the present invention includes solutions, external ointments, creams, foams, nourishing lotions, softening lotions, packs, soft water, emulsions, makeup bases, essences, soaps, liquid detergents, bathing agents, sunscreen creams, sun oils, suspensions, Emulsion, paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, patch and spray can be prepared in a formulation selected from the group consisting of, but limited thereto it is not

In addition, the cosmetic composition of the present invention may further include one or more cosmetically acceptable carriers to be formulated in general skin cosmetics, and conventional ingredients include, for example, oil, water, surfactant, humectant, lower alcohol, A thickener, a chelating agent, a colorant, a preservative, a fragrance, etc. may be appropriately mixed, but the present invention is not limited thereto.

The cosmetically acceptable carrier included in the cosmetic composition of the present invention varies depending on the formulation. When the formulation of the present invention is an ointment, paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide or Mixtures thereof may be used.

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, or mixtures thereof may be used as a carrier component. In particular, in the case of a spray, additional chlorophyll propellants such as fluorohydrocarbons, propane/butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer, or emulsifier is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl benzoate, propylene glycol, 1,3 -Butylglycol oil, in particular cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microscopically Crystalline cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

When the formulation of the present invention is a soap, alkali metal salt of fatty acid, fatty acid hemiester salt, fatty acid protein hydrolyzate, isethionate, lanolin derivative, aliphatic alcohol, vegetable oil, glycerol, sugar, etc. may be used as carrier components. can

According to another embodiment of the present invention, the present invention provides a pharmaceutical composition containing the aptamer as an active ingredient.

The composition comprising the compound of the present invention may be in various oral or parenteral formulations, but preferably parenteral formulations. In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in one or more compounds, for example, starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, and emulsions. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

The present invention may also be provided in the formulation of an external preparation for skin for skin whitening effect comprising the aptarer as an active ingredient.

When used as an external preparation for skin, additionally fatty substances, organic solvents, solubilizers, thickeners and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or Nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic actives, lipid vesicles or any other commonly used external preparations for the skin It may contain adjuvants commonly used in the field of dermatology, such as ingredients. In addition, the ingredients may be introduced in an amount generally used in the field of dermatology.

When provided as an external preparation for skin, the present invention is not limited thereto, but may have a dosage form such as an ointment, a patch, a gel, a cream, or a spray.

The pharmaceutical composition of the present invention can be particularly preferably used as a parenteral preparation, for example, the external preparation for the skin includes a suitable pharmaceutically acceptable base such as vaseline, stearyl alcohol; suitable pharmaceutically acceptable surfactants such as polysorbate and sorbitan sesquioleate; suitable pharmaceutically acceptable moisturizers such as glycerin; a suitable pharmaceutically acceptable solvent; And it can be prepared by a conventional method for preparing an external preparation for skin in which a flavoring agent, a colorant, a stabilizer, a viscous agent, and the like are homogeneously mixed.

In addition, when the composition of the present invention is used as a pharmaceutical, it may further contain one or more active ingredients exhibiting the same or similar function. For example, it may include known skin lightening ingredients. If an additional skin lightening component is included, the skin lightening effect of the composition of the present invention may be further enhanced. When adding the above ingredients, skin safety according to combined use, ease of formulation, and stability of active ingredients can be considered. In one embodiment of the present invention, the composition is a whitening component known in the art, a substance that inhibits tyrosinase enzyme activity such as Kojic acid, arbutin, etc. Hydroquinone, vitamin-C (L-Ascorbic acid) may further include one or two or more components selected from the group consisting of. Additional components may be included in an amount of 00001% by weight to 10% by weight based on the total weight of the composition, and the content range may be adjusted according to requirements such as skin safety and ease of formulation of the aptamer.

When the pharmaceutical composition of the present invention contains an effective amount of the aptamer, it is possible to provide a desirable skin whitening effect. In the present invention, the term 'effective amount' refers to an amount of a compound capable of exhibiting a skin whitening effect.

The effective amount of the aptamer included in the composition of the present invention will vary depending on the form in which the composition is commercialized, the method in which the compound is applied to the skin, and the time it stays on the skin. For example, when the composition is commercialized as a pharmaceutical, it may contain an aptamer at a higher concentration than when commercialized as a cosmetic that is routinely applied to the skin. Accordingly, the daily dose is 0.001 to 1000 ug/kg, preferably 1 to 100 ug/kg, based on the amount of the aptamer, and may be administered 1 to 6 times a day.

The present invention also relates to a health food for skin whitening comprising an aptamer.

As used herein, the term 'health food' refers to food prepared by adding the compound of Formula 1 to food materials such as beverages, teas, spices, gum, and confectionery, or as a capsule, powder, suspension, etc. It means to bring a specific effect, but unlike general drugs, it has the advantage that there are no side effects that may occur when taking the drug for a long time using food as a raw material.

Since the health food of the present invention obtained in this way can be consumed daily for a long period of time, a high skin whitening effect can be expected and is very useful.

When the aptamer is used as a food additive, the aptamer may be added as it is or used together with other foods or food ingredients, and the ingredients or mixing method may be appropriately used according to a conventional method. The mixed amount of the active ingredient may be suitably determined according to the purpose of its use (prevention, health or therapeutic treatment). However, the present invention is not limited thereto.

There is no particular limitation on the type of the food. Examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, There are alcoholic beverages, vitamin complexes, and the like, and includes all health foods in the ordinary sense.

The health drink of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional drinks. The above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; or a sugar alcohol such as xylitol, sorbitol, or erythritol. As the sweetener, natural sweeteners such as tau matine and stevia extract, and synthetic sweeteners such as saccharin and aspartame may be used. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the health drink of the present invention.

In addition to the above, the health food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol , a carbonation agent used in carbonated beverages, and the like.

In addition, the health food of the present invention may contain flesh for the production of natural fruit juice, fruit juice beverage, and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health food of the present invention.

Overall, the content of the aptamer in the composition of the present invention is preferably 0.00001-1.0% by weight based on the total weight of the composition, but is not limited thereto. Below this weight, the effect was small, and when this weight was exceeded, the effect did not increase.

The content of tranexamic acid in the composition of the present invention is preferably 0.0001-10.0% by weight based on the total weight of the composition, but is not limited thereto.

As can be seen from the present invention, it will be possible to select an aptamer that specifically binds to Tranexamic acid using SELEX and apply it to skin whitening.

1 is a diagram showing that the aptamer binds to an aminomethyl group or a carboxylate group of tranexamic acid;
Figure 2 is a figure showing the SELEX process for the selection of aptamers specifically binding to Tranexamic acid.

Hereinafter, the present invention will be described in more detail through non-limiting examples. However, the following examples are intended to illustrate the present invention, and the scope of the present invention is not to be construed as being limited by the following examples.

Example 1: Single-stranded DNA library construction

A single-stranded DNA library was prepared to select single-stranded DNA aptamers that specifically bind to tranexamic acid using the SELEX method. The single-stranded DNA library sequence consisted of a total of 60 bases by including 15 specific primer sequences in 5' and 3', respectively, and designing to have 20 or 30 random sequences.

The designed single-stranded DNA library is as follows.

5'-ATGCGGATCCCGCGC-N20-GCGCGAAGCTTGCGC-3' (single-stranded DNA library sequence; SEQ ID NO: 21)

5'-ATGCGGATCCCGCGC-N30-GCGCGAAGCTTGCGC-3' (single-stranded DNA library sequence; SEQ ID NO: 22)

The single-stranded DNA library was amplified by PCR using the synthesized single oligonucleotide fragment of the nucleotide sequence as a template. Primers 1 and 2 were prepared to carry out the PCR of the present invention, and the base sequences of Primers 1 and 2 are as follows.

5'-ATGCGGATCCCGCGC-3' (Primer 1; SEQ ID NO: 23)

5'-A-Biotin TEG-A-Biotin TEG-GCGCAAAGCTTCGCGC-3' (Primer 2; SEQ ID NO: 24)

In order to amplify a large amount of single-stranded DNA, PCR was performed by mixing Primer 1 and Primer 2 in a ratio of 1:1. The PCR reaction was amplified by repeating 30 cycles of reaction at 95 °C for 3 minutes, then repeating 30 cycles under the conditions of 95 °C, 40 seconds, 60 °C, 40 seconds, 72 °C, and 40 seconds, followed by reaction at 72 °C for 5 minutes.

The amplified PCR product was electrophoresed on a 4% agarose gel to visually check the band first, and then separated by the biotin-streptavidin method.

Mix the PCR product 1:1 with streptavidin beads and shake for 5 minutes. Thereafter, it is placed on a magnetic holder, the supernatant is discarded, 80 μl of 20 mM NaCl is added, and shaken well for 5 minutes. After that, 80ul of the supernatant was separated, mixed with 20μl of 80mM HCl, and neutralized to purify DNA. The purified single-stranded DNA library was heated at 95° C. for 5 minutes, then folded at room temperature for 10 minutes to form a folded structure, and then used for SELEX.

Example 2: SELEX for selection of aptamers that specifically bind to Tranexamic acid

SELEX (rGO-SELEX) technology using graphene was used to select single-stranded DNA aptamers that specifically bind to tranexamic acid and inhibit oxidation. (Lee, A. Y., Ha, N. R., Jung, I. P., Kim, S. H., Kim, A. R., & Yoon, M. Y. (2017). Development of a ssDNA aptamer for detection of residual benzylpenicillin. Analytical biochemistry, 531, 1-7.)

Hereinafter, the SELEX method using graphene is as follows.

First, in order to remove single-stranded DNA non-specifically binding to graphene and 1.5 ml tube, 250 pmol of single-stranded DNA library and 5 mg/mL of reduced graphene oxide (rGO) were added to binding buffer (20 mM Tris, pH 8.0). ) and reacted for 30 minutes, the supernatant was removed by centrifugation twice. The remaining single-stranded DNA and graphene mixture was treated with 40 nmol Tranexamic acid, reacted for 1 hour, and single-stranded DNA bound to Tranexamic acid was amplified by PCR.

The amplified DNA was separated by the biotin-streptavidin method to obtain the first SELEX product. The above process was repeated 5 times and symmetric PCR was performed using the 5th repeated SELEX product as a template. The amplified double-stranded DNA fragment is sequenced by NGS (Next Generation Sequencing) technology and analyzed with a high frequency of 20 sequences of SEQ ID NOs: 1 to 20 (N=20 to 10, N= 30 to 10) were identified.

SEQ ID NO: selected sequence Sequence size (bp) SEQ ID NO: 1 GCAGCAAGGGGAACGCTGATAGGCTGTTG 29 SEQ ID NO: 2 GCACGAAGGAGCACGGGGAGGCGGGTCATG 30 SEQ ID NO: 3 CGCGCGTCAGGCATTCCTCACAATTCTTCG 30 SEQ ID NO: 4 CGAGCATAAGGCTGATCCGTATTGTGTTTG 30 SEQ ID NO: 5 GGAGAATGGGCGTTGCTAGTGTGTGGTGGG 30 SEQ ID NO: 6 CGCGCGTCAGGCATTCCTCACAATTCTCG 29 SEQ ID NO: 7 GCAGTGGAGCGAGCACGGGGACGTTGTTGG 30 SEQ ID NO: 8 GCAGCAAGGGGGAACGCTGATAGGCTGTTG 30 SEQ ID NO: 9 GCAGGGTACGAGCACGGGGCCAGCGAGTTG 30 SEQ ID NO: 10 ACACGATAATCTGGGAACACTATTGGTCTG 30

Sequences from the N = 20 library of Example 1

SEQ ID NO: selected sequence Sequence size (bp) SEQ ID NO: 11 GCACGAAGGAGCACGGGGAGGCGGGTCATG 30 SEQ ID NO: 12 GCAGCAAGGGGAACGCTGATAGGCTGTTG 29 SEQ ID NO: 13 CGCGCGTCAGGCATTCCTCACAATTCTTCG 30 SEQ ID NO: 14 GCAGTGGAGCGAGCACGGGGACGTTGTTGG 30 SEQ ID NO: 15 GCAGCAAGGGGGAACGCTGATAGGCTGTTG 30 SEQ ID NO: 16 GCACGAAGGAGCACGGGAGGCGGGTCATG 29 SEQ ID NO: 17 GGTACACAACAGGCAGGCCATAGGATTGGG 30 SEQ ID NO: 18 TGGGGGCGTAGATTATCTTAGAGCATGTTG 30 SEQ ID NO: 19 GCACGGAAGGAGCACGGGGAGGCGGGTCATG 31 SEQ ID NO: 20 GCAGGGTACGAGCACGGGGCCAGCGAGTTG 30

Sequences obtained from the N = 30 library of Example 1

Example 3: Measurement of binding force between Tranexamic acid and aptamer sequence

To confirm the binding ability of the aptamer binding to tranexamic acid, the binding dissociation constant (Kd) was measured using the rGO method.

The intensity of binding was measured by attaching FAM fluorescence to 5' of single-stranded DNA and analyzing the signal difference in binding force that varies depending on the concentration of the target material. (Kim A-R, Ha N-R, Jung I-P, Kim S-H, Yoon M-Y. Development of a ssDNA aptamer system with reduced graphene oxide (rGO) to detect nonylphenol ethoxylate in domestic detergent. J Mol Recognit. 2018; e2764.) Single-stranded DNA pressure The concentration of tamer was fixed at 400 nM, and the concentration of Tranexamic acid was inserted into 16 tubes to achieve a concentration gradient ranging from 0 uM to 200 nM, followed by reaction for 60 minutes.

<110> Nexmos Co., Ltd. <120> APTAMER SPECIFICALLY BINDING TO TRANEXAMIC ACID AND USE THEREOF <130> P20-0133HS <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 1 gcagcaaggg gaacgctgat aggctgttg 29 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 2 gcacgaagga gcacggggag gcgggtcatg 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 3 cgcgcgtcag gcattcctca caattcttcg 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 4 cgagcataag gctgatccgt attgtgtttg 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 5 ggagaatggg cgttgctagt gtgtggtggg 30 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 6 cgcgcgtcag gcattcctca caattctcg 29 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 7 gcagtggagc gagcacgggg acgttgttgg 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 8 gcagcaaggg ggaacgctga taggctgttg 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 9 gcagggtacg agcacggggc cagcgagttg 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 10 acacgataat ctgggaacac tattggtctg 30 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 11 gcacgaagga gcacggggag gcgggtcatg 30 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 12 gcagcaaggg gaacgctgat aggctgttg 29 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 13 cgcgcgtcag gcattcctca caattcttcg 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 14 gcagtggagc gagcacgggg acgttgttgg 30 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 15 gcagcaaggg ggaacgctga taggctgttg 30 <210> 16 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 16 gcacgaagga gcacgggagg cgggtcatg 29 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 17 ggtacacaac aggcaggcca taggattggg 30 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 18 tgggggcgta gattatctta gagcatgttg 30 <210> 19 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 19 gcacggaagg agcacgggga ggcgggtcat g 31 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Aptamer <400> 20 gcagggtacg agcacggggc cagcgagttg 30 <210> 21 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Library <400> 21 atgcggatcc cgcgcnnnnn nnnnnnnnnn nnnnngcgcg aagcttgcgc 50 <210> 22 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Library <400> 22 atgcggatcc cgcgcnnnnn nnnnnnnnnn nnnnnnnnnn nnnnngcgcg aagcttgcgc 60 60 <210> 23 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 atgcggatcc cgcgc 15 <210> 24 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gcgcaagctt cgcgc 15

Claims (9)

An aptamer that specifically binds to tranexamic acid. The aptamer according to claim 1, wherein the aptamer specifically binding to tranexamic acid binds to an aminomethyl group or a carboxylate group of tranexamic acid. The aptamer according to claim 1, wherein the aptamer specifically binding to tranexamic acid is one or more aptamers selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 1 to 20. The aptamer of claim 1, wherein the aptamer inhibits melanin production or inhibits the activity of tyrosinase. The aptamer according to claim 1, wherein the aptamer has a skin whitening, skin aging prevention, wrinkle removal, or moisturizing effect. A composition having a skin whitening, skin aging prevention, wrinkle removal, or skin moisturizing effect comprising the aptamer of any one of claims 1 to 5 as an active ingredient. The composition according to claim 6, wherein the content of the aptamer in the composition is 0.00001-1.0% by weight based on the total weight of the composition. The composition according to claim 6, wherein the content of tranexamic acid in the composition is 0.0001-10.0 wt% based on the total weight of the composition. 7. The group of claim 6, wherein said composition comprises solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansers, oils, powder foundations, emulsion foundations, wax foundations and sprays. A composition characterized in that it has a formulation selected from

Images