KR20220056037A - Composition for preventing, improving or treating obesity comprising tilianin or salts thereof, and uses thereof - Google Patents

Abstract

The present application relates to a composition containing tilianin or a salt thereof, and uses thereof. According to one embodiment, the composition containing tilianin or a salt thereof inhibits differentiation of preadipocytes into adipocytes and fat accumulation, and regulates the expression level of factors related to fat differentiation, and the like, thereby having excellent effects of preventing, alleviating, and treating obesity.

Description

The composition for preventing, improving or treating obesity comprising tilianin or salts thereof, and uses thereof, including tilianin or salts thereof, and uses thereof

The present application relates to a composition for preventing, improving or treating obesity, including thylianine or a salt thereof, and a use thereof.

According to the World Health Organization (WHO), the number of obese people worldwide has nearly tripled since 1975, and as of 2016, 1.9 billion adults were overweight, of which 650 million were obese. In addition, according to data from the National Statistical Office, the prevalence of obesity among adults 19 years of age and older in Korea increased by 3.1%p from 31.7% in 2007 to 34.8% in 2016, and as of 2017, about 33.7% of the population aged 15 and over were overweight or obese.

Obesity is caused by an imbalance in energy intake and consumption. Excessive energy accumulation in adipose tissue and excessive proliferation of fat cells due to obesity cause unbalanced energy metabolism, which causes cardiovascular diseases such as high blood pressure and arteriosclerosis, and increases the amount of triglycerides and LDL-cholesterol in the blood. By accumulating triglycerides in peripheral tissues and abdomen, it can cause various and serious complications. The World Health Organization (WHO) classifies obesity as a disease that requires treatment.

Methods using exercise or diet are used for the treatment of obesity, but in the case of busy modern people, obesity treatment or supplementation is mainly used. Currently, sibutramine (Reductil), phentermine, and orristat (Xenical) are being used, but caution is advised due to side effects such as increased blood pressure, abdominal pain, anxiety, constipation, insomnia, and headache. in need.

Accordingly, the development of an effective and fundamental anti-obesity treatment is required.

Republic of Korea Patent Registration No. 10-0454087

An example of the present application provides a pharmaceutical composition for preventing or treating obesity, comprising tilianin or a pharmaceutically acceptable salt thereof.

Another example of the present application provides a food composition for preventing or improving obesity, including thylianine or a salt thereof.

Another example of the present application provides a composition for inhibiting differentiation into adipocytes, comprising thylianine or a salt thereof.

Another example of the present application provides a method for inhibiting differentiation into adipocytes, comprising treating a sample with the composition for inhibiting differentiation.

One aspect may provide a pharmaceutical composition for preventing or treating obesity, comprising tilianin or a pharmaceutically acceptable salt thereof.

The thylianine is 5-hydroxy-2-(methoxyphenyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxane -2-yl]oxychromen-4-one (5-hydroxy-2-(4-methoxyphenyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6- (hydroxymethyl)oxan-2-yl]oxychromen-4-one) may be named, and is a compound of formula C ₂₂ H ₂₂ O ₁₀ , molecular weight 446.40 g/mol (CAS No. 4291-60-5), and the following formula It can have a structure of 1.

[Formula 1]

The thylianine or a salt thereof may be obtained by extraction and separation from a natural product, or may be prepared by a conventional organic synthesis method, but is not limited thereto.

In the present application, the "salt of tilianine" may mean a physiologically acceptable salt among salts, which are substances in which a cation and an anion are combined by electrostatic attraction, for example, a pharmaceutically acceptable salt, acceptable for food. It may mean an acceptable salt, and/or an acceptable salt for the composition for inhibiting differentiation. For example, the salt may be at least one selected from the group consisting of a metal salt, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, a salt with a basic or acidic amino acid, and the like. In one example, the metal salt may be at least one selected from the group consisting of alkali metal salts (sodium salts, potassium salts, etc.), alkaline earth metal salts (calcium salts, magnesium salts, barium salts, etc.), aluminum salts, and the like; Salts with organic bases include triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N,N-dibenzylethylenediamine, etc. It may be at least one selected from the group consisting of salts and the like; The salt with an inorganic acid may be at least one selected from the group consisting of salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, and the like; The salt with organic acid is at least one selected from the group consisting of salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc. can; The salt with a basic amino acid may be at least one selected from the group consisting of salts with arginine, lysine, ornithine, etc.; The salt with the acidic amino acid may be at least one selected from the group consisting of salts with aspartic acid, glutamic acid, and the like.

A composition (eg, a pharmaceutical composition, a food composition, and/or a composition for inhibiting differentiation) comprising thylianine or a pharmaceutically acceptable salt thereof according to an embodiment has a preventive, ameliorating, or therapeutic effect of obesity can be excellent

In the present application, the excellent prevention, improvement, or therapeutic effect of obesity may mean one or more selected from the group consisting of the following (1) to (5) compared to the control group:

(1) reduced differentiation of preadipocytes into adipocytes;

(2) reduced fat accumulation;

(3) a decrease in the expression level of factors related to adipogenesis;

(4) decreased expression level of fat synthesis-related factors; and

(5) Increased expression level of fat oxidation-related factors.

The control group may refer to an undifferentiated group or a negative control group that does not differentiate pre-adipocytes into adipocytes (treated group not treated with tilianine or a salt thereof, or treated with water or buffer). there is.

In one example, the preadipocytes may be 3T3-L1 cells derived from mouse embryos.

The adipogenic differentiation-related factor may refer to a factor required or increased in expression of preadipocytes to differentiate into adipocytes. When the composition according to an embodiment is treated, the expression of the adipogenic differentiation-related factor may be reduced. The adipogenic differentiation-related factor is, for example, PPARγ (Peroxisome proliferator-activated receptor gamma), C/EBPa (CCAAT/enhancer-binding protein alpha), and FABP4 (Fatty acid-binding protein 4) 1 selected from the group consisting of may be more than one species. The PPARγ can play a role as a major regulator causing differentiation into adipocytes, and is continuously expressed in adipocytes after differentiation has been completed, thereby playing a major role in maintaining the traits of adipocytes, and may also be involved in fat absorption. there is. The C/EBPa is a transcription factor expressing PPARγ and/or various adipocyte genes, and may serve as a regulator causing differentiation into adipocytes. The FABP4 may serve to transport fatty acids in adipocytes, and when differentiation into adipocytes progresses, the expression of FABP4 may increase.

The fat synthesis-related factor may refer to a factor that is required for fat synthesis or whose expression is increased when fat is synthesized.

When the composition according to an embodiment is treated, the expression of the fat synthesis factor and/or the synthesis of fat in adipocytes may be reduced. The fat synthesis-related factor may be, for example, at least one selected from the group consisting of Fatty acid synthase (FAS), Acetyl-CoA carboxylase (ACC), and sterol regulatory element-binding protein 1 (SREBP1). The FAS is a fatty acid synthase, and can synthesize fatty acids using malonyl CoA. The ACC can convert acetyl-CoA present in the cytoplasm of adipocytes into malonyl-CoA. The SREBP1 is a transcription factor, and when the expression of SREBP1 is increased, the activity of FAS can be promoted, and fatty acid synthesis can be promoted by the FAS whose activity is promoted. In addition, the SREBP1 may promote the synthesis of cholesterol by promoting the activity of HMG-CoA reductase, which is a key regulator of cholesterol synthesis.

The fat oxidation-related factor refers to a factor required when fat is oxidized. When the expression of the fat oxidation-related factor increases, the amount of fat accumulation may decrease.

When the composition according to an embodiment is treated, the expression of the fat oxidation-related factor may be increased and/or fat oxidation may be increased. The fat oxidation-related factor may be, for example, CPT-1 (Carnitine palmitoyltransferase I). The CPT-1 may serve to transport fatty acids to the mitochondria. The CPT-1 combines acyl-CoA (Acyl-CoA; for example, Acyl-CoA derived from fatty acids) present in the cytoplasm with a carnitine molecule to synthesize acyl-carnitine, and , the synthesized acylcarnitine can be oxidized within the mitochondria after passing through the mitochondrial inner wall.

In the present application, the increase and/or decrease in the expression (expression rate, expression level) of the adipogenic differentiation-related factor, the fat synthesis-related factor, or the fat oxidation-related factor means (1) transcription (transcription rate) of the gene encoding the factor. , transcription amount) increases and / or decreases to increase and / or decrease the amount of mRNA of the factors; and/or (2) the translation (translation rate, translation amount) of mRNA encoding the factors increases and/or decreases, thereby increasing and/or decreasing the amount of proteins of the factors.

In the present application, "prevention" refers to any action that suppresses or delays the onset of a disease by administration of the composition according to an embodiment, and "treatment" refers to an individual suspected and onset of a disease by administration of the composition according to an embodiment. means any action in which the symptoms are improved or beneficially changed, and "improvement" means any action that at least reduces a parameter related to a condition in which a disease is treated by administration of the composition according to an example, for example, at least the degree of the symptom can do. The disease may mean obesity.

In one embodiment, the thylianine or a salt thereof is 0.01 to 500 μM, 0.01 to 200 μM, 0.01 to 100 μM, 0.1 to 500 μM, 0.1 to 200 μM, 0.1 in a composition (eg, pharmaceutical composition, food composition, or composition for inhibiting differentiation) to 100 μM, 1-500 μM, 1-200 μM, 1-100 μM, 10-100 μM, 10-95 μM, 10-90 μM, 10-85 μM, 10-80 μM, 10-75 μM, 10-70 μM, 10-65 μM, 10-60 μM , 10-55 μM, 10-50 μM, 10-45 μM, 10-40 μM, 10-35 μM, 10-30 μM, 20-100 μM, 20-95 μM, 20-90 μM, 20-85 μM, 20-80 μM, 20-75 μM, 20 to 70 μM, 20 to 65 μM, 20 to 60 μM, 20 to 55 μM, 20 to 50 μM, 20 to 45 μM, 20 to 40 μM, 20 to 35 μM, 20 to 30 μM, 30 to 100 μM, 30 to 95 μM, 30 to 90 μM, 30 to 85 μM , 30-80 μM, 30-75 μM, 30-70 μM, 30-65 μM, 30-60 μM, 30-55 μM, 30-50 μM, 30-45 μM, 30-40 μM, 30-35 μM, 35-100 μM, 35-95 μM, 35 to 90 μM, 35 to 85 μM, 35 to 80 μM, 35 to 75 μM, 35 to 70 μM, 35 to 65 μM, 35 to 60 μM, 35 to 55 μM, 35 to 50 μM, 35 to 45 μM, 35 to 40 μM, 40 to 100 μM, 40 to 95 μM , 40-90 μM, 40-85 μM, 40-80 μM, 40-75 μM, 40-70 μM, 40-65 μM, 40-60 μM, 40-55 μM, 40 to 50 μM, 40 to 45 μM, 45 to 100 μM, 45 to 95 μM, 45 to 90 μM, 45 to 85 μM, 45 to 80 μM, 45 to 75 μM, 45 to 70 μM, 45 to 65 μM, 45 to 60 μM, 45 to 55 μM, 45 to 50 μM , 50-100 μM, 50-95 μM, 50-90 μM, 50-85 μM, 50-80 μM, 50-75 μM, 50-70 μM, 50-65 μM, 50-60 μM, 50-55 μM, 55-100 μM, 55-95 μM, 55 to 90 μM, 55 to 85 μM, 55 to 80 μM, 55 to 75 μM, 55 to 70 μM, 55 to 65 μM, 55 to 60 μM, 60 to 100 μM, 60 to 95 μM, 60 to 90 μM, 60 to 85 μM, 60 to 80 μM, 60 to 75 μM , 60 to 70 μM, 60 to 65 μM, 65 to 100 μM, 65 to 95 μM, 65 to 90 μM, 65 to 85 μM, 65 to 80 μM, 65 to 75 μM, 65 to 70 μM, 70 to 100 μM, 70 to 95 μM, 70 to 90 μM, 70 to 85 μM, 70 to 80 μM, 70 to 75 μM, 75 to 100 μM, 75 to 95 μM, 75 to 90 μM, 75 to 85 μM, 75 to 80 μM, 80 to 100 μM, 80 to 95 μM, 80 to 90 μM, 80 to 85 μM, 85 to 100 μM , 85 to 95 μM, 85 to 90 μM, 90 to 100 μM, 90 to 95 μM or 95 to 100 μM.

In one example, when thylianine or a salt thereof is included in the above range, the prevention, improvement, or treatment effect of obesity may be superior to that in the case of including thylianine and/or a salt thereof outside the above range.

The pharmaceutical composition according to one embodiment may be used as a single agent, and may be prepared and used as a combination by further including a pharmaceutical composition known to have an approved anti-obesity or therapeutic effect. A pharmaceutical unit dosage form may be formulated by adding a pharmaceutically acceptable carrier, excipient, or diluent.

In the present application, "pharmaceutically acceptable" means that it does not significantly stimulate the organism and does not impair the biological activity and properties of the administered active substance. According to an embodiment, the pharmaceutical composition comprising a pharmaceutically acceptable carrier is a tablet, pill, powder, granule, capsule, suspension, internal solution, emulsion, syrup, sterile aqueous solution, non-aqueous solution, suspension, emulsion , may have any one formulation selected from the group consisting of lyophilized formulations and suppositories.

The pharmaceutical composition may be in various oral or parenteral formulations. In the case of formulation, it can be prepared using a diluent or excipient such as a filler, extender, binder, wetting agent, disintegrant, surfactant, etc. commonly used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include one or more compounds and at least one excipient, for example, starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, etc. can be mixed to prepare it. In addition to simple excipients, lubricants such as magnesium stearate, talc and the like may also be used. Liquid preparations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is.

Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.

In one example, the pharmaceutical composition is in various forms, such as oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and injections of sterile injection solutions, according to conventional methods for each purpose of use. It can be formulated and used, and it can be administered orally or through various routes including intravenous, intraperitoneal, subcutaneous, rectal, topical administration, and the like.

In one embodiment, the pharmaceutical composition may further include a carrier, excipient, or diluent, and examples of suitable carriers, excipients or diluents that may be included include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol. , maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, amorphous cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate lactate, mineral oil, and the like. In addition, the pharmaceutical composition may further include a filler, an anti-agglomeration agent, a lubricant, a wetting agent, a fragrance, an emulsifier, a preservative, and the like.

According to an example, the effective amount of the active ingredient (tilianine and/or its salt) in the pharmaceutical composition may vary depending on the age, sex, and weight of the patient, and generally 0.001 to 0.01 mg/kg of body weight, 0.001 to 0.1 mg/kg, 0.001 to 1 mg/kg, 0.001 to 10 mg/kg, 0.001 to 100 mg/kg, 0.001 to 500 mg/kg, 0.001 to 1000 mg/kg, 0.001 to 10000 mg/kg, 0.01 to 0.1 mg/kg, 0.01 to 1 mg/kg, 0.01 to 10 mg/kg, 0.01 to 100 mg/kg, 0.01 to 500 mg/kg, 0.01 to 1000 mg/kg, 0.01 to 10000 mg/kg, 0.1 to 1 mg/kg, 0.1 to 10 mg/kg, 0.1 to 100 mg/kg, 0.1 to 500 mg/kg, 0.1 to 1000 mg/kg, 0.1 to 10000 mg/kg, 1 to 10 mg/kg, 1 to 100 mg/kg, 1 to 500 mg/kg, 1 to 1000 mg/kg, 1 to 10000 mg/kg kg, 10 to 100 mg/kg, 10 to 500 mg/kg, 10 to 1000 mg/kg, 10 to 10000 mg/kg, 100 to 500 mg/kg, 100 to 1000 mg/kg, 100 to 10000 mg/kg, 500 to 1000 mg/kg, 500 to 10000 mg/kg or 1000 to 10000 mg/kg may be administered in divided doses 1 to 3 times a day.

However, since the dosage may be increased or decreased according to the route of administration, disease severity, sex, weight, age, etc., the dosage is not intended to limit the scope of the present application in any way.

In one embodiment, the pharmaceutical composition may be administered to a subject through various routes. The mode of administration may be by any route commonly used, for example, oral, rectal, intravenous, intramuscular, subcutaneous, intrauterine dural, intraperitoneal, or intracerebroventricular injection may be administered. .

The subject to which an effective amount of the composition or active ingredient (tilianine and/or a salt thereof) is administered is a mammal, including humans, dogs, cats, horses, cattle, pigs, goats, rabbits, mice, rats, or the like. It may be an isolated cell, tissue, or a culture thereof, and the like.

In the present application, "administration" means providing a predetermined substance to an individual (patient) by any suitable method, and the administration route of the pharmaceutical composition is orally through all routes as long as it can reach the target tissue. or parenterally. The mode of administration may be by any route commonly used, for example, oral administration, or parenteral administration such as intravenous administration, intramuscular administration, subcutaneous administration, intraperitoneal administration, local administration to the lesion site. In addition, the composition according to an embodiment may be administered using any device capable of delivering an active ingredient to a target cell.

Another aspect may provide a food composition for preventing or improving obesity, including tilianin or a salt thereof (a salt of tilianin).

The food composition may be used as a health functional food through its own formulation, or may be included in other health functional food as an additive to a health functional food. Health functional food refers to food that has biological control functions such as disease prevention or improvement, biological defense, immunity, recovery from illness, and aging suppression. The mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).

There is no particular limitation on the type of the food. Examples of foods to which the above substance can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and includes all health functional foods in the ordinary sense.

The food composition (eg, health functional food) includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic or natural flavoring agents, coloring agents, thickeners (cheese, chocolate, etc.), pectic acid or salts thereof , alginic acid or salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, etc. It may further contain at least one selected from the group consisting of. The ratio of these additives is generally selected from about 0.00001 to about 20 parts by weight per 100 parts by weight of the total health functional food, but is not limited thereto.

The concentration of thylianine or a salt thereof included in the food composition is the same as described above in the pharmaceutical composition.

Another aspect may provide a composition for inhibiting differentiation into adipocytes, comprising tilianin or a salt thereof (a salt of tilianin).

In one example, the composition for inhibiting differentiation may inhibit differentiation from preadipocytes into adipocytes. The inhibition of the differentiation of the preadipocytes into adipocytes may mean inhibiting the accumulation of fat (eg, lipid droplets) generated when the preadipocytes differentiate into adipocytes. The preadipocytes may have a fibroblast-like shape, and the adipocytes may have a round shape The preadipocytes and/or adipocytes may contain markers expressed in each cell (eg, PPARγ, C/ EBPα, FABP4, FAS, ACC, can be distinguished through the level of one or more selected from the group consisting of SREBP1 and CPT-1).

In one embodiment, the preadipocytes may have the following characteristics compared to adipocytes: (i) low expression levels of factors related to adipogenesis and/or factors related to adipogenesis; and/or (ii) high expression levels of fat oxidation-related factors.

In one embodiment, the adipocytes may have the following characteristics compared to the preadipocytes: (i) high expression levels of adipocyte differentiation-related factors and/or adipocyte synthesis-related factors; and/or low expression levels of fat oxidation-related factors.

In the present application, the excellent effect of reducing differentiation into adipocytes may mean at least one selected from the group consisting of the following (1) to (4) as compared to the control group:

(1) reduced fat accumulation;

(2) decreased expression level of adipogenic differentiation-related factors;

(3) decreased expression level of fat synthesis-related factors; and

(4) increased expression of fat oxidation-related factors.

In one example, the composition for inhibiting differentiation may inhibit adipocyte differentiation promoted when an inducer for inducing adipocyte differentiation is treated. The inducer may be one that promotes (induces) differentiation from conventionally known preadipocytes into adipocytes, for example, insulin, dexamethasnone, 3-isobutyl-1-methylxanthine (3). -Isobutyl-1-methylxanthine), a high fat diet, or a combination thereof.

The concentration of thylianine or a salt thereof included in the composition for inhibiting differentiation is the same as described above in the pharmaceutical composition.

In one example, the composition for inhibiting differentiation may be applied in vitro .

Another aspect may provide a method for inhibiting differentiation into adipocytes, comprising treating a sample with the composition for inhibiting differentiation.

In one embodiment, the method for inhibiting differentiation may be to inhibit the differentiation of adipocytes into adipocytes, for example, the inhibition of differentiation may be performed in vitro .

In one example, treating the sample with the composition for inhibition of differentiation has a final concentration of the composition for inhibition of differentiation of 0.01 to 500 μM, 0.01 to 200 μM, 0.01 to 100 μM, 0.1 to 500 μM, 0.1 to 200 μM, 0.1 to 100 μM, 1 to 500 μM, 1-200 μM, 1-100 μM, 10-100 μM, 10-95 μM, 10-90 μM, 10-85 μM, 10-80 μM, 10-75 μM, 10-70 μM, 10-65 μM, 10-60 μM, 10-55 μM, 10-50 μM, 10-45 μM, 10-40 μM, 10-35 μM, 10-30 μM, 20-100 μM, 20-95 μM, 20-90 μM, 20-85 μM, 20-80 μM, 20-75 μM, 20-70 μM, 20- 65 μM, 20-60 μM, 20-55 μM, 20-50 μM, 20-45 μM, 20-40 μM, 20-35 μM, 20-30 μM, 30-100 μM, 30-95 μM, 30-90 μM, 30-85 μM, 30-80 μM, 30 to 75 μM, 30 to 70 μM, 30 to 65 μM, 30 to 60 μM, 30 to 55 μM, 30 to 50 μM, 30 to 45 μM, 30 to 40 μM, 30 to 35 μM, 35 to 100 μM, 35 to 95 μM, 35 to 90 μM, 35 to 85 μM, 35-80 μM, 35-75 μM, 35-70 μM, 35-65 μM, 35-60 μM, 35-55 μM, 35-50 μM, 35-45 μM, 35-40 μM, 40-100 μM, 40-95 μM, 40-90 μM, 40-85 μM, 40-80 μM, 40-75 μM, 40-70 μM, 40-65 μM, 40-60 μM, 40-55 μM, 40-50 μM, 40 to 45 μM, 45 to 100 μM, 45 to 95 μM, 45 to 90 μM, 45 to 85 μM, 45 to 80 μM, 45 to 75 μM, 45 to 70 μM, 45 to 65 μM, 45 to 60 μM, 45 to 55 μM, 45 to 50 μM, 50 to 100 μM, 50-95 μM, 50-90 μM, 50-85 μM, 50-80 μM, 50-75 μM, 50-70 μM, 50-65 μM, 50-60 μM, 50-55 μM, 55-100 μM, 55-95 μM, 55-90 μM, 55 to 85 μM, 55 to 80 μM, 55 to 75 μM, 55 to 70 μM, 55 to 65 μM, 55 to 60 μM, 60 to 100 μM, 60 to 95 μM, 60 to 90 μM, 60 to 85 μM, 60 to 80 μM, 60 to 75 μM, 60 to 70 μM, 60-65 μM, 65-100 μM, 65-95 μM, 65-90 μM, 65-85 μM, 65-80 μM, 65-75 μM, 65-70 μM, 70-100 μM, 70-95 μM, 70-90 μM, 70-85 μM, 70 to 80 μM, 70 to 75 μM, 75 to 100 μM, 75 to 95 μM, 75 to 90 μM, 75 to 85 μM, 75 to 80 μM, 80 to 100 μM, 80 to 95 μM, 80 to 90 μM, 80 to 85 μM, 85 to 100 μM, 85 to 95 μM, 85 to 90 μM, 90 to 100 μM, 90 to 95 μM, or 95 to 100 μM.

In one example, when the sample is treated with the composition for inhibiting differentiation at a concentration within the above range, the effect of inhibiting differentiation into adipocytes may be superior to that of treatment at a concentration outside the above range.

The sample may be isolated cells and/or tissues, for example, the cells may be preadipocytes (eg, 3T3-L1).

In one example, inhibiting the differentiation may mean one or more selected from the group consisting of the following (1) to (4):

(1) reduction of fat accumulation in a sample (eg, cells);

(2) decreased expression level of adipogenic differentiation-related factors;

(3) decreased expression level of fat synthesis-related factors; and

(4) increased expression of fat oxidation-related factors.

In one example, the sample may further include an adipocyte differentiation inducing agent or may have been treated with a differentiation inducing agent, and the composition for inhibiting differentiation according to an example is added to a sample further containing a differentiation inducing agent or treated with a differentiation inducing agent. During the treatment, it may be to inhibit the promotion (induction) of differentiation into adipocytes by the differentiation inducer. In one embodiment, the differentiation inducer is insulin, dexamethasnone, 3-isobutyl-1-methylxanthine, high fat diet, or a combination thereof. can In one example, the sample may be cells (eg, differentiation-induced adipocytes, etc.), tissue, or a culture thereof isolated from an animal subject to a high fat diet. In one example, the animal may be a mammal including a human, a dog, a cat, a horse, a cow, a pig, a goat, a rabbit, a mouse, and/or a rat.

In one embodiment, inhibiting the differentiation may mean one or more selected from the group consisting of the following (1) to (4):

(1) reduction of fat accumulation increased by inducers;

(2) a decrease in the expression level of adipogenic differentiation-related factors increased by the inducer;

(3) a decrease in the expression level of a fat synthesis-related factor increased by an inducer; and

(4) The expression level of fat oxidation-related factors decreased by the inducer increased.

Another aspect is a method for reducing the expression of factors related to adipocyte differentiation, which is increased by an inducer, comprising the step of treating the composition for inhibiting differentiation in preadipocytes; a method for reducing the expression of fat synthesis-related factors increased by an inducer; and/or a method for increasing the expression of a factor related to fat oxidation that is reduced by an inducer. The method may be applied in vitro.

The expression may refer to the expression of a protein and/or a nucleic acid molecule encoding the factor.

The present application relates to a composition containing thylianine or a salt thereof, and a use thereof, and the composition containing thylianine or a salt thereof according to an embodiment inhibits differentiation of adipocytes from preadipocytes and fat accumulation and adipogenic differentiation It regulates the expression level of factors related to the back, and is excellent in preventing, improving and treating obesity.

1a to 1c show the cell viability (%) when thylianine was treated at various concentrations (10 to 100 μM) in 3T3-L1 cells of preadipocytes, the X-axis represents the concentration of tilianine, and the Y-axis represents the cell viability. . Specifically, FIGS. 1A, 1B and 1C show cell viability when 3T3-L1 cells were treated with thylianine for 24 hours, 48 hours and 72 hours, respectively.
The upper graph of FIG. 2 shows the fat accumulation rate (%) of 3T3-L1 cells when thylianine was treated at various concentrations (10 to 100 μM) in 3T3-L1 cells of preadipocytes. The X-axis represents the ND (undifferentiated group), CON (control, control) and sample treatment groups (tilianine 10, 30, 50, 70 and 100 μM treated groups), and the Y axis represents the amount of fat accumulation.
The lower photograph of FIG. 2 is a photograph of 3T3-L1 cells treated with tilianine of FIG. 2a stained with Oil Red O dye, and shows the effect of inhibiting differentiation of 3T3-L1 cells into adipocytes.
3A to 3G show the results of confirming the mRNA expression level of 3T3-L1 cells of preadipocytes when thylianine was treated at various concentrations (10 to 100 μM) in 3T3-L1 cells of preadipocytes. The X-axis represents the ND (undifferentiated group), CON (control, control) and sample treatment groups (tilianine 10, 30, 50, 70 and 100 μM treated groups), and the y-axis represents the relative mRNA expression level. Specifically, FIGS. 3A to 3F show the inhibitory effect of PPARγ, C/EBPa, FABP4, SREBP1, ACC and FAS genes, respectively, and FIG. 3G shows the expression promoting effect of the CPT-1 gene.
2 and 3A to 3G, when a statistically significant difference occurred at a level of P<0.05 through one-way analysis of variance with Duncan's test, different alphabets were used. As a statistical program, SPSS v26.0 software (SPSS, Inc., Chicago, IL, USA) was used.

The present application will be described in more detail with reference to the following examples, but the scope of the rights is not limited to the following examples.

Example 1. Cytotoxicity test of tilianine

Example 1-1. Experimental Design

Tilianine was purchased from Ensol Bioscience Co., Ltd. and used. Preadipocytes 3T3-L1 cells were purchased from ATCC (American Type Culture Collection) and used. DMEM medium (Dulbecco's Modified Eagle's) containing 10% BCS (Bovine Calf Serum) and 1% Penicillin-Streptomycin (hereinafter referred to as 'P/S') until differentiation into adipocytes is induced. Medium) was used, and cultured in an incubator of 37° C., 5% CO ₂ conditions.

Example 1-2. Results of cytotoxicity experiments of tilianine

To analyze the effect of thylianine on the survival of 3T3-L1 cells, MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay was performed.

3T3-L1 cells cultured as in Example 1-1 were inoculated with DMEM medium (10% BCS, 1% P/S) in a 96-well culture dish at 1×10 ⁴ cells/ml at 100 μl, and 24 hours After culturing in an incubator for a while, thylianine dissolved in DMSO was treated with 10, 25, 50, 75 and 100 μM and cultured for 24, 48 and 72 hours in an incubator of 37° C., 5% CO ₂ conditions.

After removing the residual material using PBS, the final MTT concentration was 0.5 mg/ml, treated by 200 μl and cultured. After 4 hours, the culture medium was removed, 100 μl of DMSO was injected, and after reacting at room temperature for 30 minutes, absorbance was measured at 570 nm. The control group proceeded in the same manner as the sample treatment group except that DMSO of the same concentration was treated instead of the sample.

This experiment was repeated a total of 6 times, and cell viability was calculated according to Equation 1 below, and the results are shown in FIG. 1 .

(Equation 1)

Cell viability (%) = (absorbance of sample treatment group / absorbance of control group) × 100

As shown in FIGS. 1A to 1C , tilianine did not significantly affect the survival of 3T3-L1 cells, so it can be seen that it does not exhibit toxicity to 3T3-L1 cells.

Example 2. Tilianine Adipocyte Differentiation Inhibitory Activity Experiment

In order to analyze the effect of tilianine on the inhibition of adipocyte differentiation, Oil Red O staining method that specifically responds to lipid droplets was used.

The 3T3-L1 cells cultured as in Example 1-1 were inoculated by 1.2 ml at 1×10 ⁴ cells/ml using DMEM medium (10% BCS, 1% P/S) in a 12-well culture dish, and 100 At the time of % confluent, it was incubated for 2 more days. After removing the old medium every 2 days while culturing the cells, 1.5 ml of a new medium was added to replace the medium.

In the medium cultured for 2 more days, the medium was removed and DMEM containing MDI [(0.5 mM IBMX (3-isobutyl-1-methylxanthine), 1 μM dexamethasone and 1 μg/ml insulin]] 2 ㎖ of medium (10% FBS (fetal bovine serum), 1% P/S) was added, and thylianine was added to various concentrations (10, 30, 50, 70 and 100 μM) and cultured for 2 days.

In the medium cultured for 2 days in DMEM medium containing the MDI, the medium was removed and 2 ml of DMEM medium (10% FBS, 1% P/S) containing 1 μg/ml insulin was added, and thylianine was added to the Concentrations (10, 30, 50, 70 and 100 μM) were added and cultured for 4 days to induce differentiation into adipocytes. After removing the old medium every 2 days while culturing the cells, 2 ml of a new medium was added to replace the medium.

The medium was removed and left at room temperature for 5 minutes using 10% formalin, and 1 ml/well of fresh 10% formalin was injected and fixed at room temperature for 1 hour. After that, the remaining formalin is removed using 1ml of 50% isopropanol, and 1ml of Oil Red O dye (60% Oil red O Stock, 40% sterile distilled water) is treated in each well at room temperature for 1 hour. Fat was stained. After removing residual Oil Red O dye using sterile distilled water, it was dried for more than half a day. 500 μl/well of 100% isopropanol was injected to elute Oil Red O dye dyed in fat in adipocytes, and absorbance was measured at 485 nm.

Unlike the sample treatment group, the undifferentiated group (ND) used DMEM medium (10% BCS, 1% P/S) that did not contain MDI, and the control group was the sample treatment group except that tilianine was not treated. The experiment was conducted in the same way as

The amount of lipid accumulation (%) was calculated according to Equation 2 below, and the result is shown in FIG. 2 .

(Equation 2)

Fat accumulation (%) = (absorbance in sample treatment group / absorbance in control group) × 100

As shown in the upper graph of FIG. 2 , it can be confirmed that tilianine inhibits fat accumulation in a concentration-dependent manner in the 30 to 70 μM section. In addition, as shown in the lower photo of FIG. 2 , it was confirmed that tilianine effectively inhibited the differentiation of preadipocytes into adipocytes in the above concentration range.

Example 3. Tilianine Adipocyte Differentiation Regulation Transcription Factor Regulation Experiment

Differentiation was induced in 12 wells of preadipocytes inoculated by 1.2 ml at 1×10 ⁴ cells/ml in the same manner as in Example 2, and tilianine was added by concentration (10, 30, 50, 70 and 100 μM during the differentiation period). ) was treated. Then, it was washed twice with PBS (phosphate buffered saline), and RNA was extracted using the AccuPrep Universal RNA Extraction Kit (Bioneer) as specified in the protocol by the manufacturer. Specifically, after mixing β-mercaptoethanol in RB buffer to 1%, put 400 μl into each well, lysate the cells, transfer to a 1.7 mL EP tube, and inject 300 μl of 80% ethanol and mixed using a pipette. This was transferred to AccuPrep Binding Column-Ⅲ and centrifuged at 14,000 rpm for 30 seconds. Using 700 μl of RWA1 buffer and 500 μl of RWA2 buffer, centrifugation was performed at 14,000 rpm for 30 seconds, respectively, and washed, followed by centrifugation with 500 μl of RWA2 buffer at 14,000 rpm for 2 minutes. After that, centrifugation was further performed for 1 minute to completely remove ethanol, and it was confirmed that there is no ethanol remaining in the column and dried at room temperature for 30 minutes. After injecting 100 μl of ER buffer and reacting for 10 minutes, RNA was obtained by extraction at 10,000 rpm for 1 minute.

After quantifying the isolated RNA, cDNA was synthesized according to the protocol using Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo scientific), a reverse transcription chain polymerization reaction kit. Specifically, for the reverse transcription reaction, 1000ng of total RNA, 4 μl of 5x Reaction Mix, 2 μl of Maxima Enzyme Mix and Nuclease free water were mixed to make a total of 20 μl, and reacted at 25° C. for 10 minutes, 50° C. for 15 minutes, and 85° C. for 5 minutes. cDNA synthesis was completed.

Real-time polymerase chain reaction (qPCR) is performed to amplify genes such as PPARγ, C/EBPa, FABP4, SREBP1, ACC, FAS, CPT-1, and β-actin, 4 μl of cDNA, primers for each factor (Forward and Reverse ), each 1 μl, Maxima SYBR Green/Fluorescein qPCR Mater mix (Thermo scientific) 10 μl was mixed and distilled water was used to prepare a total of 20 μl, followed by 95° C. 30 seconds, 60° C. 30 seconds, 72° C. 1 minute. It was set and reacted for 20 to 30 cycles. The sequences of the primers used are shown in Table 1 below.

primer Base sequence (5'→3') SEQ ID NO: PPARγ Forward CGGAAGCCCTTTGGTGACTTTATG SEQ ID NO: 1 Reverse GCAGCAGGTTGTCTTGGATGTC SEQ ID NO:2 C/EBPa Forward CGGGAACGCAACAACATCGC SEQ ID NO:3 Reverse TGTCCAGTTCACGGCTCAGC SEQ ID NO: 4 FABP4 Forward TGGGAACCTGGAAGCTTGTCTC SEQ ID NO:5 Reverse GAATTCCACGCCCAGTTTGA SEQ ID NO:6 SREBP1 Forward CCCTGTGTGTACTGGCCTTT SEQ ID NO:7 Reverse ACGGTGTGTACCCGTAGCAT SEQ ID NO:8 ACC Forward GAAGTCAGAGCCACGGCACA SEQ ID NO: 9 Reverse GGCAATCTCAGTTCAAGCCAGTC SEQ ID NO:10 FAS Forward TGGGCATAACGGTCTCTGGT SEQ ID NO: 11 Reverse TCCATGTGCGGTGGTGAAAAC SEQ ID NO: 12 CPT-1 Forward ACTCCTGGAAGAAGAAGTTCAT SEQ ID NO: 13 Reverse AGTATCTTTGACAGCTGGGAC SEQ ID NO: 14 β-actin Forward TGAGAGGGAAATCGTGCGTGAC SEQ ID NO: 15 Reverse GCTCGTTGCCAATAGTGATGACC SEQ ID NO: 16

The relative mRNA expression level was calculated according to Equation 3 below, and the results are shown in FIGS. 3A to 3G .

(Equation 3)

Relative mRNA expression level = (sample treated group mRNA expression level / control group mRNA expression level)

As shown in Figures 3a to 3g, in the tilianine 30 to 70 μM interval, the relative mRNA expression levels of FABP4 and C/EBPa, adipogenesis-related factors, SREBP1, ACC and FAS, which are factors related to adipogenesis, decreased in a concentration-dependent manner, It was confirmed that the relative mRNA expression level of the adipogenic differentiation-related factor PPARγ was significantly decreased. In addition, it was confirmed that the relative mRNA expression level of the fat oxidation-related factor CPT-1 increased in a concentration-dependent manner in the 30 to 70 μM thylianine section.

<110> Ewha University - Industry Collaboration Foundation NewTree Co., Ltd. <120> Composition for preventing, improving or treating obesity comprising tilianin or salts thereof, and uses thereof <130> DPP20202370KR <160> 16 <170> enPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PPAR gamma Forward primer <400> 1 cggaagccct ttggtgactt tatg 24 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PPAR gamma Reverse primer <400> 2 gcagcaggtt gtcttggatg tc 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C-EBP alpha Forward primer <400> 3 cgggaacgca acaacatcgc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C-EBP alpha reverse primer <400> 4 tgtccagttc acggctcagc 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FABP4 Forward primer <400> 5 tgggaacctg gaagcttgtc tc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FABP4 Reverse primer <400> 6 gaattccacg cccagtttga 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBP1 Forward primer <400> 7 ccctgtgtgt actggccttt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBP1 Reverse primer <400> 8 acggtgtgta cccgtagcat 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACC Forward primer <400> 9 gaagtcagag ccacggcaca 20 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ACC Reverse primer <400> 10 ggcaatctca gttcaagcca gtc 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS Forward primer <400> 11 tgggcataac ggtctctggt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS Reverse primer <400> 12 tccatgtgcg gtgtgaaaac 20 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CPT-1 Forward primer <400> 13 actcctggaa gaagaagttc at 22 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CPT-1 Reverse primer <400> 14 agtatctttg acagctggga c 21 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> beta-actin Forward primer <400> 15 tgagagggaa atcgtgcgtg ac 22 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse primer <400> 16 gctcgttgcc aatagtgatg acc 23

Claims (13)

A pharmaceutical composition for preventing or treating obesity, comprising tilianin or a pharmaceutically acceptable salt thereof. The pharmaceutical composition of claim 1, wherein the thylianine or a pharmaceutically acceptable salt thereof is included in a concentration of 30 to 70 μM. The pharmaceutical composition according to claim 1, wherein the prevention or treatment of obesity is at least one selected from the group consisting of the following (1) to (5):
(1) reduced differentiation of preadipocytes into adipocytes;
(2) reduced fat accumulation;
(3) a decrease in the expression level of factors related to adipogenesis;
(4) decreased expression level of fat synthesis-related factors; and
(5) Increased expression level of fat oxidation-related factors. The pharmaceutical composition according to claim 3, wherein the preadipocytes are 3T3-L1 cells. The method of claim 3, wherein the adipogenic differentiation-related factor is selected from the group consisting of PPARγ (Peroxisome proliferator-activated receptor gamma), C/EBPa (CCAAT/enhancer-binding protein alpha), and FABP4 (Fatty acid-binding protein 4). One or more of which is, a pharmaceutical composition . The method according to claim 3, wherein the fat synthesis-related factor is at least one selected from the group consisting of Fatty acid synthase (FAS), Acetyl-CoA carboxylase (ACC), and sterol regulatory element-binding protein 1 (SREBP1). pharmaceutical composition. The pharmaceutical composition of claim 3, wherein the fat oxidation-related factor is CPT-1 (Carnitine palmitoyltransferase I). A food composition for preventing or improving obesity, comprising tilianin or a salt thereof. The food composition according to claim 8, wherein the thylianine or a salt thereof is included in a concentration of 30 to 70 μM. A composition for inhibiting differentiation into adipocytes, comprising tilianin or a salt thereof. The composition for inhibiting differentiation according to claim 10, wherein the composition inhibits differentiation from preadipocytes into adipocytes. The composition for inhibiting differentiation according to claim 10, wherein the thylianine or a salt thereof is included in a concentration of 30 to 70 μM. A method for inhibiting differentiation into adipocytes, comprising treating the sample according to any one of claims 10 to 12.

Images