KR20220043684A - Methods and Compositions for Conferring and/or Enhancing Glyphosate Tolerance of Soybean - Google Patents

Abstract

The present invention relates to a plant herbicide resistance enhancement technology and, more specifically, to a technology for enhancing and/or imparting resistance to the glyphosate of soybean by introducing a mutation in 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) coding gene from the soybean.

Description

Compositions and methods for enhancing and/or conferring glyphosate resistance of soybeans

It relates to the herbicide resistance enhancement technology of plants, and more specifically, introduces a mutation in the soybean 5-enol-pyruvylshikimate-3-phosphate synthase (5-enol-pyruvylshikimate-3-phosphate synthase; EPSPS) coding gene Thus, there is provided a technology for enhancing and / or imparting resistance to glyphosate of soybeans.

The development of herbicide-tolerant crops is an important technology that enables quick and easy large-scale weeding operations, contributing to improvement of food productivity and increased income of farmers. In particular, in the case of large-scale cultivation that cannot be done manually, by introducing and cultivating herbicide-resistant crops, it is possible to mass-spray the herbicide using a tractor or a light aircraft, thereby greatly improving productivity.

On the other hand, glyphosate (glyphosate) inhibits 5-enol-pyruvylshikimate-3-phosphate synthase (EPPSPS), an essential enzyme of the pathway for producing aromatic amino acids. It is a herbicide. Glyphosate has grown rapidly since the introduction of glyphosate-resistant crops in 1996 and is now one of the most widely used herbicides worldwide. am. As the amount of glyphosate rapidly increased due to the excellent weeding effect of glyphosate, glyphosate-resistant weeds appeared as a side effect. is occurring

In order to solve this, the development of a technology for further improving the resistance of crops to glyphosate is required.

In the present specification, by introducing a mutation in the 5-enol-pyruvylshikimate-3-phosphate synthase (5-enol-pyruvylshikimate-3-phosphate synthase; EPSPS) coding gene inherent in soybean, glyphosate ( A technique for enhancing and/or imparting resistance to glyphosate) is provided.

One example is 1 or more or 2 or more, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 in the amino acid sequence of the EPSPS protein of soybean , 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 amino acids are mutated amino acid sequence It provides a polypeptide comprising.

For example, the polypeptide comprises (1) an amino acid residue corresponding to position 183 of soybean EPSPS protein (NCBI Accession No. XP_003517039.1; SEQ ID NO: 1), or (2) (i) an amino acid corresponding to position 183 residues and (ii) the 31st, 48th, 67th, 81st, 151st, 161st, 163th, 166th, 170th, 184th, 191th, 199th, 221th, 229th, 251th; At least one selected from the 253th, 276th, 278th, 292th, 294th, 307th, 309th, 373th, 359th, 424th, and 445th positions (eg, 31st, 48th, 67th, 81st, 151st, 161st, 166th, 170th, 184th, 191th, 199th, 221th, 229th, 251th, 253th, 276th, 278th, 292th, 294th, 307th , 309th, 373th, 359th, and at least one selected from the 445th position) may be a mutated amino acid residue.

The mutation of the amino acid residue may be substitution (amino acid substitution), deletion, and/or addition of an amino acid at the corresponding position with an amino acid different from the original, for example, an amino acid substitution.

Another example provides a polynucleotide encoding the polypeptide.

Another example provides a recombinant vector comprising the polynucleotide.

Another example provides a recombinant cell comprising the recombinant vector.

Another example is glyphosate resistance conferring and / including at least one selected from the group consisting of the polypeptide, a polynucleotide encoding the same, a recombinant vector comprising the polynucleotide, and a recombinant cell comprising the recombinant vector Or it provides a composition for enhancement.

Another example is the polypeptide, the polynucleotide encoding it, a recombinant vector containing the polynucleotide, and glyphosate resistance comprising at least one selected from the group consisting of a recombinant cell containing the recombinant vector, and / or to provide a composition for the production of enhanced soybeans or for imparting and/or enhancing glyphosate resistance of soybeans.

Another example is to introduce the polypeptide or a polynucleotide encoding the same into soybeans, a method for producing soybeans with enhanced and/or conferred glyphosate resistance, or a method for enhancing and/or conferring glyphosate resistance of soybeans to provide.

In one embodiment, the method comprises:

(1) introducing a mutation encoding an amino acid mutation (substitution) contained in the polypeptide into the EPSPS-encoding gene inherent in soybean, or

(2) introducing a polynucleotide encoding the polypeptide described above or a recombinant vector comprising the same into soybean, (i) in addition to the EPSPS encoding gene inherent in the bean, further comprising a polynucleotide encoding the polypeptide or (ii) all or part of the polynucleotide encoding the polypeptide (a portion corresponding to a portion of the endogenous EPSPS encoding gene of the bean) It may include the step of transforming to be substituted (replaced) with.

Another example provides soybean (transgenic soybean) comprising the polypeptide or a polynucleotide encoding the same.

In one example, the transgenic soybean contains an endogenous EPSPS-encoding gene into which a mutation is introduced to encode the polypeptide, or a polynucleotide encoding the polypeptide by replacing the endogenous EPSPS-encoding gene, or endogenous In addition to the EPSPS-encoding gene, it may further include a polynucleotide encoding the polypeptide.

In one embodiment, the transgenic soybean may be prepared by the method for producing soybeans with enhanced and/or conferred glyphosate resistance described above, or the method for enhancing and/or imparting glyphosate resistance of soybeans. .

Another example is a transgenic soybean comprising the polypeptide, a polynucleotide encoding the same, or a combination thereof, or a soybean cultivation method comprising the step of applying an effective amount of glyphosate to a cultivation area provided with the transgenic soybean, or A method for removing unwanted organisms in soybean cultivation is provided. The method for removing the unwanted organisms may be a method for removing weeds.

In the present specification, a random mutation is introduced into the EPSPS sequence of soybean (Glycine max) using a DNA polymerase with low DNA replication accuracy, and this is prepared as a plasmid-type library, and the prepared library is used as EPSPS (5- enol-pyruvylshikimate-3-phosphate synthase) was transformed into an E. coli strain deleted and cultured in M9 minimal medium supplemented with glucose and glyphosate. E. coli clones that grow in the existing environment were selected, and it was confirmed that they had glyphosate-resistant EPSPS mutations. By inoculating the selected clones in a broth containing glyphosate, and comparing the growth degree with E. coli containing wild-type EPSPS, it was confirmed once again that they had resistance to glyphosate, and resistance was particularly Excellent clones were selected. In addition, it was confirmed that herbicide resistance was obtained when the mutated EPSPS-encoding gene included in the selected clones was introduced into soybeans. In the present specification, by analyzing the EPSPS sequence of the selected clone, EPSPS variants contributing to glyphosate resistance of soybeans and uses thereof are proposed.

In the present specification, a technique for imparting and/or enhancing resistance to a herbicide (specifically, glyphosate) to a plant (specifically, soybean) is provided.

In the present specification, 'conferring and/or enhancing resistance to glyphosate of soybeans' or 'promoting resistance to glyphosate of soybeans' means imparting resistance to soybeans that are not resistant to glyphosate, or glyphosate It can be interpreted as a broad meaning encompassing all of or improving the resistance of soybeans resistant to ifosate.

In the present specification, 'consisting of a predetermined sequence', 'consisting essentially of a predetermined sequence' or 'comprising a predetermined sequence' refers to all cases including the described sequence or essentially including the sequence. It is used to mean, and it is not to be construed as intended to exclude sequences other than the described sequences or include mutations as long as the original functions are maintained.

In the present specification, 'a protein or polypeptide comprising or consisting of the amino acid sequence defined by the SEQ ID NO:' and 'a gene or polynucleotide comprising or consisting of the nucleic acid sequence defined by the SEQ ID NO: (1) or (2) 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more of the sequence of the SEQ ID NO: a protein (or polypeptide) comprising a sequence having at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence homology; or can be construed to mean a gene (or polynucleotide). The polypeptide or polynucleotide comprising the sequence having the sequence homology of (2) above while maintaining the function (eg, original enzymatic activity) of the original (including 100% identical sequence) of the polypeptide, the purpose of the present specification It may be a polypeptide having a function of enhancing and/or conferring glyphosate resistance of a plant (soybean) or a polynucleotide encoding the same. Retaining the function of the polypeptide means, for example, as measured in plants (in plants, in plant cells or in plant cell cultures, in plant tissues, etc.) and / or in vitro, and originally (100% identical sequence 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or It may be to retain the function of conferring herbicide resistance while maintaining the activity of 95% or more.

Hereinafter, the present invention will be described in more detail.

In the present specification, EPSPS (5-enol-pyruvylshikimate-3-phosphate synthase) is an enzyme present in plants or microorganisms, and phosphoenolpyruvate (PEP) and 3-phosphoshikimate (3-phosphoshikimate; It is a catalyst involved in the conversion of S3P) to phosphate and 5-enolpyruvylshikimate-3-phosphate (EPSP). EPSPS of soybeans may be EPSPS of Glycine max , for example, NCBI Accession No. It may be a polypeptide comprising an amino acid sequence selected from the group consisting of XP_003517039.1 (SEQ ID NO: 1), XP_003521857.1, and the like, but is not limited thereto.

In one embodiment, the EPSPS of soybean described herein may include the amino acid sequence of SEQ ID NO: 1. The EPSPS encoding gene of soybean (eg, Glycine max ) is a gene inherent in the genome, and may be a gene encoding the EPSPS described above, for example, SoyBase Accession No. Glyma.01G139600 (mRNA: Glyma.01g139600.1, NCBI mRNA Accession No.: XM_003516991.4), Glyma.03G027400 (mRNA Glyma.03g027400.1, NCBI mRNA Accession No.: XM_003521809.4) selected from the group consisting of The nucleic acid sequence may be a polynucleotide comprising the sequence. In one embodiment, the EPSPS encoding gene of soybean may include a nucleic acid sequence of SEQ ID NO: 2 (Glyma.01g139600).

The amino acid residue (position and amino acid type) at which the amino acid mutation described in the present specification occurs is described based on SEQ ID NO: 1, but it is understood that it also includes amino acid residues in the amino acid sequence of the EPSPS of soybean of another isoform corresponding to this. Determination of the 'amino acid residues in the amino acid sequence of EPSPS of soybean of different isotypes of interest' is well known in the art.

One example is 1 or more or 2 or more, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 in the amino acid sequence of the EPSPS protein of soybean , 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 amino acid residues A polypeptide comprising a mutated amino acid sequence is provided. The mutation of the amino acid residue may be substitution (amino acid substitution), deletion, and/or addition of an amino acid at the corresponding position with an amino acid different from the original, for example, an amino acid substitution. The amino acid mutation included in the EPSPS protein variant may include substitution, deletion, addition and/or insertion of one or more amino acids selected from amino acid residues of the interaction (binding) site between the EPSPS protein and glyphosate, but is limited thereto it's not going to be The EPSPS protein variant having such an amino acid mutation may maintain the enzymatic activity of the EPSPS before the mutation.

In the present specification, the polypeptide may be used as the same meaning as a variant EPSPS protein or a mutated EPSPS protein, unless otherwise specified.

The polypeptide will be described in more detail as follows.

In the polypeptide provided in one example, in the amino acid sequence of the EPSPS protein of soybean (Glycine max), the following amino acid residues are each independently substituted and/or deleted with an amino acid different from the original and/or an amino acid is added at the position It may include an amino acid sequence:

(1) the amino acid residue corresponding to the 183th position of SEQ ID NO: 1 (eg, the amino acid residue corresponding to the 183th position is substituted with isoleucine (I)), or

(2) (i) the amino acid residue corresponding to the 183th position of SEQ ID NO: 1 (eg, the amino acid residue corresponding to the 183th position is substituted with isoleucine (I)), and (ii) the 31st, 48th, and 67th positions , 81st, 151st, 161th, 163th, 166th, 170th, 184th, 191th, 199th, 221th, 229th, 251th, 253th, 276th, 278th, 292th, 294 one or more selected from the position of th, 307th, 309th, 373th, 359th, 424th, and 445th (eg, 31st, 48th, 67th, 81st, 151th, 161th, 166th, 170th th, 184th, 191th, 199th, 221st, 229th, 251th, 253th, 276th, 278th, 292th, 294th, 307th, 309th, 373th, 359th, and 445th one or more positions selected from among) (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14) , 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24) amino acid residues.

In one embodiment, the polypeptide, based on the amino acid sequence of the EPSPS protein of soybean (SEQ ID NO: 1), each of the following amino acid residues is independently substituted and / or deleted with an amino acid different from the original and / or at the position It may include an amino acid sequence to which amino acids have been added:

an amino acid residue corresponding to position 183 of SEQ ID NO: 1;

amino acid residues corresponding to positions 151 and 183 of SEQ ID NO: 1;

amino acid residues corresponding to positions 183 and 445 of SEQ ID NO: 1;

amino acid residues corresponding to positions 183, 184, and 251 of SEQ ID NO: 1;

amino acid residues corresponding to positions 183, 276, and 373 of SEQ ID NO: 1;

amino acid residues corresponding to positions 31, 81, 183, and 253 of SEQ ID NO: 1;

amino acid residues corresponding to positions 67, 183, 199, and 373 of SEQ ID NO: 1;

amino acid residues corresponding to positions 161, 183, 292, and 309 of SEQ ID NO: 1;

amino acid residues corresponding to positions 183, 191, 294, and 359 of SEQ ID NO: 1;

aminosa residues corresponding to positions 31, 81, 183, 253, and 307 of SEQ ID NO: 1;

aminosa residues corresponding to positions 48, 166, 170, 183, 221, 229, and 278 of SEQ ID NO: 1;

amino acid residues corresponding to positions 183, 253, 373, and 424 of SEQ ID NO: 1; or

Amino acid residues corresponding to positions 163 and 183 of SEQ ID NO: 1.

In the amino acid substitution, the amino acid residues at the above positions are, each independently, histidine (H), leucine (L), valine (V), glycine (G), asparagine (N), tryptophan (W), alanine (A) , arginine (R), tyrosine (Y), lysine (K), cysteine (C), isoleucine (I), glutamic acid (E), phenylalanine (F), aspartic acid (D), proline (P), threonine (T) ), glutamine (Q), serine (S), and methionine (M) selected from the group consisting of, and the like may mean substituted with an amino acid different from the original amino acid.

In one embodiment, the polypeptide may include an amino acid sequence in which the amino acid sequence of the soybean EPSPS protein is mutated by an amino acid substitution corresponding to the following:

Based on SEQ ID NO: 1,

T183I (threonine (T) at the 183th amino acid residue is substituted with isoleucine (I); the same applies to the expression of amino acid substitutions below; may mean including isoleucine at the position corresponding to the 183th amino acid residue (hereinafter in the same manner) interpreted)); or

For T183I, T151A, L163I, I445V, A184V, K251R, D276E, K373N, K373M, S31P, S81A, K253R, V67M, A199D, G161E, E292K, G309S, A191T, T294S, S359Y, A424T, T166A, M4824T, H307Q, , L221I, D229H, and E278G (e.g., T183I and T151A, I445V, A184V, K251R, D276E, K373N, K373M, S31P, S81A, K253R, V67M, A199D, G161E, E292K, G309S, A191T, T294S, A191T one or more selected from the group consisting of S359Y, H307Q, M48I, T166A, S170C, L221I, D229H, and E278G) (eg, 1, 2, 3, 4, 5, 6, 7) Dogs, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24) combinations.

For example, the polypeptide may include an amino acid sequence in which the amino acid sequence of the soybean EPSPS protein is mutated by an amino acid substitution corresponding to the following (an amino acid sequence mutated by an amino acid substitution described in parentheses):

Based on SEQ ID NO: 1,

containing isoleucine at position 183 (T183I);

with alanine at the 151st corresponding position and with isoleucine at the 183th corresponding position (combination of T151A and T183I; may be denoted as 'T151A+T183I');

with isoleucine at the 183th corresponding position and with valine at the 445th corresponding position (combination of T183I and I445V; may be denoted as 'T183I+I445V');

with isoleucine at corresponding position 183, valine at corresponding position 184, and arginine at corresponding position 251 (combination of T183I, A184V, and K251R; may be denoted as 'T183I+A184V+K251R') ;

with isoleucine at corresponding position 183, glutamic acid at corresponding position 276, and asparagine at corresponding position 373 (combination of T183I, D276E, and K373N; may be denoted as 'T183I+D276E+K373N') ;

with proline at corresponding position 31, alanine at corresponding position 81, isoleucine at corresponding position 183, and arginine at corresponding position 253 (combination of S31P, S81A, T183I, and K253R; 'S31P +S81A+T183I+K253R');

67th corresponding position contains methionine, 183th corresponding position contains isoleucine, 199th corresponding position contains aspartic acid, and 373th corresponding position contains methionine (combination of V67M, T183I, A199D, and K373M; V67M+T183I+A199D+K373M');

Glutamic acid at position 161, isoleucine at position 183, lysine at position 292, and serine at position 292 (combination of G161E, T183I, E292K, and G309S; 'G161E+ T183I+E292K+G309S');

isoleucine at corresponding position 183, threonine at corresponding position 191, serine at corresponding position 294, and tyrosine at corresponding position 359 (combination of T183I, A191T, T294S, and S359Y; 'T183I +A191T+T294S+S359Y');

proline at corresponding position 31, alanine at position 81, isoleucine at position 183, arginine at position 253, and glutamine at position 307 (S31P, S81A, a combination of T183I, K253R, and H307Q (which may be represented as 'S31P+S81A+T183I+K253R+H307Q');

isoleucine at position 48, alanine at position 166, cysteine at position 170, isoleucine at position 183, isoleucine at position 221, position 229 with histidine at the 278th corresponding position, and with glycine at the 278th position (combination of M48I, T166A, S170C, T183I, L221I, D229H, and E278G; can be represented as 'M48I+T166A+S170C+T183I+L221I+D229H+E278G' has exist);

a combination of T183I, K253E, K373N, and A424T (which may be denoted as 'T183I+K253E+K373N+A424T'); or

Combination of L163I and T183I (may be denoted as 'L163I+T183I').

The polypeptide (EPSPS protein mutant) in which the amino acid substitution mutation is introduced into the EPSPS protein of soybean is characterized in that it exhibits enhanced glyphosate resistance compared to the wild-type in soybean while maintaining the original enzyme activity of EPSPS.

In addition, the polypeptide is a polypeptide comprising an amino acid sequence (100% identical) having an amino acid mutation in SEQ ID NO: 1 as described above, provided that it retains the original enzymatic activity and desired glyphosate resistance and may further include mutations exhibiting bioequivalent activity. For example, the additional mutation may be an amino acid substitution that does not entirely alter the activity of the molecule. In one embodiment, the additional substitution is amino acid residues Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thr/Phe, substitutions between Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, or Asp/Gly. In some cases, the polypeptide is one or more amino acids selected from the group consisting of phosphorylation, sulfation, acylation, glycosylation, methylation, farnesylation, etc. It may be modified beyond the species. In addition, the polypeptide may include a protein variant in which structural stability to heat, pH, etc. of the protein is increased or protein activity is increased by amino acid mutation and/or modification.

Another example provides a polynucleotide encoding the polypeptide. The polynucleotide may be designed to include a codon optimized for a cell to be transduced among codons encoding each amino acid included in the polypeptide. The optimized codon can be easily recognized by those of ordinary skill in the art (eg, "http://www.genscript.com/codon-opt.html", "http://sg .idtdna.com/CodonOpt", etc.).

Another example provides a recombinant vector comprising the polynucleotide.

Another example provides a recombinant cell comprising the recombinant vector.

In the present specification, the EPSPS protein (wild-type) or the polypeptide to which the amino acid mutation described above is added herein can be obtained by extraction and purification from nature by a method well known in the art, or it can be obtained as a recombinant protein using genetic recombination technology. . In the case of using genetic recombination technology, a polynucleotide encoding a polypeptide is inserted into an appropriate expression vector, the vector is transformed into a host cell, the host cell is cultured so that the target protein is expressed, and the polypeptide is recovered from the host cell. It can be obtained by the process of For isolation and purification of the polypeptide expressed in the host cell, conventional biochemical separation techniques, for example, treatment with a protein precipitating agent (salting-out method), centrifugation, sonication, ultrafiltration, dialysis, molecular sieve chromatography (Gel filtration), adsorption chromatography, ion exchange chromatography, various chromatography such as affinity chromatography, etc. can be used, and two or more of these can be used in combination to separate high-purity proteins.

In the present specification, the polynucleotide encoding the EPSPS protein (wild-type) or the polypeptide to which the amino acid mutation described above is applied is synthesized using standard molecular biology techniques, for example, chemical synthesis or recombinant methods, or commercially available ones. can

In the examples of the present specification, it was confirmed that the survival rate during glyphosate treatment of Escherichia coli comprising a polynucleotide encoding the polypeptide increased compared to wild-type EPSPS protein (see Examples), and the polypeptide and its encoding The effect of conferring and/or enhancing glyphosate resistance of polynucleotides was confirmed.

One example provides a use for conferring and/or enhancing glyphosate resistance of the polypeptide and/or a polynucleotide encoding the same.

More specifically,

(1) the polypeptides described above;

(2) a polynucleotide encoding the polypeptide;

(3) a recombinant vector comprising the polynucleotide, and

(4) Recombinant cells containing the recombinant vector

It provides a composition for imparting and/or enhancing glyphosate resistance, comprising at least one selected from the group consisting of.

The composition for imparting and/or enhancing glyphosate resistance may be for application to soybeans.

Another example is

(1) the polypeptides described above;

(2) a polynucleotide encoding the polypeptide;

(3) a recombinant vector comprising the polynucleotide, and

(4) a recombinant cell comprising the recombinant vector

It provides a composition for glyphosate-resistance imparted and/or enhanced soybeans, or glyphosate-resistance imparting and/or enhancement of soybeans, comprising at least one selected from the group consisting of. The glyphosate resistance conferred and/or enhanced composition for producing soybeans or glyphosate resistance conferring and/or enhancing soybeans confer resistance to glyphosate to soybeans and/or wild-type EPSPS or encoding it Compared to soybeans comprising the gene, it is possible to enhance resistance to glyphosate (or to produce soybeans to which resistance is imparted and/or enhanced as such).

Another example is a method for producing a soybean with enhanced and/or conferred glyphosate resistance, comprising introducing (transformation) the polypeptide or a polynucleotide encoding the same into soybean or glyphosate resistance of soybean Methods for enhancing and/or imparting are provided. In one embodiment, the method comprises:

(1) induce a mutation to encode an amino acid mutation (substitution) described herein in the EPSPS encoding gene endogenous in soybean, or

(2) introducing a polynucleotide encoding the above-described polypeptide or a recombinant vector comprising the same into soybean, (i) in addition to the EPSPS encoding gene inherent in the bean, to further include a polynucleotide encoding the polypeptide transforming, or (ii) all or part of the endogenous EPSPS-encoding gene of the soybean with all or a part of the polynucleotide encoding the polypeptide (a portion corresponding to a portion of the endogenous EPSPS-encoding gene of the bean) It may include transforming to be substituted (replaced).

More specifically, the method for producing a soybean with enhanced and/or imparted glyphosate resistance or a method for enhancing and/or imparting glyphosate resistance of soybeans,

(1) mutating the EPSPS encoding gene inherent in soybean to encode the amino acid mutated polypeptide (EPSPS protein variant);

(2) introducing a polynucleotide encoding the polypeptide, or a recombinant vector comprising the polynucleotide, into a soybean (eg, a soybean cell or a soybean genome); or

(3) both steps (1) and (2) above

may include

The step of mutating the EPSPS-encoding gene inherent in soybeans of step (1) is a genetic mutation means commonly available, such as the CRISPR-Cas system (Cas9 protein, Cas3 protein, or its coding gene and guide RNA or its coding DNA. mixtures, complexes, or recombinant vectors including the gene and/or DNA), CRISPR-Cpf1, Zinc Finger nuclease, TALEN, and the like.

In step (2), the soybean into which the polynucleotide encoding the polypeptide or a recombinant vector comprising the same is introduced is the same individual of the same species as the bean from which the polypeptide is derived, or the same species or They may be of different individuals of the same genus (even different species).

Another example provides soy (transgenic soy) comprising a polypeptide or a polynucleotide encoding the same. The transgenic soybean contains the polypeptide or a polynucleotide encoding it, and thus, compared to soybeans not including it (eg, wild-type EPSPS or soybean containing a gene encoding it), resistance to glyphosate is conferred or and/or enhanced.

In one example, the transgenic soybean, in addition to the endogenous EPSPS gene and/or the endogenous EPSPS protein, may further include a polynucleotide encoding the polypeptide and/or the polypeptide. In this case, the polynucleotide encoding the polypeptide and/or the polypeptide further included is the same individual of the same species as the transgenic soybean, or the same species or the same genus; in other cases) may be derived from another individual.

In another example, the transgenic soybean may include a polynucleotide encoding the polypeptide as an embedded EPSPS encoding gene, or may include the polypeptide as an embedded EPSPS protein. The 'intrinsic gene or protein' refers to a gene or protein originally present in a cell into which a mutation is introduced, and is not a foreign gene or protein (eg, a gene or protein derived from another species or another individual). may be doing

In one embodiment, the transgenic soybean may be prepared by the method for producing soybeans with enhanced and/or conferred glyphosate resistance described above, or the method for enhancing and/or imparting glyphosate resistance of soybeans. .

As used herein, 'soybean or transgenic soybean' refers to one or more selected from the group consisting of soybean cells, protoplasts, callus, embryos, hypocotyls, seeds, cotyledons, whole bodies, or progeny thereof. it could mean

In the present specification, the EPSPS protein of soybean may include the amino acid sequence of SEQ ID NO: 1. The site where amino acid mutation occurs in the EPSPS protein as described herein is a site or amino acid residue that does not affect or significantly affect the original enzymatic activity of EPSPS even if mutation occurs, and interacts with (binding) glyphosate. Or it may be an amino acid residue, but is not limited thereto. Soybean (transgenic soybean) prepared by the above method, or conferred and/or enhanced with glyphosate resistance, when the mutation is not introduced in the gene encoding the EPSPS protein and/or EPSPS protein (eg, wild-type soybean) Compared to , it may have a high glyphosate resistance (eg, a high growth rate and/or survival rate and/or seed yield during glyphosate treatment, etc.).

The polynucleotide encoding the polypeptide provided herein may be introduced into soybean by various methods known in the art, and preferably a recombinant vector (expression vector) for transformation of soybean may be used.

As a suitable promoter that can be included in the vector in the case of plant (soybean) transformation, any promoter commonly used in the art for gene introduction into plants may be used, for example, SP6 promoter, T7 promoter, T3 promoter, PM promoter, maize ubiquitin promoter, cauliflower mosaic virus (CaMV) 35S promoter, nopaline synthase (nos) promoter, pigwort mosaic virus 35S promoter, sugacrane bacilliform virus promoter, Commelina yellow mottle virus promoter, ribulo Photoinducible promoter of ose-1,5-bis-phosphate carboxylase small subunit (ssRUBISCO), rice cytosolic triosphosphate isomerase (TPI) promoter, adenine phosphoribosyltransferase (APRT) of Arabidopsis One or more selected from the group consisting of a promoter, an octopine synthase promoter, and a blue copper binding protein (BCB) promoter may be used, but is not limited thereto.

In addition, the vector may include a poly A signal sequence that causes polyadenylation of the 3'-end, for example, one derived from the nopaline synthase gene of Agrobacterium tumefaciens (NOS 3' end), the terminator derived from the octopine synthase gene of Agrobacterium tumefaciens (octopine synthase terminator), the 3' end portion of the tomato or potato protease inhibitor I or II gene, CaMV 35S terminator, rice α-amylase RAmy1 A terminator and phaseolin terminator, but are not limited thereto.

In addition, the vector may optionally further include a gene encoding a selection marker as a reporter molecule, and examples of the selection marker include antibiotics (eg, neomycin, carbenicillin, kanamycin, spectinomycin, hygromycin, Bleomycin, ampicillin, chloramphenicol, etc.) or herbicides (except glyphosate) resistance genes, and the like, but are not limited thereto.

In addition, the recombinant vector for plant expression does not contain an Agrobacterium binary vector, a cointegration vector, or a T-DNA region, but a general vector designed to be expressed in plants may be used. Among them, the binary vector refers to a vector including a plasmid having LB (left border) and RB (right border), which are parts necessary for movement in a Ti (tumor inducing) plasmid, and a plasmid having a gene necessary to transfer a target nucleotide, and the It is a vector containing a promoter region and a polyadenylation signal sequence for expression in a plant therein.

In the case of using a binary vector or a coinage vector in the above, it is preferable to use Agrobacterium as a transformation strain for introducing the recombinant vector into a plant ( Agrobacterium- mediated transformation), in which case Agrobacterium tumefaci Ens ( Agrobacterium tumefaciens ) or Agrobacterium rhizogenes ( Agrobacterium rhizogenes ) can be used. In addition, in the case of using a vector that does not contain a T-DNA region, electroporation, particle bombardment, polyethylene glycol-mediated uptake, etc. are used to introduce the recombinant plasmid into the plant. can be used

Transgenic plants into which genes are introduced in the above manner can be redifferentiated into plants through processes such as callus induction, rooting and/or soil acclimatization using standard techniques known in the art.

Plants to be transformed in the present specification are, as well as mature plants, plant cells (including suspension-cultured cells) that can develop into mature plants, protoplasts, callus, hypocotyl, seeds (seed) ), cotyledon, shoot, and the like are understood to include all.

In addition, the transformant category of the present specification includes the transformant into which the gene is introduced, as well as clones or progeny thereof (T ₁ generation, T ₂ generation, T ₃ generation, T ₄ generation, T ₅ generation, or more) Including, for example, as asexual or sexual progeny of soybean transformed with the polypeptide coding gene, plants inherited with glyphosate resistance are also included in the scope of the transgenic plants of the present invention. Also included within the scope of the present invention are all mutants exhibiting the characteristics of initially transformed soybeans, along with all crosses and fusion products of the transformed soybeans herein. In addition, seeds, flowers, stems, fruits, leaves, roots, tubers, and/or tubers originating from transformed soybeans previously transformed by the method of the present invention or their progeny and consisting of at least a part of transformed cells Parts of the same plant are also included within the scope of the present invention.

Plants to which the technology of the present specification is applied may be beans, Glycine max, Glycine albicans, Glycine aphyonota, Glycine arenaria, Glycine argyrea, Glycine canescens, Glycine clandestine, Glycine curvata, Glycine cyrtoloba, Glycine Glycine cyrtoloba, Glycine grace dolicho hirticaulis, Glycine hirticaulis subsp., Glycine lactovirens, Glycine latifolia, Glycine latrobeana, Glycine microphylla, Glycine montis-douglas, Glycine peratosa, Glycine pescadrensis, Glycine pindanica, Ginecine synthicana, Glycine pullenii, Glycine rubenii, Glycine rubenii , Glycine tabacina, Glycine tomentella, Glycine wrightii , etc. may be at least one selected from the group consisting of, but is not limited thereto.

Another example is a transgenic soybean comprising the polypeptide, a polynucleotide encoding the same, or a combination thereof, or a soybean cultivation method comprising the step of applying an effective amount of glyphosate to a cultivation area provided with the transgenic soybean, or A method for removing unwanted organisms in soybean cultivation is provided. The method for removing the unwanted organisms may be a method for removing weeds.

By applying the variant of the glyphosate-resistant EPSPS protein provided in the present invention or a gene encoding the same to plants, such as soybeans, excellent glyphosate-resistance trait conferring and/or enhancing effects can be obtained, and glyphosate is selectively used Controlling can increase crop productivity by economically controlling weeds or removing unwanted organisms.

1A and 1B are graphs showing the glyphosate resistance of Escherichia coli transformed with a gene encoding a glyphosate resistant EPSPS protein variant according to an embodiment.
2 is a photograph showing the glyphosate resistance of soybeans (T ₀ ) transformed with a gene encoding a variant of the glyphosate-resistant EPSPS protein according to an embodiment.
3 is a photograph showing glyphosate resistance of soybeans (T ₁ ) transformed with a gene encoding a variant of the glyphosate-resistant EPSPS protein according to an embodiment.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the present invention is not limited by the following examples.

Example 1. Plasmid Preparation

In order to construct a glyphosate resistance gene screening platform using E. coli as a host, pSTV28-trc-GmEPSPS was constructed. The plasmid uses pSTV28 (Addgene; 2999bp) as a backbone vector, and contains trc promoter, ribosome binding site (RBS), Glycine max 5-enylpyruvylshikimate-3-phosphate synthase gene (GmEPSPS), rrnB T1 transcription terminator, etc. A chloramphenicol resistance gene is included as a selectable marker.

Based on the codon usage of E. coli , the codon-optimized Glycine max EPSPS gene (SoyBase Accession no. Glyma.01g139600) and the trc promoter, RBS, rrnB T1 transcription terminator, etc. are preferentially synthesized with a DNA fragment containing, and then added to the pBLC vector. It was created by cloning (pBLC-PGE001, manufacturer: Bioneer Co., Ltd., Codon optimization: https://zendto.bioneer.co.kr/codon/index.py).

Then, EPSPSPgs 1F (5'-CCAAGCTTGCATGCCTGCAGTTGACAATTAATCATCCGGC-3') and EPSPSPgs 1R (5'-ATGATTACGAATTCGAGCTCATTTGTCCTACTCAGGAGAG-3') was amplified through a PCR reaction using primers, and this was amplified through a recombinant PCR reaction with restriction enzyme treatment and pSTV28 assembly with Gibson. was produced.

PCR reaction for insert DNA amplification was performed according to the conditions of Table 3 after preparing the reaction solution in Table 2 including EPSPSPgs1F and EPSPSPgs1R primers (Table 1).

Insert DNA (trc-RBS-GmEPSPS-rrnB T1) DNA ^* PCR primer for amplification PCR primer Sequence (5'→3') SEQ ID NO: product size EPSPSPgs 1F CCAAGCTTGCATGCCTGCAGTTGACAATTAATCATCCGGC 3 1741 bp EPSPSPgs 1R ATGATTACGAATTCGAGCTCATTTGTCCTACTCAGGAGAG 4

* DNA insertion fragment (insert DNA) consisting of the trc promoter, ribosome binding site, Glycine max EPSPS, and rrnB T1 transcription terminator.

Insert DNA (trc-RBS-GmEPSPS-rrnB T1) DNA ^* Composition of PCR reaction solution for amplification component Volume Deionized water 33. 3 μl 5x PCR buffer (NEB) 10 μl EPSPSPgs 1F primer (10 uM, Table _) 2. 5 μl EPSPSPgs 1R primer (10 uM, Table _) 2. 5 μl 10 mM dNTPs (NEB) 1 μl Template (pBLC-PGE001, 37.6 ng/μl) 0.2 μl Q5 High Fidelity DNA Polymerase (NEB) 0.5 μl Total 50 μl

* DNA insertion fragment consisting of trc promoter, ribosome binding site, Glycine max EPSPS, and rrnB T1 transcription terminator.

PCR reaction conditions for DNA* amplification of pSTV28-trc-GmEPSPS reaction Temperature Time Cycles Pre-Denaturation 95℃ 2 m One Denaturation 95℃ 30 sec 25 Annealing 55℃ 30 sec Extension 72℃ 2. 5 m final extension 72℃ 7 m One

* DNA insertion fragment consisting of trc promoter, ribosome binding site, Glycine max EPSPS, and rrnB T1 transcription terminator.

After purifying the amplification product of the DNA insertion fragment of about 1.7 kb using the ExpinTM Gel SV Kit (GeneAll), the amplification product was purified by using Gibson Assembly® Master Mix (NEB) PstI/SacI-digested pSTV28 (Addgene; 2999 bp). After chemically introducing this into Chemically competent E. coli DH5α (Enzynomics), colonies grown on LB solid medium supplemented with chloramphenicol 0.25 μg/mL were inoculated into 10 mL of LB liquid medium (including chloramphenicol 0.25 μg/mL), Incubated for 12-18 hours at 37°C and 200 rpm. After extracting plasmid DNA (named pSTV28-trc-GmEPSPS) using the Exprep ^TM Plasmid SV mini Kit (GeneAll), sequencing the DNA insertion fragment through Macrogen (sequencing primer: M13F-pUC (GTTTTCCCAGTCACGAC; SEQ ID NO: 5)) , M13R (GCGGATAACAATTTCACACAGG; SEQ ID NO: 6) was performed, and the correspondence with the intended sequence was confirmed using the SnapGene program.

Example 2. Glycine max EPSPS (GmEPSPS) random mutant library production

Agilent's GeneMorph II Random Mutagenesis Kit (Catalog #200550) was used to introduce random mutations into GmEPSPS of pSTV28-trc-GmEPSPS. PtrcLibF (5'-GCA-TGC-CTG-CAG-TTG-ACA-ATT-AAT-CAT-CCG-GCT-CGT-ATA-ATG-TGT-GGT-TAA-TTA-AAA- GAA-GGA-GAA-TTC-TAG-ATG-3'; SEQ ID NO: 7) and rrnBLibR (5'-TTA-CGA-ATT-CGA-GCT-CAT-TTG-TCC-TAC-TCA-GGA-GAG-CGT -TCA-CCG-ACA-AAC-AAC-AGA-TAA-AAC-GAA-AGG-CCC-3'; SEQ ID NO: 8) An Error-prone PCR reaction solution was prepared as shown in Table 4 using primers.

Error-prone PCR reaction conditions of pSTV28-trc-GmEPSPS component Volume Deionized water Up to 50 μL 10× Mutazyme II reaction buffer (Agilent Tech) 5 μL PtrcLibF primer (10 μM) 0.5 μL rrnBLibR primer (10 μM) 0.5 μL 40 mM dNTPs (each 10 mM, Agilent Tech) 1 μL Template (pSTV28-trc-GmEPSPS) ^* X μL for initial target 100 ng or 800 ng ^** Mutazyme II DNA polymerase (Agilent Tech) 1 μL Total 50 μL

* Based on sequence size, 283 ng of pSTV28-trc-GmEPSPS (template DNA) is required to obtain 100 ng of GmEPSPS gene (initial target DNA).

** Control the mutation rate of Error-prone PCR by adjusting the amount of Template DNA.

The error-prone PCR product thus obtained was purified by electrophoresis and gel extraction techniques. Recombination of purified mutant GmEPSPS and pSV28 was performed through PstI-HF (NEB's Cat# R3140) and SacI-HF (NEB's Cat# R3156) restriction enzyme treatment and ligation (NEB's T4 DNA ligase, Cat# M0202). . These enzymatic reactions were performed according to the instructions of the manual provided by the manufacturer. As a result, a GmEPSPS random mutant library was obtained. It was confirmed that the GmEPSPS mutant was included in more than 95% of the obtained library clones, and it was confirmed through sequencing that at least 1 to 9 mutations were included. The three primers in Table 5 were used as primers used for sequencing.

Sequencing primer for GmEPSPS mutant gene sequencing primer Sequence (5'→3') SEQ ID NO: M13F GTAAAACGACGGCCAGT 9 ESPSPS_1252R CAAGTGTCATAGCCACATCT 10 ESPSPS_1012F AGTTATTTACTGGCTGGTGGC 11

Example 3. Glyphosate resistance Glycine max EPSPS ( GmEPSPS ) mutant screening and validation

The process of selecting only clones having herbicide resistance from the random mutant library of GmEPSPS prepared in Example 2 was performed in E. coli BW25113 strain (Dharmacon, Cat# OEC4987-200826398) in which the EPSPS gene (aroA) was knocked out. GmEPSPS random mutant library was transformed into the above strain, and the transformant was applied to M9 minimal medium containing 30 mM Glyphosate (Table 6). The M9 minimal medium is a minimal nutrient medium containing only a single carbon source, minerals, and some vitamins, which are the minimum components necessary for the growth of E. coli . Since aromatic amino acids are not supplied, EPSPS activity is essential for its production. Because the medium contains glyphosate, only clones with GmEPSPS that are resistant to glyphosate form colonies. Clones forming colonies were sequenced through sequencing using the primers in Table 5, and Glyphosate resistance was measured in subsequent experiments.

Composition of M9 solid medium (including chloramphenicol and 30 mM glyphosate) component 30 mM glyphosate Volume Autoclaved agar / deionized water 1. 5 g / 34.7 mL Glyphosate* 5X M9 minimal salts* 0.507 g 20 mL Autoclaved deionized water* 44 mL 40% glucose stock (100X) 1 mL 0.5 M MgSO ₄ stock (1000X) 0.1 mL 1 MCaCl ₂ stock (10000X) 0.01 mL 0.1% thiamine-HCl stock (1000X)** 0.1 mL 0.25% chloramphenicol stock (1000X)** 0.1 mL Total 100 mL

As a result of the sequence confirmation, T183I, T151A+T183I, T183I+I445V, T183I+A184V+K251R, T183I+D276E+K373N, S31P+S81A+T183I+K253R, V67M+T183I+A199D+K373M, G161E+T183I+E292K+T183I+E292 , T183I+A191T+T294S+S359Y, S31P+S81A+T183I+K253R+H307Q, M48I+T166A+S170C+T183I+L221I+D229H+E278G, and T183I+K253E+K373N+A424T, L163I+T183I mutations respectively introduced It was confirmed that the transformed E. coli BW25113 strain into which the gene fragment encoding the GmEPSPS variant was introduced forms colonies in a medium containing Glyphosate.

Example 4. Measurement of glyphosate resistance in E. coli

In order to evaluate the glyphosate resistance of the transformants obtained in Example 3, each single colony was inoculated into M9 liquid medium (containing 0.25 μl of chloramphenicol) of a 96-well plate, and 16 at 37°C, 200 rpm. After time incubation, OD ₆₀₀ (Optical Density at 600 nm) of each culture was measured. Using a new 96 well plate, inoculate the culture medium of each strain in M9 + 40 mM glyphosate liquid medium (including chloramphenicol 25 μg/mL) so that Final OD600=0.01 (Final volume 200 μL). This was cultured at 37° C. for 16 hours or 18 hours, and repeated experiments were performed. The growth degree of the transformants was confirmed by measuring the OD ₆₀₀ value of the culture at 16 hours or 18 hours of culture (n=3), and glyphosate resistance of the transformants was evaluated based on this.

Composition of M9 medium (containing chloramphenicol and 40 mM glyphosate) component 40 mM glyphosate Volume Glyphosate* 5X M9 minimal salts* 0.676 g 20 mL Autoclaved deionized water* 78.7 mL 40% glucose stock (100X) 1 mL 0.5 M MgSO ₄ stock (1000X) 0.1 mL 1 MCaCl ₂ stock (10000X) 0.01 mL 0.1% thiamine-HCl stock (1000X)** 0.1 mL 0.25% chloramphenicol stock (1000X)** 0.1 mL Total 100 mL

The results obtained at 16 hours of incubation are shown in Table 8 and FIG. 1A:

GmEPSPS variants 0 hr incubation 16 hr incubation ΔOD ₆₀₀ Average Average Average stdev wild type (WT) 0.021 0.002 0.025 0.008 0.004 T183I+P187S 0.008 0.000 0.249 0.107 0.241 T183I 0.005 0.000 0.367 0.051 0.362

(In Table 8, ΔOD600: OD600 value at 16 hr incubation - OD600 value at 0 hr incubation)

As shown in Table 8 and Figure 1a, when cultured for 16 hours in the presence of 40 mM glyphosate, the GmEPSPS mutant containing the T183I alone mutation exhibited superior glyphosate resistance than the GmEPSPS mutant containing the T183I + P187S double mutation. can confirm.

In addition, the results obtained at the time of incubation for 18 hours are shown in Table 9 and FIG. 1B:

GmEPSPS variants 0 hr incubation OD ₆₀₀ 18 hr incubation OD ₆₀₀ ΔOD ₆₀₀ Average Average Average stdev wild type (WT) 0.021 0.002 0.024 0.011 0.003 T183I 0.005 0.000 0.358 0.047 0.353 T151A+T183I 0.006 0.001 0.365 0.051 0.359 T183I+I445V 0.006 0.000 0.383 0.016 0.377 T183I+A184V+K251R 0.004 0.000 0.425 0.018 0.421 T183I+D276E+K373N 0.008 0.003 0.326 0.039 0.318 S31P+S81A+T183I+K253R 0.010 0.003 0.345 0.050 0.335 V67M+T183I+A199D+K373M 0.007 0.000 0.393 0.040 0.386 G161E+T183I+E292K+G309S 0.008 0.001 0.325 0.040 0.317 T183I+A191T+T294S+S359Y 0.008 0.001 0.346 0.013 0.338 S31P+S81A+T183I+K253R+H307Q 0.007 0.001 0.316 0.023 0.309 M48I+T166A+S170C+T183I+L221I+D229H+E278G 0.008 0.001 0.334 0.051 0.326 T183I+K253E+K373N+A424T 0.011 0.004 0.282 0.056 0.271 L163I+T183I 0.006 0.001 0.108 0.024 0.102 T183I+P187S 0.008 0.000 0.296 0.029 0.288 P187S 0.017 0.004 0.305 0.063 0.288

(In Table 9, ΔOD600: OD600 value at 18 hr incubation - OD600 value at 0 hr incubation)

As shown in Table 9 and FIG. 1B , in the presence of 40 mM glyphosate, all GmEPSPS mutants tested showed at least 25-fold or more, or about 100-fold or more increased cell growth compared to wild-type, particularly Example 3 The selected GmEPSPS mutants showed overall increased cell growth compared to other mutants (P187S, T183I+P187S, etc.). These results demonstrate that the GmEPSPS mutant selected in Example 3 has elevated glyphosate resistance compared to the wild-type and other mutants.

Example 5. Glyphosate resistance verification in transgenic soybeans

A transgenic soybean into which GmEPSPS (gene: Glyma.01G139600) was introduced having a mutation in which Glyphosate resistance was confirmed in Example 4 was prepared. Specifically, the seeds of soybean (Williams82) are planted in sterile MS medium (MURASHIGE &SKOOG; Cat. No. M0221; Duchefa) and cultured for 6 days. After cutting the cotyledonary node of the cultured soybean including 0.5 cm of the hypocotyl and giving a certain wound to the growth point, T183I, T183I+I445V, T183I+A184V+K251R, T183I+D276E+K373N, S31P+S81A+T183I+K253R, or M48I+ The T166A+S170C+T183I+L221I+D229H+E278G mutation was co-cultured with Agrobacterium into which the GmEPSPS mutant coding gene was introduced for 3 days.

More specifically, the Agrobacterium transformation was performed by a freeze-thaw method comprising the following steps:

Concentrate the cells by centrifugation in the cell culture medium, store at -80°C and freeze

Add DNA to cells from 1 melted on ice and tap to mix

Cells containing DNA were treated in liquid nitrogen for 10 seconds.

After liquid nitrogen treatment, treatment at 37 degrees for 5 minutes

After incubation at 28°C, smear on solid medium with appropriate antibiotics; and

Co-culture of the colonies grown in this way in a medium such as LB.

When the co-culture was completed, the plant sections were washed 3 to 5 times to sufficiently remove Agrobacterium, then transferred to a stem induction medium and cultured for 2 weeks was repeated twice. After that, the plant sections with well-developed stems were transferred to the stem elongation medium and subcultured once every 2 weeks. When the stems developed to 7 cm or more, they were transferred to the root induction medium. . Transgenic soybeans were produced by the acclimatization process in which the plant moved to the soil initially blocked contact with the outside air and then gradually increased the contact with the outside air. P35 F (5'-AAGCAAGTGGATTGATGTGATATCTC-3'; SEQ ID NO: 12)) and P35 R (5'-GCGAAGGATAGTGGGATTGTG-3'; sequence No. 13) PCR (polymerase chain reaction) using primers was performed to confirm whether the target gene was introduced into soybeans, and the herbicide resistance phenotype was verified in the individuals whose gene introduction was confirmed.

15 mM glyphosate was added to the well-spread young leaves of the upper part of the prepared transgenic beans in an amount of 10 ul by dropping 1 point.

As a control, the same test was performed by preparing transgenic soybeans into which the wild-type GmEPSPS gene was introduced.

The appearance was observed after 19 days of glyphosate treatment, and is shown in FIG. 2 . As confirmed in FIG. 2 , in the transgenic soybeans introduced with the wild-type GmEPSPS gene, weakness was observed around the point where glyphosate was applied, whereas in the transgenic soybeans introduced with all tested GmEPSPS gene variants, no weakness was observed. . These results show that glyphosate resistance was conferred or enhanced in the transgenic soybean into which the GmEPSPS gene mutant was introduced.

Example 6. T of transgenic soybeans _One Validation of glyphosate resistance in generations

The T1 generation of transgenic soybeans into which the GmEPSPS gene mutant prepared in Example 2 was introduced was prepared. Specifically, with reference to Example 5, a transgenic soybean (T0) into which the T183I mutation was introduced was prepared on behalf of the mutants obtained in Example 3. On the 11th day after sowing the seeds obtained from the transgenic soybeans, 7.5mM glyphosate was dropped into the first main leaf in an amount of 10ul, and the results observed 5 days later are shown in FIG.

As shown in FIG. 3 , transgenic soybeans (Williams 82 (WT)) into which the wild-type GmEPSPS gene was introduced were observed to spread over a relatively wide area around the point where glyphosate was applied, whereas the GmEPSPS gene mutant (T183I) ), the introduced transgenic soybean (T1) showed almost no weakness. These results show that glyphosate resistance was conferred or enhanced in transgenic soybeans into which the GmEPSPS gene mutant was introduced, and that this trait was successfully transmitted to the T1 generation.

<110> LG CHEM, LTD. <120> Methods and Compositions for Conferring and/or Enhancing Glyphosate Tolerance of Soybean <130> DPP20201939KR <160> 13 <170> enPatentIn 3.0 <210> 1 <211> 525 <212> PRT <213> Artificial Sequence <220> <223> EPSPS (5-enol-pyruvylshikimate-3-phosphate synthase) of Glycine max <400> 1 Met Ala Gln Val Ser Arg Val His Asn Leu Ala Gln Ser Thr Gln Ile 1 5 10 15 Phe Gly His Ser Ser Asn Ser Asn Lys Leu Lys Ser Val Asn Ser Val 20 25 30 Ser Leu Arg Pro Arg Leu Trp Gly Ala Ser Lys Ser Arg Ile Pro Met 35 40 45 His Lys Asn Gly Ser Phe Met Gly Asn Phe Asn Val Gly Lys Gly Asn 50 55 60 Ser Gly Val Phe Lys Val Ser Ala Ser Val Ala Ala Ala Glu Lys Pro 65 70 75 80 Ser Thr Ser Pro Glu Ile Val Leu Glu Pro Ile Lys Asp Phe Ser Gly 85 90 95 Thr Ile Thr Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu Leu 100 105 110 Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu Leu Tyr 115 120 125 Ser Glu Asp Ile His Tyr Met Leu Gly Ala Leu Arg Thr Leu Gly Leu 130 135 140 Arg Val Glu Asp Asp Lys Thr Thr Lys Gln Ala Ile Val Glu Gly Cys 145 150 155 160 Gly Gly Leu Phe Pro Thr Ser Lys Glu Ser Lys Asp Glu Ile Asn Leu 165 170 175 Phe Leu Gly Asn Ala Gly Thr Ala Met Arg Pro Leu Thr Ala Ala Val 180 185 190 Val Ala Ala Gly Gly Asn Ala Ser Tyr Val Leu Asp Gly Val Pro Arg 195 200 205 Met Arg Glu Arg Pro Ile Gly Asp Leu Val Ala Gly Leu Lys Gln Leu 210 215 220 Gly Ala Asp Val Asp Cys Phe Leu Gly Thr Asn Cys Pro Pro Val Arg 225 230 235 240 Val Asn Gly Lys Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser Gly 245 250 255 Ser Val Ser Ser Gln Tyr Leu Thr Ala Leu Leu Met Ala Ala Pro Leu 260 265 270 Ala Leu Gly Asp Val Glu Ile Glu Ile Val Asp Lys Leu Ile Ser Val 275 280 285 Pro Tyr Val Glu Met Thr Leu Lys Leu Met Glu Arg Phe Gly Val Ser 290 295 300 Val Glu His Ser Gly Asn Trp Asp Arg Phe Leu Val His Gly Gly Gln 305 310 315 320 Lys Tyr Lys Ser Pro Gly Asn Ala Phe Val Glu Gly Asp Ala Ser Ser 325 330 335 Ala Ser Tyr Leu Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Ile Thr 340 345 350 Val Asn Gly Cys Gly Thr Ser Ser Leu Gln Gly Asp Val Lys Phe Ala 355 360 365 Glu Val Leu Glu Lys Met Gly Ala Lys Val Thr Trp Ser Glu Asn Ser 370 375 380 Val Thr Val Ser Gly Pro Pro Arg Asp Phe Ser Gly Arg Lys Val Leu 385 390 395 400 Arg Gly Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr 405 410 415 Leu Ala Val Val Ala Leu Phe Ala Asn Gly Pro Thr Ala Ile Arg Asp 420 425 430 Val Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Ile Ala Ile Cys 435 440 445 Thr Glu Leu Arg Lys Leu Gly Ala Thr Val Glu Glu Gly Pro Asp Tyr 450 455 460 Cys Val Ile Thr Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr 465 470 475 480 Tyr Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys Gly 485 490 495 Asp Val Pro Val Thr Ile Lys Asp Pro Gly Cys Thr Arg Lys Thr Phe 500 505 510 Pro Asp Tyr Phe Glu Val Leu Glu Arg Leu Thr Lys His 515 520 525 <210> 2 <211> 1578 <212> DNA <213> Artificial Sequence <220> <223> EPSPS coding gene (Glyma.01g139600) of Glycine max <400> 2 atggcccaag tgagcagagt gcacaatctt gctcaaagca ctcaaatttt tggccattct 60 tccaactcca acaaactcaa atcggtgaat tcggtttcat tgaggccacg cctttggggg 120 gcctcaaaat ctcgcatccc gatgcataaa aatggaagct ttatgggaaa ttttaatgtg 180 gggaagggaa attccggcgt gtttaaggtt tctgcatcgg tcgccgccgc agagaagccg 240 tcaacgtcgc cggagatcgt gttggaaccc atcaaagact tctcgggtac catcacattg 300 ccagggtcca agtctctgtc caatcgaatt ttgcttcttg ctgctctctc tgagggaaca 360 actgttgtag acaacttgtt gtatagtgag gatattcatt acatgcttgg tgcattaagg 420 acccttggac tgcgtgtgga agatgacaaa acaaccaaac aagcaattgt tgaaggctgt 480 gggggattgt ttcccactag taaggaatct aaagatgaaa tcaatttatt ccttggaaat 540 gctggtactg caatgcgtcc tttgacagca gctgtggttg ctgcaggtgg aaatgcaagc 600 tacgtacttg atggggtgcc ccgaatgaga gagaggccaa ttggggattt ggttgctggt 660 cttaagcaac ttggtgcaga tgttgattgc tttcttggca caaactgtcc acctgttcgt 720 gtaaatggga agggaggact tcctggcgga aaggtgaaac tgtctggatc agttagcagt 780 caatacttga ctgctttgct tatggcagct cctttagctc ttggtgatgt ggaaattgag 840 attgttgata aactgatttc tgttccatat gttgaaatga ctctgaagtt gatggagcgt 900 tttggagttt ctgtggaaca cagtggtaat tgggataggt tcttggtcca tggaggtcaa 960 aagtacaagt ctcctggcaa tgcttttgtt gaaggtgatg cttcaagtgc cagttattta 1020 ctagctggtg cagcaattac tggtgggact atcactgtta atggctgtgg cacaagcagt 1080 ttacagggag atgtaaaatt tgctgaagtt cttgaaaaga tgggagctaa ggttacatgg 1140 tcagagaaca gtgtcactgt ttctggacca ccacgagatt tttctggtcg aaaagtcttg 1200 cgaggcattg atgtcaatat gaacaagatg ccagatgttg ccatgacact tgctgttgtt 1260 gcactatttg ctaatggtcc cactgctata agagatgtgg caagttggag agttaaagag 1320 actgagagga tgatagcaat ctgcacagaa ctcagaaagc taggagcaac agttgaagaa 1380 ggtcctgatt actgtgtgat tactccacct gagaaattga atgtcacagc tatagacaca 1440 tatgatgacc acagaatggc catggcattc tctcttgctg cttgtgggga tgttccagta 1500 accatcaagg atcctggttg caccaggaag acatttcctg actactttga agtccttgag 1560 aggttaacaa agcactaa 1578 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> EPSPSPgs 1F primer <400> 3 ccaagcttgc atgcctgcag ttgacaatta atcatccggc 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> EPSPSPgs 1R primer <400> 4 atgattacga attcgagctc atttgtccta ctcaggagag 40 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> M13F-pUC primer <400> 5 gttttcccag tcacgac 17 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> M13R primer <400> 6 gcggataaca atttcacaca gg 22 <210> 7 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> PtrcLib_F primer <400> 7 gcatgcctgc agttgacaat taatcatccg gctcgtataa tgtgtggtta attaaaagaa 60 ggagaattct agatg 75 <210> 8 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> rrnBLib_R primer <400> 8 ttacgaattc gagctcattt gtcctactca ggagagcgtt caccgacaaa caacagataa 60 aacgaaaggc cc 72 <210> 9 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> M13_F primer <400> 9 gtaaaacgac ggccagt 17 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ESPSPS_1252_R primer <400> 10 caagtgtcat agccacatct 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ESPSPS_1012_F primer <400> 11 agttatttac tggctggtgc 20 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P35 F primer <400> 12 aagcaagtgg attgatgtga tatctc 26 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> P35 R primer <400> 13 gcgaaggata gtgggattgt g 21

Claims (15)

A polypeptide comprising an amino acid sequence in which the soybean EPSPS (5-enol-pyruvylshikimate-3-phosphate synthase) protein is mutated by the following amino acid mutations or an amino acid sequence having 90% or more homology thereto:
Based on SEQ ID NO: 1,
(1) the amino acid residue corresponding to position 183 is substituted with isoleucine, or
(2) a combination of the following (i) and (ii): (i) the amino acid residue corresponding to position 183 is substituted with cysteine, and (ii) at positions 31, 48, 67, 81, 151, 161st, 166th, 170th, 184th, 191th, 199th, 221th, 229th, 251th, 253th, 276th, 278th, 292th, 294th, 307th, 309th, 373th , amino acid residues corresponding to one or more positions selected from positions 359, and 445 are each independently substituted, deleted, or added with an amino acid different from the original. The polypeptide of claim 1 , wherein the amino acid mutation comprises:
Based on SEQ ID NO: 1,
T183I; or
For T183I, T151A, I445V, A184V, K251R, D276E, K373N, K373M, S31P, S81A, K253R, V67M, A199D, G161E, E292K, G309S, A191T, T294S, S359Y, H307Q, M48I, T166A, S170C, T166A, S170C, T166A, , and one or more combinations selected from the group consisting of E278G. The polypeptide of claim 1 , wherein the amino acid mutation comprises:
Based on SEQ ID NO: 1,
T183I;
combination of T151A and T183I;
combination of T183I and I445V;
combination of T183I, A184V, and K251R;
a combination of T183I, D276E, and K373N;
a combination of S31P, S81A, T183I, and K253R;
a combination of V67M, T183I, A199D, and K373M;
a combination of G161E, T183I, E292K, and G309S;
a combination of T183I, A191T, T294S, and S359Y;
a combination of S31P, S81A, T183I, K253R, and H307Q; or
Combinations of M48I, T166A, S170C, T183I, L221I, D229H, and E278G. A polynucleotide encoding the polypeptide of any one of claims 1 to 3. A recombinant vector comprising the polynucleotide of claim 4. A recombinant cell comprising the recombinant vector of claim 5 . The polypeptide of any one of claims 1 to 3; a polynucleotide encoding the polypeptide; a recombinant vector comprising the polynucleotide; And a composition for enhancing or imparting resistance to glyphosate of soybeans, comprising at least one selected from the group consisting of recombinant cells comprising the recombinant vector. The step of introducing a polynucleotide encoding the polypeptide of any one of claims 1 to 3 or a recombinant vector comprising the polynucleotide into soybean, or mutating an endogenous EPSPS-encoding gene of soybean to encode the polypeptide Including, glyphosate resistance is enhanced or a method for producing soybeans imparted. The method according to claim 8, wherein the soybean is a soybean cell, protoplast, callus, hypocotyl, seed, cotyledon, whole plant, or progeny thereof. The step of introducing a polynucleotide encoding the polypeptide of any one of claims 1 to 3 or a recombinant vector comprising the polynucleotide into soybean, or mutating an endogenous EPSPS-encoding gene of soybean to encode the polypeptide A method for enhancing or imparting glyphosate resistance of soy, comprising. The method according to claim 10, wherein the soybean is a cell, protoplast, callus, hypocotyl, seed, cotyledon, whole plant, or progeny thereof, glyphosate resistance enhancement or conferring method of soybean. A soybean transformant having resistance to glyphosate, comprising the polypeptide of any one of claims 1 to 3, or a polynucleotide encoding the polypeptide. The method according to claim 12, wherein the transformant of soybean is a cell, protoplast, callus, hypocotyl, seed, cotyledon, whole plant, or a progeny thereof, of a soybean transformant. Claims 1 to 3, comprising the step of applying an effective amount of glyphosate to a transgenic soybean comprising the polypeptide of any one of claims 1 to 3, or a polynucleotide encoding the polypeptide, or to a cultivated land provided with the transgenic soybean , how to grow soybeans. Claims 1 to 3, comprising the step of applying an effective amount of glyphosate to a transgenic soybean comprising the polypeptide of any one of claims 1 to 3, or a polynucleotide encoding the polypeptide, or to a cultivated land provided with the transgenic soybean , how to control weeds in soybean plantations.

Images