KR20220036304A - Composition for anti-obesity comprising dihydrocaffeic acid - Google Patents

Abstract

The present invention relates to an anti-obesity composition containing dihydrocaffeic acid, and more specifically, to a pharmaceutical composition for preventing or treating obesity containing dihydrocaffeic acid as an active ingredient, and to a health composition for preventing or improving obesity. It relates to functional food compositions and quasi-drug compositions for preventing or improving obesity.
The composition containing dihydrocaffeic acid of the present invention has excellent effects in inhibiting differentiation of adipocytes and fat accumulation in adipocytes, and can be usefully used as an anti-obesity composition.

Description

Anti-obesity composition comprising dihydrocaffeic acid {Composition for anti-obesity comprising dihydrocaffeic acid}

The present invention relates to an anti-obesity composition containing dihydrocaffeic acid, and more specifically, to a pharmaceutical composition for preventing or treating obesity containing dihydrocaffeic acid as an active ingredient, and to a health composition for preventing or improving obesity. It relates to functional food compositions and quasi-drug compositions for preventing or improving obesity.

Obesity or obesity refers to a state of excessive body fat, and can be defined as a health risk condition that causes various diseases, including heart disease, due to excessive body fat. Pathologically, it is the so-called condition defined by the World Health Organization (WHO). It refers to cases where the standard body mass index (BMI) is over 30, but in Korea, obesity is diagnosed when it is over 25. In most cases, this means weighing more than normal, but even if the weight is not that much, if the proportion of fat in the body composition is high, it is called obesity. Obesity may not be a problem in itself, but the social disabilities it causes and the secondary complications caused by excessive fat are serious. For example, obesity can significantly increase the incidence of hyperlipidemia, high blood pressure, arteriosclerosis, diabetes, fatty liver, and joint abnormalities.

In this way, obesity is the cause of various adult diseases. As you gain weight, your ability to process blood sugar decreases, making you more prone to diabetes and high blood pressure. If your weight increases by 20% compared to normal weight, the likelihood of developing diabetes increases to 10 times that of a normal person. Additionally, heart and lung function may weaken and lifespan may be shortened. Complex factors such as high blood pressure, diabetes, hypercholesterolemia, and arteriosclerosis put pressure on heart function, leading to heart failure and sudden death. In the case of women, the incidence of endometrial cancer increases and the likelihood of developing cholelithiasis also increases. Men have an increased risk of developing colon cancer and prostate cancer. In addition, as you gain weight, you cannot help but be conscious of how others look at you, and as your obsession with this becomes more severe, you begin to avoid people and try to be alone. Additionally, the feeling of inferiority that comes from one's body causes one to lose confidence in one's life and even affects one's self.

Since most obesity is caused by excessive calorie intake and lack of physical activity, the basic treatment for obesity is improving lifestyle habits through diet and exercise. Weight loss and waist circumference reduction are important goals in the treatment of obesity. Although the treatment principle is simple, achieving long-term weight loss is very difficult. Therefore, obesity should be approached as a chronic disease that requires continuous treatment for several years or more. In improving lifestyle habits, exercise therapy and behavioral therapy are used in combination with a low-calorie diet, and in some cases of severe obesity, surgical surgery is also used.

There are three main approaches to treating obesity (Cooke and Bloom, 2006; Shi and Burn, 2004). The first approach is to suppress appetite. Diethylpropion, phendimetrazine, and phentermine are used to treat obesity by stimulating brain nerves to create a feeling of fullness. They have been approved by the U.S. FDA. The second approach is to inhibit the absorption of ingested fat. A representative example is Orlistat, which acts on the digestive system and prevents fat absorption, making it a long-term drug. The third approach is to induce weight loss through high energy consumption in the body. A representative drug is sibutramine, which increases energy expenditure through neuromodulation. However, these drugs require caution when using them due to side effects such as nerve agent side effects or interference with the absorption of fat-soluble vitamins. In particular, the use of obesity medication is not recommended for children, pregnant women, or those with diseases such as high blood pressure. In addition, in most cases of obesity, long-term treatment is required because weight is gained again after a short period of weight loss, so there is a need to discover new treatments.

The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating obesity containing dihydrocaffeic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

Additionally, the present invention aims to provide a health functional food composition for preventing or improving obesity containing dihydrocaffeic acid or a salt thereof as an active ingredient.

Additionally, the purpose of the present invention is to provide a quasi-drug composition for preventing or improving obesity containing dihydrocaffeic acid or a salt thereof as an active ingredient.

In order to solve the above problems, the present invention provides a pharmaceutical composition for preventing or treating obesity containing dihydrocaffeic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

Additionally, the present invention provides a health functional food composition for preventing or improving obesity containing dihydrocaffeic acid or a salt thereof as an active ingredient.

Additionally, the present invention provides a quasi-drug composition for preventing or improving obesity containing dihydrocaffeic acid or a salt thereof as an active ingredient.

The composition containing dihydrocaffeic acid of the present invention has excellent effects in inhibiting differentiation of adipocytes and fat accumulation in adipocytes, and can be usefully used as an anti-obesity composition.

Figure 1 schematically shows the process of adipocyte differentiation and fat accumulation experiment using the mouse 3T3-L1 cell line.
Figure 2 shows the image analysis results for the effect of inhibiting fat accumulation by dihydrocaffeic acid.
Figure 3 shows the results of quantitative comparison of the effect of inhibiting fat accumulation by dihydrocaffeic acid.
Figure 4 shows the results of analyzing the effect of inhibiting the expression of genes related to fat synthesis by dihydrocaffeic acid.
Figure 5 shows the results of a comparative analysis of the fat accumulation inhibition effect of dihydrocaffeic acid, caffeic acid, and caffeic acid phenethyl ester.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is It is well known and commonly used in the art.

In one aspect, the present invention relates to a pharmaceutical composition for preventing or treating obesity containing dihydrocaffeic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

As used herein, the term “composition” is considered to include not only products containing specific ingredients, but also any product made directly or indirectly by combining specific ingredients.

The term “anti-obesity” used in the present invention means preventing, suppressing, improving, alleviating or treating obesity. Obesity is a condition in which fat tissue is excessively accumulated in the body. Energy intake is greater than energy consumption, and the remaining unconsumed energy is accumulated as body fat in the form of various lipids or increases the lipid content in the blood.

Dihydrocaffeic acid used as an active ingredient in the composition of the present invention may be represented by the following [Formula 1]:

[Formula 1]

.

In the present invention, the prevention or treatment of obesity may be achieved by suppressing the differentiation of preadipocytes into adipocytes, and may also be achieved by suppressing fat accumulation by reducing the expression of genes related to fat accumulation.

At this time, the fat accumulation-related gene may be acetyl-CoA carboxylase 1 (ACC1), as can be seen from the results of the examples below.

When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in preparation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Includes, but is limited to, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It doesn't work. In addition to the above ingredients, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19 th ed, 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally, and is preferably applied by oral administration.

The appropriate dosage of the pharmaceutical composition of the present invention is prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. It can be. The preferred dosage of the pharmaceutical composition of the present invention is within the range of 0001 to 100 mg/kg for adults.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating it using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by a person skilled in the art. Alternatively, it can be manufactured by placing it in a multi-capacity container. At this time, the formulation may be in the form of a solution, suspension, syrup or emulsion in oil or aqueous medium, or may be in the form of extract, powder, powder, granule, tablet or capsule, and may additionally contain a dispersant or stabilizer.

From another aspect, the present invention relates to a health functional food composition for preventing or improving obesity containing dihydrocaffeic acid or a salt thereof as an active ingredient.

When the composition of the present invention is manufactured as a functional food composition or food composition, it contains not only dihydrocaffeic acid or a pharmaceutically acceptable salt thereof as an active ingredient, but also ingredients commonly added during the production of functional food or food, Examples include proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. Examples of the above-mentioned carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, oligosaccharides, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a flavoring agent, natural flavoring agents (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

When the functional food or food composition of the present invention is manufactured as a drink, in addition to dihydrocaffeic acid, which is the active ingredient of the present invention, or a pharmaceutically acceptable salt thereof, citric acid, high fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, and cephalic acid are added. Extract, jujube extract, or licorice extract may be additionally included.

From another aspect, the present invention relates to a quasi-drug composition for preventing or improving obesity containing dihydrocaffeic acid or a salt thereof as an active ingredient.

In the present invention, the term "quasi-drug" refers to fibers, rubber products, or similar products used for the purpose of treating, alleviating, treating, or preventing diseases in humans or animals. They have a weak effect on the human body or do not directly act on the human body, and refer to devices or Items that are non-machine or similar, or products that are used for sterilization, insecticide and similar purposes to prevent infectious diseases, and are used for the purpose of diagnosing, treating, mitigating, treating or preventing diseases in humans or animals. It refers to articles that are not instruments, machines, or devices among articles used for the purpose of having a pharmacological effect on the structure and function of humans or animals, excluding articles that are not instruments, machines, or devices.

When using the composition of the present invention as a quasi-drug composition, the dihydrocaffeic acid or a pharmaceutically acceptable salt thereof can be added as is or used together with other quasi-drug ingredients, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment). According to one embodiment of the present invention, the quasi-drug composition of the present invention may be a disinfectant cleaner, toothpaste, shower foam, gargle, wet tissue, detergent soap, hand wash, humidifier filler, mask, ointment, or filter filler.

Since the quasi-drug and health functional food composition of the present invention share active ingredients and uses with the above-mentioned pharmaceutical composition, the description of common information in relation to the pharmaceutical composition is omitted to avoid excessive complexity of the present specification. do.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be obvious to those skilled in the art that the scope of the present invention should not be construed as limited by these examples. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

< Example >

At the core of the anti-obesity effect is an increase in the number of adipocytes due to differentiation of adipocytes and an increase in adipocyte size due to an increase in the amount of fat within adipocytes. Therefore, suppressing the differentiation of adipocytes or suppressing fat accumulation within adipocytes becomes the primary target of anti-obesity action. The present invention was carried out by establishing a cell line model for adipocyte differentiation and fat accumulation, and through this, screening the anti-obesity effect of various substances to discover effective substances. An appropriate differentiation induction system was established using the 3T3-L1 cell line, a mouse fetal fibroblast cell line, and the effects of various bacterial-derived compounds were screened using this system. Finally, by confirming the amount of fat present in the cell line induced into adipocytes through oil red O staining, a substance that inhibits adipocyte differentiation and fat accumulation in adipocytes was discovered (see Figure 1).

Dehydro Confirmation of the effects of caffeic acid on inhibiting adipocyte differentiation and fat accumulation: Oil-red O staining method

Mouse 3T3-L1 preadipocytes (American Type Culture Collection (ATCC) #F8979) containing 10% calf serum (CS; Invitrogen) and antibiotic solution (100 units/mL penicillin, 100 ug/mL streptomycin; Invitrogen). It was maintained in a 37°C CO ₂ incubator (5% CO ₂ : 95% air) using Dulbecco's modified Eagle medium (DMEM; Invitrogen). Differentiation of 3T3-L1 preadipocytes was induced using MDI-differentiation medium (DMEM (Invitrogen), 10% FBS (Invitrogen), 1 uM dexamethasone (Sigma-Aldrich), 0.5 mM IBMX (SigmaAldrich), and 5 ug/ml insulin ( Sigma-Aldrich)) and maintained for 2 days. Two days later, dexamethasone and IBMX were removed, the previous medium was replaced with regular medium containing only insulin, and the cell line was maintained by replacing it with new medium every two days. At 8 days after treatment with MDI-differentiation medium, differentiation of adipocytes and amount of fat were measured. At this time, more than 90% of the cells had differentiated into mature adipocytes with accumulated fat droplets. To examine the mechanism of inhibiting differentiation of adipocytes, the compound dihydrocaffeic acid was treated at different concentrations (0, 1, 10 μM) during MDI-differentiation medium treatment and at each medium exchange time.

On the 8th day of induction of adipocyte differentiation, adipocytes were washed twice with ice-cold PBS and fixed with 10% formalin for 1 hour at room temperature. Afterwards, the cells were stained with 0.6% Oil-red O (Sigma-Aldrich) dissolved in 60% isopropanol for 1 hour. After washing the cells with water, image analysis was performed, and the results are shown in Figure 2 below. Through Figure 2, it was confirmed that the amount of fat droplets that appeared red by Oil-red O staining was reduced by treatment with dihydrocaffeic acid. Next, the red-stained fat droplets were dissolved with isopropanol and then quantified at 540 nm using a spectrophotometer, and the results are shown in Figure 3 below. As shown in Figure 3, when treated with dihydrocaffeic acid at concentrations of 1 and 10 μM, significant inhibition of fat accumulation was observed in a concentration-dependent manner compared to the dihydrocaffeic acid untreated group (0 μM) (compared to the untreated group) (28% inhibition when treated with 1 μM, 35% inhibition when treated with 10 μM), it was confirmed that dihydrocaffeic acid, the active ingredient of the present invention, can effectively inhibit differentiation and development of adipocytes.

Dehydro Regulation of fat accumulation-related gene expression by caffeic acid: real-time polymerase chain reaction analyze

Changes in the expression of genes related to fat accumulation during adipocyte differentiation according to dihydrocaffeic acid treatment (10 μM) were confirmed through real-time polymerase chain reaction. Mouse 3T3-L1 preadipocytes (preadipocytes; American Type Culture Collection (ATCC) #F8979) were differentiated into adipocytes in the same manner as above, and RNA was extracted from the cells 3 days after treatment with MDI-differentiation medium and subjected to real-time polymerase chain analysis. The reaction was carried out. Through this, we measured the mRNA expression of Acetyl-CoA carboxylase 1 (ACC1) and fatty acid synthase (FAS), which are involved in fat synthesis, and carnitine palmitoyl, which is involved in lipolysis. Carnitine palmitoyltransferase 1a (CPT1a), Peroxisome proliferator-activated receptor α (PPARα), Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (Peroxisome proliferator-activated receptor α; PPARα) The mRNA expression of activated receptor γ coactivator 1 α; PGC1α) was measured. The base sequences of primers used to measure mRNA expression of each gene are shown in Table 1 below.

FAS F mouse CCT GCT ATC ATC TGA CTT CCT CT R mouse AGG GTG GTT GTT AGA AAG ATC AA ACC1 F mouse GCGGGAGGA GTTCCTAATTC R mouse TGTCCCAGACGTAAGCCTTC CPT1a F m/r GTCTGAGCCATGGAGGTTGT R m/r GGCTTGTCTCAAGTGCTTCC PPARa F mouse AACTGGATGACAGTGACATTTCC R mouse CCCTCCTGCAACTTCTCAAT PGC1a F mouse CGA TGT GTC GCC TTC TTG CT R mouse CGA GAG CGC ATC CTT TGG

Figure 4 shows the results of analyzing the effect of inhibiting the expression of genes related to fat synthesis by dihydrocaffeic acid. As shown in Figure 4, upon treatment with dihydrocaffeic acid, the expression of the ACC1 gene, which plays an important role in fat synthesis, was found to be significantly reduced. Through this, it was found that dihydrocaffeic acid according to the present invention promotes fat synthesis. It was confirmed that differentiation and development of adipocytes can be effectively inhibited by inhibiting it.

Dehydro Comparison of effects of inhibiting adipocyte differentiation and fat accumulation by caffeic acid-like substances: Oil-red O staining method

In order to determine the extent of the effect of dihydrocaffeic acid on inhibiting fat differentiation and fat accumulation, caffeic acid and caffeic acid phenethyl ester, which are similar substances to dihydrocaffeic acid, were used to determine adipocyte differentiation and The effect of inhibiting fat accumulation was compared. Mouse 3T3-L1 preadipocytes (American Type Culture Collection (ATCC) #F8979) were differentiated into adipocytes in the same manner as above, and treated with each compound to measure the degree of adipocyte differentiation and fat accumulation. On the 8th day of differentiation induction, Oil-red O staining was performed to quantify the amount of red fat droplets, and the results are shown in Figure 5 and Table 2 below.

1 μM 10 μM dihydrocaffeic acid 28% suppression 35% suppression caffeic acid 5% suppression 0% suppression Caffeic acid phenethyl ester 4% suppression 23% suppression

Through Figure 5 and Table 2 above, it was confirmed that dihydrocaffeic acid, the active ingredient of the present invention, exhibits a stronger effect of inhibiting fat accumulation compared to caffeic acid and caffeic acid phenethyl ester. In conclusion, it can be concluded that dihydrocaffeic acid, the active ingredient of the present invention, It was confirmed that hydrocaffeic acid can effectively inhibit differentiation and accumulation of adipocytes.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (6)

A pharmaceutical composition for preventing or treating obesity comprising dihydrocaffeic acid or a pharmaceutically acceptable salt thereof as an active ingredient. According to paragraph 1,
A pharmaceutical composition for preventing or treating obesity, wherein the dihydrocaffeic acid inhibits the differentiation of preadipocytes into adipocytes. According to paragraph 1,
The dihydrocaffeic acid is a pharmaceutical composition for preventing or treating obesity, characterized in that it reduces the expression of genes related to fat accumulation. According to paragraph 3,
A pharmaceutical composition for preventing or treating obesity, wherein the fat accumulation-related gene is acetyl-CoA carboxylase 1 (ACC1). A health functional food composition for preventing or improving obesity comprising dihydrocaffeic acid or a salt thereof as an active ingredient. A quasi-drug composition for preventing or improving obesity comprising dihydrocaffeic acid or a salt thereof as an active ingredient.