KR20210064915A - Composition for improving muscle function, comprising grub extract - Google Patents

Abstract

The present invention relates to a composition for enhancing muscle activity, improving muscle function, and improving exercise performance, containing an extract of larvae of Protaetia brevitarsis. In addition, since the Holotrichia diomphalia exract contains a component derived from a natural product, it can be usefully used as a material with low toxicity to the human body.

Description

Composition for improving muscle function comprising a slug extract {COMPOSITION FOR IMPROVING MUSCLE FUNCTION, COMPRISING GRUB EXTRACT}

The present invention relates to a composition for enhancing muscle activity, improving muscle function, and improving exercise performance, comprising an extract of larvae of Protaetia brevitarsis seulensis.

Muscles are divided into skeletal muscles, cardiac muscles, and visceral muscles. The skeletal muscle occupies a large part of the human body, accounting for 40% of the body weight, and together with the bones, it holds the shape of the human body and enables movement and movement. Together, these bones and skeletal muscles are called the musculoskeletal system.

The basic cells of muscle are composed of myoblasts. When the muscle is injured or the muscle tissue is ruptured due to excessive exercise, the satellite cells, which are stem cells of the muscle tissue, are activated and the division of the satellite cells is promoted. Some of the increased satellite cells preserve the function of stem cells again, and some begin to differentiate into muscle cells. At this time, various transcription factors related to the differentiation of muscle cells are activated, and the satellite cells differentiate into myocytes, myoblasts, and myotubes in that order to refill the wounded and damaged muscle tissue with new muscle fibers. do.

On the other hand, the growth of muscle can be divided into two types. First, there is hyperplasia, which increases the number of muscle cells to grow, and hypertrophy, which grows by increasing the size of the cells. Mainly growth (hyperplasia) occurs mainly from infancy to secondary sexual characteristics, that is, growth of muscle through exercise corresponds to hypertrophy (hypertrophy). In addition, when an appropriate amount of exercise is continuously performed to stimulate muscle cells, factors involved in muscle development are continuously expressed. The size and number of muscle fibers, muscle development and muscle mass increase, as well as the mitochondrial biosynthesis and its function, which are important for muscle motility, are improved.

Maintaining muscle homeostasis is an essential condition for maintaining a smooth life, but in modern society, the lack of exercise is increasing due to aging and changes in occupational distribution. As a result, the amount of muscle used is reduced, and the muscle mass and muscle function are reduced, so that it is easy to feel fatigued or suffer a large injury even from a small collision. In addition, behaviors that are harmful to the human body, such as irregular eating habits, stress, alcohol, and smoking, also cause muscle weakness.

Strength refers to the ability of a muscle, and mainly refers to the maximum force that a muscle can produce at one time. Exercise performance refers to the ability to perform an exercise using muscle strength. Weakness of muscle function and muscle weakness due to the above-mentioned problems causes a decrease in muscle strength and exercise performance, which causes a decrease in physical strength, an increase in adult diseases, a decrease in quality of life, and the like.

Protaetia brevitarsis seulensis (Protaetia brevitarsis seulensis) is a type of scarab that is 17-22 mm in size and has a coppery-black color and is glossy, flat, and gives a hard impression. It has a habit of gathering.

Caterpillars are also called slugs and have been treated well as herbal medicines since ancient times, including in Donguibogam. It is eaten raw, baked, or roasted, and as insect food has been in the limelight, on September 30, 2014, the larvae of the white-spotted beetle were recognized as food. It is cultivated in many farms and is very beneficial to humans, such as raising it as a pet. It is a familiar insect.

However, the extracts and ingredients are known as food or additives as novel protein sources, but studies on improving muscle function related to muscle function and improving exercise performance through this have not been reported as well as not being made.

Korean Patent Registration No. 10-1382400

It is an object of the present invention to provide a pharmaceutical composition for treating or preventing muscle disease, comprising an extract of larvae of Protaetia brevitarsis seulensis.

Another object of the present invention is to provide a composition for improving exercise performance comprising an extract of larvae of Protaetia brevitarsis seulensis and a food composition comprising the same.

Another object of the present invention is to provide a method for improving muscle disease treatment or exercise performance by administering the composition.

One aspect of the present invention for achieving the above object provides a pharmaceutical composition for the treatment or prevention of muscle diseases, comprising an extract of larvae of Protaetia brevitarsis seulensis.

In the present invention, the “white-spotted flower radish ( Protaetia brevitarsis )” is one of the edible insects, and is called “manufacture” or “slug” in traditional oriental medicine books such as folk and Donguibogam. It belongs to the subfamily and is a herbivorous insect with a body length of 17-22 mm and a width of 12-15 mm. The body is dark copper-colored, glossy, and yellowish-white patterns are scattered.

The white-spotted flower radish has been used as a herbal medicine for the treatment of liver diseases and the like from a long time ago. In addition, it has recently attracted great attention as an insect resource for the search and development of useful bioactive substances, and the production of antibiotics, the restoration of liver lipid metabolism damaged by excessive alcohol intake in experiments using mice, etc. Although this is known and its usefulness has been confirmed, such as a study on thrombolytic enzymes and a hepatoprotective effect on hepatotoxicity induced by administration of carbon tetrachloride in rats, improvement of muscle function related to muscle function and exercise performance through it Studies on ability improvement have not been done nor have been reported.

In the specification of the present invention, the term "slug" is used instead of the larva of the white spot daisy.

In the present invention, "muscle" refers to tendons, muscles, and tendons comprehensively, and "muscular function" means the ability to exert force by contraction of the muscle, and the muscle can exert maximum contractile force to overcome resistance. These include strength, which is the ability to be able to, muscular endurance, which is the ability to repeat contractions and relaxations for how long or how many times a muscle can repeat contractions and relaxations with a given weight, and instantaneous power, which is the ability to exert strong force in a short time. This muscle function is controlled by the liver and is proportional to the muscle mass, and "improving muscle function 　" means improving the muscle function better.

In the present invention, "exercise performance ability" refers to when physical motions seen in daily life or sports are externally divided into running, jumping, throwing, swimming, etc., to perform the motion quickly, strongly, accurately, for a long time, and skillfully. It indicates the degree to which exercise performance can be performed, and exercise performance is defined by factors such as muscle strength, agility, and endurance, and "improving exercise performance" means improving or improving exercise performance.

In the present invention, the expression levels of genes (Experimental Example 1) and proteins related to muscle function and muscle synthesis were compared in order to confirm the degree of improvement in muscle function and improvement in exercise performance according to the treatment of slugs extract (Experimental Example 2), Furthermore, changes in the amount of ATP in muscle cells (Experimental Example 3) and changes in muscle cell proliferation (Experimental Example 4) by the slug extract treatment were confirmed.

In the present invention, specifically, the extract _{may be extracted with water, a C 1} to C ₄ lower alcohol, or a mixed solvent thereof. More specifically, it may be extracted using water, but is not limited thereto.

Specifically, in the extraction process of the extract, one or more methods selected from the group consisting of cold chim, warm chim, heating, reflux and ultrasonic extraction may be used alone or in combination, and the present invention is not limited thereto, and may be appropriately changed and applied as necessary. can

In addition, after performing the extraction or fractionation process, the extract may be concentrated or the solvent may be removed by performing a filtration process under reduced pressure or further concentration and/or freeze-drying, specifically, the process of concentration under reduced pressure after extraction It is possible to obtain an extract through the process, but is not limited thereto, and can be applied by appropriately changing it.

In the present invention, specifically, the muscle disease may be a muscle disease caused by 　muscular function 　decrease, muscle wasting or muscle degeneration, and more specifically, the muscle disease is atony, muscular atrophy, muscular dystrophy. (muscular dystrophy), myasthenia, cachexia (cachexia) and may be one or more selected from the group consisting of sarcopenia (sarcopenia), but is not limited thereto.

The “atony” refers to a disease in which dystonia, atonia, and dystonia, also called dystonia, and a state in which muscle tone is reduced or lost.

The "muscular atrophy" refers to a loss of muscle tissue or a disease of the muscle itself or damage to the nerve that controls the muscle caused by not using the muscle, and includes both progressive muscle atrophy and muscle weakness. In general, there are cases where severe muscle strength loss occurs due to not using muscles and gradually progresses to muscle atrophy. In addition, in the case of people living in a place where there is no gravity, or due to a decrease in calcium and muscle strength, muscle strength decreases. Occasionally, symptoms may be reduced.

In addition, muscle atrophy due to the disease of the muscle itself may include myasthenia gravis, Duchenne type, Becker type, zone type, scapular brachial type, and inflammation occurring in the muscle itself, and the nerves that control the muscle Spinal muscular amyotrophy (Beradnig-Hoffmann type), Kugelberg-Velander disease, amyotrophic lateral sclerosis (ALS), Lou Gehrig's disease, Spinobular muscular atrophy) can include Kennedy's disease.

The "muscular dystrophy" is a type of degenerative myopathy, which indicates necrosis of muscle fibers, and muscle fiber loss and atrophy occur through necrosis and degeneration of muscle fibers due to damage to the muscle cell membrane. Duchenne muscular dystrophy, Becker muscular dystrophy, Limb-girdle muscular dystrophy, Emery-Dreifuss muscular dystrophy, Facioscapulohumeral dystrophy ), myotonic muscular dystrophy, oculopharyngeal muscular dystrophy, extremity muscular dystrophy, congenital muscular dystrophy, etc., and can appear in various forms depending on the site.

In addition, the muscle wasting or muscle degeneration occurs due to genetic factors, acquired factors, aging, etc., and includes both a gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal or voluntary muscles, and cardiac muscles, resulting in muscle weakness may include all of them.

The "muscle weakness" refers to a state in which the strength of one or more muscles is reduced. The muscle weakness may be limited to any one muscle, one side of the body, upper or lower extremities, or the like, or may appear throughout the body. In addition, subjective muscle weakness symptoms including muscle fatigue and muscle pain can be quantified in an objective way through medical examination. The causes of muscle weakness include, but are not limited to, muscle damage, decreased muscle mass due to decreased differentiation of muscle cells, and muscle aging.

In the present invention, "muscle damage" refers to any damage caused by physical or chemical destruction caused by the injury.

Specifically, the muscle damage includes muscle strain, muscle rupture, muscle tearing, contusion, distortion, rotator cuff syndrome, and myositis. ) may be one or more selected from the group consisting of, but is not limited thereto.

The "myasthenia" is a disease in which muscles are weakened due to a neurological disorder of the muscles, and at first, mild symptoms such as drooping eyelids (ptosis) and poor pupils appear. Also, when speaking, the pronunciation is not correct or the food is swallowed incorrectly. In addition, facial muscles are weakened. When myasthenia gravis worsens, the symptoms spread throughout the body, making it difficult for the arms and legs to enter, making it difficult to lift objects and fall easily. Dangerous conditions such as shortness of breath and respiratory paralysis may also appear.

The “cachexia” refers to a condition that results in a marked weakness of the systemic state, and causes include malignant tumor, Basedow disease, hypopituitarism, malaria, adrenal cortex hypofunction, thymus insufficiency, and the like. Clinically, general weakness, anemia, and edema are the main symptoms. It is known that the anemia of malignant tumors causes nutritional disorders due to the local effects of the tumor itself, and systemically competes with the host metabolism to cause host metabolism disorders and cachexia by the metabolites of the tumor.

In the present invention, specifically, the improvement of exercise performance may mean preventing or treating one or more diseases selected from the group consisting of mitochondrial abnormalities, neurodegenerative diseases, hypostamina, and hypotonia.

In the present invention, the "mitochondrial disease" is a disease caused by a dysfunction of mitochondria, phosphate swelling due to abnormal mitochondrial membrane potential, oxidative stress caused by reactive oxygen species or free radicals, etc., mitochondrial DNA It can include all diseases caused by functional abnormalities due to genetic factors such as mutations in mitochondrial function-related genes in the cell nucleus, and defects in the oxidative phosphorylation function for mitochondrial energy generation.

Mitochondria are essential organelles that produce ATP, which is the energy of cells. Mitochondrial dysfunction causes less and less energy produced within the cell, followed by cell damage or even cell death. Accordingly, the mitochondrial dysfunction inhibits all cell functions including mitochondria other than red blood cells that do not have mitochondria, and in particular, causes fatal damage to organs with high energy demand, such as muscles or brain.

Mitochondrial dysfunction can affect virtually any tissue, and a wide variety of symptoms can exist depending on the degree to which the tissue is involved. Examples of specific mitochondrial disorders include Friedreich's ataxia (FRDA), Leber's Hereditary Optic Neuropathy (LHON), Dominant Optic atrophy (DOA); Mitochondrial Myopathy, Encephalopathy, Lactacidosis, Stroke (MELAS), Myoclonus Epilepsy Associated with Ragged-Red Fibers (MERRF) Syndrome, Ray Leigh) syndrome and oxidative phosphorylation disorders, and most mitochondrial diseases are known to be neurodegenerative diseases, stroke, blindness, deafness, diabetes, and heart failure.

When the slug extract of the present invention was treated in muscle cells (C2C12) (Experimental Example 1), it was confirmed that the gene expression related to ATP production increased, and in Experimental Example 3, it was confirmed that the amount of ATP in the cells actually increased (Fig. 19). Therefore, the slug extract of the present invention can exhibit improvement and preventive effects on mitochondrial abnormal diseases and neurodegenerative diseases, hypostamina, and hypotonia that may be caused by damage to muscles and brain due to lack of ATP.

In the present invention, the "neurodegenerative disease" is a disease that causes abnormalities in motor control ability, cognitive function, sensory function, sensory function, and autonomic nerve function due to loss of nerve structure and function. It may mean one or more selected from the group consisting of lateral sclerosis, Amyotrophic lateral sclerosis; ALS), Alzheimer's disease (AD), and Parkinson's disease (PD).

In the present invention, the "hypo endurance" and "hypodynamics" are caused by a malfunction of mitochondria in muscle cells, and may be caused by not proceeding with the normal ATP synthesis process.

In the present invention, the term “prevention” refers to a reduction in the degree of occurrence of pathological cells in an animal or damage or loss of cells. Prevention may be complete or partial. In this case, it may mean a phenomenon in which the generation of pathological cells or the death or loss of nerve cells in the individual is reduced compared to the case where the composition for treating muscle disease or improving exercise performance is not used.

In the present invention, the "treatment" means improving the symptoms of the muscle disease or stopping the progression of the symptoms, and may encompass the meaning of commonly used treatment.

Another aspect of the present invention provides a pharmaceutical composition for treating muscle disease or improving athletic performance comprising the composition.

The pharmaceutical composition may include 0.001 wt% to 99.9 wt%, specifically 0.1 wt% to 99 wt%, more specifically 1 wt% to 50 wt% of the slugs extract based on the total weight of the composition. In addition, the content of the additional component may be specifically added in the range of 0.1 to 20 parts by weight per 100 parts by weight of the slug extract.

In addition, the pharmaceutical composition may further include carriers, excipients and diluents used in the preparation of conventional pharmaceutical compositions.

The carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil.

In addition, the composition can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, external preparations, suppositories, and sterile injection solutions.

The solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient, for example, starch, calcium carbonate, sucrose, lactose in the slug extract and its fractions. , or it can be prepared by mixing gelatin and the like. In addition to the above excipients, lubricants such as magnesium stearate and talc may be used.

As the liquid formulation for oral administration, a suspension, an internal solution, an emulsion, a syrup, etc. may be used, and in addition to the simple diluent water and liquid paraffin, various excipients, for example, a wetting agent, a sweetener, a fragrance, a preservative, etc. may be included. have.

A sterile aqueous solution, a non-aqueous solution, a suspension, an emulsion, a lyophilized formulation, and a suppository may be used in the formulation for parenteral administration. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin fat, and glycerogelatin may be used.

The pharmaceutical composition including the slug extract may be administered to a subject in a pharmaceutically effective amount. The “pharmaceutically effective amount” means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is dependent on the patient's type, severity, drug activity, and drug. Sensitivity, time of administration, route of administration and rate of excretion, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field.

The pharmaceutical composition may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple. Taking all of the above factors into consideration, it is preferable to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

The preferred dosage of the therapeutic composition of the present invention varies depending on the condition and body weight, the degree of disease, the drug form, the route and duration of administration, but may be appropriately selected by those of ordinary skill in the art to which the present invention pertains. have. Preferably, the therapeutic composition of the present invention is administered at 0.0001 to 1000 mg/kg per day based on the amount of slug extract, and to be more effective, it is preferably administered at 0.01 to 100 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The dosage and frequency of administration are not intended to limit the scope of the present invention in any way.

Another aspect of the present invention provides a composition for improving athletic performance, comprising an extract of larvae of Protaetia brevitarsis seulensis

Specifically, the improvement of the exercise performance may indicate an effect selected from the group consisting of an increase in exercise endurance, an increase in muscle strength, an improvement in a sense of balance, and an improvement in the exercise adaptation ability, but is limited thereto. doesn't happen

Specifically, the improvement of the exercise performance may be to prevent or improve one or more diseases selected from the group consisting of mitochondrial abnormal diseases, neurodegenerative diseases, hypostamina, and hypotonia, but is not limited thereto.

Mitochondrial abnormal disease, neurodegenerative disease, hypostamina, and hypotonia are the same as described above.

Another aspect of the present invention provides a food composition for improving athletic performance, comprising the composition.

In the present invention, food means a natural product or processed product containing one or more nutrients, and preferably means a state that can be eaten directly through a certain processing process, and in a conventional sense, It is intended to include all health functional foods, beverages, food additives and beverage additives.

Foods of the present invention include, for example, various foods, beverages, gum, tea, vitamin complexes, health functional foods, and the like. In addition, in the present invention, food includes special nutritional food (eg, formula milk, infant food, etc.), processed meat products, fish meat products, tofu, jelly, noodles (eg, ramen, noodles, etc.), health supplements, seasoned foods ( Ex, soy sauce, soybean paste, red pepper paste, mixed soy sauce, etc.), sauces, sweets (eg snacks), dairy products (eg fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various kimchi, pickles, etc.), beverages ( Examples include, but are not limited to, fruit and vegetable beverages, soy milk, fermented beverages, etc.) and natural seasonings (eg, ramen soup, etc.). The above foods, health functional foods, beverages, food additives and beverage additives are conventionally manufactured method can be prepared.

In the present invention, health functional food refers to a food group or food composition that has added value to act and express the function of the food for a specific purpose by using physical, biochemical, and bioengineering methods, etc. It refers to food that has been designed and processed to sufficiently express body control functions related to recovery, etc. The health functional food may include a food supplementary additive that is acceptable in terms of food, and may further include an appropriate carrier, excipient and diluent commonly used in the manufacture of health functional food.

In the present invention, beverage means a generic term for drinking to quench thirst or enjoy taste, and is intended to include health functional beverages. The beverage is not particularly limited in other ingredients other than including the slug extract as an active ingredient as an essential ingredient in the indicated ratio, and may contain various flavoring agents or natural carbohydrates as additional ingredients like a conventional beverage. .

Examples of the above natural carbohydrates include monosaccharides, such as glucose, fructose, etc. disaccharides, such as maltose, sucrose, etc. and polysaccharides, such as conventional sugars such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (taumatine, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The proportion of the natural carbohydrate is generally about 1 to 20 g, preferably 5 to 12 g, per 100 ml of the composition of the present invention. In addition, the composition of the present invention is suitable for the preparation of natural fruit juice, fruit juice beverage, and vegetable beverage. It may additionally contain the pulp for

In addition to the above, the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. These components may be used independently or in combination. The proportion of these additives is not so important, but may be selected from 0 to 20 parts by weight per 100 parts by weight of the slug extract of the present invention.

In the present invention, a health functional beverage is a beverage that uses physical, biochemical, or bioengineering methods to act and express the function of the beverage for a specific purpose. It refers to a beverage designed and processed to sufficiently express the body control functions related to recovery and recovery.

In addition, in a food composition for the purpose of improving muscle disease or improving exercise performance, the amount of the slug extract may be included in an amount of 0.01 to 15% by weight of the total food weight, and the beverage composition is 0.02 based on 100 ml to 5 g, preferably 0.3 to 1 g.

Another aspect of the present invention provides a method for treating or preventing a muscle disease in a subject other than humans, comprising administering a pharmaceutical composition comprising the slug extract.

Another aspect of the present invention provides a method for improving exercise performance of an individual, comprising a composition for improving exercise performance comprising the slug extract.

In the present invention, the "individual" includes an animal or human having a muscle disease whose symptoms can be improved by administration of the pharmaceutical composition according to the present invention. By administering the composition for treatment according to the present invention to an individual, it is possible to effectively prevent and treat muscle diseases.

In the present invention, the "administration" means introducing a predetermined substance into a human or animal by any suitable method, and the administration route of the therapeutic composition according to the present invention is through any general route as long as it can reach the target tissue. It may be administered orally or parenterally. In addition, the therapeutic composition according to the present invention may be administered by any device capable of moving the active ingredient to the target cell.

As described above, the preferred dosage of the composition of the present invention varies depending on the condition and weight, the degree of disease, the drug form, the route of administration, and the period, but it is appropriately determined by those of ordinary skill in the art to which the present invention pertains. can be selected. Specifically, it is preferably administered at 0.0001 to 1000 mg/kg per day based on the amount of the slug extract of the present invention, and to be more effective, at 0.01 to 100 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The dosage and frequency of administration are not intended to limit the scope of the present invention in any way.

According to the present invention, the slug extract of the present invention can be utilized to increase muscle mass and improve muscle function for improving exercise capacity.

In addition, since the slug extract contains a component derived from a natural product, it can be usefully used as a material with low toxicity to the human body.

It should be understood that the effects of the present invention are not limited to the above-described effects, and include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

1 shows the degree of myoD gene expression change by slug extract.
Figure 2 shows the degree of myogenin gene expression change by the slug extract.
Figure 3 shows the degree of NRF-1 gene expression change by the slug extract.
Figure 4 shows the degree of change in Tfam gene expression by the slug extract.
5 shows the degree of change in CytC gene expression by the slug extract.
Figure 6 shows the degree of change in Cox2 gene expression by the slug extract.
7 shows the degree of change in Cox4 gene expression by the slug extract.
8 shows the degree of change in ATG5g1 gene expression by slug extract.
9 shows the degree of change in SDHb gene expression by slug extract.
10 shows the degree of change in UCP1 gene expression by slug extract.
11 shows the degree of change in SIRT1 gene expression by slug extract.
12 shows the degree of change in PGC1-α gene expression by the slug extract.
13 shows the degree of change in ERR-α gene expression by slug extract.
14 shows the degree of change in the expression of PPAR-α gene by slug extract.
Figure 15 shows the degree of change in PPAR-β gene expression by slug extract.
16 shows the degree of change in TSC1 gene expression by slug extract.
17 shows the degree of change in TSC2 gene expression by slug extract.
18 shows the results of confirming the degree of muscle function-related protein change by the slugs extract.
19 shows the results of confirming the degree of change in the ATP content in muscle cells by the slug extract.
20 shows the results of confirming the degree of muscle cell growth change by the slug extract.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1. Preparation of extract of slugs (P.

0.5 kg of dried slugs (white spot flower larvae) (purchased from: Gumbucks, Korea) was crushed and placed in an extraction container, purified water 15 times the weight of slugs was added, and the mixture was extracted by stirring at 60° C. for 3 hours. The extract was filtered with a filter paper and then concentrated under reduced pressure at 50° C. until the filtrate was completely evaporated, to finally obtain a slug extract. Accordingly, the yield was about 20.59%.

Experimental Example 1. Experiment of gene expression change related to muscle function improvement by slug extract

Experimental Example 1-1. Experimental method of gene expression change related to muscle function improvement

C2C12 is an immortalized mouse myoblast cell line, a cell line widely used for in vitro muscle research. Cell division is very fast under high serum conditions, and it differentiates rapidly under low serum conditions or starvation conditions to form multi-nucleated myotubes, which are contractile myotubes, and produce muscle protein. Therefore, it is used in various protein or gene expression studies for the analysis of mechanistic biochemical pathways related to the differentiation of myoblasts.

After differentiation of C2C12 cells for 5 days in order to confirm the improvement of muscle function and changes in muscle activity, 10 ug/ml or 100 ug/ml of slug extract was treated for 24 hours. Then, RNA was extracted from the cells using Trizol. After cDNA was synthesized from the RNA using reverse tanscriptase (Nanohelix), qRT-PCR (CFX Connect Real-Time PCR Detection System, Bio-Rad) was performed using the primers in Table 1 below.

gene direction Sequence (5'-3') SEQ ID NO: MyoD Forward CCGTGTTTCGACTCACCAGA One Reverse GTAGTAGGCGGTGTCGTAGC 2 Myogenin Forward GAGGAAGTCTGTGTCGGTGG 3 Reverse CCACGATGGACGTAAGGGAG 4 NRF-1 Forward CTTCATGGAGGAGCACGGAG 5 Reverse ATGAGGCCGTTTCCGTTTCT 6 Tfam Forward GAGCGTGCTAAAAGCACTGG 7 Reverse CCACAGGGCTGCAATTTTCC 8 CytC Forward GGGCCTCGTTAGTGCAGCAGG 9 Reverse GGGCTCCCAGAAAAGGTTGCCT 10 COX2 Forward ACGAAATCAACAACCCCGTA 11 Reverse GGCACAACGACTCGGTTATC 12 COX4 Forward ACTACCCCTTGCCTGATGTG 13 Reverse GCCCACAACTGTCTTCCATT 14 ATP5g1 Forward TGGGGACCAGGGCAGCCATT 15 Reverse AGGGCTTGCTGCCCACACAT 16 SIRT1 Forward TGCCATCATGAAGCCAGAGA 17 Reverse AACATCGCAGTCTCCAAGGA 18 SDHb Forward ACTGGTGGAACGGGAGACAAG 19 Reverse GTTAAGCCAATGCTCGCTTC 20 PGC-1α Forward GTCCTTCCTCCATGCCTGAC 21 Reverse GACTGCGGTTGTGTATGGGA 22 UCP1 Forward CGGAAACAAGATCTCAGCCG 23 Reverse CTGACCTTCACGACCTCTGT 24 ERRα Forward GAGGTGGACCCTTTGCCTTT 25 Reverse GGCTAACACCCTATGCTGGG 26 PPARα Forward ATCCAGGGTTCAGTCCAGTG 27 Reverse GCTTAGGGACAGTGACAGGT 28 PPARδ Forward GTTCCTTGACCCTGTCCTC 29 Reverse CCAGCAAGTTTCAAGCCACT 30 TSC1 Forward TTATCCATCCTCTCGCTGCT 31 Reverse AGGTGCTGCTTCCCTGACT 32 TSC2 Forward ATGGATGTTGGCTTGTCCTC 33 Reverse CAGGCAGTTGTAGCAGACCA 34 GAPDH Forward AACTTTGGCATTGTGGAAGG 35 Reverse GGATGCAGGGATGATGTTCT 36

1-2. Measurement of myoD and myogenin expression level change The myoD expression level change according to the treatment concentration of the slug extract is shown in FIG. 1 , and the myogenin expression level change is shown in FIG. 2 .

As a result, it was confirmed that when the slugs extract was treated with 100 ug/ml, the expression level of myoD increased by 8.85 times (FIG. 1), and the expression level of myogenin increased by 3.78 times (FIG. 2), respectively.

myoD and myogenin are transcription factors belonging to myogenic regulatory factors. myoD is an important factor for the differentiation of muscle cells from satellite cells, and their expression levels increase in response to exercise or muscle tissue damage. do. Myogenin is also important for the differentiation of muscle cells and, in particular, as an essential factor for the development of functional skeletal muscle, is known to play a very important role in the proper differentiation of myogenic precursor cells during myogenesis.

In conclusion, the increase in gene expression of these two transcription factors induces muscle cell differentiation to induce the formation of muscle fibers and increase in skeletal muscle mass, thereby playing a very important role in improving muscle function, as well as preventing muscle cell damage. If it occurs, it can induce injury healing, meaning that it can affect muscle cell protection.

1-2. NRF-1 and Tfam measurement of expression level change

The change in the expression level of NRF-1 according to the treatment concentration of the slug extract is shown in FIG. 3, and the change in the expression level of Tfam is shown in FIG. 4 .

As a result, it was confirmed that the expression level of NRF-1 increased by 4.47 times and the expression level of Tfam by 2.67 times when the slug extract was treated with 100 ug/ml compared to the case where the slug extract was not treated.

RF-1 (Nuclear respiratory factor 1) is a transcription factor that regulates oxidative phosphorylation and mitochondrial biogenesis-related gene expression, and Tfam (Mitochondrial transcription factor A) regulates transcription and replication of mitochondrial genes. As a transcription factor, it was confirmed that the increase in the expression level of the two genes by the administration of the slug leaf extract resulted in the increase of mitochondrial biosynthesis.

1-3. CytC, Cox2 and Cox4 measurement of expression level change

The slugs are CytC expression amount changes according to the concentration of the extract 5, the expression level change of the Cox2 in Figure 6, the expression amount was changed is shown in Figure 7 of Cox4.

CytC (Mitochondrial cytochrome C) , Cox2 (Cytochrome c oxidase subunit 2), and Cox4 (Cytochrome c oxidase subunit 4) are major proteins of the electron transport chain present in the inner membrane of mitochondria that synthesize ATP. As a result of the treatment of the slugs extract, it was confirmed that the gene expression of CytC (Fig. 5, 0.855 fold) and Cox2 (Fig. 6, 0.996 fold) did not increase, but the gene expression of Cox4 (Fig. 7, 2.18 fold) was increased.

1-4. ATG5g1 measurement of expression level change

The change in the expression level of ATG5g1 according to the treatment concentration of the slug extract is shown in FIG. 8 .

ATG5g1 is a gene encoding a membrane subunit c of mitochondrial ATP synthase, and the membrane subunit c is a protein involved in the synthesis of ATP.

As shown in FIG. 8 , it was confirmed that the expression level of the ATG5g1 gene increased by 1.3 times when 100 ug/ml of the slug extract was treated, and through this, as the amount of ATP synthesis increased, the energy transporter increased and cell activity could be increased. Confirmed.

1-5. SDHb and UCP1 measurement of expression level change

The change in the expression level of SDHb according to the treatment concentration of the slughead extract is shown in FIG. 9 , and the change in the expression level of UCP1 is shown in FIG. 10 .

As a result, it was confirmed that the expression level of SDHb increased by 1.61 times and the expression level of UCP1 decreased by 0.44 times when the slug extract was treated with 100 ug/ml compared to the case where the slug extract was not treated.

SDHb (Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial) is also known as the iron sulfur subunit of complex II, and the oxidation of succinic acid during the catabolism of the TCA cycle in the inner mitochondrial membrane. It is a gene encoding an enzyme that reduces FAD to FADH _2.

UCP1 is a gene encoding thermogenin or uncoupling protein 1, and UCP1 protein plays a role in reducing the difference in the concentration of protons generated through oxidative phosphorylation in the inner mitochondrial membrane.

That is, when the slug extract was treated, it was confirmed that the SDHb gene expression increase and the UCP1 gene expression decrease effect were shown. From the above results, it was confirmed that the slugfish extract had an effect on the ATP production increase.

1-6. SIRT1, PGC1-α and ERR-α measurement of expression level change

SIRT1 according to the treatment concentration of the slug extract The expression level change is shown in FIG. 11, the expression level change of PGC1-α is shown in FIG. 12, and the expression level of ERR-α is shown in FIG. The expression level change is shown in FIG. 13 .

SIRT1 is known to have various regulatory actions in cells such as aging and metabolism, and deacetylation of the metabolic regulatory transcription factor PGC1-α/ERR-α complex of the following two proteins to regulate activity.

PGC1-α (Peroxisome proliferator-activated receptor gamma coactivator 1-alpha) is a transcription coactivator involved in energy metabolism and is known to directly affect mitochondrial biosynthesis in response to external stimuli. Endurance exercise increases the expression of this protein in skeletal muscle.

ERRα (Estrogen-related receptor alpha) is a nuclear membrane receptor involved in metabolism and estrogen signaling. From a metabolic point of view, mitochondrial biogenesis, gluconeogenesis, oxidative phosphorylation, and fatty acid metabolism ) to increase the expression of related genes.

That is, when the slug extract was treated with 100 ug/ml , the expression of genes in SIRT1 (FIG. 11, 2.65 times), PGC1-α (FIG. 12, 4.05 times) and ERR-α (FIG. 13, 1.5 times) was increased. confirmed that.

1-7. PPAR-α and PPAR-β measurement of expression level change

The change in the expression level of PPAR-α according to the treatment concentration of the slug extract is shown in FIG. 14, and the change in the expression level of PPAR-β is shown in FIG. 15.

There are three types of PPARs (Peroxisome proliferator-activated receptors), α, β, and γ, and they are known to be involved in metabolic processes, cell proliferation, and differentiation. Of these, two of α and β are mostly expressed in tissues and regulate fatty acid metabolism in muscles. PPAR-α increases the expression of genes involved in fatty acid transport and activation, and PPAR-β increases the use of fatty acids instead of glucose for energy metabolism.

When the slug extract was treated with 100 ug/ml, both the gene expression of PPAR-α (Fig. 14, 2.09 times) and the gene expression of PPAR-β/δ (Fig. 15, 1.17 times) were increased, and in particular, the expression of PPAR-α Since the amount was greatly increased, it was confirmed that the slug extract of the present invention contributes to energy homeostasis by promoting fatty acid transport to muscles.

That is, when considering the results of Experimental Examples 1-6 and 1-7, the slug extract of the present invention increases the absorption and oxidation of glucose and fatty acids, thereby contributing to maintaining energy homeostasis, and increasing mitochondrial biosynthesis. It was confirmed that it can.

1-8. TSC1 and TSC2 measurement of expression level change

The change in the expression level of TSC1 according to the treatment concentration of the slughead extract is shown in FIG. 16 , and the change in the expression level of TSC2 is shown in FIG. 17 .

Tuberous sclerosis 1 (TSC1) and Tuberous sclerosis 2 (TSC2) together form a TSC complex to regulate cell size. In addition, the TSC complex negatively regulates the mTOR signaling pathway by acting as a GTPase-activating protein (GAP).

The mTOR (Mammalian target of rapamycin) is activated by an external signal and by signal transduction, cell growth, cell proliferation, cell motility, and cell survival ), protein synthesis, and autophagy, as a protein regulating the expression of related genes, is known to have a function of increasing muscle mass by participating in cell proliferation in muscle cells.

That is, when the slug extract of the present invention was treated with 100 ug/ml, the degree of decrease in the expression of TSC1/2 was 0.33 times (FIG. 16) and 0.31 times (FIG. 17), respectively. It was confirmed that cell activity and muscle mass could be increased.

Experimental Example 2. Experiment on protein expression change related to muscle function improvement by slug extract

After differentiation of C2C12 cells for 5 days in order to check muscle function improvement and muscle activity, each slug extract was treated at a concentration of 10 ug/ml or 100 ug/ml for 24 hours. Thereafter, the cells were disrupted using a modified RIPA buffer, and 20 ug of protein was collected for each condition and used for analysis.

Primary antibodies are ERK (sc-135900: santa cruz) p-ERK (9101S, Cell Signaling), mTOR (sc-8319, santa cruz) p-mTOR (2971, Cell signaling), p70S6k (sc-230, santa cruz) ), p-p70S6k (sc-11759, santa cruz), p38 (sc-535, santa cruz), p-p38 (sc-17852-R, santa cruz), p-AMPK (4186, Cell signaling), GAPDH ( sc-25778, santa cruz) was used, and secondary antibodies were analyzed using mouse anti-rabbit IgG-HRP (sc-2357, santa cruz) and m-IgGk BP-HRP (sc-516102, santa cruz). , the results are shown in FIG. 18 .

As shown in FIG. 18 , it was confirmed that phosphorylation of ERK1/2 in C2C12 cells was promoted by the slug extract. ERKs (Extracellular signal-regulated kinases) are major kinase proteins of the MAP (Mitogen-activated protein) pathway known to be involved in cell proliferation of various tissues in humans. Confirmed.

mTOR (Mammalian target of rapamycin) is essential for skeletal muscle hypertrophy through human muscle fiber and muscle protein synthesis in response to physical exercise and ingestion of specific amino acids or amino acid derivatives. Therefore, activation of mTOR, that is, increase in phosphorylation, corresponds to a very important factor in increasing cell activity and muscle mass, and the slug extract of the present invention activates the mTOR signaling pathway along with a decrease in TSC1/2 expression to increase cell activity and muscle mass. It was confirmed that it can contribute.

Ribosomal protein S6 kinase beta-1 (S6K1), also known as p70S6 kinase (p70S6K, p70-S6K), is one of the kinases regulated by the mTOR. p70S6K is involved in intracellular signaling and plays a role in activating protein synthesis when phosphorylated by the mTOR signaling pathway. It was confirmed that phosphorylation of mTOR by the slug extract of the present invention leads to phosphorylation of p70S6K, which affects muscle growth (FIG. 18).

p38, together with ERK1/2, is one of the major kinase proteins of the MAP pathway, and is known to be involved in cell proliferation in various tissues as well, and phosphorylation of p38 is also known to promote cell proliferation in muscle. Therefore, it was confirmed from the increased phosphorylation of p38 (FIG. 18) that the slug extract of the present invention can contribute to the increase in muscle mass by affecting the differentiation of muscle cells.

AMPK (5' AMP-activated protein kinase) is an enzyme that plays a role in cellular energy homeostasis, and from the increased phosphorylation of AMPK by the slug extract of the present invention (FIG. 18), the slug extract of the present invention is a mitochondrial biosynthesis and electron transport system enzyme gene It was confirmed that, along with the increase in expression level, it is possible to increase mitochondrial biogenesis.

Experimental Example 3. Change in ATP Amount in C2C12 Cells by Slugfish Extract

The amount of ATP in C2C12 cells was measured to confirm the effect of increasing muscle energy synthesis by the slug extract of the present invention.

Specifically, after differentiation of C2C12 cells for 5 days, each slug extract was treated at a concentration of 10 ug/ml or 100 ug/ml for 24 hours. The differentiated cells were added with a 2X ATP detection reagent at room temperature, and then ^{fluorescence was measured using a Mitochondrial ToxGlo TM} Assay kit (Promega), and the results are shown in FIG. 19 .

As a result, as shown in FIG. 19 , it was confirmed that the slug extract increased the amount of ATP in the cells in a concentration-dependent manner, and an increase of about 18% was confirmed at a concentration of 100 ug/ml.

As shown in the above results, it is concluded that energy synthesis is increased by increasing the expression of genes related to mitochondrial biosynthesis and ATP synthesis, suggesting that the slug extract can improve muscle function and increase muscle cell activity.

Experimental Example 4. Confirmation of cell growth change by slug extract

MTT assay was performed to confirm the effect of improving cell proliferation ability by the slug extract of the present invention.

Specifically, 10 ³ cells of cells were put into each well of a 96-well tissue culture plate (SPL), and the slug extract dissolved in DMSO was added to the culture plate at 10ug/ml and 100ug/ml, respectively, and cultured for 48 hours. Control DMSO was added to each plate so that the maximum concentration did not exceed 0.2%.

After 48 hours of incubation, 100 μl of 5 mg/ml MTT (sigma Cat. M2128) was added, followed by reaction at 37° C. for 2 hours. After removing the medium, 0.1 ml of DMSO was added and reacted at room temperature for 10 minutes, and then activity was measured at absorbance at 540 nm using a micro plate reader (BioTek Instruments, Korea), and the results are shown in FIG. 20 It was.

As a result, as shown in FIG. 20 , it was confirmed that the cell viability increased in a concentration-dependent manner compared to the control group in the cell group treated with the slug extract, and there was also no cytotoxicity. Therefore, from the above results, it was confirmed that the slug extract is not harmful to the human body and can promote the proliferation of muscle cells.

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. For example, each component described as a single type may be implemented in a dispersed form, and likewise components described as distributed may be implemented in a combined form.

The scope of the present invention is indicated by the following claims, and all changes or modifications derived from the meaning and scope of the claims and their equivalents should be construed as being included in the scope of the present invention.

<110> University-Industry Cooperation Group of Kyung Hee University <120> COMPOSITION FOR IMPROVING MUSCLE FUNCTION, COMPRISING GRUB EXTRACT <130> 19PP31055 <160> 36 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MyoD_F <400> 1 ccgtgtttcg actcaccaga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MyoD_R <400> 2 gtagtaggcg gtgtcgtagc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myogenin_F <400> 3 gaggaagtct gtgtcggtgg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myogenin_R <400> 4 ccacgatgga cgtaagggag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NRF-1_F <400> 5 cttcatggag gagcacggag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NRF-1_R <400> 6 atgaggccgt ttccgtttct 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tfam_F <400> 7 gagcgtgcta aaagcactgg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tfam_R <400> 8 ccacagggct gcaattttcc 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CytC_F <400> 9 gggcctcgtt agtgcagcag g 21 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CytC_R <400> 10 gggctcccag aaaaggttgc ct 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COX2_F <400> 11 acgaaatcaa caaccccgta 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COX2_R <400> 12 ggcacaacga ctcggttatc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COX4_F <400> 13 actacccctt gcctgatgtg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COX4_R <400> 14 gcccacaact gtcttccatt 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ATP5g1_F <400> 15 tggggaccag ggcagccatt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ATP5g1_R <400> 16 agggcttgct gcccacacat 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SIRT1_F <400> 17 tgccatcatg aagccagaga 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SIRT1_R <400> 18 aacatcgcag tctccaagga 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SDHb_F <400> 19 actggtggaa cggagacaag 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SDHb_R <400> 20 gttaagccaa tgctcgcttc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PGC-1a_F <400> 21 gtccttcctc catgcctgac 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PGC-1a_R <400> 22 gactgcggtt gtgtatggga 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UCP1_F <400> 23 cggaaacaag atctcagccg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UCP1_R <400> 24 ctgaccttca cgacctctgt 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ERRa_F <400> 25 gaggtggacc ctttgccttt 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ERRa_R <400> 26 gaggtggacc ctttgccttt 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARa_F <400> 27 atccagggtt cagtccagtg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARa_R <400> 28 gcttagggac agtgacaggt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPAR_delta_F <400> 29 gttcctctga ccctgtcctc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPAR_delta_R <400> 30 ccagcaagtt tcaagccact 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TSC1_F <400> 31 ttatccatcc tctcgctgct 20 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TSC1_R <400> 32 aggtgctgct tccctgact 19 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TSC2_F <400> 33 atggatgttg gcttgtcctc 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TSC2_R <400> 34 caggcagttg tagcagacca 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 35 aactttggca ttgtggaagg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 36 ggatgcaggg atgatgttct 20

Claims (12)

White-spotted flower radish ( Protaetia brevitarsis seulensis ) A pharmaceutical composition for the treatment or prevention of muscle diseases, comprising an extract of the larvae. According to claim 1,
The muscle disease will be a muscle disease induced by muscle damage, decreased muscle function, muscle wasting or muscle degeneration, a pharmaceutical composition. 3. The method of claim 2,
The muscle disease is at least one selected from the group consisting of dystonia, muscular atrophy, muscular dystrophy, myasthenia, cachexia and sarcopenia, pharmaceuticals enemy composition. According to claim 1,
The extract is water, C ₁ to C ₄ A lower alcohol, or a pharmaceutical composition that is extracted with a mixed solvent thereof. 5. The method of claim 4,
The extract is extracted by at least one method selected from the group consisting of cold chilling, reflux and ultrasonic extraction, the pharmaceutical composition. 5. The method of claim 4,
The muscle damage consists of muscle strain, muscle rupture, muscle tearing, contusion, distortion, rotator cuff syndrome, and myositis. One or more selected from the group, the pharmaceutical composition. A composition for improving athletic performance, comprising an extract of the larvae of the white-spotted flower radish ( Protaetia brevitarsis seulensis ). 8. The method of claim 7,
The improvement in exercise performance is one or more selected from the group consisting of an increase in exercise performance time (exercise endurance), muscle strength, balance, and exercise adaptation, the composition. 9. The method of claim 8,
The improvement in exercise performance is to prevent or improve one or more diseases selected from the group consisting of mitochondrial abnormal diseases, neurodegenerative diseases, hypostamina and hypotonia, the composition. A food composition for improving exercise performance, comprising the composition of any one of claims 7 to 9. A method for treating or preventing a muscle disease in a subject other than a human, comprising administering the pharmaceutical composition of any one of claims 1 to 6. 10. A method of improving exercise performance of an individual other than a human, comprising administering the composition of any one of claims 7 to 9.

Images