KR20220004479A - Pentavalent vaccine composition for preventing disease in fish and manufacturing method thereof - Google Patents

Abstract

The present invention relates to a multivalent vaccine composition that can be inoculated by an immersion method for the prevention of parasitic and bacterial diseases of fish, and a method for manufacturing the vaccine composition, which prevents scuticociliatosis, vibrio disease, and/or gliding bacterial disease, reduces the mortality rate of halibut on infectious disease, and increases a relative survival rate.

Description

A pentavalent vaccine composition for preventing disease in fish and a manufacturing method thereof {Pentavalent vaccine composition for preventing disease in fish and manufacturing method thereof}

The present invention relates to a vaccine composition for fish, and more particularly, to a vaccine composition for preventing fish parasites and pathogens, and a method for preparing the same.

Fish nopeunde likely to be infected with various diseases, especially diseases that are a major problem in most of the fish farming industry, a bacterial disease caused by parasites, diseases of the slide Surgical Utica increase and T. maritimum infection by M. avidus There are bacteriosis and vibriosis caused by Vibrio infection.

Specifically, U. nigricans parasitizing in Southern bluefin tuna cultured in Australia, U. nigricans parasitic to Uronema marinum, parasitic to salmon in the Atlantic Ocean, and U. nigricans, which are parasitic to salmon in an aquarium as a ciliate causing the scotikasis. Many types of scutica infections have been reported in various fish species, such as perch of . Scoutikasis occurs widely from fry to adult fish of farmed fish, and once it occurs, it not only causes mass death, but also indirectly induces various major bacterial diseases, causing serious damage to the productivity of farmed fish. It is a ciliary disease that Once scoticosis occurs, it not only causes mass death, but also indirectly induces various major bacterial diseases, causing serious damage to the productivity of farmed fish.

정도이다. 활주세균증에 감염되면 넙치의 체표면이 회색으로 변하거나 원형의 상처, 궤양이 관찰되며 지느러미가 부식되면서 골격만이 남는다. 아가미가 부식된 넙치는 체색이 검어지고 힘없이 떠다니는 현상을 보인다.Glycobacteria are known to be an important cause of bacterial diseases in seawater fish breeding plants because they occur in sea bream, halibut, puffer fish, and flounder fry. The causative agent, Tenacibaculum maritimum, was initially known as Flexibacter maritimus.

it is about When infected with gliosis, the surface of the halibut turns gray or circular wounds and ulcers are observed, and only the skeleton remains as the fins corrode. Flounder with corroded gills turns black and floats helplessly.

Vibriosis is caused by Vibrio, a gram-negative bacillus, and when infected, externally, body color blackening, partial redness, and ulceration. As a result, the liver becomes congested and discolored, ascites accumulates, and petechiae appear in the intestine.

In domestic farmed halibut, various bacterial diseases continue to occur by growth stage and season, resulting in a high mortality rate, making it difficult to plan production and problematic management rationalization for farmed fishers.

In order to treat the bacterial disease, antibiotics have been administered and treated, but in this method, the pathogen settles in the intestinal tract, proliferates, and occurs repeatedly, so the treatment is not good. There is a downside to this.

Excessive use of antibiotics and antibacterial agents so far in relation to the above diseases of fish leads to the acquisition of resistance of the causative bacteria, making it increasingly difficult to cure the disease, and the accumulation of chemicals in the fish adversely affects the human body and even causes environmental pollution. There is a problem that

On the other hand, chemical agents and oligochitosan are used for parasitic diseases that occur in farmed fish, but the repeated use of these drugs leads to stress on the fish, slowing growth, and the effect on parasite extermination is extremely low. There is no situation

In order to solve the problems presented above, it is attempted to develop a pentavalent vaccine containing inactivated cells of bacterial or parasitic disease pathogens occurring in fish as an active ingredient.

The present invention provides a vaccine composition for fish, comprising a fish pathogenic parasite and inactivated bacteria of bacteria as an active ingredient, and a method for preparing the same. The vaccine composition may have an effect of preventing infection and/or disease caused by the parasite and/or bacteria against parasites of fish, infectious bacteria of fish, or both.

The present invention also provides a pharmaceutical composition for the prevention of a parasitic and/or bacterial infectious disease in fish, and a method for preventing the infectious disease using the pharmaceutical composition.

In addition, an object of the present invention is to provide a vaccine composition that contains the fish pathogenic parasite and the inactivated bacteria of bacteria as an active ingredient, has excellent antigen effect, and can be utilized as an immersion vaccine, and a method for producing the same.

Accordingly, the present inventors have developed a pentavalent complex vaccine that includes inactivated cells and inactivated bacteria of parasitic and bacterial pathogens as active ingredients in order to prevent the bacterial and parasitic diseases, and can be inoculated by immersion method.

Hereinafter, the present invention will be described in more detail.

An example of the present invention relates to a fish disease vaccine composition and/or a fish disease prevention composition comprising inactivated cells of fish pathogenic parasites and fish pathogenic bacteria. The present invention can prevent all diseases of fish caused by parasites and/or bacteria, including both pathogenic parasites in fish and inactivated cells of bacteria.

에서 2시간 이상, 처리하여 수행될 수 있다.In the present specification, "inactivated cells of fish pathogenic parasites and fish pathogenic bacteria" or "inactivated cells" include both inactivated cells of pathogenic parasites and inactivated cells of pathogenic bacteria, and the inactivated cells are pathogenic parasites or pathogenic bacteria. It can be prepared by freely selecting an inactivation method within the intended range for inactivating bacteria. For example, the inactivated cells may be prepared by a formalin treatment method, a heat treatment method, or a freeze treatment method, and in one example, the formalin treatment method reduces pathogenic bacteria and/or parasites by 0.5 to 2% (v/v) 2 to 10 with formalin

For more than 2 hours, it can be carried out by processing.

The fish pathogenic parasite may be miamiensis avidus , and may be miamiensis avidus serotype 2 (serotype 2) and/or miamiensis avidus serotype 1 (serotype 1).

The Miamiensis avidus pathogen is characteristic in the Cox-1 gene sequence, for example, the Cox-1 gene of Miamiensis avidus serotype 2 in the vaccine composition is to include the nucleotide sequence of SEQ ID NO: 9, The Cox-1 gene of Miamiensis avidus serotype 1 includes the nucleotide sequence of SEQ ID NO: 10.

For example, the Miamiensis avidus serotype 2 may be Miamiensis avidus JJB1403, and the Miamiensis avidus serotype 1 may be Miamiensis avidus JJC1404.

The miamiensis avidus is a causative agent of scotikasis, and has stronger pathogenicity for flatfish compared to Pseudocohnilembus persalinus, Pseudo-cohnilembus hargisi and U. marinum, and parasitizes in gills, body surface and fins, causing tissue collapse, and symptoms When this progresses, the muscles are exposed, and they can even penetrate the brain and various internal organs, causing tissue necrosis.

Antigens reacted differently depending on the scutica serotype through aggregation assay or western blot according to the antisera of halibut. Cox-1 type 2 is serotype 1, Cox-1 type 1 is serotype 2 as different serotypes (Song et al., J Fish Dis 32(12) (2009) 1027-34). Miamiensis avidus JJB1403 and Miamiensis avidus JJC1404 are strains classified according to the Cox gene sequence. Cox-1 type 1 was named JJB1403 and Cox-1 type 2 was named JJC1404 (Jung, et al., Parasitol Res 108(5) (2011) 1153-61).

Although the two serotypes 1 and 2 of M. avidus were pathogenic and similar in shape, there was a problem that cross-protection was impossible, but the vaccine composition of the present invention is M. avidus serotype 2 (serotype 2) and Miamiensis avidus serotype 1 (serotype 1) has a vaccine effect on both, so it is useful in aquaculture fields where serotype 1 and serotype 2 are present in a ratio of about 50:50 (serotype 1: serotype 2) It can be used as a vaccine composition.

In the present specification, 'Scutica worm' is used interchangeably with the same meaning as 'Scutica ciliate'. The Scutica caterpillar is a parasite belonging to the order Scuticociliatids, more specifically, Miamiensis avidus . It means, in one example, M. avidus JJB1403 and / or M. avidus JJC1404. have.

The fish pathogenic bacteria are, Tenacibaculum maritimum, Vibrio harveyi , and Vibrio anguillarum ( Vibrio anguillarum ) It may be one or more, two or more, or three kinds of pathogenic bacteria selected from the group consisting of. In one example, the vaccine composition provided by the present invention may include all three types of bacteria and/or inactivated cells of the bacteria.

The tenasibaculum maritium is the causative agent of glial bacterium, and was initially called Flexibacter maritimus, and is a gram-negative enteric bacillus, and the optimum growth temperature is about 15-20°C. When infected with gliosis, the surface of the halibut turns gray or circular wounds and ulcers are observed, and only the skeleton remains as the fins corrode. Flounder with corroded gills turns black and floats helplessly.

The Vibrio haveii is a gram-negative bacillus as one of the causative agents of Vibrio disease, which exists in seawater and causes many deaths in halibut. Infection caused by Vibrio Harvey is a common disease in farmed halibut in summer. The halibut infected with Vibrio Harvey shows external symptoms such as abdominal distension, hernia, and split fins, as well as internal symptoms such as hemorrhagic ascites, hepatic hemorrhage, and spleen atrophy.

The Vibrio anguilarum is the causative agent of Vibrio disease, and when infected with Gram-negative bacilli, externally, body color blackening, partial redness and ulceration, bleeding around the periphery, gill damage, bleeding at the base of the fin, defects, and collapse. Internal symptoms include congestion and discoloration of the liver, ascites, and petechiae in the intestine.

An example of the present invention is a vaccine composition comprising inactivated cells of Miamiensis avidus JJB1403, Miamiensis avidus JJC1404, Tenasibaculum maritium, Vibrio haveii, and Vibrio anguilarum.

Inactivated cells of the non-N-Sys father lost Douce JJB1403 is to 1.0X10 ⁴ 2.5X10 ⁵ cell / fish, 1.5X10 ⁴ 7.5X10 ⁴ to cell / fish, to 2.0X10 ⁴ 5.0X10 ⁴ cell / fish, or ⁴ to 2.0X10 It can be administered at a concentration of 2.5X10 ^{4 cell/fish.}

Inactivated cells of the non-N-Sys father lost Douce JJC1404 is to 1.0X10 ⁴ 2.5X10 ⁵ cell / fish, 1.5X10 ⁴ 7.5X10 ⁴ to cell / fish, to 2.0X10 ⁴ 5.0X10 ⁴ cell / fish or 2.0X10 ⁴ to 2.5 It may be administered at a concentration of X10 ^{4 cell/fish.}

The antenna Ciba Coolum grains inactivated cells of timeom is 1X10 ⁷ to 1X10 ⁹ CFU / fish, 3X10 ⁷ to 5X10 ⁸ CFU / fish, 5X10 ⁷ to 3X10 ⁸ CFU / fish or to 1.0X10 ⁸ 2.0X10 ⁸ CFU / ml concentration of can be administered.

The inactivated cells of Vibrio haveii may be administered at a concentration ^{of 5X10 7} to 5X10 ⁸ CFU/fish, 7.5X10 ⁷ to 3X10 ⁸ CFU/fish, ^{1X10 8} to 2X10 ^{8 CFU/fish.}

The inactivated cells of Vibrio anguilarum may be administered at a concentration ^{of 5X10 7} to 5X10 ⁸ CFU/fish, 7.5X10 ⁷ to 3X10 ⁸ CFU/fish, ^{1X10 8} to 2X10 ^{8 CFU/fish.}

The vaccine composition of the present invention can simultaneously prevent diseases of fish caused by pathogenic parasites and/or bacteria of fish, and has excellent vaccine effect compared to compositions having alone or in combination with other pathogens. In the case of inoculating a single vaccine individually for each type, it not only stresses the fish body but also takes a lot of labor and time. can be saved In addition, the vaccine composition provided by the present invention is generally excellent in protection against parasitic and bacterial infections (complex infection) that are complexly formed in aquaculture flounder.

In addition, the vaccine composition of the present invention does not interfere with the formation of antibodies between antigens, and thus has an excellent effect as a multivalent vaccine.

In one embodiment of the present invention, as a result of confirming the presence or absence of antibody interference by administering the vaccine composition to halibut compared to the control group inoculated with PBS, all of the vaccinated groups showed higher antibody levels compared to the control group, and the vaccine In the experimental group inoculated with the booster vaccine 2 weeks after the inoculation, a statistically significant amount of antibody production was confirmed compared to the control group, and thus it was confirmed that the interference phenomenon did not occur.

When the vaccine composition provided by the present invention is administered to fish, the relative survival rate (RPS) may be improved when exposed to pathogenic parasites or bacteria compared to the control group not administered with the vaccine composition. The relative survival rate (RPS) is calculated using the formula of Equation 1 below.

[Equation 1]

In Equation 1, control mortality means the mortality rate when the control group not administered the vaccine is exposed to pathogenic parasites or bacteria, and vaccinate mortality is the experimental group fish administered with the 5-valent vaccine of the present application was exposed to pathogenic parasites or bacteria. It means the mortality rate when The relative survival rate may be calculated based on the day when the cumulative mortality rate of the control group not administered with the vaccine is 60% or more (hereinafter referred to as the "base day") according to the animal drug test standards for aquaculture. In one example, the reference date may be a day in which the relative survival rate of the experimental group (vaccine administration group) is the highest among days in which the cumulative mortality rate of the control group is 60% or more.

More specifically, the fish administered with the vaccine composition may have the following relative survival rates:

Relative survival rate (RPS) of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 10-99%, 20-99%, when exposed to Miamiensis avidus JJB1403 scutica 30-99%, 40-99%, 45-99%, 10-95%, 20-95%, 30-95%, 40-95%, 45-95%, 10-90%, 20-90%, 30 to 90%, 40 to 90%, 45 to 90%, 10 to 80%, 20 to 80%, 30 to 80%, 40 to 80%, 45 to 80%, 10 to 60%, 20 to 60%, 30-60%, 40-60%, or 45-60%;

Relative survival rate (RPS) of 10% or more, 20% or more, 30% or more, 40% or more, 10-99%, 20-99%, 30-99% when exposed to Miamiensis avidus JJC1404 scutica , 40-99%, 10-95%, 20-95%, 30-95%, 40-95%, 10-90%, 20-90%, 30-90%, 40-90%, 10-80% , 20 to 80%, 30 to 80%, 40 to 80%, 10 to 60%, 20 to 60%, 30 to 60%, or 40 to 60%;

Relative survival rate (RPS) of 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 10-99%, 20-99%, 30-99%, 40-99%, 50-99%, 10-95%, 20-95%, 30-95%, 40-95%, 50-95%, 10-90%, 20-90%, 30-90%, 40-90%, 50-90%, 10-80%, 20-80%, 30-80%, 40-80%, 50-80%, 10-60%, 20-60%, 30 to 60%, 40 to 60%, or 50 to 60%;

Relative survival rate (RPS) when exposed to Vibrio haveii is 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 10-99%, 20-99%, 30-99%, 40- 99%, 45-99%, 10-95%, 20-95%, 30-95%, 40-95%, 45-95%, 10-90%, 20-90%, 30-90%, 40- 90%, 45 to 90%, 10 to 80%, 20 to 80%, 30 to 80%, 40 to 80%, 45 to 80%, 10 to 60%, 20 to 60%, 30 to 60%, 40 to 60%, or 45-60%;

Relative survival rate when exposed to Vibrio anguilarum is 10% or more, 20% or more, 30% or more, 40% or more, 10-99%, 20-99%, 30-99%, 40-99%, 10- 95%, 20-95%, 30-95%, 40-95%, 10-90%, 20-90%, 30-90%, 40-90%, 10-80%, 20-80%, 30- 80%, 40 to 80%, 10 to 60%, 20 to 60%, 30 to 60%, or 40 to 60%.

In one embodiment of the present invention, 4 weeks from the first vaccine administration date for the group administered with the pentavalent vaccine to halibut, the group additionally vaccinated with the booster vaccine 2 weeks after the administration date, and the control group administered with PBS instead of the vaccine After the elapse of the infection experiment for each pathogen, the relative survival rate (RPS, %) was calculated by Equation 1 above. As a result, the relative survival rate was as high as 40% or more in all the vaccinated groups regardless of the inoculation of the booster vaccine, confirming that the defense against each pathogen was improved compared to the non-vaccinated group.

An administration target of the vaccine composition provided by the present invention may be a fish, and M. avidus JJB1403, Miamiensis avidus JJC1404, Tenasibaculum maritium, Vibrio haveii, and/or Vibrio anguilarum caused by infection It can be used without limitation in the range of purposes for preventing mortality. For example, it may be a farmed fish including, but not limited to, rockfish, halibut, red snapper, sea bream, mullet, perch, and/or perch. In one embodiment of the present invention, the target of the vaccine administration may be flounder, and the flounder may include, without limitation, aquaculture target fish of the order Flounder family. In one embodiment of the present invention, the target of the vaccine may be flounder.

When the vaccine composition of the present invention is administered to halibut, it may be administered at the growth stage of eggs, larvae, fry, abbreviations, juveniles, or adults. In one example, the vaccine composition may be administered to flounder larvae and/or fry. In one example, the vaccine composition may be administered to halibut 1 to 10 cm in length after hatching.

The vaccine composition provided by the present invention can be administered by an immersion method, and it is possible to prevent bacterial and parasitic infections in the early growth stage of halibut without the risk of stress and inflammation due to injection even for fry of 10 cm or less.

The vaccine composition provided by the present invention may further include an adjuvant or an adjuvant. The adjuvant or adjuvant may be used without limitation within the range of purposes capable of improving immune activity to a desired degree without causing side effects, for example, magnesium hydroxide, magnesium carbonate hydroxide pentahydrate date, titanium Didoxide, calcium carbonate, barium oxide, barium hydroxide, barium peroxide, barium sulfate, calcium sulfate, calcium pyrophosphate, magnesium carbonate, magnesium oxide, aluminum hydroxide, aluminum phosphate and hydrated aluminum potassium sulfate (Alum) may be one or more metal salts selected from the group consisting of, a Toll-like receptor (TLR) agonist, an emulsion, a liposome containing a nonionic surfactant, a saponin, a nanoparticle immune enhancer, or a mucosal immune enhancer. The emulsion may include an oil component, and the oil component may be squalene. The nonionic surfactant is a polyoxyethylene sorbitan fatty acid ester-based nonionic surfactant, a sorbitan fatty acid ester-based nonionic surfactant, a polyoxyethylene alkyl ether-based nonionic surfactant, and a polyoxyethylene fatty acid ester-based nonionic surfactant And it may be at least one selected from the group consisting of polyethylene polypropylene glycol-based nonionic surfactants. For example, the polyoxyethylene sorbitan fatty acid ester-based nonionic surfactant may be at least one surfactant selected from the group consisting of Tween 20, Tween 40, Tween 60, Tween 80, and Tween 85. In addition, the sorbitan fatty acid ester-based nonionic surfactant may be at least one surfactant selected from the group consisting of span 20, span 40, span 60, span 80 and span 85.

The adjuvant or adjuvant plays a role in activating the non-specific immune system, and serves to assist the vaccine that activates specific immunity, improves the immunity of fish or farmed fish, and can further increase the efficacy of the vaccine. there is an effect

The vaccine composition of the present invention may include a pharmaceutically acceptable carrier, and as commonly used in formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil; The present invention is not limited thereto. The vaccine composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. The vaccine composition according to the present invention may further include additives such as excipients and/or stabilizers, for example, phosphate buffered saline (PBS) may be further included.

The vaccine composition of the present invention can be administered to fish by injection, oral administration, or immersion method. When using the injection administration method, there is an advantage that the dosage is accurate, the amount of vaccine required is small, and an adjuvant or immune enhancer can be additionally included. The oral administration method is ideal for fish farming for groups, and has the advantage of very easy inoculation. The immersion method has the advantage that it can be administered to the fry and can be processed in large quantities.

As used herein, "immersion" or "administration of immersion" refers to a method of dissolving a vaccine in breeding seawater and/or fresh water to penetrate into the body of a fish.

Since the vaccine composition provided by the present invention can be administered using the immersion method, when the vaccine is administered to a flounder of 10 cm or less during conventional injection administration, the size of the individual is too small and the stress of the fish by the injection needle is reduced. It is large, there is a risk of secondary infection through a wound caused by a needle, and it can solve the problem of mortality caused by this, and the vaccine composition provided by the present invention can be administered by an immersion method, so that the stress and It has the advantage of being able to minimize damage to fish and giving immunity to halibut in the early stages of breeding.

When the vaccine composition of the present invention or the pharmaceutical composition for preventing diseases of fish is administered by the immersion method, each pathogen (antigen) or inactivated bacteria of each pathogen is 2 to 100 times, 5 to 50 times the final vaccine administration concentration , 10 to 30 times or 15 to 25 times stock solution (stock solution) is first prepared, and then diluted in seawater and / or fresh water reared before immersion can be used for immersion.

The vaccine composition of the present invention may be administered once or a plurality of times as needed, for example, 1 time, 2 times, 3 times, 4 times, 5 times, 1 to 5 times, 1 to 4 times, 1 to 3 times, 1 to 2 times, 2 to 5 times, 2 to 4 times, 2 to 3 times, 3 to 5 times, or 3 to 4 times may be administered.

When the number of vaccine administrations is 2 or more, each vaccine administration day may be administered at intervals of 3 to 200 days, 5 to 180 days, 7 to 60 days, 10 to 30 days, or 12 to 15 days. However, the present invention is not limited thereto. When the number of vaccine administrations is two or more, the same and/or different methods may be used for each vaccine administration method as the first administration method.

When the number of vaccine administrations is multiple times, the amount of antibody produced in the body of fish may increase, and since the antibody is regenerated by the immune response due to multiple administrations, the duration of the antibody-specific antibody in the body can be extended. have. In addition, it can be expected to improve the protective effect of the vaccine due to the improvement of the antibody production amount and duration in the body.

When the vaccine composition of the present invention or the pharmaceutical composition for preventing diseases of fish is immersed, the appropriate immersion administration time is 5 seconds to 5 minutes, 5 seconds to 3 minutes, 5 seconds to 1 minute, 5 seconds to 45 seconds, 5 seconds to 40 seconds, 10 seconds to 5 minutes, 10 seconds to 3 minutes, 10 seconds to 1 minute, 10 seconds to 410 seconds, 10 seconds to 40 seconds, 15 seconds to 5 minutes, 15 seconds to 3 minutes, 15 seconds to 1 minute, 15 seconds to 415 seconds, 15 seconds to 40 seconds, 20 seconds to 5 minutes, 20 seconds to 3 minutes, 20 seconds to 1 minute, 20 seconds to 420 seconds, 20 seconds to 40 seconds, for example 25 seconds to 35 seconds.

The vaccine composition of the present invention or the composition for preventing fish diseases may include inactivated cells and buffers of pathogens of parasitic or bacterial diseases occurring in the fish, and the inactivated cells are formalin treatment method, heat treatment method, or freezing treatment method and the like.

Another embodiment of the present invention is a method for preventing diseases of fish, comprising administering the vaccine composition and/or a pharmaceutical composition for preventing diseases of fish to fish.

The administration method may be administered to fish using an injection administration method, oral administration method, or immersion method. The specific method of the immersion method is as described above.

The disease of the fish may be one or more, two or more or three kinds of diseases selected from the group consisting of scuticasis, vibriosis, and gliosis, and specific symptoms are as described above.

Another embodiment of the present invention is a method for producing a multivalent vaccine using a pathogen of a disease occurring in fish as an antigen, wherein M. avidus JJB1403 and/or M. abidus JJC1404 is isolated and inactivated after culturing. step; and culturing and then separating and inactivating Tenasibaculum maritium, Vibrio haveii, and/or Vibrio anguilarum. After culturing the Miamiensis avidus JJB1403 and/or Miamiensis avidus JJC1404, separating and inactivating; After culturing Tenasibaculum maritium, Vibrio haveii, and/or Vibrio anguilarum, the steps of separating and inactivating may be performed simultaneously or sequentially regardless of the order.

Matters relating to the vaccine composition may be applied to a method for preparing the vaccine composition.

The medium for culturing the bacteria used in the step of culturing the bacteria can be appropriately selected and performed according to each culture target bacteria, and specific culture conditions can be appropriately selected from known culture conditions and used for culturing the parasites or bacteria. Before performing the step, it may further include the step of pre-culturing for 12 to 24 hours in a medium for culturing parasites or bacteria.

The inactivation step may be performed by a formalin treatment method, and in one example, the parasites and/or bacteria may be inactivated by a formalin treatment method. For example, the formalin treatment method may be performed by treating pathogenic parasites and/or bacteria with 0.5 to 2% (v/v) formalin at 2 to 10° C., or 4° C. for 2 hours or more.

Another embodiment of the present invention provides a fish feed composition comprising the vaccine composition. The feed composition can be prepared by adding the vaccine composition according to the present invention to a medium used for conventional fish farming.

The vaccine composition for the prevention of fish diseases of the present invention is a multivalent vaccine using a pathogen that causes parasitic and bacterial diseases occurring in fish as an antigen, and has excellent vaccine effect even at a small content or low concentration compared to conventional vaccines. It can prevent all diseases caused by parasites and bacteria, so it can be usefully used as a fish disease vaccine.

The vaccine provided by the present invention is an immersion vaccine, and the vaccination method is simpler than injection inoculation, the antigen requirement is lower than the oral administration method, and the vaccine can be vaccinated with less stress to flounder and bacterial and parasitic diseases. Prevention is possible.

1 shows the results of electrophoresis after PCR for identification of each vaccine strain.
2A to 2E are sequencing results of PCR products of each vaccine strain and BLAST analysis results of the corresponding sequences. 2a is M. avidus JJB1403, 2b is M. avidus JJC1404, 2c is T. maritimum , 2d is V. anguillarum , and 2e is the result of V. harveyi vaccine strain.
3A to 3E are graphs of growth curves for each vaccine strain. 3a is M. avidus JJB1403, 3b is M. avidus JJC1404, 3c is T. maritimum , 3d is V. anguillarum , and 3e is the growth curve of V. harveyi vaccine strain.
4A to 4E are graphs showing the cumulative mortality rate over time for 14 days after each pathogen was infected with halibut to confirm pathogenicity. 4a is M. avidus JJB1403, 4b is M. avidus JJC1404, 4c is T. maritimum , 4d is V. anguillarum , and 4e is V. harveyi inoculation result cumulative mortality graph.
5A to 5E are graphs of the result of confirming the cumulative mortality rate over time for 14 days after infecting halibut by concentration of each pathogen to determine the amount of antigen. 5a is M. avidus JJB1403, 5b is M. avidus JJC1404, 5c is T. maritimum , 5d is V. anguillarum , and 5e is a graph of cumulative mortality as a result of inoculation with V. harveyi.
6A to 6E are diagrams of the unvaccinated group (Control), the test vaccination group (IMS-5V), and the adjuvant booster vaccination group (IMS-5V (Booster)) to determine the presence or absence of interference with antibody formation. It is an indirect ELISA (indirect ELISA) result graph. 6a is M. avidus JJB1403, 6b is M. avidus JJC1404, 6c is T. maritimum , 6d is V. anguillarum , and 6e is the result graph of V. harveyi.
7A to 7E show a control group not administered with a vaccine (Control), a group administered with a test vaccine (IMS-5V), and a group administered with a test vaccine and an adjuvant (IMS-5V (booster) to confirm the vaccine effect. )) is a graph of the cumulative mortality and relative survival rates of infection experiments for each pathogen after immersion. 7a is M. avidus JJB1403, 7b is M. avidus JJC1404, 7c is T. maritimum , 7d is V. anguillarum , and 7e is the result graph of V. harveyi.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the present invention is not limited by the following examples.

Example 1. Isolation of each strain and parasite

1-1. Isolation of ciliated scutica

The ciliate scutica Miamiensis avidus (strain name: JJB1403, JJC1404) was isolated from the brain tissue of flounder infected with scutica obtained from a local farm in Jeju Island in 2014 under aseptic conditions.

Specifically, the brain tissue of halibut showing symptoms of parasite infection was isolated and separated through a step-dilution method. The isolated Scutica ciliates were grown sufficiently in L-15 Leibovitz medium containing an antibiotic solution (100 units/mL of penicillin G, 0.1 mg of streptomycin sulphate; Sigma) and 5% (v/v) fetal bovine serum (FBS). Fathead minnow (FHM) cells were used and cultured at 20°C.

1-2. Isolation of pathogenic bacteria

Tenacibaculum maritimum , Vibrio harveyi , and Vibrio anguillarum were separated by separating the liver and kidneys of halibut showing symptoms infected with each pathogen and smearing it on a solid blood medium.

Specifically, T. maritimum bacteria was isolated from the liver and kidney of halibut showing symptoms of infection, inoculated in blood solid medium and cultured at 25° C. to purely isolate a single colony.

V. harveyi and V. anguillarum were isolated from the liver and kidney of halibut showing symptoms of vibriosis, inoculated in blood solid medium, cultured at 25° C. for 12 hours, and then a single colony was purely isolated.

Example 2. Identification of each strain and parasite by polymerase chain reaction and sequencing

For the identification of Scutica ciliates isolated and cultured by the method of Example 1-1, M. avidus JJB1403 and M. avidus JJC1404 were subjected to Polymerase chain reaction (PCR) using a specific primer pair of the Cox-1 gene. to confirm the size of the PCR product. The Cox-1 gene-specific primer pairs are shown in Table 1 below.

In addition, in order to identify pathogenic bacteria, polymerase chain reaction (PCR) was performed using a primer pair (Table 1) specific to each bacteria to confirm the size of the PCR product.

order
number Name base sequence (5'> 3') PCR product size (bp) One M. avidus Cox-1 forward GGTTCTAAAGATGTGGCTTACCCTAGAC 597 2 M. avidus Cox-1 reverse CATACCAGGCATACATAAAGTACGTCTTGT 3 T. maritimum 16s rRNA MAR1 forward AATGGCATCGTTTTTAAA 1088 4 T. maritimum 16s rRNA MAR2 reverse CGCTCTCTGTTGCCAGA 5 V. harveyi toxR AY247418 forward TTCTGAAGCAGCACTCAC 390 6 V. harveyi toxR AY247418 reverse TCGACTGGTGAAGACTCA 7 V. anguillarum groESL forward TATCACTGTTGAAGAAGGTCAAGCACTG 195 8 V. anguillarum groESL reverse CGCTTCAAGTGCAGGAAGCAG

1 shows the results of electrophoresis after PCR of Scutica ciliates and each pathogenic bacteria. As a result of electrophoresis, a band matching the expected size was confirmed, and M. avidus was confirmed through nucleotide BLAST analysis at NCBI. In addition, the specific sequences possessed by JJB1403 and JJC1404 of the Cox-1 gene were identified, and JJB1403 and JJC1404 were distinguished.

2a to 2b show the sequencing results and BLAST results of the specific sequence region of the Cox-1 gene of the JJB1403 and JJC1404 strains. In the Cox-1 gene of the JJB1403 and JJC1404 strains, the nucleotide sequences specifically shown in each strain are separately indicated in parentheses.

Tenacibaculum maritimum , Vibrio harveyi , and Vibrio anguillarum were subjected to PCR using specific primer pairs in Table 1, respectively. As a result of electrophoresis, a band matching the expected size was confirmed, and after sequencing the amplification product (SEQ ID NOs: 11 to 13), nucleotide BLAST analysis at NCBI confirmed that each of the bacteria was Tenacibaculum maritimum , Vibrio harveyi , and Vibrio anguillarum.

Sequencing results and BLAST results of Tenacibaculum maritimum , Vibrio harveyi , and Vibrio anguillarum are shown in FIGS. 2C to 2E .

Example 3. Pathogenicity test and determination of challenge inoculum

3-1. Methods for culturing pathogenic parasites and strains

M. avidus JJB1403 and JJC1404 parasites were cultured at a temperature of 20° C. using the self-developed MGL-MA medium. The MGL-MA medium was prepared by dissolving 11.5 g of L-15 medium powder, 1 g of peptone, 4 g of NaCl and _{2 g of MgCl 2 in} 1000 ml of distilled water.

3A to 3B respectively show graphs of growth curves of JJB1403 serotype parasites and JJC1404 serotype parasites according to the culture conditions.

Tenacibaculum maritimum , Vibrio harveyi , and Vibrio anguillarum were cultured in a culture medium and temperature optimized for the growth of pathogenic strains as shown in Table 2 below. Specifically, each pathogen was smeared on a solid medium to obtain a single colony, and the single colony was pre-cultured in 5 ml of a medium according to the table below for 12 to 24 h using a stirred incubator. After completion of the pre-cultivation, it was again cultured using a stirred incubator for 12 to 24 h in an appropriate medium for each bacteria.

Tenacibaculum maritimum , Vibrio harveyi , and growth curve graphs of Vibrio anguillarum strains are shown in FIGS. 3c to 3e , respectively.

pathogen badge incubation temperature Miamiensis avidus JJB1403 MGL-MA medium (self-developed) 20 ℃ Miamiensis avidus JJC1404 Tenacibaculum maritimum MGL-TM medium (self-developed) 25 ℃ Vibrio harveyi Brain heart infusion (BHI) (final concentration 1.5 % (w/v) NaCl) Vibrio anguillarum Luria-Bertani (LB) medium

3-2. Quantification method for each pathogen

Quantification of each pathogen (bacteria and parasite) was performed using a hemocytometer in the case of parasites, and in the case of bacteria, a wavelength of 600 nm was used using a reference graph comparing optical density (OD) and colony forming unit (CFU). It was performed using the OD value measured in Table 3 below shows the CFU values when the OD600 of each pathogenic bacteria is 1.

pathogenic bacteria CFU/ml when OD600 is 1 Tenacibaculum maritimum 2X10 ⁸ Vibrio harveyi 2X10 ⁹ Vibrio anguillarum 2X10 ⁹

3-3. Parasite pathogenicity test

In order to confirm the pathogenicity of M. avidus , M. avidus JJB1403 was added to 20 healthy flatfish with an average length and weight of 10 cm and 8 g, respectively ^{, at a concentration of 2X10 5} /fish, and 20 healthy flatfish under the same conditions as the flatfish. M. avidus JJC1404 was inoculated at a concentration of ^{2X10 5 /fish.}

Figures 4a and 4b show graphs of cumulative mortality according to the lapse of days after inoculation of JJB1403 and JJC1404.

After M. avidus JJB1403 ^{was injected into healthy halibut at a concentration of 2X10 5} /fish, pathogenicity was confirmed. As a result, mortality occurred 5 days after injection, and cumulative mortality of 80% was confirmed 14 days after injection. In addition, the JJB1403 parasite-infected flounder showed infection symptoms such as abdominal distension and body color blackening, and ascites of the dead flounder was examined under a microscope, and scutica parasite was confirmed. Therefore, the pathogenicity of M. avidus JJB1403 was confirmed.

As a result of confirming pathogenicity after injecting M. avidus JJC1404 ^{into healthy halibut at a concentration of 2X10 5} /fish, mortality occurred from the 3rd day after infection, and the cumulative mortality rate was confirmed to be 80% after 14 days after the injection. In addition , symptoms of infection with Scutica M. avidus JJC1404 were confirmed in halibut, specifically, abdominal distension and darkening of body color. Therefore, the pathogenicity of M. avidus JJC1404 was confirmed.

3-4. Pathogenicity testing of each strain

For each pathogen, 20 healthy flatfish, each with a length and weight of 10 cm and 8 g, were used for the pathogenicity test.

Specifically, the T. maritimum strain was injected into healthy flatfish with an average length and weight of 10 cm and 8 g, respectively, at a concentration ^{of 5X10 7 CFU/fish.} V. anguillarum was intraperitoneally injected into healthy halibut at a concentration of 1X10 ⁶ CFU/fish, and V. harveyi was intraperitoneally injected at a concentration of 2X10 ^{8 CFU/fish.}

4c to 4e shows a graph of the cumulative mortality rate according to the change of date after intraperitoneal injection of the pathogenic strains.

When the T. maritimum strain was administered, mortality started to occur from the 4th day after injection, and the cumulative mortality rate was 80% on the 6th day, and infection symptoms such as abdominal distension were observed in the flatfish treated with the T. maritimum strain. Infection by T. maritimum was confirmed as a result of isolating liver and heart tissue and confirming it using PCR.

When V. anguillarum was administered, mortality occurred from the 2nd day after injection, and after that, the mortality increased rapidly, showing a cumulative mortality rate of 100% on the 5th day after injection. Infected halibut showed abdominal distension, and V. anguillarum infection was confirmed in liver and kidney tissues.

In the case of infection with V. harveyi , mortality occurred from the 3rd day after injection, and on the 7th day, the cumulative mortality rate reached 80%, showing a rapid increase in the cumulative mortality rate, and abdominal distension was confirmed. In addition, as a result of isolating liver and kidney tissue from the infected individual and confirming it using PCR, it was confirmed that V. harveyi was infected.

Therefore, it was confirmed that the above three types of pathogenic bacteria were pathogenic for halibut.

Example 4. Determination of antigen amount of vaccine

In order to determine the amount of antigen, 2 types of parasites and 3 types of pathogenic bacteria are injected (inoculated) into halibut by concentration, respectively, and after 1 month of inoculation, each corresponding pathogen is injected intraperitoneally (infection) with the passage of the day from the date of infection. The cumulative mortality and relative survival rates were confirmed. A control group (control group) for comparison was inoculated with the same amount of phosphate buffer solution (PBS).

The relative survival rate (RPS, %) was calculated by the method of Equation 1 below.

[Equation 1]

Figures 5a to 5e show a graph of the cumulative mortality according to the amount of inoculated antigen of each antigen, and Table 4 below shows the concentration of each antigen and the mortality and relative survival rate (RPS, %) according to the concentration. The relative survival rate was calculated according to Equation 1 when the mortality rate of the control group was 60% or more according to the animal drug test standards for aquaculture.

antigen class Infectious antigen concentration inoculation concentration Relative survival rate (%) final decision M. avidus JJB1403 1X10 ⁵ cells/ml Control (PBS) - - 2.5X10 ⁴ cells/ml 46 O 7.5X10 ⁴ cells/ml 15 - 2.5X10 ⁵ cells/ml 46 - M. avidus JJC1404 2X10 ⁵ cells/ml Control (PBS) - - 2.5X10 ⁴ cells/ml 50 O 7.5X10 ⁴ cells/ml 17 - 2.5X10 ⁵ cells/ml 0 - T. maritimum 4X10 ⁷ CFU/ml Control (PBS) - - 1X10 ⁷ CFU/ml 14 - 3X10 ⁷ CFU/ml 36 - 1X10 ⁸ CFU/ml 57 O V. harveyi 5X10 ⁸ CFU/ml Control (PBS) - - 5X10 ⁷ CFU/ml 26 - 1.5X10 ⁸ CFU/ml 45 O 5X10 ⁸ CFU/ml 37 - V. anguillarum 2X10 ⁶ CFU/ml Control (PBS) - - 5X10 ⁷ CFU/ml 80 O 1.5X10 ⁸ CFU/ml 67 - 5X10 ⁸ CFU/ml 80 -

In M. avidus JJB1403, mortality occurred 3 days after the injection, and when compared with the control group, the mortality was decreased and the relative survival rate (RPS) was 46%.

In M. avidus JJC1404, mortality occurred 4 days after the injection, and when compared with the control group, the mortality was reduced and the relative survival rate (RPS) was 50% or more.

T. maritimum died from 2 days after infection, and when compared with the control group, the mortality was reduced and the relative survival rate (RPS) was 50% or more.

V. harveyi died from the 2nd day after infection, and when compared with the control group, the mortality was reduced and the relative survival rate (RPS) was confirmed to be more than 50%.

V. anguillarum died from the 2nd day after infection, and when compared with the control group, the mortality was decreased and the relative survival rate (RPS) was confirmed to be over 80%.

Through the above results, M. avidus JJB1403 the antigen is 2.5X10 ⁴ cells / ml, M. avidus antigen is 2.5X10 ⁴ cells / ml, antigen of T. maritimum of JJC1404 is 1X10 ⁸ CFU / ml, V. harveyi antigen of Silver was determined to be ^{1.5X10 8} CFU/ml, and the antigen amount of V. anguillarum ^{was 5X10 7 CFU/ml.}

Example 5. Efficacy test of test vaccine

5-1. Preparation and Immersion of Test Vaccines

The final concentration of the test vaccine of the pentavalent immersion vaccine was M. avidus JJB1403 2.5X10 ⁴ cell/ml, M. avidus JJC1404 2.5X10 ⁴ cell/ml, T. maritimum ^{1X10 8} CFU/ml, V. ^{harveyi 1.5X10 8} CFU /ml, and V. anguillarum 5X10 ⁷ CFU/ml, commercially available as an adjuvant Montanide?? IMS 1312 VG (SPPIC) was added to a final concentration of 1% (v/v).

에 보관하였다. All of the pathogenic parasites and pathogenic bacteria were inactivated and used. Specifically, after culturing Scutica ciliates in substantially the same manner as in Example 3-1 , formalin was added to the Scutica worms (M. avidus JJB1403 and M. avidus JJC1404) with the maximum growth at a final concentration of 1% (v /v) and inactivated. Then, centrifuged at 1000 x g for 20 minutes to collect the inactivated scutica worms, washed three times with phosphate buffered solution (PBS), and counted the number of scutica ciliates using a hemocytometer and -80

was stored in

After T. maritimum , V. harveyi , and V. anguillarum were cultured in the method of Example 3-1, formalin was added to a final concentration of 1% (v/v) to inactivate each bacteria, and at 25° C. Incubated for 2 hours and stored at 4°C for 72 hours. After inactivation, the bacteria were collected by centrifugation at 4000 g at 4° C. for 15 minutes, and washed with phosphate buffer solution (PBS) by centrifugation 3 times at 1000 g at 4° C. for 15 minutes. The number of bacteria was measured through a reference graph comparing the optical density (OD) measured at 600 nm and the colony forming unit (CFU) and the OD value measured at 600 nm. All pathogens were confirmed to be completely inactivated by viable count and stored at -80°C until use.

In the preparation of the test vaccine, a stock solution was prepared so that each antigen had a concentration of 20 times the final concentration in the test vaccine, and then diluted 20 times with breeding seawater during immersion and immersed.

Inoculation of the immersion vaccine was performed using 2 L of immersion vaccine per 150 fish, followed by immersion under oxygen aeration for 30 seconds according to the experiment.

5-2. Confirmation of presence or absence of interference with antibody formation

In order to confirm the presence or absence of interference with the antibody formation by the combination of each antigen, the test vaccine prepared by the method of Example 5-1 was prepared.

The sera of the group immersed in the pentavalent test vaccine and the control group immersed in the same amount of PBS without inoculation were sampled by time, and the antibody formed through indirect ELISA was compared to interfere The presence or absence of was confirmed.

Specifically, the group immersed in the vaccine was again divided into an IMS-5V (booster) group that was vaccinated with a booster vaccine 2 weeks after the initial vaccination, and an IMS-5V (no booster) group that was not vaccinated with a booster. Inoculation of the booster vaccine was performed by reinoculating the same vaccine in the same manner 2 weeks after inoculation of the test vaccine.

Four weeks after the initial vaccination, six halibuts were randomly selected from each of the two experimental groups (IMS-5V (booster), IMS-5V (no booster)) and the control group, and blood was collected, and the antibody titer was measured by ELISA. did

Specifically, the concentration of each antigen in a 96-well plate of bacterial antigen ( T. maritimum , V. harveyi , and V. anguillarum ) was 1X10 ⁷ CFU/well, and parasitic antigen ( M. avidus JJB1403, M. avidus JJC1404). The concentration of 1X10 ⁵ cells/well was diluted with a coating buffer (Coating buffer, bicarbonate/carbonate buffer), and then treated at 4°C for 24 hours to fix the antigen in a 96-well plate. After washing once using TBS-T buffer (20mM Tris, 137mM NaCl, 0.1% tween20, pH7.7), 200ul of 5% (w/v) skim milk/TBS-T buffer was added to 1 at 4°C. Blocking was carried out for a period of time to block non-specific signals.

Afterwards, the serum separated from the experimental group immersed in the pentavalent vaccine and the control group to which the vaccine was not administered was diluted 10-fold in 5% (w/v) skim milk/TBS-T buffer, respectively, and 100ul was dispensed into each well at 25°C. The reaction was carried out for 3 hours. After the reaction was completed, the 96-well plate was washed 3 times with TBS-T buffer.

Thereafter, mouse anti-flounder IgM monoclonal was diluted 1:3000, and 100ul was dispensed into each well of a 96-well plate, reacted at 25°C for 3 hours, and washed 3 times with TBS-T buffer again. Thereafter, the Goat anti-mouse IgG peroxidase-conjugate antibody was diluted 1:3000, and 100ul was again dispensed into each well, and the reaction was performed at 25°C for 2 hours. After the secondary antibody reaction, after washing 5 times with TBS-T buffer, 50ul of tetramethylbenzidine (TMB) is added to cause a color reaction, stop solution (1N H2SO4) is added to terminate the reaction, and the optical density ( Optical density, OD) values were measured.

6A to 6E show the results of the indirect ELISA.

In the case of the IMS-5V (booster) group compared to the control group immersed in PBS, the antibody titers were significantly higher in all antigens, and the antibody in the experimental group inoculated with the booster vaccine was higher than in the experimental group not inoculated with the booster vaccine. was confirmed to be high.

Therefore, it was confirmed that all of the flounder vaccinated with the booster vaccine after the initial vaccination showed high antibody titers, so that antibodies to all pathogens were formed without the problem of antigen interference in the multivalent vaccine.

5-3. Confirmation of pharmacological action

In order to confirm the effectiveness of the test vaccine, the test vaccine prepared by the method of Example 5-1 was immersed and inoculated to halibut, and an infection test for each pathogen was carried out one month after the inoculation date, cumulative mortality and relative survival rate (RPS) was confirmed.

Specifically, 450 halibut with an average length of 4±0.5 cm and a weight of about 0.5 g were used as the experimental group and control group. As the experimental group, a group administered with the test vaccine prepared by the method of Example 5-1 (IMS-5V (no booster)) and a booster vaccination group additionally inoculated with a booster vaccine 2 weeks after administration of the test vaccine (IMS- The test was conducted for two types of 5V (booster). In the control group, the vaccine was not administered, and only PBS was immersed in the infection experiment.

Infection of each pathogen was done 4 weeks after the date of inoculation of the vaccine or PBS (the case of the administration of booster vaccine group first inoculation day), M. avidus JJB1403 was 1E + 5cell / fish, M. avidus JJC1404 is 1E + 5 Cell/fish, T. maritimum was infected by administration at a concentration of 6E+7 CFU/fih, V. harveyi 8E+8 CFU/fish, and V. anguillarum at 2E+6 CFU/fish.

The cumulative mortality over the course of the day was recorded daily from the date of infection, and internal organs (liver and kidney) were separated and the pathogen was re-isolated to confirm the pathogen infection. Relative survival (RPS, %) was calculated.

[Equation 1]

7A to 7E show graphs of the cumulative mortality rates of the test group and the control group according to each pathogen infection, and Table 5 shows the cumulative mortality and relative survival rates based on the reference day. More specifically, the "base date" means the date that is the basis for calculating the relative survival rate according to the animal drug test standards for fisheries, and the "base day mortality" is the mortality rate of the experimental group and the control group measured on the reference day of each group, relative to the reference date Survival rate is the relative survival rate (RPS) calculated using the baseline mortality value.

pathogen inoculation vaccine Accumulated mortality rate on the base date Baseline Relative Survival Rate M. avidus JJB 1403 Control 70% - IMS-5V (no booster) 55% 21% IMS-5V (booster) 35% 50% M. avidus JJC 1404 Control 70% - IMS-5V (no booster) 55% 21% IMS-5V (booster) 40% 43% T. maritimum Control 75% - IMS-5V (no booster) 70% 7% IMS-5V (booster) 35% 53% V. harveyi Control 60% - IMS-5V (no booster) 45% 25% IMS-5V (booster) 30% 50% V. anguillarum Control 85% - IMS-5V (no booster) 75% 12% IMS-5V (booster) 50% 41%

As can be seen in Table 5 above, as a result of comparing the relative survival rate of the inoculated group at the reference day in which the cumulative mortality rate of the control group was measured to be 60% or more, the relative survival rate was 40% or more in all the vaccination groups treated with the booster vaccine. , and it was confirmed that the defense against each pathogen (antigen) was increased compared to the non-vaccinated group. Therefore, it can be seen that the test vaccine has efficacy against each antigen.

<110> Jeju National University Industry-Academic Cooperation Foundation <120> Pentavalent vaccine composition for preventing disease in fish and manufacturing method <130> DPP20192127KR <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> M. avidus Cox-1 forward primer <400> 1 ggttctaaag atgtggctta ccctagac 28 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> M. avidus Cox-1 reverse primer <400> 2 cataccaggc atacataaag tacgtcttgt 30 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> T. maritimum 16s rRNA MAR1 forward <400> 3 aatggcatcg ttttaaa 17 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> T. maritimum 16s rRNA MAR1 reverse <400> 4 cgctctctgt tgccaga 17 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> V. harveyi toxR AY247418 forward primer <400> 5 ttctgaagca gcactcac 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> V. harveyi toxR AY247418 reverse primer <400> 6 tcgactggtg aagactca 18 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> V. anguillarum groESL forward primer <400> 7 tatcactgtt gaagaaggtc aagcactg 28 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> V. anguillarum groESL reverse primer <400> 8 cgcttcaagt gcaggaagca g 21 <210> 9 <211> 597 <212> DNA <213> Artificial Sequence <220> <223> M.avidus serotype 2 Cox-1 <400> 9 ggttctaaag atgtggctta ccctagacta aatagtatag gtttttgaat tcaaccttgt 60 ggttttattt tagtatctaa aatagcattt ttaaggccac aatactgaag atactatgat 120 aaagcttctt actattttcc tttacttgat aaaagtaata atagaacatt taacgaattt 180 aataacacta ataacatttt tcagtttaga gcattacaaa ggtatgcttt agacgaacat 240 acgctatttt gaaaacctaa actaacaaat aaatatacaa attatgaaaa ttattctgga 300 attcctttaa aattattatt ttgaaaagat attattaact acccagaatc tttttgatac 360 gttgtaagtc gtattaataa agtacgtaga aaaaaagtat attttactaa atgttctaac 420 agaaccttaa ctacagctgg ttgaactttt attacaccat ttgcatcaaa tgtaaaatat 480 acaggtattg gtgctcaaga tttaactatta gtatcagttg tttttgctgg tattagttct 540 acagtatcgt ttacaaattt attaattaca agacgtactt tatgtatgcc tggtatg 597 <210> 10 <211> 598 <212> DNA <213> Artificial Sequence <220> <223> M.avidus serotype 1 Cox-1 <400> 10 ggttctaaag atgtggctta ccctagacta aatagtatag gtttttgaat tcaaccttgt 60 ggttttattt tagtatctaa aatagcattt ttaaggccac aatactgaag atactacgat 120 aaagcttctt actattttcc tttacttgat aaaagtaata acagagtatt taacgaattt 180 aataacacta ataacatttt tcagtttagg gcattacaaa ggtatgcttt agacgaacat 240 acactatttt gaaaacctaa actaacaaat aaatatacaa attatgaaaa ttattctgga 300 attcctttaa aattattatt ttgaaaagat attattaact acccagaatc tttttgatac 360 gttgtgagtc gtattaataa agtacgaaga aaaaaagtat actttactaa atgttctaac 420 agaaccttaa ctacagctgg ttgaactttt attacaccat tcgcatcaaa tgtaaaatat 480 acaggtattg gtgctcaaga tttaactatta gtatcagttg tttttgctgg tattagttct 540 acagtatcgt tcacaaattt attaattaca aagacgtact ttatgtatgc ctggtatg 598 <210> 11 <211> 1079 <212> DNA <213> Artificial Sequence <220> <223> T. maritimum sequencing result <400> 11 aatggcatcg ttttaaagtt aaagatttat cggtagaaga tgactatgcg tcctattagc 60 tagatggtaa ggtaacggct taccatggca acgataggta ggggtcctga gagggagatc 120 cccccccact ggtactgaga cacggaccag actcctacgg gaggcagcag tgaggaatat 180 tgggcaatgg aggcaactct gacccagcca tgccgcgtgc aggaagactg ccctatgggt 240 tgtaaactgc ttttatacag gaagaaacgt acctacgagt aggtatttga cggtactgta 300 agaataagga ccggctaact ccgtgccagc agccgcggta atacggaggg tccgagcgtt 360 atccggaatc attgggttta aagggtccgc aggcggtcga ttaagtcaga ggtgaaatcc 420 catagcttaa ctatggaact gcctttgata ctggttgact tgagtgatac ggaagtagat 480 agaatatgta gtgtagcggt gaaatgcata gatattacat agaataccga ttgcgaaggc 540 agtctactac gtatttactg acgctcatgg acgaaagcgt ggggagcgaa caggattaga 600 taccctggta gtccacgccg taaacgatgg acactagttg ttgggaaata tctcagtgac 660 taagcgaaag tgataagtgt cccacctggg gagtacgatc gcaagattga aactcaaagg 720 aattgacggg ggcccgcaca agcggtggag catgtggttt aattcgatga tacgcgagga 780 accttaccag ggcttaaatg tggaatgaca gggctagaga tagctttttc ttcggacatt 840 tcacaaggtg ctgcatggtt gtcgtcagct cgtgccgtga ggtgtcaggt taagtcctat 900 aacgagcgca acccctattg ttagttgcta gcaggtaaag ctgaggactc tagcgagact 960 gccggtgcaa accgcgagga aggtggggat gacgtcaaat catcacggcc cttacgtcct 1020 gggctacaca cgtgctacaa tggtatggac aatgagcagc catctggcaa cagagagcg 1079 <210> 12 <211> 196 <212> DNA <213> Artificial Sequence <220> <223> V. anguillarum sequencing result <400> 12 tatcactgtt gaagaaggtc aagcactgca agatgaactc gatgtagtgg aaggcatgca 60 gtttgatcgt ggttacctat ctccttactt cattaataac caagaagcgg gcagtgttga 120 tctagatagc ccattcatcc tattggttga taagaaaatt tctaacattc gcgaactgct 180 tcctgcactt gaagcg 196 <210> 13 <211> 393 <212> DNA <213> Artificial Sequence <220> <223> V. harveyi sequencing result <400> 13 ttctgaagca gcactcaccg atgttgatgc tcaagaggaa gaaaatgaag ctccagtcgt 60 tgatctagag caattcgcag agcccactgc tgagacaaaa gcagaaacag ccgtcgaaca 120 agcaccgaca gctcaaccat caaaatctgc acctgcacaa aagaacacaa actggttatt 180 cagaatcatc gtgttagttg ccctgctact tcctgttggc gtgttaatgc taaccaaccc 240 tgcagaatca caatttcgtc aaattggtga atatcacaac gtgccagtga tgacaccgat 300 caaccaccct caattaaaca attggctgcc gtccattgag caatgcgttc aacgctatgt 360 tgaacaccat gctgctgagt cttcaccagt cga 393

Claims (16)

Mia US N-Sys father Douce (Miamiensis avidus) serotype 2 (serotype 2), Mia US N-Sys father Douce (Miamiensis avidus) serotype 1 (serotype 1), antenna Ciba Coolum grains timeom (Tenacibaculum maritimum), Vibrio habeyiyi (Vibrio harveyi) , And Vibrio anguillarum ( Vibrio anguillarum ) A vaccine composition for preventing infectious diseases of fish, comprising the inactivated cells as an active ingredient. The vaccine composition according to claim 1, wherein the infectious disease of the fish is at least one infection selected from the group consisting of scuticasis, vibrio disease, and gliding bacterial disease. The method of claim 2, wherein the scotika is miamiensis avidus ( Miamiensis avidus ) serotype 2 (serotype 2) and miamiensis avidus ( Miamiensis avidus ) serotype 1 (serotype 1) is selected from the group consisting of A vaccine composition, which is caused by one or more parasites. 3. The method of claim 2, wherein Vibrio disease habeyiyi Vibrio (Vibrio harveyi), and Vibrio central nine days rareom (Vibrio anguillarum) in the vaccine composition to the onset by one or more bacteria selected from the group consisting of. The method of claim 1,
The miamiensis avidus serotype 2 is 1.0X10 ⁴ to 2.5X10 ⁵ cell/fish;
The miamiensis avidus serotype 1 is 1.0X10 ⁴ to 2.5X10 ⁵ cell/fish;
The tenasibaculum maritium, 1X10 ⁷ to ^{1X10 9} CFU / fish;
The Vibrio habei, 5X10 ⁷ to 5X10 ⁸ CFU / fish and
The Vibrio anguilarum is 5X10 ⁷ to 5X10 ⁸ CFU / fish will be included at a concentration of, the vaccine composition. The vaccine composition of claim 1, wherein the composition further comprises an adjuvant. The vaccine composition of claim 1, wherein the vaccine composition is administered by an immersion method. The vaccine composition according to claim 1, wherein the fish is one or more farmed fish selected from the group consisting of rockfish, flounder, red snapper, sea bream, mullet, perch, and perch. According to claim 1, wherein the fish to which the composition is administered,
Relative survival rate (RPS) for M. avidus serotype 2 antigen of 10% or more,
Relative survival rate (RPS) for miamiensis avidus serotype 1 antigen of 10% or more,
Relative survival rate (RPS) of 10% or more for the tenasibaculum maritium antigen,
Relative survival rate (RPS) for Vibrio haveii antigen of 10% or more, or
The relative survival rate (RPS) for the Vibrio anguilarum antigen is 10% or more, and the relative survival rate (RPS) is calculated by the method of Equation 1 below, the vaccine composition:
[Equation 1]

After culturing M. avidus serotype 2 and M. avidus serotype 1, separating and inactivating them; and
Tenacibaculum maritimum, Vibrio harveyi , and Vibrio anguillarum ( Vibrio anguillarum ) A method for preparing a vaccine composition for preventing diseases of fish, comprising the step of separating and inactivating after culturing,
The fish disease is one or more infectious diseases selected from the group consisting of scuticasis, vibrio disease and gliding bacterial disease, the production method. 11. The method of claim 10, wherein the fish to which the vaccine composition for preventing diseases of the fish is administered,
Relative survival rate (RPS) for M. avidus serotype 2 antigen of 10% or more,
Relative survival rate (RPS) for miamiensis avidus serotype 1 antigen of 10% or more,
Relative survival rate (RPS) of 10% or more for the tenasibaculum maritium antigen,
Relative survival rate (RPS) for Vibrio haveii antigen of 10% or more, or
The relative survival rate (RPS) for the Vibrio anguilarum antigen is 10% or more, and the relative survival rate (RPS) is calculated by the method of Equation 1 below, the preparation method:
[Equation 1]

The method according to claim 10, wherein the inactivated cells are prepared by a formalin treatment method, a heat treatment method, or a freeze treatment method. The method according to claim 12, wherein the formalin treatment method is performed by treatment with 0.5 to 2% (v/v) formalin at 2 to 10° C. for 2 hours or more. 10. A method of preventing an infectious disease in fish, comprising administering the vaccine composition of any one of claims 1 to 9 to the fish. 15. The method of claim 14, wherein the infectious disease of the fish is one or more infectious diseases selected from the group consisting of scuticosis, vibrio disease, and gliding bacterial disease, the prevention method. 15. The method of claim 14, wherein the administration is carried out using an immersion method.

Images