KR102471093B1 - Octavalent vaccine composition for preventing diseases in fish and manufacturing method thereof - Google Patents

Abstract

The present invention relates to a multivalent vaccine composition for the prevention of viral and bacterial diseases of halibut and a method for preparing the vaccine composition, which prevents viral hemorrhagic sepsis, streptococci, vibrio disease, slide bacterial disease, or Edwards disease, It is possible to reduce the mortality rate and increase the relative survival rate of halibut caused by the infectious disease.

Description

Octavalent vaccine composition for preventing diseases in fish and manufacturing method thereof {Octavalent vaccine composition for preventing diseases in fish and manufacturing method thereof}

The present invention relates to a vaccine composition for fish, and more particularly, to a vaccine composition for preventing viruses and pathogens in fish and a method for preparing the same.

BACKGROUND OF THE INVENTION Recently, in the fish farming industry, not only bacterial diseases but also viral and parasitic diseases are diversifying the types of diseases that occur in fish. Among them, bacterial diseases that cause the most damage to halibut farming include streptococcal disease caused by infection with bacteria belonging to the genus Streptococcus, slide bacterial disease caused by Tenacibaculum maritimum ( Flexibacter maritimus ) infection, Edwards disease caused by Edwardsiella tarda infection, and pathogens belonging to the genus Vibrio. There are vibriosis caused by infection. Antibiotics have been administered to treat the above bacterial diseases, but this method is difficult to treat because pathogens settle in the intestinal tract, proliferate, and occur repeatedly, and the use of various antibiotics risks mass-producing pathogens with multi-drug resistance. There is a downside to this.

In addition, Viral hemorrhagic septicemia (VHS), or Egtved disease, a viral disease, infects halibut from late autumn to spring when the water temperature is low, causing mass mortality and causing economic loss to fish farmers. disease that causes It is a symptom of infection with the viral hemorrhagic septicemia virus (VHSV) that causes this disease. External symptoms include exophthalmos, darkening of the body, abdominal distension, anemia and bleeding (eyes, skin, gills, and fin bases). Internal symptoms include liver congestion, spleen enlargement, and kidney enlargement. In the case of the above viral diseases, there is no definite treatment, so prevention is the best method at present.

The present invention provides a vaccine composition for fish, comprising inactivated strains of fish pathogenic viruses and bacteria as active ingredients, and a method for preparing the same.

In addition, an object of the present invention is to provide a vaccine composition containing the inactivated cells of the fish pathogenic virus and bacteria as an active ingredient, and having excellent antigenic effect while using a low concentration of antigen, and a method for preparing the vaccine composition.

Accordingly, the present inventors developed a VHSV 8-valent combination vaccine containing inactivated cells of viral and bacterial pathogens as an active ingredient in order to prevent the bacterial and viral diseases.

Hereinafter, the present invention will be described in more detail.

One example of the present invention relates to a fish disease vaccine composition comprising an inactivated strain of fish pathogenic virus and an inactivated strain of fish pathogenic bacteria. The present invention can prevent all fish diseases caused by viruses or bacteria by including both fish pathogenic viruses and inactivated bacteria.

The fish pathogenic virus may be, for example, viral hemorrhagic septicemia virus (VHSV).

The fish pathogenic bacteria, Streptococcus parauberis I-2 ( Streptococcus parauberis Ib ( I-2)), Streptococcus parauberis I-3 ( Streptococcus parauberis Ic (I-3)), Streptococcus parauberis I -4 ( Streptococcus parauberis Ia (I-4)), Tenacibaculum maritimum, Edwardsiella tarda, Vibrio harveyi , and It may be one or more, two or more, three or more, four or more, five or more, six or more or seven pathogenic bacteria selected from the group consisting of Vibrio anguillarum . In one example, the vaccine composition provided by the present invention may include all of the 7 types of bacteria.

The viral hemorrhagic septicemia virus (VHSV) is a virus that infects halibut at low water temperature. External symptoms include exophthalmos, blackening of the body, abdominal distension, hernia, anemia and eye, skin, gills, Bleeding occurs at the base of the fin, and internal symptoms include liver congestion, spleen enlargement, and kidney enlargement.

The Streptococcus parauberis, as a causative agent of streptococci, is classified into I-2, I-3, and I-4 according to the serotype. Mass mortality does not occur during the onset of streptococcal disease, but continuous damage is caused over a long period of time, and the infected flounder has external features such as whiteness of the eyeball, congestion, protrusion, congestion or redness of the gill cartilage, and congestion in the upper and lower jaws In the case of laparotomy, redness of the intestinal tract, ascites, and congestion of the liver may be seen, but most of them do not show any abnormalities that are specifically observed with the naked eye.

The Edwardsiella tarda, as the causative agent of Edwards disease, is prolonged in years when feeding activity is very far away or high water temperature continues, causing high mortality. As a gram-negative bacillus, there is no motility in Edwardsiella derived from red sea bream, but motility is reported in Edwardsiella strain derived from halibut. When the bacteria Edward Siella tarda is infected with halibut, external distension, expansion and redness of the anus, and protrusion of the intestine appear severe, and when opened, bloody ascites and liver bleeding appear along with a bad smell. In addition, hypertrophy of the kidney and abscess around the eyeball may appear.

The Vibrio harveyi is one of the causative agents of Vibrio disease and is a gram-negative bacillus, which resides in seawater and causes many deaths in halibut. Infection caused by Vibrio harvey is a common disease in farmed flounder in summer. Flatfish infected with Vibrio harvey show external symptoms such as abdominal distension, hernia, and split fins, and internal symptoms such as hemorrhagic ascites, hepatic hemorrhage, and spleen atrophy.

The Vibrio anguilarum is the causative agent of Vibrio disease, and when infected with a gram-negative bacillus, externally blackening of the body, partial redness and ulcer formation, bleeding around the mouth, gill damage, bleeding at the base of the fin, defect, collapse Internal symptoms include congestion and discoloration of the liver, accumulation of ascites, and petechial hemorrhage in the intestine.

The Tenacibaculum maritimum is a causative agent of slide bacterial disease, and was called Flexibacter maritimus in the early days. When infected with bacteriosis, the body surface of flounder turns gray, or circular wounds and ulcers are observed, and fins are eroded, leaving only the skeleton. Flatfish with corroded gills turn black and float weakly.

An example of the present invention is an inactivated strain of viral hemorrhagic sepsis virus (VHSV), and Streptococcus parauberis I-2 ( Streptococcus parauberis I-2), Streptococcus parauberis I-3 ( Streptococcus parauberis I-3 ), Streptococcus parauberis I-4 ( Streptococcus parauberis I-4), Tenacibaculum maritimum, Edwardsiella tarda, Vibrio harveyi , and It is a vaccine composition containing an inactivated cell of Vibrio anguillarum .

The inactivated cells of the viral hemorrhagic sepsis virus may be included in 6E + 5 to 10E + 6 TCID ₅₀ / fish or 2E + 6 to 8E + 6 TCID 50 / fish, in one embodiment, 6E + 6 TCID 50 / fish Concentrations may be included, but are not limited thereto.

The inactivated strain of the Streptococcus parauberis Ib (I-2) strain may be included in 1.25X10 ⁸ to 2X10 ⁹ CFU / fish or 2.5X10 ⁸ to 1X10 ⁹ CFU / fish, and in one embodiment, 5X10 ⁸ CFU / It may be included in the concentration of fish, but is not limited thereto.

The inactivated strain of the Streptococcus parauberis Ic (I-3) strain may be included in 1.25X10 ⁸ to 2X10 ⁹ CFU / fish or 2.5X10 ⁸ to 1X10 ⁹ CFU / fish, and in one embodiment, 5X10 ⁸ CFU / It may be included in the concentration of fish, but is not limited thereto.

The inactivated strain of the Streptococcus parauberis Ia (I-4) strain may be included in 1.25X10 ⁸ to 2X10 ⁹ CFU / fish or 2.5X10 ⁸ to 1X10 ⁹ CFU / fish, and in one embodiment, 5X10 ⁸ CFU / It may be included in the concentration of fish, but is not limited thereto.

The inactivated cells of the strain Tenacibaculum maritimum may be included at 2X10 ⁷ to 8X10 ⁸ CFU / fish, or 3X10 ⁷ to 2X10 ⁸ CFU / fish, and in one embodiment, it may be included at a concentration of 5X10 ⁷ CFU / fish , but not limited thereto.

The inactivated strain of the Edwardsiella tarda bacteria may be included at 6.25X10 ⁷ to 1X10 ⁹ CFU / fish, or 1X10 ⁸ to 5X10 ⁸ CFU / fish, and in one embodiment, it may be included at a concentration of 2.5X10 ⁸ CFU / fish However, it is not limited thereto.

The inactivated cell of the Vibrio harbei strain may be included at 1X10 ⁸ to 8X10 ⁹ CFU / fish, or 2X10 ⁹ to 2X10 ⁹ CFU / fish, and in one embodiment, it may be included at a concentration of 5X10 ⁸ CFU / fish, but is not limited thereto don't

The inactivated cells of the Vibrio anguillarum bacteria may be included at a concentration of 1X10 ⁸ to 8X10 ⁹ CFU / fish, or 2X10 ⁹ to 2X10 ⁹ CFU / fish, and in one embodiment, it may be included at a concentration of 5X10 ⁸ CFU / fish, Not limited to this.

The vaccine composition of the present invention can prevent fish diseases caused by pathogenic viruses and bacteria of fish at the same time, and has an excellent vaccine effect compared to the composition alone or in combination with other pathogens. In addition, since the octavalent vaccine provided by the present invention can prevent diseases against 8 pathogens with one inoculation without the need for multiple vaccinations, the stress suffered by fish due to multiple injections is reduced and it is excellent in terms of economy.

In addition, the vaccine composition of the present invention does not interfere with antibody formation between antigens, and thus has an excellent effect as a multivalent vaccine.

In one embodiment of the present invention, as a result of confirming the presence or absence of antibody interference by administering the vaccine composition to halibut compared to a control group inoculated with PBS, 4 weeks after vaccination, for all pathogenic viruses and / or bacteria, 2 It was confirmed that the antibody level was more than twice as high, and no interference occurred.

When the vaccine composition provided by the present invention is administered to fish, the relative survival rate (RPS) when exposed to pathogenic viruses or bacteria can be improved compared to a control group not administered with the vaccine composition. The relative survival rate (RPS) is calculated using the formula of Equation 1 below.

[Equation 1]

In Equation 1, control mortality refers to the mortality rate when the control group, which has not been administered with the vaccine, is exposed to pathogenic viruses or bacteria, and vaccinate mortality refers to the mortality rate when the fish in the experimental group administered with the 8-valent vaccine of the present application are exposed to pathogenic viruses or bacteria. refers to the mortality rate at

More specifically, the fish administered with the vaccine composition may have the following relative survival rate:

Relative survival rate (RPS) from exposure to VHSV of 60% or more, 70% or more, 75% or more, 80% or more, or 82% or more, such as 60 to 99%, 70 to 95%, 80 to 90% %, or 82 to 87%;

Relative survival rate (RPS) when exposed to S. parauberis Ib (I-2) is 60% or more, 70% or more, 75% or more, 80% or more, or 82% or more, for example, 60 to 99%; 70 to 95%, 80 to 90%, or 82 to 87%;

Relative survival rate (RPS) when exposed to S. parauberis Ic (I-3) is 60% or more, 70% or more, 75% or more, 80% or more, or 85% or more, for example, 60 to 99.9%; 70 to 99%, 80 to 75%, or 85 to 95%;

60% or more, 70% or more, 75% or more, or 80% or more, e.g., 60 to 99%, 70 to 95%, when exposed to S. parauberis Ia (I-4) , 75 to 90%, or 80 to 85%;

Relative Survival Rate (RPS) upon exposure to T. maritimum of 60% or greater, 70% or greater, 75% or greater, 80% or greater, 90% or greater, or 93% or greater, e.g., 60 to 99.9%, 70 to 70% or greater 99%, 80 to 99%, 90 to 95%, or 93 to 95%;

E. tarda Relative Survival Rate (RPS) of 60% or more, 70% or more, 75% or more, 80% or more, 90% or more, or 93% or more, e.g., 60 to 99.9%, 70 to 70% or more 99%, 80 to 99%, 90 to 95%, or 93 to 95%;

a relative survival rate (RPS) of 60% or greater, 70% or greater, 80% or greater, 90% or greater, 95% or greater, 97% or greater, 99% or greater, or 99.9% or greater when exposed to V. harveyi ; and/or

A relative survival rate (RPS) of 60% or greater, 70% or greater, 80% or greater, 90% or greater, 95% or greater, 97% or greater, 99% or greater, or 99.9% or greater when exposed to V. anguillarum .

In one embodiment of the present invention, flounder was vaccinated with an 8-valent vaccine, and an infection experiment was conducted for 8 pathogens 1 month after inoculation, and the relative survival rate (RPS) was calculated by Equation 1, VHSV, In S. parauberis I-2, S. parauberis I-3, S. parauberis I-4, T. maritimum , and E. tarda , RPS was over 70%, and cumulative mortality was observed in infection experiments on V. harveyi and V. anguillarum . The amount decreased and the relative survival rate was confirmed as 100%. More specifically, the relative survival rate for VHSV is about 85%, the relative survival rate for S. parauberis I-2 is about 83.3%, the relative survival rate for S. parauberis I-3 is about 90.0%, and the relative survival rate for S. parauberis I-4 is about 90.0%. The relative survival rate for T. maritimum was about 81.3%, the relative survival rate for T. maritimum was about 94.1%, and the relative survival rate for E. tarda was about 94.4%.

When the vaccine composition provided by the present invention is administered to fish, the following mortality rates may be observed:

Mortality from VHSV exposure of less than 30%, less than 25%, less than 20% or less than 15%;

mortality from exposure to S. parauberis I-2 of less than 30%, less than 25%, less than 20%, or less than 15%;

mortality from exposure to S. parauberis I-3 of less than 30%, less than 25%, less than 20%, less than 15%, or less than 10%;

mortality from exposure to S. parauberis I-4 of less than 30%, less than 25%, less than 20%, or less than 15%;

mortality from exposure to T. maritimum less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5%;

mortality from exposure to E. tarda of 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less;

mortality from exposure to V. harveyi of 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, 1% or less, 0.5% or less, or 0%; and/or

Mortality from exposure to V. anguillarum of less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1%, less than 0.5% or 0%.

The administration target of the vaccine composition provided by the present invention may be fish, and viral hemorrhagic sepsis virus (VHSV), Streptococcus parauberis I-2 ( Streptococcus parauberis I-2), Streptococcus parauberis I-3 ( Streptococcus parauberis I-3), Streptococcus parauberis I-4 ( Streptococcus parauberis I-4), Tenacibaculum maritimum, Edwardsiella tarda, Vibrio harveyi , and/or It can be used without limitation within the scope of the purpose for preventing mortality due to infection of Vibrio anguillarum . For example, it may be farmed fish including rockfish (rockfish), halibut, red snapper, snapper, mullet, finfish, and/or sea bass, but is not limited thereto. In one example of the present invention, the target of administration of the vaccine may be flounder, and the flounder may include, without limitation, fish to be farmed in the family Flounder. In one example of the present invention, the vaccine may be administered to halibut.

The vaccine composition of the present invention may be administered in the growth stage of fish, fry, abbreviations, immature, or adult fish. In one embodiment, when the vaccine composition of the present invention is administered to flounder, it may be administered to flounder of fry and / or flounder, and the flounder of fry and / or offspring may be flounder with a body length of 12 to 17 cm However, it is not limited thereto. If the body length of the fish is 10 cm or less at the time of vaccine administration, the stress of the fish due to the needle is high due to the small size of the individual, and the risk of secondary infection through the needle wound increases, so it may be unsuitable for administration. Streptococcal disease, streptococcal disease, Edward's disease, vibrio disease, and/or viral hemorrhagic sepsis prevented by the vaccine provided by the present invention are known to cause great damage to flounder fry and/or adult fish, so flounder It may be recommended to administer at a body length of 12 to 17 cm, when immunity is properly developed and known to be able to withstand stress due to injection, but is not limited thereto.

The vaccine composition provided by the present invention may further include an adjuvant or an immune enhancer. The adjuvant or adjuvant may be used without limitation within a range of purposes capable of improving immune activity to a desired level without causing side effects, for example, magnesium hydroxide, magnesium carbonate hydroxide pentahydride, titanium Dioxide, calcium carbonate, barium oxide, barium hydroxide, barium peroxide, barium sulfate, calcium sulfate, calcium pyrophosphate, magnesium carbonate, magnesium oxide, aluminum hydroxide, aluminum phosphate and hydrated aluminum potassium sulfate It may be one or more metal salts selected from the group consisting of (Alum), TLR (Toll-like receptor) agonists, emulsions, liposomes including nonionic surfactants, saponins, nanoparticle immune enhancers, or mucosal immune enhancers. The emulsion may include an oil component, and the oil component may be squalene. The nonionic surfactant is a polyoxyethylene sorbitan fatty acid ester-based nonionic surfactant, a sorbitan fatty acid ester-based nonionic surfactant, a polyoxyethylene alkyl ether-based nonionic surfactant, or a polyoxyethylene fatty acid ester-based nonionic surfactant. And it may be one or more selected from the group consisting of polyethylene polypropylene glycol-based nonionic surfactants. For example, the polyoxyethylene sorbitan fatty acid ester-based nonionic surfactant may be one or more surfactants selected from the group consisting of Tween 20, Tween 40, Tween 60, Tween 80, and Tween 85. In addition, the sorbitan fatty acid ester-based nonionic surfactant may be at least one surfactant selected from the group consisting of Span 20, Span 40, Span 60, Span 80, and Span 85.

The adjuvant or adjuvant plays a role in activating the non-specific immune system, thereby supporting a vaccine that activates specific immunity, improving the immunity of fish or farmed fish, and further increasing the efficacy of the vaccine. There is an effect.

The vaccine composition of the present invention may include a pharmaceutically acceptable carrier, and as those commonly used in formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, including gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil; It is not limited to this. The vaccine composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, and preservatives in addition to the above components. The vaccine composition according to the present invention may further include additives such as excipients and/or stabilizers, for example, phosphate buffered saline (PBS).

The vaccine composition of the present invention may be administered to fish using an injection administration method, an oral administration method, or an immersion method. In the case of using the injection administration method, there are advantages in that the dosage is accurate, the amount of vaccine required is small, and an adjuvant or an immune enhancer can be additionally included. The oral administration method is ideal for fish farming for a population, and has the advantage of being very easy to inoculate. The immersion method has the advantage of being able to be administered to fry and mass processing.

When the vaccine composition of the present invention is administered by the injection method, it may be administered through intramuscular and/or intraperitoneal injection.

The vaccine composition of the present invention may include inactivated cells and a buffer solution of pathogens of viral or bacterial diseases occurring in fish, and the inactivated cells may be prepared by, for example, a formalin treatment method, a heat treatment method, or a freeze treatment method. It can be manufactured, but is not limited thereto. In one embodiment, the inactivated cells and/or the inactivated virus may be prepared by a formalin treatment method.

Another embodiment of the present invention is a method for producing a multivalent vaccine using a pathogen of a disease occurring in fish as an antigen, comprising culturing viral hemorrhagic sepsis virus (VHSV), isolating and inactivating it, and Streptococcus parauberis I-2 ( Streptococcus parauberis Ib (I-2)), Streptococcus parauberis I-3 ( Streptococcus parauberis Ic (I-3), Streptococcus parauberis I-4 ( Streptococcus parauberis Ib (I-4)) , Tenacibaculum maritimum, Edwardsiella tarda, Vibrio harveyi , and and culturing Vibrio anguillarum and then isolating and inactivating it.

The details of the vaccine composition may be applied to a method for preparing the vaccine composition.

The bacterial culture medium used in the step of culturing the bacteria can be appropriately selected and used according to each target bacteria, and specific culture conditions can be appropriately selected and used from known culture conditions, and the step of culturing the virus or bacteria Before carrying out, a step of pre-culturing for 12 to 24 hours in a virus or bacterial culture medium may be further included.

The inactivation step may be by a formalin treatment method, and the formalin treatment method may be treated with 1% (v / v) formalin at about 4 ° C. for about 2 hours or more. The step of inactivating the culture may be performed by a formalin treatment method. Preferably, the viruses and bacteria can be inactivated by a formalin treatment method.

Another embodiment of the present invention provides a fish feed composition comprising the vaccine composition. The feed composition may be prepared and used by adding the vaccine composition according to the present invention to a medium used for normal fish farming.

The vaccine composition for preventing fish diseases of the present invention is a multivalent vaccine whose antigen is a pathogen that causes viral and bacterial diseases occurring in fish, and has excellent vaccine effect even at a lower content or concentration than conventional vaccines. It can prevent all diseases caused by viruses and bacteria, so it can be usefully used as a fish disease vaccine.

1 is the result of electrophoresis after PCR for the identification of each vaccine strain.
2a to 2h are PCR product sequencing results of each vaccine strain and BLAST analysis results of the corresponding sequences. 2a for VHSV, 2b for S. parauberis I-2, 2c for S. parauberis I-3, 2d for S. parauberis I-4, 2e for T. maritimum , 2f for E. tarda , 2g for V. anguillarum , 2h is the result of the V. harveyi vaccine strain.
Figure 3 is a Western blot result for distinguishing each antigenic type of S. parauberis bacteria. The yellow dot represents a band specific to serotype I-2, the blue dot represents a band specific to serotype I-3, and the red dot represents a band specific to serotype I-4.
FIG. 4a is FHM cells for measuring TCID50 of VHSV, and is a result of observing control cells not inoculated with VHSV under a microscope (magnification: 200 times, the same below).
FIG. 4B is FHM cells for measuring TCID50 of VHSV, and is a result of microscopic observation of FHM cells inoculated with VHSV and generating CPE.
4C is a diagram showing whether or not CPE occurred according to each dilution factor as a result of the TCID50 test. On the horizontal axis, the dilution ratio of VHSV is shown in stages from 10 ^-2 to 10 ^-9 , and each row means the number of test repetitions. Wells with CPE were marked with a + sign.
5A to 5G are growth graphs showing absorbance measurement results according to culturing time as a result of culture experiments for confirming the viable cell count of each pathogenic bacterium. 5a is S. parauberis I-2, 5b is S. parauberis I-3, 5c is S. parauberis I-4, 5d is T. maritimum , 5e is E. tarda , 5f is V. anguillarum , 5g is V. harveyi is the growth graph of
6a to 6h are graphs showing the cumulative mortality over time for 14 days after infection of flounder with each pathogen to confirm pathogenicity. 6a is VHSV 1E+7.5 TCID ₅₀ /fish inoculation result, 6b is S. parauberis I-2 1E+9 CFU/fish inoculation result, 6c is S. parauberis I-3 1E+9 CFU/fish inoculation result, 6d is S. .parauberis I-4 1E+9 CFU/fish inoculation result, 6e is E. tarda 1E+6 CFU/fish inoculation result, 6f is T. maritimum 5E+7 CFU/fish inoculation result, 6g is V. harveyi 2E+8 CFU/fish inoculation results, and 6h are V. anguillarum 1E+6 CFU/fish inoculation results.
7a to 7h are graphs showing the result of confirming the cumulative mortality rate for 21 days after intraperitoneal injection of each pathogen by concentration to determine the antigen amount of the vaccine. 7a is VHSV, 7b is S. parauberis I-2, 7c is S. parauberis I-3, 7d is S. parauberis I-4, 7e is T. maritimum , 7f is E. tarda , 7g is V. harveyi , and 7h is a graph of V. anguillarum injection results.
Figures 8a to 8h are graphs of the results of confirming the formation of antibodies to each pathogen by ELISA 2 weeks and 4 weeks after injecting the test vaccine into halibut to determine the presence or absence of interference with the antibody formation of the test vaccine. 8a is VHSV, 8b is S. parauberis I-2, 8c is S. parauberis I-3, 8d is S. parauberis I-4, 8e is T. maritimum , 8f is E. tarda , 8g is V. harveyi , and 8h is the antibody formation result of V. anguillarum .
9a to 9h are graphs showing the cumulative mortality for 21 days after each pathogen was inoculated into halibut by concentration to determine the amount of attack inoculation of each pathogen. 9a is VHSV, 9b is S. parauberis I-2, 9c is S. parauberis I-3, 9d is S. parauberis I-4, 9e is T. maritimum , 9f is E. tarda , 9g is V. harveyi , and 9h is the cumulative mortality after inoculation with V. anguillarum .
10a to 10h are graphs showing the cumulative mortality over time as a result of infecting flounder with each pathogen one month after administration of the test vaccine in order to confirm the protective ability of the test vaccine against each pathogen. 10a: VHSV infection after vaccination, 10b: S. parauberis I-2 infection after vaccination, 10c: S. parauberis I-3 infection after vaccination, 10d: S. parauberis I-4 infection after vaccination, 10e: vaccine T. maritimum infection after vaccination, 10f E. tarda infection after vaccination, 10g graph showing V. harveyi infection after vaccination, and 10h graph showing V. anguillarum infection after vaccination.
Figure 11a is a graph of body weight change in flounder for 3 weeks after administration of the vaccine composition of the present invention to flounder at 1-fold and 2-fold concentrations.
Figure 11b is a graph of the results of confirming the change in the feeding amount of flounder for 3 weeks after administering the vaccine composition of the present invention to flounder at a concentration of 1 or 2 times.
12a to 12c are the results of an anatomical examination for 21 days after administering the vaccine composition of the present invention to halibut at a concentration of 1 or 2 times. 12a is the dissection result of halibut 7 days after vaccination, 12b is 14 days after vaccination, and 12c is 21 days after vaccination.
Figure 13a is the result of analyzing the liver tissue for 3 weeks after administering the vaccine composition of the present invention to halibut at a concentration of 1 or 2 times (observation magnification: X400, hereinafter the same).
Figure 13b is the result of analyzing the spleen tissue for 3 weeks after administering the vaccine composition of the present invention to halibut at a concentration of 1 or 2 times.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the present invention is not limited by the following examples.

Example 1. Isolation, cultivation and inactivation of each strain and virus

1-1. Isolation and cultivation of vaccine strains

Seven pathogens from flounder showing bacterial infection symptoms, specifically Streptococcus parauberis Ib (hereinafter "I-2"), Streptococcus parauberis Ic (hereinafter "I-3"), Streptococcus parauberis Ia (hereinafter "I-4") ), Tenacibaculum maritimum, Edwardsiella tarda, Vibrio harveyi, and Vibrio anguillarum .

Specifically, halibut suspected of having symptoms of the bacteria are selected at a farm in Jeju Island, and liver, kidney, and spleen tissue are smeared on BHI on an appropriate medium for each pathogen or virus, and cultured at 25 ° C for 24 or 48 hours. Colonies were allowed to form on solid medium. Table 1 below shows appropriate solid media and culture conditions for each vaccine strain.

In the case of the VHSV virus, halibut suspected of viral hemorrhagic sepsis were sampled from a farm in Jeju Island and isolated from the kidneys. Afterwards, Fathead Minnow (FHM) cell line cultured in LeibovitzL-15 medium supplemented with 10% FBS (Fetal bovine serum) and an antibiotic solution (100 units mL1 of penicillin G, 0.1 mg of streptomycin sulphate; Sigma) was used at 25 ° C. cultured.

vaccine strain badge (composition) Streptococcus parauberis I-2 Brain heart infusion (BHI) (final concentration 1.5% (w/v) NaCl) Streptococcus parauberis I-3 Brain heart infusion (BHI) (final concentration 1.5% (w/v) NaCl) Streptococcus parauberis I-4 Brain heart infusion (BHI) (final concentration 1.5% (w/v) NaCl) Tenacibaculum maritimum MGL-TM medium Edwardsiella tarda Brain heart infusion (BHI) (final concentration 1.5% (w/v) NaCl) Vibrio harveyi Brain heart infusion (BHI) (final concentration 1.5% (w/v) NaCl) Vibrio anguillarum Luria-Bertani (LB) Medium

A single colony of each vaccine strain was again inoculated into 5 ml of the corresponding liquid medium in Table 1 and pre-cultured at 25 ° C, and then inoculated with each pre-cultured strain in 1000 ml of each liquid medium again, and at 25 ° C for 24 to 48 hours. Cultivation was performed using a stirred incubator.

1-2. Confirmation of viable cell counts of pathogen strains

Viable cell counts of the pathogenic strains Streptococcus parauberis I-2, Streptococcus parauberis I-3, Streptococcus parauberis I-4, Tenacibaculum maritimum, Edwardsiella tarda, Vibrio harveyi, and Vibrio anguillarum were determined by optical density (OD) and colony-forming units (colony). forming unit, cfu) was measured through a standard graph comparing. The results are shown in Table 2 below.

Bacteria CFU/ml value when OD600 value is 1 Streptococcus parauberis I-2 1Ⅹ10 ⁹ Streptococcus parauberis I-3 1Ⅹ10 ⁹ Streptococcus parauberis I-4 1Ⅹ10 ⁹ Tenacibaculum maritimum 2Ⅹ10 ⁸ Edwardsiella tarda 5Ⅹ10 ⁸ Vibrio harveyi 2Ⅹ10 ⁹ Vibrio anguillarum 2Ⅹ10 ⁹

1-3. Check the viable cell count of the virus strain

After culturing VHSV, the number of viable VHSV cells was measured by a 50% tissue culture infective dose (Tissue culture infective dose ₅₀ , TCID ₅₀ ) method.

Specifically, VHSV cultured in FHM cells was diluted 10-fold stepwise from 10 ^-1 to 10 ^-10 , and then 100uL of each diluted VHSV was inoculated into 96-well FHM cells. As a control, non-inoculated cells were used. After culturing the 96-well plate at a temperature of 20 ° C for 7 days, the cytopathic effect (CPE) was observed and the TCID ₅₀ value was calculated, resulting in a TCID of 10 ^8.5 A value of ₅₀ /ml was shown.

Figure 4a shows the appearance of control FHM cells before virus infection, Figure 4b shows the appearance of FHM cells showing cytopathic effects after VHSV inoculation, and Figure 4c shows the CPE results after serial dilution for TCID ₅₀ confirmation. The + sign means that CPE has occurred.

1-4. inactivation of bacteria

S. parauberis Ia, S. parauberis Ib, S. parauberis Ic, E. tarda , T. maritimum , V. harveyi , and V. anguillarum , which are the main pathogens to be used in the vaccine, were grown under optimal culture conditions (25°C, 5 ml medium). It was pre-cultured using an agitated incubator for up to 24 hours. Thereafter, culture was performed using an agitation incubator in 1 L of a medium appropriate for each bacteria (see Table 1 above) for 24 hours.

In order to inactivate each cultured bacteria, formalin was added to a final concentration of 1% (v/v) and treated at 25° C. for 3 hours and at 4° C. for 72 hours. After inactivation, each pathogen was collected by centrifugation at 4°C at 4000 Хg for 30 minutes and washed with phosphate buffered saline (PBS) by centrifugation three times at 4°C at 4000 Хg for 30 minutes. The concentration of pathogens to be used in the vaccine was measured through a reference graph comparing optical density (OD) and colony forming unit (CFU) measured at 600 nm and OD values measured at 600 nm. All pathogens were confirmed to be completely inactivated by viable count and stored at -80 ° C until use.

1-5. inactivation of the virus

VHSV, the pathogen causing viral hemorrhagic sepsis, a major viral disease of halibut, was prepared in Leibovitz L-15 (L-15) medium containing 10% (v/v) FBS, 100 IU/mL penicillin G, and 100 ug/mL streptomycin. Fathead Minnow (FHM) epithelial cell line cultured in was inoculated and expanded. The proliferated VHSV titer was measured by the TCID ₅₀ method. The VHSV propagated in the FHM cell line was serially diluted 10-fold, and 100 μl of the diluted VHSV was inoculated into 96 wells. Non-inoculated cells were used as a control, and the values were calculated after observing the cytopathic effect (CPE) by culturing at 20 ° C for 7 days.

In the case of VHSV to be used in the vaccine, it was treated so that the final concentration of formalin was 0.3% (v / v) and inactivated by stirring at 4 ° C. In order to confirm that the inactivation was complete, the FHM cell line was re-inoculated to confirm.

Example 2. Vaccine strain identification

2-1. Strain identification using PCR

In order to identify the cultured strain and virus, PCR (Polymerase Chain Reaction) was performed on each strain or virus-specific gene. Table 2 below shows PCR primer sequences for identification of each vaccine strain.

In the case of the VHSV virus, PCR was performed using the cDNA as a template through a cDNA synthesis process after RNA was first isolated to perform PCR. Specifically, RNA was extracted using RNAiso (Takara) and cDNA synthesis was performed using PrimeScript?? It was synthesized using 1st strand cDNA Synthesis Kit (Takara). In addition, PCR was performed using the primer pairs shown in Table 2. In the case of VHSV, the gene was amplified by denaturing at 94°C for 5 minutes, repeating 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 68°C for 1 minute, and then extending at 68°C for 7 minutes.

For each pathogen strain, genomic DNA was extracted using the QIAamp DNA Mini kit (Qiagen), and PCR was performed using the primer pairs shown in Table 2. PCR performance conditions were denaturation at 94 ° C for 5 minutes in the case of V. anguillarum , followed by 25 cycles of 94 ° C for 30 seconds, 67 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 7 minutes, V. harveyi In the case of T. maritimum, after denaturation at 94℃ for 5 minutes, 94℃ for 1 minute, 63℃ for 1 minute, and 72℃ for 30 cycles of minutes, extension was performed at 72℃ for 7 minutes, and in the case of T. maritimum , 95℃ for 5 minutes. After denaturation, 95°C for 30 seconds, 45°C for 1 minute, and 72°C for 1 minute and 30 seconds were repeated 35 times, and then extended at 72°C for 7 minutes to amplify the gene. In the case of S. parauberis , after denaturation at 94 ° C for 5 minutes, repeated 30 times at 94 ° C for 30 seconds, 53 ° C for 30 seconds, and 72 ° C for 40 seconds, and then finally extended at 72 ° C for 7 minutes, in the case of E. tarda , 94 After denaturation at °C for 5 minutes, a cycle of 94 °C for 30 seconds, 53 °C for 30 seconds, and 72 °C for 40 seconds was repeated 30 times, and finally extended at 72 °C for 7 minutes. The polymerase used at this time was TaKaRa Ex Taq ® (TaKaRa, Japan).

sequence number primer name Base sequence (5'>3') length (mer) output size (bp) One VHSV to VN forward ATGGAAGGAGGAATTCGTGAAGCG 24 505 2 VHSV-VN reverse GCGGTGAAGTGCTGCAGTTCCC 22 3 S. parauberis Spa2152 forward TTTCGTCTGAGGCAATGTTG 20 718 4 S. parauberis Spa2870 reverse GCTTCATATATCGCTATACT 20 5 T. maritimum 16s rRNA MAR1 forward AATGGCATCGTTTTAAA 17 1088 6 T. maritimum 16s rRNA MAR2 reverse CGCTCTCTGTTGCCAGA 17 7 E. tarda gyrB1 forward GCATGGAGACCTTCAGCAAT 20 415 8 E. tarda gyrB1 reverse GCGGAGATTTTGCTCTTCTT 20 9 V. harveyi toxR AY247418 forward TTCTGAAGCAGCACTCAC 18 390 10 V. harveyi toxR AY247418 reverse TCGACTGGTGAAGACTCA 18 11 V. anguillarum groESL forward TATCACTGTTGAAGAAGGTCAAGCACTG 28 195 12 V. anguillarum groESL reverse CGCTTCAAGTGCAGGAAGCAG 21

1 shows the electrophoresis results of the PCR products of each vaccine strain. As a result of electrophoresis, it was confirmed that VHSV, S. parauberis, T. maritimum, E. tarda, V. harveyi and V. anguillarum all produced PCR products of the expected size.

2-2. Identification of vaccine strains by sequencing

For more accurate strain identification, the specific nucleotide sequence of each vaccine strain was confirmed through sequencing.

Specifically, the PCR product obtained in Example 2-1 was requested for sequencing by Macrogen, and the nucleotide sequence was confirmed.

Thereafter, the nucleotide sequence analysis results were identified using BLAST (Basic Local Alignment Search Tool) of the National Center for Biotechnology Information (NCBI) to identify microbial species having the corresponding nucleotide sequence.

2a to 2h show the sequencing results and BLAST results of each vaccine strain.

2-3. by Western blot S. parauberis serotypic identification of

In particular, in the case of S. parauberis , it is divided into three types according to the serotype, and since this difference cannot be determined only by the PCR of Example 2-1, each serotype was confirmed using Western blotting.

First, each of the three S. parauberis strains isolated in Example 2-1 was cultured in BHI medium at 25° C. for 12 hours, and then centrifuged to prepare protein samples. In order to load on SDS-PAGE gel so that the total protein amount of each sample was 6.7 μg, fetal bovine serum albumin (BS) was quantified using Bradford assay. After electrophoresis was performed on a 12% SDS-polyacrylamide gel, a polyvinylidene difluoride (PVDF) membrane was run on a Trans-Blot® SD Semi-Dry Transfer Cell (Bio-Rad) instrument at 18 V for 60 minutes. A transfer was performed. The PVDF membrane on which the protein was transferred was blocked with 5% (w/v) skim milk for 1 hour at room temperature, and then rabbit anti- S. parauberis I-2 polyclonal antibody (1:2,000) as the primary antibody. ) was used to carry out an antigen-antibody reaction at room temperature for 1 hour. After completing the primary antibody reaction, the PVDF membrane was washed 6 times with a Tris-salin (0.1% (w/v) TBS-T) solution containing 0.1% (v/v) Tween 20, followed by peroxidase fusion ( A peroxidase-conjugated secondary antibody (Goat anti-Mouse IgG (H+L) Cross-adsorbed Secondary Antibody, HRP (Thermo Fisher)) was diluted 1:10,000, and an antigen-antibody reaction was performed for 1 hour. Then, after washing 6 times with the 0.1% TBS-T solution, the reaction was performed with an ECL detection reagent, and the final result was confirmed using a Microchemi 4.2 (DNR) instrument.

Figure 3 shows the result of confirming the antigen type using Western blot. In FIG. 3 , a band marked with a yellow dot represents an I-2 specific band, a band marked with a blue dot represents an I-3 specific band, and a band marked with a red dot represents an I-4 specific band.

In the case of S. parauberis I-2, the band indicated by the yellow dots appeared faintly. In the case of S. parauberis I-3, two bands around 20 kDa were newly identified, which were not found in I-2 or I-4. Also, in the case of S. parauberis I-4, unlike I-2 and I-3, new bands were identified around 37 kDa and 25 kDa. A band corresponding to the 25 kDa position of I-4 appeared at a position larger than 25 kDa in I-2 and I-3.

That is, S. parauberis I-2, S. parauberis I-3, and S. parauberis I-4 were the same in PCR and sequencing results, but showed different protein expression bands, confirming that they were different antigenic types. .

Example 3. Determination of challenge inoculum

3-1. Determination of VHSV challenge dose

In order to determine the challenge inoculum, VHSV was infected and proliferated in the FHM cell line, and the amount of VHSV cultured to match the challenge inoculum concentration was measured by the TCID ₅₀ method substantially the same as in Examples 1-3. The VHSV prepared as the challenge inoculation was injected into the abdominal cavity of flounder, respectively, and the infection and mortality were confirmed to determine the challenge inoculation.

Specifically, VHSV was injected into the abdominal cavity of 20 healthy flatfish with an average body length of about 12 cm at a concentration of 1x10 ^7.5 TCID ₅₀ /fish using an automatic self-refilling syringe (Socorex, Switzerland). Afterwards, flounder were reared in a 100 L square tank with the water temperature maintained at 16 °C. Afterwards, infection and mortality were checked over time. Figures 6a to 6h show a graph of the mortality rate of halibut according to the elapsed date after VHSV injection.

After injecting 100 ul of VHSV into the abdominal cavity of healthy halibut (average length 12 cm) at a concentration of 1x10 ^7.5 TCID ₅₀ /fish, pathogenicity was confirmed. appeared as

When healthy halibut (average body length 12 cm) was inoculated with VHSV at a concentration of 1x10 ^7.5 TCID50/fish, VHSV-infected symptoms such as abdominal distension and body color blackening were confirmed 4 days after inoculation, and mortality occurred. Through this, it was confirmed that VHSV is pathogenic.

3-2. Pathogenicity test for each pathogen

S. parauberis , E. tarda , T. maritimum , V. harveyi , and V. anguillarum were inoculated into the medium of Table 1 by the method of Example 1-1, respectively, and cultured at 25 ° C.

As targets for inoculation of each pathogen, healthy halibut with an average length of 12 cm were bred in a 100 L square tank with the water temperature maintained at 20 °C.

Each pathogen was injected intraperitoneally by 100 ul each to 20 halibut per pathogen at the concentration shown in Table 4, and then the infection symptoms and mortality rates shown in Table 4 were measured over time. The concentration of each pathogen was measured by the method of Example 1-2.

pathogen Inoculum concentration (CFU/fish) infection symptoms S. parauberis I-2 1Ⅹ10 ⁹ body discoloration S. parauberis I-3 1Ⅹ10 ⁹ body discoloration S. parauberis I-4 1Ⅹ10 ⁹ body discoloration E. tarda 1Ⅹ10 ⁶ Abdominal distension, hernia T. maritimum 5Ⅹ10 ⁷ bloating V. harveyi 2Ⅹ10 ⁸ Abdominal distension, hernia V. anguillarum 1Ⅹ10 ⁶ Abdominal distension, hernia

6a to 6h show the cumulative mortality of halibut over time after intraperitoneal injection of each pathogen. Infection symptoms corresponding to each pathogen appeared according to all pathogen inoculations, and S. parauberis I-2 had a cumulative mortality of 70% at 11 days after pathogen injection, and S. parauberis I-3 at 13 days after pathogen injection. 80% cumulative mortality on day 1, S. parauberis I-4 70% cumulative mortality 13 days after pathogen injection, and E. tarda 100% cumulative mortality 7 days after pathogen injection. , T. maritimum had a cumulative mortality of 80% on day 6 after injection, V. harveyi had a cumulative mortality of 80% on day 14 after injection, and V. anguillarum had a cumulative mortality of 100% on day 6 after injection. showed lung mortality.

Therefore, the pathogenicity of each strain was confirmed.

Example 4. Antigen Amount Determination

4-1. Determination of the antigen amount of virus and each strain

In order to determine the antigen amount of VHSV and each pathogen strain, each antigen was prepared by concentration and injected into the abdominal cavity of flatfish at 0.1 ml each. Flounder injected with the same amount of phosphate buffered saline (PBS) was used as a control for each antigen.

A challenge experiment was performed one month after each antigen inoculation. The challenge experiment was performed by injecting 0.1 ml of the same antigen as each inoculated virus or strain at the same concentration as in Example 3-1 or Example 3-2 into the abdominal cavity of flounder. Mortality and relative survival rate (RPS) over time after the challenge inoculation were confirmed.

The relative survival rate (RPS, %) was calculated by the method of Equation 1 below.

[Equation 1]

Figures 7a to 7b show graphs of cumulative mortality according to the antigen amount of each antigen, and Table 5 shows the concentration of each antigen and the amount of death and relative survival according to each concentration.

antigen type antigen concentration
(VHSV: TCID ₅₀ /fish,
Bacteria: CFU/fish) Mortality (%) Relative survival rate (%) final decision VHSV Control (PBS) 85 - - 6E+5 35 59 - 2E+6 25 70 - 6E+6 10 88 O S. parauberis I-2 Control (PBS) 75 - - 2X10 ⁹ 40 47 - 5x10 ⁸ 30 60 O 1.25X10 ⁸ 40 47 - S. parauberis I-3 Control (PBS) 70 - - 2X10 ⁹ 30 57 - 5x10 ⁸ 25 64 O 1.25X10 ⁸ 30 57 - S. parauberis I-4 Control (PBS) 65 - - 2X10 ⁹ 40 38 - 5x10 ⁸ 20 69 O 1.25X10 ⁸ 10 85 - T. maritimum Control (PBS) 85 - - 8X10 ⁸ 7.5 91.2 - 2X10 ⁸ 10.0 88.2 - 5X10 ⁷ 32.5 61.8 O E. tarda Control (PBS) 100 - - 1X10 ⁹ 0 100 - 2.5X10 ⁸ 10 90 O 6.25X10 ⁷ 65 35 - V. harveyi Control (PBS) 60 - - 8X10 ⁹ 12.5 79 - 2X10 ⁹ 12.5 79 - 5x10 ⁸ 10 83 O V. anguillarum Control (PBS) 75 - - 8X10 ⁹ 5 93 - 2X10 ⁹ 0 100 - 5x10 ⁸ 5 93 O

The final antigen amount was 6E+6 TCID ₅₀ /fish for VHSV, 5X10 8 CFU/fish for S. parauberis I-2, 5X10 ⁸ CFU/fish for S. parauberis I-3, and 5X10 ⁸ for S. parauberis I- ⁴ . CFU/fish, T. maritimum was 5X10 ⁷ CFU/fish, E. tarda was 2.5X10 ⁸ CFU/fish, V. harveyi was 5X10 ⁸ CFU/fish, and V. anguillarum was determined to be 5X10 ⁸ CFU/fish.

4-2. Check for interference with antibody formation

In order to confirm the presence or absence of interference with antibody formation by the combination of each antigen, VHSV 6E + 6 TCID ₅₀ /fish, S. parauberis I-2 5Ⅹ10 ⁸ CFU / fish, S. parauberis I-3 5Ⅹ10 ⁸ CFU / fish, S. parauberis I-4 5Ⅹ10 ⁸ CFU/fish, T. maritimum 5Ⅹ10 ⁷ CFU/fish, E. tarda 2.5Ⅹ10 ⁸ CFU/fish, V. harveyi 5Ⅹ10 ⁸ CFU/fish, and V. anguillarum 5Ⅹ10 ⁸ CFU/fish antigens A test vaccine was prepared by adding Squalene, Tween 80, and Span85 as adjuvants. Table 6 below shows the concentration and adjuvant information of each antigen used in the test vaccine.

type name density antigen VHSV 6E+6 TCID ₅₀ /fish S. parauberis I-2 5Ⅹ10 ⁸ CFU/fish S. parauberis I-3 5Ⅹ10 ⁸ CFU/fish S. parauberis I-4 5Ⅹ10 ⁸ CFU/fish T. maritimum 5Ⅹ10 ⁷ CFU/fish E. tarda 2.5Ⅹ10 ⁸ CFU/fish V. harveyi 5Ⅹ10 ⁸ CFU/fish V. anguillarum 5Ⅹ10 ⁸ CFU/fish immune supplements Squalene 2.5% Tween80 0.25% Span85 0.25%

For the group vaccinated with the 8-valent test vaccine and the control group vaccinated with PBS instead of the vaccine, serum was sampled for each elapsed time after vaccination, and antibodies formed through indirect ELISA were compared to determine the presence or absence of interference.

In order to measure the antibody titer, an indirect ELISA method was performed using a mouse anti-flounder IgM antibody established at the Aquatic Vaccine Research Center. Unvaccinated halibut was used as the control group and halibut vaccinated with the 8-valent combination vaccine as the inoculation group, and 5 animals were randomly selected and blood was collected at 0, 4, and 8 weeks after vaccination, respectively. The collected blood was stored at 4℃ for 24 hours, and then _centrifuged ( ^3000Хg , 10 minutes, 4℃) to separate serum. The following experiment was conducted. After diluting with coating buffer (Coating buffer, bicarbonate/carbonate buffer) to a concentration of ⁷ CFU, adding 100 ul each, treatment at 37 ° C for 24 hours to fix the antigen in a 96-well plate. Then, TBS-T buffer ( After washing once using 20mM Tris, 137mM NaCl, 0.1% tween20, pH7.7), 200ul of 5% (w/v) skim milk/TBS-T buffer was added and blocking was performed at 4℃ for 1 hour. , blocking non-specific signals.

에서 3시간 동안 반응을 수행하였다. 반응이 완료된 96-well plate는 TBS-T 버퍼로 3회 세척하였다.Then, serum isolated from the experimental group administered with the octavalent vaccine and the control group administered with PBS was diluted 10-fold in 5% (w/v) skim milk/TBS-T buffer, and 100 μl was dispensed into each well to obtain 25

The reaction was carried out for 3 hours. The reaction completed 96-well plate was washed three times with TBS-T buffer.

Then, the mouse anti-flounder IgM monoclonal antibody was diluted 1:500 or 1:3000, and 100ul was dispensed into each well of a 96-well plate, reacted at 25 ° C for 3 hours, and washed three times with TBS-T buffer. . Thereafter, the goat anti-mouse IgG peroxidase-conjugate antibody was diluted 1:1000 or 1:3000, and 100ul was dispensed into each well, followed by reaction at 25°C for 2 hours. After the secondary antibody reaction, after washing 5 times with TBS-T buffer, 50ul of tetramethylbenzidine (TMB) was added and when a color reaction occurred, the reaction was terminated by adding Stop solution (1N H2SO4) and the optical density (Optical Density) at 450nm wavelength density, OD) values were measured.

8a to 8h show indirect ELISA results.

In the group injected with the vaccine, high antibody formation against E. tarda, V. harveyi, and V. anguillarum pathogens appeared 2 weeks after administration, and differences in OD ₄₅₀ values for other pathogens also began to appear. After a week, it was confirmed that the OD ₄₅₀ values for all pathogens were more than twice as high as those of the control group. As all antibodies for each pathogen showed a difference compared to the control group, it was confirmed that an 8-valent vaccine including 8 antigens was prepared because there was no interference between antigens.

Example 5. Vaccine efficacy test

In order to test the effect of the test vaccine prepared in Example 4-2, flounder was inoculated with the test vaccine and 1 month later, an infection experiment was conducted for each pathogen, and the cumulative mortality (%) and relative survival rate (RPS, %) was measured to confirm the effectiveness of the vaccine.

Specifically, the vaccine was intraperitoneally injected into 180 healthy halibut, and each pathogen was infected by intraperitoneal injection 1 month after the injection date, and the cumulative mortality and pathogens were confirmed daily. Control halibut were intraperitoneally injected with PBS instead of vaccine. Then, after calculating the relative survival rate (RPS) through Equation 1 below, the effect of the vaccine was measured.

[Equation 1]

As a result, when infection experiments were conducted for each pathogen after vaccination, it was confirmed that the cumulative mortality decreased in the vaccinated group compared to the non-vaccinated group (control group). Specifically, when the cumulative mortality rate of the control group after vaccination is 60% or more, the relative survival rate of the vaccinated group is VHSV, S. parauberis I-2, S. parauberis I-3, S. parauberis I-4, T. maritimum , E In tarda , the cumulative mortality decreased and the relative survival rate was 100% in the infection test on V. harveyi and V. anguillarum . Therefore, it was confirmed that the efficacy of the vaccine was excellent compared to the control group. Table 7 below shows the cumulative mortality (mortality, %) and relative survival (RPS, %) according to each pathogen infection of the control group and the vaccine administration group.

Antigen Groups Mortality (%) RPS (%) VHSV PBS 100 - VHSV-8V 15 85.0 S. parauberis I-2 PBS 90 - VHSV-8V 15 83.3 S. parauberis I-3 PBS 100 - VHSV-8V 10 90.0 S. parauberis I-4 PBS 80 - VHSV-8V 15 81.3 T. maritimum PBS 85 - VHSV-8V 5 94.1 E. tarda PBS 90 - VHSV-8V 5 94.4 V. harveyi PBS 100 - VHSV-8V 0 100 V. anguillarum PBS 95 - VHSV-8V 0 100

Example 6. Safety test of vaccine

In order to confirm the safety of the vaccine, feeding and growth were investigated for 21 days after vaccination after administration at a concentration of 1 or 2 times the vaccine. In addition, anatomical analysis, histological analysis, and hematological analysis were performed to confirm that there were no problems with safety.

6-1. Flounder feeding and growth following vaccination

As a result of comparing with the control after administering the vaccine at 1-fold and 2-fold concentration, it was confirmed that there was no difference in the feeding part at 1, 2, and 3 weeks. However, 1 week and 2 weeks after vaccination, the water temperature was low, so the feeding amount was low in both the control and vaccine groups. It was also confirmed that there was no difference between the control group and the control group at 1, 2, and 3 weeks in the growth part of flounder.

According to the anatomical examination, in the experimental group administered with 1-fold and 2-fold of the 8-valent combination vaccine, no residual was confirmed by visual observation at 1, 2, and 3 weeks, and organ fusion was not confirmed.

Histological observation of the liver and spleen showed that no significant difference was observed between the experimental groups by concentration from 1, 2, and 3 weeks after the administration of the control group and the 8-valent combination vaccine. It is considered that there is no problem with safety.

Hematological analysis was performed to confirm the safety of the 8-valent combination vaccine. Confirmation was performed at 1, 2, and 3 weeks after injection of the octavalent combination vaccine at 1-fold and 2-fold concentrations. Aspatate aminotransferase (AST), Alanine aminotransferase (ALT), Glucose, total cholesterol levels, there was no significant difference between the control group and the 1-fold and 2-fold vaccine groups, and it is considered that there is no problem with safety.

<110> Jeju National University Industry-Academic Cooperation Foundation Jeju special Self-Governing Province, Ocean and Fisheries Reseach Institute <120> Octavalent vaccine composition for preventing diseases in fish and manufacturing methods thereof <130> DPP20192126KR <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> artificial sequence <220> <223> VHSV-VN forward <400> 1 atggaaggag gaattcgtga agcg 24 <210> 2 <211> 22 <212> DNA <213> artificial sequence <220> <223> VHSV-VN reverse <400> 2 gcggtgaagt gctgcagttc cc 22 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> S. parauberis Spa2152 forward <400> 3 tttcgtctga ggcaatgttg 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> S. parauberis Spa2870 reverse <400> 4 gcttcatata tcgctatact 20 <210> 5 <211> 17 <212> DNA <213> artificial sequence <220> <223> T. maritimum 16s rRNA MAR1 forward <400> 5 aatggcatcg ttttaaa 17 <210> 6 <211> 17 <212> DNA <213> artificial sequence <220> <223> T. maritimum 16s rRNA MAR2 reverse <400> 6 cgctctctgt tgccaga 17 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> E. tarda gyrB1 forward <400> 7 gcatggagac cttcagcaat 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> E. tarda gyrB1 reverse <400> 8 gcggagattt tgctcttctt 20 <210> 9 <211> 18 <212> DNA <213> artificial sequence <220> <223> V. harveyi toxR AY247418 forward <400> 9 ttctgaagca gcactcac 18 <210> 10 <211> 18 <212> DNA <213> artificial sequence <220> <223> V. harveyi toxR AY247418 reverse <400> 10 tcgactggtg aagactca 18 <210> 11 <211> 28 <212> DNA <213> artificial sequence <220> <223> V. anguillarum groESL forward <400> 11 tatcactgtt gaagaaggtc aagcactg 28 <210> 12 <211> 21 <212> DNA <213> artificial sequence <220> <223> V. anguillarum groESL reverse <400> 12 cgcttcaagt gcaggaagca g 21

Claims (8)

Viral hemorrhagic sepsis virus (VHSV), Streptococcus parauberis I-2 ( Streptococcus parauberis Ib), Streptococcus parauberis I-3 ( Streptococcus parauberis Ic), Streptococcus parauberis I-4 ( Streptococcus parauberis Ia) , Tenacibaculum maritimum, Edwardsiella tarda, Vibrio harveyi , and A vaccine composition for preventing infectious diseases of fish, comprising inactivated strains of Vibrio anguillarum and squalene, Tween80 and Span85 as adjuvants,
The fish infectious disease is one or more infections selected from the group consisting of viral hemorrhagic sepsis, streptococci, Edward's disease, Vibrio disease, and slide bacterial disease, vaccine composition. According to claim 1,
The inactivated cell of the viral hemorrhagic sepsis virus is 6E+5 to 10E+6 TCID ₅₀ /fish,
The inactivated strain of the Streptococcus parauberis Ib strain is 1.25X10 ⁸ to 2X10 ⁹ CFU / fish,
The inactivated strain of the Streptococcus parauberis Ic is 1.25X10 ⁸ to 2X10 ⁹ CFU / fish,
The inactivated strain of the Streptococcus parauberis Ia (I-4) strain is 1.25X10 ⁸ to 2X10 ⁹ CFU / fish,
The inactivated cells of the Tenacibaculum maritium bacteria are 2X10 ⁷ to 8X10 ⁸ CFU / fish,
The inactivated strain of the Edward Siella tarda bacteria is 6.25X10 ⁷ to 1X10 ⁹ CFU / fish,
The inactivated cell of the Vibrio harbei bacteria is 1X10 ⁸ to 8X10 ⁹ CFU / fish, and
The inactivated cells of the Vibrio anguilarum bacteria are contained at a concentration of 1X10 ⁸ to 8X10 ⁹ CFU / fish, vaccine composition. delete delete The vaccine composition according to claim 1, wherein the fish is halibut. The method of claim 1, wherein the composition, the relative survival rate (RPS) for the viral hemorrhagic sepsis virus antigen is 60% or more,
Relative survival rate (RPS) for Streptococcus parauberis Ib antigen is 60% or more;
Relative survival rate (RPS) for Streptococcus parauberis Ic antigen is 60% or more;
Relative survival rate (RPS) for Streptococcus parauberis Ia antigen is 60% or more;
Relative survival rate (RPS) to Tenacibaculum maritimum antigen is 60% or more,
The relative survival rate (RPS) for the Edwardsiella tarda antigen is 60% or more,
Relative survival rate (RPS) for Vibrio harveyi antigen is 60% or more, or
A vaccine composition having a relative survival rate (RPS) of 60% or more for the Vibrio anguillarum antigen. Inactivating by isolating and culturing viral hemorrhagic sepsis virus (VHSV); and
Streptococcus parauberis I-2 ( Streptococcus parauberis Ib), Streptococcus parauberis I-3 ( Streptococcus parauberis Ic), Streptococcus parauberis I-4 ( Streptococcus parauberis Ia), Tenacibaculum maritimum, Edwardsiella tarda, Vibrio harveyi , and A method for producing a vaccine composition for preventing fish disease, comprising culturing Vibrio anguillarum and then isolating and inactivating it,
The disease of the fish is one or more infections selected from the group consisting of viral hemorrhagic sepsis, streptococci, Edward's disease, Vibrio disease and slide bacterial disease, the manufacturing method. The method of claim 7, wherein the composition has a relative survival rate (RPS) for viral hemorrhagic sepsis virus antigen of 60% or more,
Relative survival rate (RPS) for Streptococcus parauberis Ib antigen is 60% or more;
Relative survival rate (RPS) for Streptococcus parauberis Ic antigen is 60% or more;
Relative survival rate (RPS) for Streptococcus parauberis Ia antigen is 60% or more;
Relative survival rate (RPS) for Tenacibaculum maritimum antigen is 60% or more,
The relative survival rate (RPS) for the Edwardsiella tarda antigen is 60% or more,
Relative survival rate (RPS) for Vibrio harveyi antigen is 60% or more, or
A manufacturing method wherein the relative survival rate (RPS) for the Vibrio anguillarum antigen is 60% or more.

Images