KR20220000220A - Novel antimicrobial peptide from starry flounder and uses thereof - Google Patents

Abstract

The present invention relates to antibacterial peptides derived from Platichthys stellatus consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and uses thereof. The antimicrobial peptides of the present invention can be usefully utilized as an antibiotic substitute for fish.

Description

Novel antimicrobial peptide from starry flounder and uses thereof

The present invention relates to a novel antibacterial peptide prepared based on an amino acid sequence expected to have antibacterial activity in a Prosaposin-like protein derived from Platichthys stellatus, and to a use thereof.

Prosaposin (PSAP) was initially identified as a precursor of four lysosomal activator proteins known as Saposin (SAP) A, B, C and D, and is known as a lysosomal protein and a secretory protein. In addition, PSAP is a secreted factor found in many secretions including cerebrospinal fluid, semen, milk, pancreatic fluid and bile, and can promote cell survival, neurite growth and differentiation, and is neuroprotective in cholinergic cell lines. It is known as a neurotrophic factor showing activity. These functions negatively affected the neuronal and reproductive development of knockout mice, and it has been reported that PSAP is overexpressed in various cancer cells. Some members of the SAP-like protein family, including NK-lysin and granulysin, exhibit potent antibacterial activity that penetrates cell membranes and kills bacteria.

Today, excessive use of antibiotics in medicine, food and agriculture has increased bacterial resistance, and deaths due to these bacterial infections are also increasing. Antimicrobial peptide (AMP) is an important component of innate immunity. It is a natural substance with a wide range of antibacterial, antifungal, antiviral and anticancer activity, and is thought to be able to overcome drug resistance, a problem facing antibiotics. . However, despite these advantages, natural AMPs have a problem in replacing antibiotics due to their high production cost, short in vivo half-life, and in vivo toxicity, and development of AMPs capable of overcoming the above problems is required. Currently, more than 20,000 AMP sequences are registered in the DRAMP (Data Repository of Antimicrobial Peptides, http://dramp.cpu-bioinfor.org/) database, but less than 0.4% of AMPs are being clinically tested.

In the fish aquaculture industry, AMP is attracting attention due to growing public health concerns and regulation of the use of antibiotics. Since fish live in an environment exposed to various pathogens, it can be used as an important resource for discovering new antibacterial peptides. .

Platichthys stellatus is a promising aquaculture fish near the east coast of South Korea and China, and is a popular fish for leisure fishing in the North Pacific region. However, as an aquaculture fish species with a relatively short aquaculture history and relatively low demand, case studies on immunological studies are lacking.

Meanwhile, Korea Patent Publication No. 2018-0039393 discloses 'a novel antimicrobial peptide derived from polar fish,' and Korea No. 2013-0109543 discloses 'a new antimicrobial peptide derived from yellowfin and its use'. However, there is no disclosure about the novel antibacterial peptide derived from the strength leg of the present invention and its use.

The present invention has been derived from the above needs, and the present inventors have prepared two synthetic peptides (PsPSAPL-1 and -2) predicted to have antibacterial activity from Prosaposin-like protein (PsPSAPL) derived from Platichthys stellatus. ) and confirmed the antibacterial activity and cytotoxicity to the host's erythrocytes, the antibacterial peptides derived from the two species of strength leg showed antibacterial activity against various gram-positive and gram-negative bacteria, and showed weak hemolytic activity against erythrocytes of the host. By confirming the appearance, the present invention was completed.

In order to solve the above problems, the present invention provides an antibacterial peptide derived from the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, leg strength leg ( Platichthys stellatus).

In addition, the present invention provides a polynucleotide encoding the antibacterial peptide.

In addition, the present invention provides a recombinant vector comprising the polynucleotide.

In addition, the present invention provides a host cell transformed with the recombinant vector.

In addition, the present invention provides a method for producing an antibacterial peptide comprising the step of transforming a host cell with the recombinant vector to overexpress a polynucleotide encoding the antibacterial peptide.

In addition, the present invention provides an antibacterial peptide produced by the method.

In addition, the present invention provides an antibacterial composition containing the antimicrobial peptide as an active ingredient.

In addition, the present invention provides a feed additive for fish containing the antibacterial peptide as an active ingredient.

The novel antibacterial peptide derived from the strength leg according to the present invention not only has excellent antibacterial activity against various fish pathogens, but also shows little cytotoxicity to host cells. It may be usefully used as a feed additive for

Figure 1 shows the results of multiple alignment analysis and phylogenetic tree of Prosaposin-like protein (PsPSAPL) derived from the strength leg ( Platichthys stellatus).
Figure 2 is the result of confirming the expression level of PsPSAPL in each tissue of a healthy legged fish.
3 shows the results of confirming the change in the expression level of PsPSAPL in each tissue of the robin leg fish after artificial infection with VHSV (A) or Streptococcus parauberis PH0710, B).
4 is a result confirming the biofilm formation inhibitory ability of PsPSAPL-1 and -2 antibacterial peptides.
5 is a result confirming the antiparasitic activity of PsPSAPL-1 and -2 antibacterial peptides.
6 is a result of a red blood cell hemolysis experiment to determine the cytotoxicity of PsPSAPL-1 and -2 antibacterial peptides.

In order to achieve the object of the present invention, the present invention provides an antibacterial peptide derived from the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, leg strength leg ( Platichthys stellatus).

The present inventors, based on the amino acid sequence expected to have antibacterial activity in Prosaposin-like protein (GenBank accession No. MT044467) derived from Platichthys stellatus, are two antibacterial peptides consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, respectively was produced and named as PsPSAPL-1 and PsPSAPL-2, respectively.

The scope of the antibacterial peptide derived from the strength leg according to the present invention includes a peptide represented by an amino acid sequence selected from the group consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and functional equivalents of the peptide. "Functional equivalent" means at least 60% or more, preferably 70% or more, more preferably 80% or more of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 as a result of addition, substitution or deletion of amino acids, Even more preferably, it refers to a peptide having a sequence homology of 90% or more, and exhibiting physiological activity substantially identical to that of the peptide represented by the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. "Substantially homogenous physiological activity" means antibacterial activity.

The present invention also provides a polynucleotide encoding the antibacterial peptide. The polynucleotide of the present invention may be DNA or RNA encoding the antibacterial peptide. DNA includes cDNA, genomic DNA, or man-made synthetic DNA, and the DNA may be single-stranded or double-stranded.

The present invention also provides a recombinant vector comprising the polynucleotide.

The term “vector” is used to refer to a DNA fragment(s), a nucleic acid molecule, that is delivered into a cell. The vector replicates DNA and can be reproduced independently in a host cell. The term "carrier" is often used interchangeably with "vector." The term "expression vector" refers to a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expression of an operably linked coding sequence in a particular host organism. In general, any plasmid and vector can be used as long as it is capable of replication and stabilization in the host. An important characteristic of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element. The translation control elements available in eukaryotes, such as enhancers, ribosome binding sites, termination signals, polyadenylation signals, and promoters, are known in the art. The expression vector can be constructed by methods well known in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology. The DNA sequence can be effectively linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector may also contain a ribosome binding moiety and a transcription terminator as a translation initiation site.

Vectors of the invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of propagating transcription (eg, pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.); It generally includes a ribosome binding site for initiation of translation and a transcription/translation termination sequence. When E. coli is used as a host cell, the promoter and operator sites of the tryptophan biosynthesis pathway of E. coli, and the left-handed promoter (pLλ promoter) of phage (λ) may be used as regulatory regions.

On the other hand, vectors that can be used in the present invention include plasmids (eg, pSC101, ColE1, pBR322, pUC8/9, pHC79, pGEX series, pET series and pUC19, etc.) often used in the art, phage (eg, λgt4 λB) , λ-Charon, λΔz1 and M13, etc.) or viruses (eg, SV40, etc.). On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is a host, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter) or a promoter derived from a mammalian virus (eg, adeno viral late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

The vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and a gene for resistance to tetracycline.

The present invention also provides a host cell transformed with the recombinant vector.

As a host cell capable of stably and continuously cloning and expressing the vector of the present invention, any host cell known in the art may be used, for example, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, Bacillus genus strains such as E. coli B, E. coli X1776, E. coli W3110, Bacillus subtilis , Bacillus thuringiensis , Salmonella typhimurium , Serratia marcescens and There are enterobacteriaceae and strains such as various Pseudomonas species.

In addition, when the vector of the present invention is transformed into a eukaryotic cell, as a host cell, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293 ) , HepG2, 3T3, RIN and MDCK cell lines) and plant cells may be used.

The method of delivering the vector of the present invention into a host cell is, when the host cell is a prokaryotic cell, the CaCl ₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973)) ), the Hanahan method (Hanahan, D., J. Mol. Biol., 166:557-580 (1983)) and the electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145). (1988)) and the like. In addition, when the host cell is a eukaryotic cell, microinjection method (Capecchi, MR, Cell, 22:479 (1980)), calcium phosphate precipitation method (Graham, FL et al., Virology, 52:456 (1973)), electroporation (Neumann, E. et al., EMBO J., 1:841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87 (1980)), DEAE- Dextran treatment (Gopal, Mol. Cell Biol., 5:1188-1190 (1985)) and gene bambadment (Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572 (1990)) The vector may be injected into a host cell by such a method.

The present invention also provides a method for producing an antibacterial peptide comprising the step of overexpressing a polynucleotide encoding an antibacterial peptide by transforming a host cell with the recombinant vector, and an antibacterial peptide produced by the method.

In the method for producing the antibacterial peptide of the present invention, the transformant is cultured in a medium suitable for the production of a recombinant protein (peptide) using a known technique. For example, the cells may be cultured by small-scale or large-scale fermentation, shake flask culture in a laboratory or industrial fermentor conducted under suitable media and conditions permitting expression and/or isolation of the protein. Cultivation takes place in a suitable medium containing a carbon, nitrogen source and inorganic salts using known techniques. A suitable medium can be obtained commercially or can be prepared according to the components and composition ratios described in publications such as, for example, catalogs of the American Type Culture Collection (ATCC).

In the above production method, the protein (peptide) expressed by the target gene can be recovered using a protein isolation method known in the art. For example, the protein may be separated from the nutrient medium by conventional methods including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation or precipitation. Furthermore, proteins can be further purified by a variety of known methods including chromatography (eg ion exchange, affinity, hydrophobicity and size exclusion), electrophoresis, fractional lysis (eg ammonium sulfate precipitation), SDS-PAGE or extraction. can be purified.

The antibacterial peptide of the present invention is as described above, and is an antibacterial peptide having growth inhibitory activity against bacteria such as gram-positive bacteria or gram-negative bacteria.

In addition, the present invention provides an antibacterial composition containing the antimicrobial peptide as an active ingredient. The antimicrobial composition may be used as an antimicrobial composition for fish, but is not limited thereto.

By "antimicrobial" is meant the ability to reduce, prevent, inhibit, or eliminate the growth or survival of a microorganism at a certain concentration, and may preferably mean anti-bacterial, wherein the bacterium is gram-positive or gram-negative even number and, preferably, am is the gram-positive Streptococcus Ke (Streptococcus iniae) or Streptococcus para Ube-less (S. parauberis), and gram-negative bacteria is Vibrio see Norris coarse tea (Vibrio alginolyticus) , Vibrio anguillarum ( V. anguillarum ), Vibrio campbellii ( V. campbellii ), Vibrio harveyi ( Vibrio harveyi ) or Vibrio ordalii ( Vibrio ordalii ) may be, but is not limited thereto.

The present invention also provides a feed additive for fish containing the antibacterial peptide as an active ingredient. The feed additive contains a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 having antibacterial activity as an active ingredient, and can induce an immune enhancing effect of fish.

The feed additive of the present invention includes auxiliary components such as amino acids, inorganic salts, vitamins, antibiotics, antibacterial substances, antioxidants, antifungal enzymes, and other live cell types of microbial preparations; grains such as milled or crushed wheat, oats, barley, corn and rice; plant protein feeds, such as those based on rape, soybean and sunflower; animal protein feeds such as blood meal, meat meal, bone meal and fish meal; Dry ingredients consisting of sugar and dairy products, for example, various milk powders and whey powder; lipids, for example main components such as animal fats and vegetable fats optionally liquefied by heating; Additives such as nutritional supplements, digestion and absorption enhancers, growth promoters, and disease prevention agents may be further included.

The feed additive of the present invention may be in the form of a powder or liquid formulation, and may include an excipient for adding feed. The excipient for feed addition may include, for example, calcium carbonate, wheat flour, zeolite, jade flour, or rice bran, but is not limited thereto.

The feed additive of the present invention may further comprise one or more enzyme preparations. For example, lipolytic enzymes such as lipase, phytase that breaks down phytic acid to produce phosphate and inositol phosphate, and alpha-1,4-glycosidic bonds (α-1) contained in starch and glycogen Amylase, an enzyme that hydrolyzes 4-glycoside bonds, phosphatase, an enzyme that hydrolyzes organophosphate esters, maltase that hydrolyzes maltose into two molecules of glucose, and glucose-fruc by hydrolyzing saccharose It may contain a converting enzyme, etc. to make a toss mixture.

The feed additive of the present invention may be administered to the fish alone or in combination with other feed additives in an edible carrier. In addition, the composition for addition to the feed can be easily administered as a top dressing, directly mixed with the feed, or separately from the feed, in a separate oral formulation, or in combination with other ingredients. Typically, single daily intakes or divided daily intakes may be used as is well known in the art.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

One. PsPSAPL Identification and cloning of genes

The open reading frame (ORF) sequence of the PsPSAPL ( Platichthys stellatus Prosaposin-like) gene was confirmed through subcloning and Sanger sequencing based on the sequence obtained in the previous study. Briefly, the ORF sequence of PsPSAPL was amplified by PCR, ligated with pGEM T-easy vector (Promega, USA), and transformed into E. coli JM109 strain. After culturing the E. coli strain and extracting the plasmid, the sequence was determined through Sanger sequencing.

2. Multiple Sorting and Phylogenetic Analysis

The obtained cDNA sequence of PsPSAPL was predicted using GENETYX software version 8.0 (SDC Software Development, Japan), and the related PSAPL sequence was obtained from the NCBI database (http://www.ncbi.nlm.nih. gov/blast). The amino acid sequence confirmed through multiple alignment was visualized through GeneDoc using the ClustalX2 algorithm, and domain and motif prediction was confirmed using the PROSITE profile database (http://www.expasy.org/tools/scanprosite/). The phylogenetic tree was constructed through ClustalW with 1,000 boost trap iterations using the neighbor-joining method, and visualized using MEGA software version 6.0.

3. in vivo gene expression profiling

3-1. Fish and pathogenic microorganisms

Healthy strength legs (weight: 128.7 ± 18.2 g, body length: 21.5 ± 1.3 cm) were purchased from a private farm in Pohang and acclimatized for 2 weeks in seawater conditions. For the diagnosis of major diseases, it was randomly selected from among robbers accustomed to seawater, and the health status was confirmed through a clinical examination using PCR, and then used in the experiment.

The pathogenic bacteria used in the present invention are as follows: Edwardsiella piscicida FSW910410, Streptococcus iniae FP5228, S. parauberi KSP28, Streptococcus parauberi KSP28 Lis PH0710, Vibrio alginolyticus ( Vibrio alginolyticus ) KCCM2928, Vibrio anguillarum ( V. anguillarum ) TR14001NF, Vibrio campbelli ( V. campbellii ) KCCM40684, Vibrio halvei ( Vibrio ordalii ) KCCM2928, Vibrio ordalii ( Vibrio ordalii ) ATCC14126 and . The pathogenic bacteria were provided and used by the National Institute of Fisheries Science.

3-2. Sample preparation and tissue collection

Expression profiling of PsPSAPL mRNA was performed in various tissues of clinically healthy strength legs (brain, eyes, gills, head kidney, heart, intestine, liver, muscle, skin, pancreas, stomach and trunk kidney). was measured from After blood was collected from caudal arrhythmias, peripheral blood leukocytes (PBLs) and red blood cells (RBCs) were isolated through a concentration gradient of Percoll (Sigma-Aldrich, USA). The prepared tissue samples were stored at -80°C until total RNA extraction.

Pathogen artificial infection experiment, Streptococcus parauberis PH0710 (1 Х 10 ³ CFU/fish) or VHSV (Viral Hemorrhagic Septicemia virus, 1 Х 10 ⁶ copies/fish) were cultured at 17 or 25 ℃ after infection, respectively. Primary tissues were collected at 1 hour, 12 hours, 1 day, 3 days, 5 days and 7 days after artificial infection and stored at -80°C until total RNA extraction.

3-3. Total RNA extraction and cDNA synthesis

After each tissue was homogenized, total RNA was extracted using RNAiso Plus reagent (Takara, Japan) according to the manufacturer's instructions. During the extraction process, genomic DNA was decontaminated using a DNase I kit (Takara). The quality of the extracted total RNA was measured using a NanoVue spectrophotometer (GE Healthcare, USA), ^{and cDNA was synthesized using the PrimeScript TM} 1st Strand cDNA Synthesis Kit (Takara).

3-4. Quantitative real-time PCR

The expression level of PsPSAPL mRNA was analyzed by the SYBR green method, and Thermal Cycler Dice ^® Real Time System Ⅲ (Takara) was used. For relative expression analysis, PsPSAPL specific primers [forward: CTGCACCTGGCTCCTAACTC (SEQ ID NO: 3) and reverse: TCCCAAAACCTTCTGCAGTC (SEQ ID NO: 4)] and PsEF1α specific primers [forward: GTGGCAAGTCCACCACCA (SEQ ID NO: 5) and reverse: GCTTGTCCAGCACCCAGG (SEQ ID NO: 5) 6)] and calculated using the ^{2 -ΔΔCT method.}

4. Peptide Synthesis

The amino acid sequence of PsPSAPL predicted to have antibacterial activity was synthesized at the request of Peptron (Daejeon, South Korea). The synthesized peptides (antibacterial peptides) were as follows, dissolved in PSB (phosphate-buffered saline) buffer and used for the experiment: PsPSAPL-1 : YLPKVLHQTPGHLKP (SEQ ID NO: 1) and PsPSAPL-2 : FTKIYGSRLQKVLGN (SEQ ID NO: 2).

5. Minimum inhibitory concentration (MIC) analysis

In order to evaluate the antimicrobial activity of the two synthesized antimicrobial peptides, MIC values were analyzed. Bacteria cultured in BHI (brain heart infusion; BD Biosciences, USA) medium ( E. piscicida , S. iniae , S. parauberis KSP28, S. parauberis PH0710, V. alginolyticus, V. anguillarum , V. campbellii , V. harveyi and V. ordalii ^{) were diluted to 1 Х 10 6} CFU/ml in mueller-hinton (MH; BD Biosciences) medium, and the antibacterial peptide (0 to 500 μg/ml) serially diluted two times was added to each bacterial solution. was mixed in the same amount. Then, the mixture was transferred to a 96-well plate, incubated at 28° C. for 8 hours, and absorbance was measured at 595 nm using a VICTOR3 plate reader (PerkinElmer, USA).

6. Microbial biofilm analysis

The effect of the antimicrobial peptides (PsPSAPL-1 and -2) of the present invention on the formation of a bacterial biofilm was analyzed through a crystal violet assay. 1 Х 10 in the BHI culture medium of bacteria (S. iniae, S. parauberis PH0710, V. alginolyticus, V. campbellii, V. harveyi and V. ordalii) the culture, the minimal medium M9 ^{(Welgene, South Korea) 7 CFU} / After each dilution to a concentration of ㎖, after mixing with an antibacterial peptide (125 to 250 ㎍ / ㎖) was reacted at 28 ℃. After 24 hours, the supernatant was collected and fixed with ethanol. Then, the supernatant was washed 3 times with PBS and stained with 1% crystal violet solution for 10 minutes. It was washed 5 times with distilled water, reacted for 10 minutes by adding a 30% acetic acid solution, and it was confirmed by measuring the absorbance at 595 nm to determine whether a biofilm was formed.

7. Antiparasitic analysis

In order to measure the antiparasitic activity of PsPSAPL-1 and -2, the cultured Scotika (Miamiensis avidus ) was diluted in PBS, and centrifuged at 650Х g for 5 minutes. After washing, diluted to a concentration of 1 Х 10 ⁵ cells/ml in PBS and mixed with an antibacterial peptide, the mixture was transferred to a 24-well plate and reacted at 20° C. for 1 hour. Then, the killing of scutica was measured using propidium iodide (Sigma-Aldrich) and a flow cytometer.

8. Cytotoxicity assay

To analyze the cytotoxicity of antibacterial peptides, the isolated strength leg RBCs were diluted in PBS buffer at a ratio of 4%, mixed with antibacterial peptides (0 to 500 μg/ml), and serially diluted two-fold in a 96-well plate. and was busy. A positive control was mixed with 0.1% Triton X-100 instead of the antibacterial peptide, and reacted for 30 minutes. Thereafter, the supernatant was recovered by centrifugation at 1,000Х g for 10 minutes and absorbance was measured at 540 nm.

9. Statistical Analysis

All samples were performed in triplicate, and the results were reported as mean±standard deviation. Statistical analysis was performed using SPSS software version 19 (IBM, USA), the results were verified using ANOVA (one-way analysis of variance), and Tukey's test was used for comparison between the results (* p < 0.05 and ** p < 0.01).

Example 1. Identification and amino acid sequence analysis of PsPSAPL

The present inventors registered the cDNA and amino acid sequence of the Prosaposin-like protein gene ( PsPSAPL ) derived from Platichthys stellatus in the NCBI database (accession No. MT044467). The ORF sequence of PsPSAPL cDNA is 987 bp and encodes 328 amino acids. As a result of multiple alignment of PsPSAPL with the PSAPL amino acid sequence of other fish species, it was confirmed that the three saposin B-type domains (36-117, 148-229, and 237-317 amino acids) were conserved at a very high level (Fig. 1A). . The PSAPL of the robber leg showed the highest homology with that of the olive flounder (85.2%), followed by barramundi (77.5%) and grayfish (75.9%).

The phylogenetic tree showed that PSAPL belonged to a cluster distinct from that of fish PSAPL, and was closest in similarity to PSAPL of halibut (Fig. 1B).

Example 2. PsPSAPL gene expression profiling

It was confirmed that PsPSAPL mRNA was abundantly expressed in brain tissue compared to muscles, gills and RBCs in healthy strength legs (FIG. 2).

When VHSV was artificially infected, the mRNA expression level of PsPSAPL was down-regulated in most tissues, and it was confirmed that the expression level in gill and liver tissues was maintained at a constant level ( FIG. 3A ). On the other hand, when Streptococcus parauberis was artificially infected, the mRNA expression level of PsPSAPL was significantly up-regulated in heart, liver and intestinal tissues, and it was confirmed that it was down-regulated to the lowest level in gill and pancreatic tissues ( Figure 3B).

Example 3. Antimicrobial activity assay

The purity of the synthesized PsPSAPL-1 and -2 antibacterial peptides used in the antimicrobial activity assay was 98%. The MIC values of PsPSAPL-1 and -2 antibacterial peptides against Gram-positive and Gram-negative bacteria are shown in Table 1 below.

PsPSAPL-1 is am trying Streptococcus (Streptococcus iniae) FP5228, it is a wide range of bacterial species Streptococcus para Ube lease (S. parauberi) PH0710, halbeyi Vibrio (Vibrio harveyi) were found to inhibit the growth of ATCC14126, PsPSAPL-2 ( S. iniae, S. parauberis PH0710, V. alginolyticus, V. anguillarum, V. campbellii, V. harveyi and V. ordalii ) were confirmed to exhibit antibacterial activity.

Example 4. Inhibition of biofilm formation and antiparasitic ability

PsPSAPL-1 and -2 peptides were confirmed to significantly reduce the biofilm formation of bacteria used in the experiment (FIG. 4).

In addition, PsPSAPL-1 and -2 peptides showed concentration-dependent antiparasitic activity (FIG. 5). Unlike the antibacterial activity, it was confirmed that the PsPSAPL-1 peptide had superior antiparasitic activity compared to the PsPSAPL-2 peptide.

Example 5. Cytotoxicity assay

The present inventors measured the hemolytic activity of PsPSAPL-1 and -2 peptides using RBCs. As a result, as shown in FIG. 6 , it was confirmed that the PsPSAPL-1 and -2 antibacterial peptides did not show any hemolytic activity even at the highest treatment concentration of 500 μg/ml, indicating that they were antibacterial peptides without cytotoxicity.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Novel antimicrobial peptide from starry flounder and uses thereof <130> PN20097 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 15 <212> PRT <213> Unknown <220> <223> Platichthys stellatus <400> 1 Tyr Leu Pro Lys Val Leu His Gln Thr Pro Gly His Leu Lys Pro 1 5 10 15 <210> 2 <211> 15 <212> PRT <213> Unknown <220> <223> Platichthys stellatus <400> 2 Phe Thr Lys Ile Tyr Gly Ser Arg Leu Gln Lys Val Leu Gly Asn 1 5 10 15 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ctgcacctgg ctcctaactc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tcccaaaacc ttctgcagtc 20 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gtggcaagtc caccacca 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gcttgtccag cacccagg 18

Claims (10)

Consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, an antibacterial peptide derived from Platichthys stellatus. A polynucleotide encoding the antimicrobial peptide of claim 1. A recombinant vector comprising the polynucleotide of claim 2. A host cell transformed with the recombinant vector of claim 3. A method for producing an antibacterial peptide comprising the step of transforming a host cell with the recombinant vector of claim 3 to overexpress a polynucleotide encoding the antibacterial peptide. An antibacterial peptide produced by the method of claim 5 . An antibacterial composition comprising the antimicrobial peptide of claim 1 or 6 as an active ingredient. The antibacterial composition according to claim 7, wherein the composition has antibacterial activity against gram-positive and gram-negative pathogens. According to claim 8, wherein the gram-positive pathogen is Streptococcus iniae or Streptococcus parauberis ( S. parauberis ), and the gram-negative pathogen is Vibrio alginolyticus , Vibrio anguillarum ( V. anguillarum ), Vibrio campbellii ( V. campbellii ), Vibrio harveyi ( Vibrio harveyi ) or Vibrio ordalii ( Vibrio ordalii ) Antibacterial composition, characterized in that. A feed additive for fish containing the antibacterial peptide of claim 1 or 6 as an active ingredient.

Images