KR20210156259A - Biomarker composition for diagnosing resistant cancer comprising ACLY and use thereof - Google Patents

Abstract

According to a composition, a kit and a method for diagnosing cancer resistant to a cancer therapeutic agent, the cancer resistant to the cancer therapeutic agent is efficiently diagnosed to maximize a therapeutic effect using the cancer therapeutic agent, and a candidate material capable of treating the cancer resistant to the cancer therapeutic agent can be efficiently selected.

Description

Biomarker composition for diagnosing resistant cancer comprising ACLY and use thereof

It relates to compositions, kits and methods for diagnosing cancer resistant to cancer therapeutic agents.

The cancer treatment paradigm has been changed in a 10-year cycle. In the 1990s, chemotherapy, such as paclitaxel, was the main treatment. In addition, as traditional immunotherapy, cytokine therapy, cancer vaccine therapy, and adaptive cell therapy have been used. The first attempted cytokine treatment was IFN-α, which is currently being used in some patients with leukemia, malignant melanoma, and Kaposi's sarcoma. The second tried IL-2 is being used in malignant melanoma or kidney cancer. In addition, TNF-α, GM-CSF, etc., showed anticancer effects, and were suggested as cytokine therapy. However, the problem is that such cytokine treatment is tumor-limited in its effect and shows severe toxicity in a significant number of patients.

Since then, with the development of genetic techniques and increased interest in cancer cells themselves, targeted anticancer drugs that target specific genes of cancer cells have emerged. Targeted anticancer drugs that appeared one after another, starting with rituximab in 1997 and imatinib in 2001, were used in full-scale for chemotherapy. However, as it became known that several targeted anticancer drugs also developed resistance, a new cancer treatment paradigm was required.

Biomarkers are generally indicators that can detect changes in the body using proteins, DNA, RNA, or metabolites. That is, in the case of a specific disease or cancer, it refers to a marker that can distinguish between normal and pathological conditions, predict treatment response, and objectively measure. Biomarkers should serve to objectively measure and evaluate normal biological processes, disease progression, and drug responsiveness to treatment methods. This is a target marker that confirms the existence of a drug target according to the application, a diagnostic marker that diagnoses the presence or absence of a disease, a predictive marker that can distinguish a responder from a non-responder to a specific drug, and a surrogate that can monitor the effect of a drug treatment There are marker markers and prognostic biomarkers that indicate the prognosis of a disease.

Developing predictive markers is quite difficult because cancer cells are constantly changing and the immune system is also diverse. However, in the case of patients whose drug response was not predicted in advance, a biomarker is urgently needed because meaningless drug administration is expected.

One aspect is PREX1 (Phosphatidylinositol 3,4,5-trisphosphate-dependent Rac exchanger 1), SNORA14B (small nucleolar RNA, H / ACA box 14B), GREB1 (growth regulating estrogen receptor binding 1), ACLY (ATP citrate lyase), PRB4 (proline rich protein BstNI subfamily 4) and SMPD1 (Sphingomyelin phosphodiesterase 1) comprising an agent for measuring the expression level or mutation of one or more selected from the group consisting of a composition for predicting resistance to a cancer therapeutic agent will provide

Another aspect is PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1 comprising an agent for measuring the expression level or mutation of one or more selected from the group consisting of, providing a kit for predicting resistance to cancer therapeutics in an individual will be.

Another aspect comprises the steps of measuring the expression level or mutation of one or more selected from the group consisting of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1 from a sample isolated from an individual; And it is to provide an information providing method for predicting resistance to cancer treatment of an individual comprising the step of comparing whether the expression level or mutation of the measured gene with the expression level or mutation of a normal control sample.

Another aspect includes the steps of measuring the expression level or mutation of one or more selected from the group consisting of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1 from a sample of an individual administered with a candidate substance for treatment of cancer drug-resistant cancer; and comparing the measured expression level or mutation with the expression level or mutation of a normal control sample.

One aspect is PREX1 (Phosphatidylinositol 3,4,5-trisphosphate-dependent Rac exchanger 1), SNORA14B (small nucleolar RNA, H / ACA box 14B), GREB1 (growth regulating estrogen receptor binding 1), ACLY (ATP citrate lyase), PRB4 (proline rich protein BstNI subfamily 4) and SMPD1 (Sphingomyelin phosphodiesterase 1) comprising an agent for measuring the expression level or mutation of one or more selected from the group consisting of a composition for predicting resistance to a cancer therapeutic agent to provide.

As used herein, the term "PREX1 (Phosphatidylinositol 3,4,5-trisphosphate-dependent Rac exchanger 1)" is a protein that acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It is known to bind and activate RAC1 by exchanging bound GDP for free GTP. It is mainly found in the cytoplasm and is known to be activated by phosphatidylinositol-3,4,5-triphosphate and beta-gamma subunits of heterotrimeric G protein. The PREX1 may be PREX1 derived from various animals capable of generating tumor tissues, particularly PREX1 derived from humans, and its sequence information can be found in NCBI GeneBank, a known database. For example, it can be translated into a protein expressed from mRNA comprising NM_020820.4 or NM_177782.3, a peptide or protein comprising the amino acid sequence of NP_065871.3 or NP_808450.2. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having biologically equivalent activity may be regarded as PREX1 mRNA or PREX1 protein.

As used herein, the term "SNORA14B (small nucleolar RNA, H/ACA box 14B)" is a non-coding RNA with a length of 60-150 nt, and includes two groups: C / D box snoRNA and H / ACA box snoRNA. C/D box snoRNA is a guide for 2'-O-ribose methylation of rRNA or snRNA. The H/ACA box snoRNA is a guide for the isomerization of uridine residues to pseudouridine. This gene belongs to the group of H/ACA box snoRNAs and is known to function in 18S rRNA pseudouridylation at position U966. The SNORA14B may be SNORA14B derived from various animals capable of generating tumor tissues, particularly SNORA14B derived from humans, and the sequence information thereof can be found in the known database, NCBI GeneBank. For example, it can be translated into a protein expressed from an mRNA comprising NR_002956.1. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having a biologically equivalent activity may be regarded as SNORA14B mRNA or SNORA14B protein.

As used herein, the term "growth regulating estrogen receptor binding 1 (GREB1)" is an estrogen-responsive gene that is an early response gene in the estrogen receptor regulatory pathway. It is known to play an important role in hormone-responsive tissues and cancer. The GREB1 may be GREB1 derived from various animals capable of generating tumor tissues, particularly GREB1 derived from humans, and its sequence information can be found in NCBI GeneBank, a known database. For example, a protein expressed from an mRNA comprising NM_014668.4, NM_001252071.1, NM_033090.3, NM_015764.4 or NM_148903.3, NP_055483.2, NP_001239000.1, NP_149081.1, NP_056579.2 or NP_683701. It can be translated into a peptide or protein comprising the amino acid sequence of 2. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having biologically equivalent activity may be regarded as GREB1 mRNA or GREB1 protein.

As used herein, the term "ACLY (ATP citrate lyase)" is an enzyme representing an important step in the biosynthesis of fatty acids in animals. ACLY is known to link the metabolism of carbohydrates to produce citrate as an intermediate and the production of fatty acids requiring acetyl-CoA by converting citrate to acetyl-CoA. In plants, ACLY is known to generate cytoplasmic acetyl-CoA precursors of thousands of specialized metabolites, including waxes, sterols and polyketides. The ACLY may be ACLY derived from various animals capable of generating tumor tissues, particularly ACLY derived from humans, and its sequence information can be found in NCBI GeneBank, a known database. For example, a protein expressed from an mRNA comprising NM_001096.3, NM_001303274.1, NM_001303275.1 or NM_198830.1, a peptide comprising the amino acid sequence of NP_001087.2, NP_001290203.1, NP_001290204.1 or NP_942127.1 Or it can be translated into a protein. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having a biologically equivalent activity may be regarded as an ACLY mRNA or ACLY protein. The ACLY may be a gene comprising the sequence of SEQ ID NO: 1. In addition, mutations may occur in the ACLY protein encoded by the SEQ ID NO: ACLY gene and the polynucleotide represented by SEQ ID NO: 1.

As used herein, the term "PRB4 (proline rich protein BstNI subfamily 4)" encodes a member of a heterologous family of basic and proline-rich human salivary glycoproteins. It is known that the encoded preproprotein undergoes proteolytic processing to produce one or more mature peptides before secretion from the parotid gland. The PRB4 may be PRB4 derived from various animals capable of generating tumor tissues, particularly PRB4 derived from humans, and its sequence information can be found in NCBI GeneBank, a known database. For example, it can be translated into a protein expressed from an mRNA comprising NM_001261399.2 or NM_002723.6, a peptide or protein comprising the amino acid sequence of NP_001248328.1 or NP_002714.2. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having a biologically equivalent activity may be regarded as a PRB4 mRNA or a PRB4 protein. The PRB4 may be a gene comprising the sequence of SEQ ID NO: 2. In addition, mutations may occur in the PRB4 protein encoded by the SEQ ID NO: PRB4 gene and the polynucleotide represented by SEQ ID NO: 2.

As used herein, the term “Sphingomyelin phosphodiesterase 1 (SMPD1)” is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide and has phospholipase C activity. Defects in this gene are known to cause Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). The SMPD1 may be SMPD1 derived from various animals capable of generating tumor tissues, particularly SMPD1 derived from humans, and its sequence information can be found in NCBI GeneBank, a known database. For example, a protein expressed from an mRNA comprising NM_000543.5, NM_001007593.3, NM_001318087.2, NM_001318088.2 or NM_001365135.2, NP_000534.3, NP_001007594.2, NP_001305016.1, NP_001305017.1 or NP_001352064. It can be translated into a peptide or protein comprising the amino acid sequence of 1. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having a biologically equivalent activity may be regarded as an mRNA of SMPD1 or a SMPD1 protein. The SMPD1 may be a gene comprising the sequence of SEQ ID NO: 3. In addition, mutations may occur in the SMPD1 gene encoded by the SEQ ID NO: SMPD1 gene and the polynucleotide represented by SEQ ID NO: 3.

As used herein, the term “resistance to a cancer treatment agent” means that when a cancer patient is treated using a cancer treatment agent, there is no treatment effect from the initial stage of treatment, or there is a cancer treatment effect at the initial stage, but the cancer treatment effect is lost during the continuous treatment process do. The determination of the general therapeutic effect in anticancer drug treatment can be determined based on the response evaluation criteria in the solid tumor group (RECIST v1.1: New response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1)) (EUROPEAN JOURNAL OF CANCER 45) , (2009) 228-247). According to the above criteria, the effect of cancer treatment is a complete response (CR), partial response (PR), progressive disease (PD) or stable disease (SD) group from a change in the size of the tumor. can be classified. For example, when a target lesion (TL) is determined according to RECIST v1.1, the complete response group (CR) has all target lesions disappear, and pathological lymph nodes are reduced in all target and non-target lesions. It may mean a group with a short axis <10 mm. The partial response group (PR) may refer to a group in which the sum of diameters of target lesions is reduced by at least 30% based on the total diameter of the baseline. In the advanced group (PD), the sum of the diameters of the target lesions was increased by at least 20% based on the smallest sum according to the study, and the sum of the diameters of the target lesion was increased by 20% relatively, but also absolutely at least 5 mm may mean an increased group. The stable group (SD) may refer to a group that does not decrease sufficiently to be classified as a partial response group and does not increase sufficiently to be classified as an advanced group, based on the smallest diameter according to the study.

As used herein, the term "measurement of the expression level" refers to the gene itself of PREX1, SNORA14B, GREB1, ACLY, PRB4, SMPD1 or a combination thereof, or the level at which the gene is expressed, that is, the expression level of a protein encoded by the gene. can be found by checking In addition, the term "measurement of whether a mutation is present" can be determined by determining whether the gene itself of PREX1, SNORA14B, GREB1, ACLY, PRB4, SMPD1, or a combination thereof is mutated.

The preparations include primers, probes, nucleotides, antibodies or antigen-binding fragments thereof, ligands, receptors, proteins or combinations thereof that specifically bind to mRNA or protein of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1 genes. can

As used herein, the term "primer" is a nucleic acid sequence having a free 3-terminal hydroxyl group (free 3' hydroxyl group), which can form a base pair with a template complementary to a specific nucleotide sequence, and form a template strand copy. It refers to a nucleic acid sequence that serves as a starting point for The primer is capable of initiating DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. For example, PCR amplification is performed using sense and antisense primers having a 7 to 50 nucleotide sequence as a primer specific for the mRNA of PREX1, SNORA14B, GREB1, ACLY, PRB4 or SMPD1 gene to measure the amount of production of the desired product. Through this, it is possible to predict the resistance of an individual to a cancer treatment. PCR conditions and lengths of sense and antisense primers may be appropriately selected according to techniques known in the art. The primers are 10 to 100, 15 to 100, 10 to 80, 10 to 50, 10 to 30, 10 to 20, 15 to 80, 15 to 50, 15 to 30, 15 to 20, 20 to 100, 20 to 80 , 20 to 50, or 20 to 30 nt.

As used herein, the term "probe" refers to a nucleic acid fragment such as RNA or DNA that can specifically bind to a target nucleic acid, for example, mRNA, and can determine the presence, absence, content and expression level of a specific mRNA. It may be labeled so as to The probe may be manufactured in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, or the like. For example, hybridization is performed using a probe having a nucleic acid sequence complementary to the mRNA of PREX1, SNORA14B, GREB1, ACLY, PRB4, or SMPD1 gene, and the expression level of mRNA is measured through the degree of hybridization. resistance can be predicted. Suitable probe selection and hybridization conditions can be appropriately selected according to techniques known in the art. The probe is 10 to 100, 15 to 100, 10 to 80, 10 to 50, 10 to 30, 10 to 20, 15 to 80, 15 to 50, 15 to 30, 15 to 20, 20 to 100, 20 to 80 , 20 to 50, or 20 to 30 nt.

In addition, the primer or probe may be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods. In addition, these nucleic acid sequences can be modified through various methods known in the art. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, or modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates. etc.) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.). Primers or probes may also be modified with labels capable of directly or indirectly providing a detectable signal. Examples of such labels may include radioactive isotopes, fluorescent molecules, or biotin.

As used herein, the term “antibody” is a term known in the art and refers to a specific immunoglobulin directed against an antigenic site. The antibody may specifically bind to a PREX1, SNORA14B, GREB1, ACLY, PRB4 or SMPD1 protein or fragment thereof. The protein fragment of PREX1, SNORA14B, GREB1, ACLY, PRB4 or SMPD1 may be, for example, an immunogenic fragment. The fragment refers to a protein fragment having at least one epitope that can be recognized by an antibody against PREX1, SNORA14B, GREB1, ACLY, PRB4 or SMPD1 protein. The PREX1, SNORA14B, GREB1, ACLY, PRB4 or SMPD1 gene is cloned into an expression vector, the PREX1, SNORA14B, GREB1, ACLY, PRB4 or SMPD1 protein encoded by the gene is obtained, and from the obtained protein, conventional methods in the art Antibodies can be prepared according to the method.

The form of the antibody includes a polyclonal antibody, a monoclonal antibody, or a recombinant antibody, and all immunoglobulin antibodies are included. The antibody refers to a complete form having two full-length light chains and two full-length heavy chains. Moreover, the said antibody also includes special antibodies, such as a humanized antibody. Polyclonal antibodies can be prepared by injecting an immunogen biomarker protein or a fragment thereof into an external host according to a conventional method known to those skilled in the art. As the external host, mammals such as mice, rats, sheep, and rabbits can be used. When the immunogen is injected by an intramuscular, intraperitoneal or subcutaneous injection method, it may be administered together with an adjuvant to increase antigenicity in general. Thereafter, blood may be periodically collected from an external host to collect serum showing improved titer and antigen specificity, or antibodies may be isolated and purified therefrom.

Monoclonal antibodies can be prepared by techniques for generating immortalized cell lines by fusion known to those skilled in the art. Briefly describing the monoclonal antibody production method, the protein is purified and an appropriate amount of about 10 μg is immunized to Balb/C mice, or a polypeptide fragment of the protein is synthesized and combined with bovine serum albumin to immunize mice. Then, antigen-producing lymphocytes isolated from mice are fused with human or mouse myeloma to generate immortalized hybridomas, and ELISA is used to select and proliferate only hybridoma cells producing the desired monoclonal antibody. After this, monoclonal antibodies can be isolated and purified from the culture. In addition, monoclonal antibodies can be used by obtaining commercially available antibodies against PREX1, SNORA14B, GREB1, ACLY, PRB4 or SMPD1 proteins.

Enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), sandwich assay, Western blotting or immunoblotting on polyacrylic gels known in the art using these antibodies It can be confirmed whether the protein is expressed in the biological sample by such a method.

As used herein, the term “fragment” refers to, for example, a polypeptide that does not have the structure of an intact antibody, peptide or protein, but has a specific antigen-binding site or binding domain directed to the antigenic site. Such fragments include functional fragments of antibody molecules that are not intact antibodies having two light chains and two heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and may be Fab, F(ab'), F(ab') ₂ or Fv. The binding fragment may comprise at least 7 or more amino acids, for example, 9 or more amino acids, 12 or more amino acids.

In one embodiment, the mutation is a single nucleotide variation (Single nucleotide variation, SNV), frame shift variation, insertion / deletion variation (Indel), copy number variation (CNV), deletion (deletion) ) and inversion may be one or more mutations selected from the group consisting of.

As used herein, the term "single nucleotide variation (Single Nucleotide Variation, SNV)" refers to the difference between single nucleotides in which single nucleotide sequence polymorphism (Single Nucleotide Polymorphism) appears in multiple populations within one species. It means the difference of single nucleotides appearing in the population of

As used herein, the term "insertion/deletion mutation (Indel)" refers to an insertion or deletion mutation capable of changing the number of nucleic acids of a gene.

As used herein, the term “copy number variation (CNV)” refers to a state in which the copy number of a gene is increased or decreased.

Mutations in the gene may include any one or more mutations, for example, truncating mutations, missense mutations (or missense mutations), nonsense mutations, as well as the mutations described above. , frame shift mutations, in-frame mutations (or in-frame mutations), splice mutations, and splice_region mutations may have at least one mutation selected from the group consisting of mutations. The frame shift mutation may be at least one of a frame shift insert (FS ins) mutation and a frame shift delete mutation (FS del). The in-frame mutation may be at least one of an in-frame insertion (IF ins) mutation and an in-frame delete (IF del) mutation.

In one embodiment, the cancer therapeutic agent may be a CDK4/6 inhibitor, fulvestrant, or a combination thereof.

As used herein, the term "CDK4/6 inhibitor" is a substance that inhibits the functions of CDK (cyclin-dependent kinase)4 and CDK6, and can be used to treat cancer by preventing excessive proliferation of cancer cells.

As used herein, the term “hormonal agent” is a substance containing hormones, and may be used to treat cancer. Hormones may be administered alone or in combination, and when administered in combination, may have a synergistic therapeutic effect on cancer.

The CDK4/6 inhibitor may be any one selected from the group consisting of palbociclib, ribociclib, and abemaciclib.

The hormonal agent may be fulvestrant.

The cancer may be any one selected from the group consisting of ovarian cancer, liver cancer, colorectal cancer, cervical cancer, kidney cancer, stomach cancer, prostate cancer, breast cancer, brain tumor, lung cancer, uterine cancer, colon cancer, bladder cancer, and pancreatic cancer.

According to one embodiment, decreased expression of PREX1, SNORA14B or GREB1 and mutagenesis of ACLY, PRB4 or SMPD1 in tumor cells or tissues were found to be associated with resistance to a breast cancer treatment agent. ACLY is a frameshift deletion mutation after the 589th alanine of the amino acid sequence of ACLY encoded by the polynucleotide represented by SEQ ID NO: 1, and PRB4 is the amino acid sequence of PRB4 encoded by the polynucleotide represented by SEQ ID NO: 2 A mutation in which alanine at position 209 is substituted with proline has occurred, and SMPD1 is a mutation in which glycine at position 508 of the amino acid sequence of SMPD1 encoded by the polynucleotide represented by SEQ ID NO: 3 is substituted with arginine. Therefore, the expression level or mutation of PREX1, SNORA14B, GREB1, ACLY, PRB4, or SMPD1 can be used to diagnose resistance to a treatment for breast cancer.

Another aspect provides a kit for predicting resistance to a cancer treatment in an individual, comprising an agent for measuring the expression level or mutation of one or more selected from the group consisting of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1. .

Among the terms or elements mentioned in the kit, those mentioned in the description of the composition are understood as being referred to in the description of the composition above.

The kit has an effect of diagnosing resistance to cancer therapeutics by measuring the expression level or mutation of one or more selected from the group consisting of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1. The kit may further include antisense oligonucleotides, primer pairs, probes, etc., as well as one or more other component compositions, solutions, or devices suitable for the assay method for diagnosing resistance to cancer therapeutic agents, RT- PCR kits, microarray chip kits, and DNA chip kits may be included.

The kit for measuring the expression level or mutation of one or more selected from the group consisting of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1 may be a kit including elements necessary for performing RT-PCR. In addition to each primer pair specific for a marker gene, the RT-PCR kit includes a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC -Water (DEPC-water), sterile water, etc. may be included.

In addition, the kit for measuring the expression level or mutation of one or more selected from the group consisting of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1 may be a kit including essential elements necessary for performing a microarray. The microarray kit includes a substrate to which cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate may include a cDNA corresponding to a quantitative control gene or a fragment thereof. It can be easily manufactured by the manufacturing method used as In order to fabricate a microarray, a micropipetting method using a piezoelectric method or a pin type to immobilize the detected marker on a substrate of a DNA chip using the probe DNA molecule A method using a spotter or the like can be used. The substrate of the microarray chip may be coated with an active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane.

In addition, the kit for measuring the expression level or mutation of one or more selected from the group consisting of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1 may be a kit including essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA or oligonucleotide corresponding to a gene or fragment thereof is attached, and reagents, agents, enzymes, etc. for preparing a fluorescently labeled probe. In addition, the substrate may include cDNA or oligonucleotide corresponding to a control gene or fragment thereof.

Another aspect comprises the steps of measuring the expression level or mutation of one or more selected from the group consisting of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1 from a sample isolated from an individual; And it provides an information providing method for predicting resistance to cancer treatment of an individual comprising the step of comparing whether the expression level or mutation of the measured gene with the expression level or mutation of a normal control sample.

Among the terms or elements mentioned in the information providing method for predicting the resistance, those mentioned in the description of the composition or kit are understood to be as mentioned in the description of the composition or kit above.

As used herein, the term “individual” refers to an individual who wants to confirm or predict whether resistance to a cancer treatment agent exists. The subject may be a vertebrate, specifically mammals, amphibians, reptiles, birds, etc., and more specifically mammals, for example, humans (Homo sapiens).

As used herein, the term "sample" may include whole blood, serum, plasma, saliva, urine, sputum, lymph, cells, tissues, etc. isolated from an individual, for example, it may be a tumor cell or tumor tissue.

The "method for measuring expression level or mutation" may be one or more selected from the group consisting of reverse transcription polymerase reaction, competitive reverse transcription polymerase reaction, real-time reverse transcription polymerase reaction, RNase protection assay, Northern blotting, DNA chip. .

The method may include determining that the subject is resistant to a cancer therapeutic agent when the expression level or mutation is changed compared to the expression level or mutation of the control group.

In the method, when the expression level of PREX1, SNORA14B or GREB1 measured from the subject's sample is reduced compared to the normal control, and ACLY, PRB4 or SMPD1 measured from the subject's sample is mutated compared to the normal control, cancer It can be judged to have resistance to the therapeutic agent. The change in the expression level of the subject is a similar level or 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% compared to the normal control or positive control. , 60%, 70%, 80%, 90%, and 100% or more increasing or decreasing.

In the method, the step of measuring the expression level is RT-PCR, competitive RT-PCR (competitive RT-PCR), real-time RT-PCR (RT-PCR), RNase protection assay (RPA) , Northern blotting, nucleic acid microarray including DNA, Western blotting, ELISA (enzyme linked immunosorbent assay), Radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony ) Immune diffusion method, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, mass spectrometry, magnetic bead-antibody immunoprecipitation method, protein chip chip), or a combination thereof.

Another aspect includes the steps of measuring the expression level or mutation of one or more selected from the group consisting of PREX1, SNORA14B, GREB1, ACLY, PRB4 and SMPD1 from a sample of an individual administered with a candidate substance for treatment of cancer drug-resistant cancer; and comparing the measured expression level or mutation with the expression level or mutation of a normal control sample.

It is understood that any of the terms or elements mentioned in the method for screening, as mentioned in the description of the composition, kit or method, are as referred to in the description of the composition, kit or method above.

As used herein, the term “candidate substance” refers to a newly synthesized or known compound, and may include, without limitation, substances expected to have an effect in the treatment of cancer drug-resistant cancer.

"Administration" of the candidate drug means introducing a predetermined substance into a subject by an appropriate method. The administration route of the candidate substance may be administered through any general route as long as it can reach the target tissue. It can be administered by intraperitoneal administration, intravenous administration, administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, rectal administration, and the like.

In the method, when the expression level of PREX1, SNORA14B or GREB1 measured from the subject's sample is reduced compared to the normal control, and ACLY, PRB4 or SMPD1 measured from the subject's sample is mutated compared to the normal control, a candidate The substance can be judged as a cancer treatment-resistant cancer treatment. The change in the expression level of the subject is a similar level or 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% compared to the normal control or positive control. , 60%, 70%, 80%, 90%, and 100% or more increasing or decreasing.

Compositions, kits and methods for predicting resistance to cancer therapeutics according to an aspect are capable of efficiently diagnosing resistant cancer to cancer therapeutics, maximizing the therapeutic effect using cancer therapeutics, and treating cancer resistant to cancer therapeutics Candidate substances can be efficiently selected.

1 is a view showing an overall experimental method for selecting a gene that can be used for diagnosing resistance to a cancer treatment agent.
FIG. 2 is a view showing the process of selecting PREX1, SNORA14B, and GREB1, which are DEGs that can be used for diagnosing resistance to cancer treatment by selecting differentially expressed genes (DEG).
3 is a diagram illustrating a process of selecting ACLY, PRB4, and SMPD1 that can be used for diagnosing resistance to cancer therapeutics by performing whole exome sequencing (WES).

Hereinafter, it will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Confirmation of association between fulvestrant or palbociclib resistance and expression of PREX1, SNORA14B and GREB1, ACLY, PRB4 and mutagenesis of SMPD1

To determine the association between fulvestrant or palbociclib resistance and the expression of PREX1, SNORA14B and GREB1, and mutagenesis of ACLY, PRB4 and SMPD1, xenotransplantation of the CDK4/6 inhibitor palbociclib-sensitive breast cancer cell line MCF7 (PDTX: Patient-Derived Tumor Xenograft) To construct the drug-resistant animal model by administering alone or co-administering palbociclib or fulvestrant, a breast cancer anticancer agent and CDK4/6 inhibitor, to an animal model, and from this, a resistant tumor tissue was obtained, and microarray and whole exome sequencing (WES) were performed. The overall experimental process is shown in FIGS. 1, 2 and 3 .

Specifically, the hormone receptor-positive breast cancer cell line MCF7 showing sensitivity to palbociclib was subcutaneously transplanted into 12 athymic nude mice. Of these, three animals were in the control group not administered with the drug, the other three animals were in the experimental group administered with fulvestrant, another 3 animals were administered falbociclib in the experimental group, and the other three animals were fulvestrant and falbociclib. It was set as the experimental group administered by using the clip together. When the tumor size reached about 100 mm ³ in the animal model, oral administration of each of the drugs was started. Fulvestrant was administered at 250 mg/kg, once a day, 5 days a week, and palbociclib was administered at 100 mg/kg, once a day, daily, and administered for 9 to 12 months. When administered in combination, the dose and schedule of each of the two drugs were the same as when administered alone. Thereafter, the tumor size was measured three times a week. If the tumor size increased again from the maximum decrease and increased by 25% or more, it was judged to be acquired resistance (Nat Genet. 2012 Jul 1:44(8):852-60). Each of fulvestrant, falbociclib, and fulvestrant and falbociclib were obtained by using a combination of administration to obtain tissues confirmed to be resistant. Using the tissue, mRNA microarray and whole exome sequencing were performed. In the case of mRNA microarray, the probe sequences used are shown in Table 1 below.

gene name gene probe sequence SEQ ID NO: PREX1 ACTTAGAACGAAGCTACCAAGAGGGCTTAGAACGAAGCTACCAAGAGGGT
AGCACTTAGAACGAAGCTACCAAGA
TTGGAAGCACTTAGAACGAAGCTAC
TGGAAGCACTTAGAACGAAGCTACC
CACTTAGAACGAAGCTACCAAGAGG
CTTGGAAGCACTTAGAACGAAGCTA
GAAGCACTTAGAACGAAGCTACCAA
GCACTTAGAACGAAGCTACCAAGAG
AAGCACTTAGAACGAAGCTACCAAG
ATCTTGGAAGCACTTAGAACGAAGC
TCTTGGAAGCACTTAGAACGAAGCT
GGAAGCACTTAGAACGAAGCTACCA 4 SNORA14B ACTTAGAACGAAGCTACCAAGAGGGCTTAGAACGAAGCTACCAAGAGGGT
AGCACTTAGAACGAAGCTACCAAGA
TTGGAAGCACTTAGAACGAAGCTAC
TGGAAGCACTTAGAACGAAGCTACC
CACTTAGAACGAAGCTACCAAGAGG
CTTGGAAGCACTTAGAACGAAGCTA
GAAGCACTTAGAACGAAGCTACCAA
GCACTTAGAACGAAGCTACCAAGAG
AAGCACTTAGAACGAAGCTACCAAG
ATCTTGGAAGCACTTAGAACGAAGC
TCTTGGAAGCACTTAGAACGAAGCT
GGAAGCACTTAGAACGAAGCTACCA 5 GREB1 TTGAGACTGTCCAAAGAGTGGCACAAAGAACCTCTTGTCAACGGCGCACA
GATTCGGTGCAAAAGCCTGGCTCCA
GACCAACAGCCGGAACATCTCGGAG
GAATTCCGTGAAGTAACAGAAGCCT
CCAGGGATGCTGCTTTAGTGACAGA
CATTTATTGAGACTTGGCCAAGGTC
GAAAGGTGACTGAAGCTGGTCCCAC
TGAGAAGGCTCTCGGAAAGAATCCG
TGACTCTCATGGAAGCCACATCAGA
TTAGACTGTTTCACTAGGAGCTGCC
ACGTCCGGATTTCGTATTTGATGTG
TGTCGTACACGAGCTTGGGCAAGAA
TCTGTGAGCCGAACAAGCATCCTGG
GATAGTGCGAACAAATCAGGCTGGC
GATTAAAGAGCCCATGTTCGTGACG
TGCTGAGCTCCCATCAGGATGCTGG
GAATCTTTGCCGTTGAAAACAGCCG
TGCAGTTGAGCAATCGGTCCACCAA
GATTCAATAAACTCCGACAGCCCGA
GATTAGCCAGCCAGAGCATGTCCAA
TCTGCCGGACCAAGGGCTACCATTT
GGTGAAGCTATCAAATCCTCTCGGG
GTCTTGTGCACAGCTTACGGTCCCA
TGGGAGCGGGACCTCTCCCTTTTCA
CAGAACTTTCCATAGGGCTCCAGGT
CACAAGATCCCAGTGCGCATGGTCA
CGACCGCGGCAGAGTTATCAGACAC
CACTGAACAGCAAGTCCGAGCAGCT
TCACGCAGGAGTCATCAGAGATCAC
TCAGAGGAATCCTGATGGCCTCCCA
GAAGATCAGGATGCAAGGCAGACCC
GGAGTTTATCAATCGCAGGTCACAG
TGTCGTCCCGTCAGAAAAAAGAGCG
CAGATTTTGGGTGCTGGAATCCGCA
CACCCGCAGGTTGAAGTCTACATCG
TACAAAAAGCTGGTCACTTCAGGCA
TAAGAATGCATTCTGAGGCCAGGCG 6

Specifically, for quality control, RNA purity was evaluated at an absorbance ratio of 260/280, and analyzed with an Agilent 2100 Bioanalyzer. The Affymetrix Whjole transcript expression array process was analyzed using the protocol of the GeneChip Whole Transcript PLUS reagent Kit. cDNA was synthesized using the GeneChip WT (whole transcript) Amplification kit, and the synthesized cDNA was labeled with biotin-labeled TdT (terminal deoxynucleotidyl transferase) on the fragmented DNA using the GeneChip WT terminal labeling kit. Approximately 5.5 μg of the labeled DNA target was hybridized to Affymetrix GeneChip Human or Mouse 2.0 ST Array at 45°C for 16 hours. The hybrid array was washed and stained with GeneChip Fluidics Station 450, and then imaged with a GCS3000 scanner (Affiymetrix). Signal values were analyzed by computer using Affymetrix® GeneChip™ Command Console software.

After analyzing the microarray results, we found differentially expressed genes (DEGs) whose expression differed by more than three times when compared between groups. In the resistant tissue of the group administered alone, the common DEGs PREX1, SNORA14B and GREB1 were selected as resistance genes compared to the control tissue. The fold change of each resistance gene expression is shown in Table 2.

gene Fold Change PREX1 -4.6 SNORA14B -3.1 GREB1 -3.6

The mutated gene was screened by performing whole exome sequencing in the resistant tissues of the control group, the group administered with fulvestrant alone, and the group administered with fulvestrant and palbociclib in combination.

Specifically, for the generation of standard exome capture libraries, the Agilent SureSelect Target Enrichment method for Illumina paired-end sequencing libraries (version C2, December 2018) with 1 ug input gDNA was used. In all cases, the SureSelect Human All Exon V6 probe set was used. DNA quantification and DNA quality were measured with PicoGreen and Nanodrop. 1ug fragmentation of genomic DNA was performed using adaptive focused acoustic technology (AFA; Covaris). The fragmented DNA is repaired and an 'A' is attached to the 3' end, where an Agilent adapter is attached to the fragment. Once binding was assessed, the product bound to the adapter was amplified by PCR. At this time, the final purified product was quantified and quality verified using TapeStation DNA screentape (Agilent). For exome capture, according to the standard Agilent SureSelect Target Enrichment method, 250 ng of DNA library was mixed with hybridization buffer, blocking mixture, RNase blocker and 5 ul of SureSelect all exome capture library. Mixing for Capture baits was performed at 65 °C using the thermal cycler lid option heated at 105 °C for 24 h in a PCR machine. At this time, the captured DNA was amplified, and the final purified product was quantified using qPCR according to the qPCR Qnantification Protocel Guide, and quality was confirmed using a TapeStation DNA screentape (Agilent). And at this time, sequencing was performed using the NovaSeq platform (Illumina, San Diego, USA).

Genes related to resistance were first selected in all groups, and then overlapping genes were excluded from all groups. Then, as shown in Table 3, a mutant gene that disappears after fulvestrant or falbociclib administration, a mutant gene induced after fulvestrant single administration, and a mutant gene induced after fulvestrant and falbociclib combination administration was selected, and the ACLY, PRB4 and SMPD1 genes were finally selected as genes related to cancer progression and drug resistance through existing literature. Here, ACLY has a frameshift deletion mutation after alanine at position 589 of the ACLY amino acid sequence, PRB4 has a mutation in which alanine at position 209 of the PRB4 amino acid sequence is substituted with proline, and SMPD1 has glycine at position 508 of the SMPD1 amino acid sequence Mutations were substituted for arginine.

Mutant gene disappearing after administration of fulvestrant or palbociclib Mutation gene induced after fulvestrant alone administration Mutation gene induced after co-administration of fulvestrant and palbociclib AES CCDC40 ACLY BLZF1 HSPB11 DDX60L C20orf27 MTCH2 LRCH2 CD24 MYPOP OTOA CDC5L POTEH PRB4 CNTN5 RAPGEF2 RNF10 CNTNAP3B ROBO2 SMPD1 CUX2 SLC3A2 ZDHHC8 LINC01193 TPSB2 RSPO2 TRIM64B SPATA5L1 ZNF503 TIMEM217

From the above results, the expression levels of PREX1, SNORA14B and GREB1 in the drug-resistant tissue were significantly different from the normal control tissue and the positive control tissue administered with fulvestrant or palbociclib, ACLY, PRB4 and SMPD1 It can be confirmed that this mutation occurs. That is, by measuring the expression level of PREX1, SNORA14B and GREB1 or the formation of mutations in ACLY, PRB4 and SMPD1, resistance to the drug can be efficiently diagnosed to maximize the therapeutic effect using the drug, and resistance to the drug It was confirmed that candidate substances capable of treating cancer can be efficiently selected.

<110> SUNGKWANG MEDICAL FOUNDATION <120> Biomarker composition for diagnosing resistant cancer comprising ACLY and use thereof <130> PN142642KR <150> KR 10-2019-0156126 <151> 2019-11-28 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 325 <212> DNA <213> Homo sapiens <400> 1 acttagaacg aagctaccaa gagggcttag aacgaagcta ccaagagggt agcacttaga 60 acgaagctac caagattgga agcacttaga acgaagctac tggaagcact tagaacgaag 120 ctacccactt agaacgaagc taccaagagg cttggaagca cttagaacga agctagaagc 180 acttagaacg aagctaccaa gcacttagaa cgaagctacc aagagaagca cttagaacga 240 agctaccaag atcttggaag cacttagaac gaagctcttg gaagcactta gaacgaagct 300 ggaagcactt agaacgaagc tacca 325 <210> 2 <211> 891 <212> DNA <213> Homo sapiens <400> 2 tgcagagttg ggagtgactc cagagcctcc agcgagatgc tgttgattct gctgtcagtg 60 gccctgctgg ccctgagctc agctgagagt tcaagtgaag atgtcagcca ggaagaatct 120 ctcttcctaa tatcaggaaa gccagaagga cgacgcccac aaggaggaaa ccagccccaa 180 cgtccccccac ctcctccagg aaagccacaa ggaccacccc cacaaggagg aaaccagtcc 240 caaggtcccc cacctcctcc aggaaagcca gaaggacgac ccccacaagg aggcaaccag 300 tcccaaggtc ccccacctca tccaggaaag ccagaaagac cacccccaca aggaggaaac 360 cagtcccaag gtaccccacc tcctccagga aagccagaaa gaccaccccc acaaggaggc 420 aaccagtccc accgtccccc acctcctcca ggaaagccag aaagaccacc cccacaagga 480 ggtaaccagt cccaaggtcc cccacctcat ccaggaaagc cagaaggacc acccccacag 540 gaaggaaaca agtcccgaag tgcccgatct cctccaggaa agccacaagg accaccccaa 600 caagaaggca acaagcctca aggtccccca cctcctggaa agccacaagg cccaccccca 660 gcaggaggca atccccagca gcctcaggac cctcctgctg gaaagcccca ggggccacct 720 ccacctcctc aagggggcag gccacccaga cctgcccagg gacaacagcc tccccagtaa 780 tctaggattc aatgacagga agtgaataag aagatgacag tgtttcaaat gccttgaaac 840 ataatgtgat catgctctaa cttcaatata ccaataaaat aatcagcttg c 891 <210> 3 <211> 2266 <212> DNA <213> Homo sapiens <400> 3 ggtgtccccg gcgccgcccg gggccctgag ggctggctag ggtccaggcc gggggggacg 60 ggacagacga accagccccg tgtaggaagc gcgacaatgc cccgctacgg agcgtcactc 120 cgccagagct gccccaggtc cggccgggag cagggacaag acgggaccgc cggagccccc 180 ggactccttt ggatgggcct ggcgctggcg ctggcgctgg cgctggcgct ggctctgtct 240 gactctcggg ttctctgggc tccggcagag gctcaccctc tttctcccca aggccatcct 300 gccaggttac atcgcatagt gccccggctc cgagatgtct ttgggtgggg gaacctcacc 360 tgcccaatct gcaaaggtct attcaccgcc atcaacctcg ggctgaagaa ggaacccaat 420 gtggctcgcg tgggctccgt ggccatcaag ctgtgcaatc tgctgaagat agcaccacct 480 gccgtgtgcc aatccattgt ccacctcttt gaggatgaca tggtggaggt gtggagacgc 540 tcagtgctga gcccatctga ggcctgtggc ctgctcctgg gctccacctg tgggcactgg 600 gacattttct catcttggaa catctctttg cctactgtgc cgaagccgcc ccccaaaccc 660 cctagccccc cagccccagg tgcccctgtc agccgcatcc tcttcctcac tgacctgcac 720 tgggatcatg actacctgga gggcacggac cctgactgtg cagacccact gtgctgccgc 780 cggggttctg gcctgccgcc cgcatcccgg ccaggtgccg gatactgggg cgaatacagc 840 aagtgtgacc tgcccctgag gaccctggag agcctgttga gtgggctggg cccagccggc 900 ccttttgata tggtgtactg gacaggagac atccccgcac atgatgtctg gcaccagact 960 cgtcaggacc aactgcgggc cctgaccacc gtcacagcac ttgtgaggaa gttcctgggg 1020 ccagtgccag tgtaccctgc tgtgggtaac catgaaagca cacctgtcaa tagcttccct 1080 ccccccttca ttgagggcaa ccactcctcc cgctggctct atgaagcgat ggccaaggct 1140 tgggagccct ggctgcctgc cgaagccctg cgcaccctca ggtgcatata attggccaca 1200 ttcccccagg gcactgtctg aagagctgga gctggaatta ttaccgaatt gtagccaggt 1260 atgagaacac cctggctgct cagttctttg gccacactca tgtggatgaa tttgaggtct 1320 tctatgatga agagactctg agccggccgc tggctgtagc cttcctggca cccagtgcaa 1380 ctacctacat cggccttaat cctggttacc gtgtgtacca aatagatgga aactactccg 1440 ggagctctca cgtggtcctg gaccatgaga cctacatcct gaatctgacc caggcaaaca 1500 taccgggagc cataccgcac tggcagcttc tctacagggc tcgagaaacc tatgggctgc 1560 ccaacacact gcctaccgcc tggcacaacc tggtatatcg catgcggggc gacatgcaac 1620 ttttccagac cttctggttt ctctaccata agggccaccc accctcggag ccctgtggca 1680 cgccctgccg tctggctact ctttgtgccc agctctctgc ccgtgctgac agccctgctc 1740 tgtgccgcca cctgatgcca gatgggagcc tcccagaggc ccagagcctg tggccaaggc 1800 cactgttttg ctagggcccc agggcccaca tttgggaaag ttcttgatgt aggaaagggt 1860 gaaaaagccc aaatgctgct gtggttcaac caggcaagat catccggtga aagaaccagt 1920 ccctgggccc caaggatgcc ggggaaacag gaccttctcc tttcctggag ctggtttagc 1980 tggatatggg agggggtttg gctgcctgtg cccaggagct agactgcctt gaggctgctg 2040 tcctttcaca gccatggagt agaggcctaa gttgacactg ccctgggcag acaagacagg 2100 agctgtcgcc ccaggcctgt gctgcccagc caggaaccct gtactgctgc tgcgacctga 2160 tgctgccagt ctgttaaaat aaagataaga gacttggact ccaaaaaaaa aaaaaaaaaa 2220 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaa 2266 <210> 4 <211> 325 <212> DNA <213> Artificial Sequence <220> <223> PREX1 probe <400> 4 acttagaacg aagctaccaa gagggcttag aacgaagcta ccaagagggt agcacttaga 60 acgaagctac caagattgga agcacttaga acgaagctac tggaagcact tagaacgaag 120 ctacccactt agaacgaagc taccaagagg cttggaagca cttagaacga agctagaagc 180 acttagaacg aagctaccaa gcacttagaa cgaagctacc aagagaagca cttagaacga 240 agctaccaag atcttggaag cacttagaac gaagctcttg gaagcactta gaacgaagct 300 ggaagcactt agaacgaagc tacca 325 <210> 5 <211> 325 <212> DNA <213> Artificial Sequence <220> <223> SNORA14B probe <400> 5 acttagaacg aagctaccaa gagggcttag aacgaagcta ccaagagggt agcacttaga 60 acgaagctac caagattgga agcacttaga acgaagctac tggaagcact tagaacgaag 120 ctacccactt agaacgaagc taccaagagg cttggaagca cttagaacga agctagaagc 180 acttagaacg aagctaccaa gcacttagaa cgaagctacc aagagaagca cttagaacga 240 agctaccaag atcttggaag cacttagaac gaagctcttg gaagcactta gaacgaagct 300 ggaagcactt agaacgaagc tacca 325 <210> 6 <211> 950 <212> DNA <213> Artificial Sequence <220> <223> GREB1 probe <400> 6 ttgagactgt ccaaagagtg gcacaaagaa cctcttgtca acggcgcaca gattcggtgc 60 aaaagcctgg ctccagcca acagccggaa catctcggag gaattccgtg aagtaacaga 120 agcctccagg gatgctgctt tagtgacaga catttattga gacttggcca aggtcgaaag 180 gtgactgaag ctggtcccac tgagaaggct ctcggaaaga atccgtgact ctcatggaag 240 ccacatcaga ttagactgtt tcactaggag ctgccacgtc cggatttcgt atttgatgtg 300 tgtcgtacac gagcttgggc aagaatctgt gagccgaaca agcatcctgg gatagtgcga 360 acaaatcagg ctggcgatta aagagcccat gttcgtgacg tgctgagctc ccatcaggat 420 gctgggaatc tttgccgttg aaaacagccg tgcagttgag caatcggtcc accaagattc 480 aataaactcc gacagcccga gattagccag ccagagcatg tccaatctgc cggaccaagg 540 gctaccattt ggtgaagcta tcaaatcctc tcggggtctt gtgcacagct tacggtccca 600 tgggagcggg acctctccct tttcacagaa ctttccatag ggctccaggt cacaagatcc 660 cagtgcgcat ggtcacgacc gcggcagagt tatcagacac cactgaacag caagtccgag 720 cagcttcacg caggagtcat cagagatcac tcagaggaat cctgatggcc tcccagaaga 780 tcaggatgca aggcagaccc ggagtttatc aatcgcaggt cacagtgtcg tcccgtcaga 840 aaaaagagcg cagattttgg gtgctggaat ccgcacaccc gcaggttgaa gtctacatcg 900 tacaaaaagc tggtcacttc aggcataaga atgcattctg aggccaggcg 950

Claims (15)

As a composition for predicting resistance to cancer therapeutics in an individual, comprising an agent for measuring whether ACLY (ATP citrate lyase) is mutated,
The mutation is a frameshift deletion mutation after alanine at position 589 of the ACLY amino acid sequence,
The composition comprising the agent for measuring whether the mutation is a composition for predicting resistance to a combination of palbociclib and fulbestrant of an individual, the composition. The method according to claim 1, wherein the composition
1) one or more expression levels selected from the group consisting of Phosphatidylinositol 3,4,5-trisphosphate-dependent Rac exchanger 1 (PREX1), small nucleolar RNA, H/ACA box 14B (SNORA14B) and growth regulating estrogen receptor binding 1 (GREB1) agents for measuring
2) an agent for measuring whether one or more mutations selected from the group consisting of proline rich protein BstNI subfamily 4 (PRB4) and sphingomyelin phosphodiesterase 1 (SMPD1);
Or a composition further comprising a combination thereof,
The mutation is at least one selected from the group consisting of a mutation in which alanine at position 209 of the PRB4 amino acid sequence is substituted with proline and a mutation in which glycine at position 508 of the SMPD1 amino acid sequence is substituted with arginine,
A composition comprising an agent for measuring the expression level is a composition for predicting resistance to an individual's palbociclib or a combination of palbociclib and fulbestrant,
The composition comprising the agent for measuring whether the mutation is a composition for predicting resistance to the combination of palbociclib and fulvestrant of an individual, the composition. The method according to claim 2, wherein the agent is PREX1, SNORA14B, GREB1, ACLY, PRB4, and a primer, probe, nucleotide, antibody or antigen-binding fragment thereof that specifically binds to mRNA or protein of PRB4 and SMPD1 genes, ligand, receptor, protein or its A composition comprising a combination. The method according to claim 1, wherein the cancer is any one selected from the group consisting of ovarian cancer, liver cancer, colorectal cancer, cervical cancer, kidney cancer, stomach cancer, prostate cancer, breast cancer, brain tumor, lung cancer, uterine cancer, colon cancer, bladder cancer, and pancreatic cancer composition. A kit for predicting resistance to a cancer therapeutic agent in an individual comprising the composition of claim 1 or 2,
A composition comprising an agent for measuring the expression level is a composition for predicting resistance to an individual's palbociclib or a combination of palbociclib and fulbestrant,
The agent for measuring whether the mutation is a composition for predicting resistance to a combination of palbociclib and fulbestrant (fulbestrant), the kit. measuring whether ACLY is mutated from a sample isolated from a subject; and
As an information providing method for predicting resistance to a cancer treatment of an individual comprising the step of comparing whether the measured gene is mutated with whether or not a normal control sample is mutated,
The mutation is a frameshift deletion mutation after alanine at position 589 of the ACLY amino acid sequence,
The information providing method comprising the step of measuring whether the mutation is an information providing method for predicting resistance to the combination of palbociclib and fulvestrant of an individual, the information providing method. 7. The method of claim 6, wherein the method
Measuring the expression level of one or more selected from the group consisting of PREX1, SNORA14B and GREB1, or at least one mutation selected from the group consisting of PRB4 and SMPD1 from the sample isolated from the individual; and
As an information providing method further comprising the step of comparing the measured expression level or mutation of the gene with the expression level or mutation of a normal control sample,
The mutation is at least one selected from the group consisting of a mutation in which alanine at position 209 of the PRB4 amino acid sequence is substituted with proline and a mutation in which glycine at position 508 of the SMPD1 amino acid sequence is substituted with arginine,
The information providing method comprising the step of measuring the expression level is an information providing method for predicting resistance to palbociclib or a combination of falbociclib and fulvestrant of an individual,
The information providing method comprising the step of measuring whether the mutation is an information providing method for predicting resistance to the combination of palbociclib and fulbestrant (fulbestrant) of an individual, the information providing method. The method according to claim 7, wherein when the expression level or whether the mutation is changed compared to the expression level or mutation of the control group, the method comprises determining that the subject has resistance to the cancer therapeutic agent. The method of claim 6, wherein the sample is a tumor tissue. The method according to claim 6, wherein the step of measuring the expression level is RT-PCR, competitive RT-PCR (competitive RT-PCR), real-time RT-PCR (Real-time RT-PCR), RNase protection assay (RNase protection assay: RPA) ), Northern blotting, nucleic acid microarray including DNA, Western blotting, ELISA (enzyme linked immunosorbent assay), Radioimmunoassay (RIA), radioimmunodiffusion, Oukteroni ( Ouchterlony) immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay (Immunoprecipitation Assay), complement fixation assay (Complement Fixation Assay), FACS, mass spectrometry, magnetic bead-antibody immunoprecipitation method, protein chip ( protein chip), or a method for providing information that is performed by a combination thereof. measuring whether ACLY is mutated from a sample of an individual administered with a candidate substance for treatment of cancer drug-resistant cancer; and
A method of screening a cancer treatment resistant cancer treatment comprising the step of comparing whether the measured gene is mutated with whether a normal control sample is mutated,
The mutation is a frameshift deletion mutation after alanine at position 589 of the ACLY amino acid sequence,
The method comprising the step of determining whether the mutation is a method of screening a cancer therapeutic agent having resistance to the combination of palbociclib and fulvestrant in an individual. 12. The method of claim 11, wherein the method
Measuring the expression level of one or more selected from the group consisting of PREX1, SNORA14B, and GREB1 or one or more mutations selected from the group consisting of PRB4 and SMPD1 from a sample of an individual administered with a candidate substance for treatment of cancer drug-resistant cancer; and
As a method of screening a cancer therapeutic agent resistant to a cancer therapeutic agent further comprising the step of comparing the measured expression level or mutation with the expression level or mutation of a normal control sample,
The mutation is at least one selected from the group consisting of a mutation in which alanine at position 209 of the PRB4 amino acid sequence is substituted with proline and a mutation in which glycine at position 508 of the SMPD1 amino acid sequence is substituted with arginine,
The method comprising the step of measuring the expression level is a method of screening a cancer therapeutic agent having resistance to palbociclib or a combination of palbociclib and fulvestrant in an individual,
The method comprising the step of measuring whether the mutation is a method of screening a cancer therapeutic agent having resistance to the combination of palbociclib and fulvestrant (fulbestrant) of an individual, the method. The screening method according to claim 11, wherein the sample is a tumor tissue. The method according to claim 11, wherein the step of measuring the expression level is RT-PCR, competitive RT-PCR (competitive RT-PCR), real-time RT-PCR (Real-time RT-PCR), RNase protection assay (RNase protection assay: RPA) ), Northern blotting, nucleic acid microarray including DNA, Western blotting, ELISA (enzyme linked immunosorbent assay), Radioimmunoassay (RIA), radioimmunodiffusion, Oukteroni ( Ouchterlony) immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay (Immunoprecipitation Assay), complement fixation assay (Complement Fixation Assay), FACS, mass spectrometry, magnetic bead-antibody immunoprecipitation method, protein chip ( protein chip), or a screening method that is performed by a combination thereof. The method according to claim 12, when the measured expression level of PREX1, SNORA14B or GREB1 is lower than that of the normal control group, and when the measured ACLY, PRB4 or SMPD1 is mutated compared to the normal control, the administered candidate is used as a cancer therapeutic agent The screening method further comprising the step of determining a resistant cancer therapeutic agent.

Images