KR20210147348A - Use of Eef1a1 for Diagnosis of Alzheimer's Disease - Google Patents

Abstract

The present invention relates to a use of Eef1a1 for diagnosis or treatment of Alzheimer's disease, and more specifically, to a composition for Alzheimer's disease diagnostic marker containing Eef1a1 gene, a composition for diagnosing Alzheimer's disease containing a substance for measuring an expression level of the Eef1a1 gene, and a method for providing information for predicting or diagnosing the onset of Alzheimer's disease. Eef1a1, which is a biomarker gene for Alzheimer's disease according to the present invention, has an expression level specifically increased in the plasma of an individual with induced Alzheimer's disease compared to a normal group, and thus has the effect of accurately, simply and quickly diagnosing the onset of Alzheimer's disease by analyzing an expression level of Eef1a1 in plasma samples which are easily obtained. Furthermore, an expression regulator of Eef1a1 can be advantageously used as a target for a novel therapeutic agent for Alzheimer's disease.

Description

Use of Eef1a1 for Diagnosis of Alzheimer's Disease

The present invention relates to the novel use of Eef1a1 for the diagnosis of Alzheimer's disease.

Degenerative brain disease refers to a disease that occurs in the brain among degenerative diseases that occur with advancing age, and can be classified by considering the main symptoms and affected brain regions. .

Alzheimer's disease, a representative degenerative brain disease, is one of the diseases that cause dementia, and is a disease in which cognitive function including memory deteriorates gradually with aging. Although the exact pathogenesis of Alzheimer's disease is not known, it is known as a general mechanism that beta-amyloid protein is excessively produced and deposited in the brain to have a detrimental effect on brain cells.

As drugs for the treatment of Alzheimer's disease, acetylcholinesterase (AChE) inhibitors or N-Methyl-D-aspartate (NMDA) receptor antagonists are used, but most of these drugs are used in patients with early-stage Alzheimer's disease. It is known to be effective against

Also, for the diagnosis of Alzheimer's disease, methods such as clinical exam and brain imaging are used, but it is very difficult to diagnose early stage Alzheimer's disease by such a diagnostic method.

In particular, through analysis of the brains of people with Alzheimer's disease, pathologies such as the presence of extracellular aggregates of Amyloid-β peptide and abnormal nerve fiber entanglement of Tau, a microtubule protein However, there is no clear biomarker that can confirm the possibility of Alzheimer's disease other than a tissue biopsy in which brain tissue must be directly collected, so there is a very big limitation in effectively preventing Alzheimer's disease.

Therefore, although early diagnosis of the disease is essential for effective treatment of Alzheimer's disease, there are few methods for accurately and rapidly diagnosing Alzheimer's disease until now.

On the other hand, Eef1a1 (Elongation factor 1-alpha 1) is an isoform of the alpha subunit of elongation factor-1, and is responsible for delivering aminoacyl tRNA to the ribosome, and the alpha 1 isotype is the brain, placenta, Alpha 2, which is expressed in the lung, liver, kidney and pancreas and a different isotype, is known to be expressed in the brain, heart and skeletal muscle. It is also known that Eef1a1 is involved in the translational elongation of proteins and acts as a coactivator of aldosterone receptors in the heart and kidney.

However, the relationship between Eef1a1 and Alzheimer's has not yet been studied.

1. Mol Neurobiol. 2019 Sep;56(9):6017-6034. 2. Neurodegener Dis. 2016 ; 16(0): 39-43

Accordingly, the present inventors confirmed that Eef1a1 can be used as a new biomarker for the diagnosis of Alzheimer's disease. The present invention was completed by confirming that it can be used as a target for a biomarker and a new therapeutic agent for

Accordingly, it is an object of the present invention to provide a composition for an Alzheimer's disease diagnostic marker, containing the Eef1a1 (Elongation factor 1-alpha 1) gene.

Another object of the present invention is to provide a composition for diagnosing Alzheimer's disease, comprising a substance measuring the RNA level of Eef1a1 (Elongation factor 1-alpha 1) gene.

Another object of the present invention is to provide a kit for diagnosing Alzheimer's disease, comprising the composition of the present invention.

Another object of the present invention is to provide an information providing method for predicting or diagnosing the onset of Alzheimer's disease.

In order to achieve the above object, the present invention provides a composition for an Alzheimer's disease diagnostic marker, containing the Eef1a1 (Elongation factor 1-alpha 1) gene.

In one embodiment of the present invention, the Eef1a1 gene may be composed of the nucleotide sequence of SEQ ID NO: 1.

The present invention also provides a composition for diagnosing Alzheimer's disease, comprising a substance for measuring the expression level of Eef1a1 (Elongation factor 1-alpha 1) gene.

In one embodiment of the present invention, the substance may be a primer or probe capable of specifically binding to the Eef1a1 gene.

In one embodiment of the present invention, the primer may be a primer set of SEQ ID NO: 3 and SEQ ID NO: 4.

The present invention also provides a kit for diagnosing Alzheimer's disease, comprising the composition of the present invention.

In addition, the present invention, (a) measuring the expression level of the Eef1a1 (Elongation factor 1-alpha 1) gene from a biological sample of a patient suspected of Alzheimer's disease; And (b) provides an information providing method for predicting or diagnosing the onset of Alzheimer's disease, comprising comparing the expression level of the Eef1a1 gene with the expression level of the corresponding gene in a normal control sample.

In one embodiment of the present invention, as a result of measuring the expression level of the Eef1a1 gene, when the expression level of the Eef1a1 gene is increased compared to the normal control, the step of determining that Alzheimer's disease has occurred may be further added.

In one embodiment of the present invention, the biological sample may be blood, plasma or brain tissue.

In one embodiment of the present invention, the measurement may be reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, or Northern blot.

In one embodiment of the present invention, the measurement may be to perform a real time-polymerase chain reaction using the primer sets of SEQ ID NO: 3 and SEQ ID NO: 4.

Eef1a1, a marker gene for Alzheimer's disease according to the present invention, is specifically increased in plasma or brain tissue of an Alzheimer's-induced individual compared to the normal group. It has an effect that can be used as a marker, and has the effect of accurately and simply diagnosing the onset of Alzheimer's disease using plasma samples. can

1 is a linear graph showing changes in the expression of lncRNA obtained by performing whole genome analysis on blood-derived plasma obtained from Alzheimer's disease-induced mice and normal mice.
Figure 2 shows the results of identifying the Alzheimer's disease-specific Eef1a1 gene through total RNA-sequencing after extracting total RNA from plasma obtained from Alzheimer's disease-induced and normal mice, respectively.
3 is a graph showing the analysis result of the FPKM value of the Eef1a1 gene quantified based on the genome analysis result of FIG. 2 .
4 shows the cDNA base sequence of the Eef1a1 gene of the present invention, and the sequence marked in yellow shows the sequence of the region corresponding to the 4th exon in the Eef1a1 gene.
5 is a gene for the region of Eef1a1 that can be detected when RT-qPCR is performed on plasma samples obtained from Alzheimer's disease-induced mice and normal mice using the primer set designed in an embodiment of the present invention; It is represented by a blue translucent boxed area in the phase.
6 shows the expression level of Eef1a1 mRNA in each plasma by performing RT-qPCR on plasma samples obtained from Alzheimer's disease-induced mice and normal mice using the primer set designed in an embodiment of the present invention. The results of comparative analysis are shown.
7 shows the results of total RNA-sequencing analysis after extracting total RNA from tissue samples obtained from Alzheimer's disease-induced and normal mice, respectively (7a) and the expression of the Eef1a1 gene is also increased in the brain tissue of Alzheimer's disease mice The result (7b) is shown.

The present invention is characterized in that the novel use of Eef1a1 as a new biomarker for the diagnosis of Alzheimer's disease was identified for the first time.

Conventional methods for diagnosing Alzheimer's disease include neurocognitive tests, magnetic resonance imaging (MRI), and pathological analysis through brain tissue biopsy. There is a problem that can put a great burden on you.

Accordingly, the present inventors measured the expression level of the Eef1a1 gene from easily obtainable blood or plasma samples while researching to discover new biomarkers that can easily and quickly diagnose Alzheimer's disease while solving the inconvenience of tissue analysis. Through this, it was confirmed that the onset of Alzheimer's disease can be diagnosed quickly and accurately.

In this regard, in one embodiment of the present invention, after blood was isolated from Alzheimer's disease-induced and normal mice, plasma was separated from blood, and total RNA was extracted from plasma, and whole genome analysis was performed. Thus, genes showing differences in expression levels in the disease group and the normal group were screened.

As a result, it was specifically confirmed that the expression level of Eef1a1 mRNA was significantly increased in the Alzheimer's disease group compared to the normal group.

Therefore, when Alzheimer's disease is induced, the expression of the Eef1a1 gene is significantly increased compared to normal, and this confirmation has been confirmed in both tissues and blood, preferably plasma, and furthermore, between the normal group and the patient group, the expression level of the Eef1a1 gene is significantly increased. The differences were found to be greater in plasma samples than in tissues.

Therefore, it was found that the onset of Alzheimer's disease can be diagnosed simply and accurately by measuring the expression level of the Eef1a1 gene in a plasma sample that is easy to obtain.

Furthermore, the present inventors analyzed whether there is a region with a particularly high expression level in the Eef1a1 gene sequence at the time of Alzheimer's disease.

Eef1a1 is composed of a total of 8 exons. Among the 8 exons, the 4th exon region is composed of the longest nucleotide sequence, and when Alzheimer’s is induced, the expression of the 4th exon region is significantly increased compared to the normal group. appear.

Accordingly, the present inventors prepared a primer for specifically detecting the 4th exon region of Eef1a1, which is a region with a particularly strong expression increase during the onset of Alzheimer's disease, and prepared a primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4.

In addition, the difference in the expression level of Eef1a1 was analyzed through RT-qPCR analysis on the plasma of Alzheimer's-induced mice and normal mice with the primer sets of SEQ ID NOs: 3 and 4 designed in the present invention. As a result, compared to the normal group, It was confirmed using the primer set of the present invention that the expression of Eef1a1 in the plasma of the disease group was significantly increased, and as a result of nucleotide sequence analysis of the amplified reaction product, it was confirmed that the gene fragment of SEQ ID NO: 2 having a size of 116 bp .

Therefore, the primer sets of SEQ ID NOs: 3 and 4 of the present invention can specifically and accurately detect the Eef1a1 gene, and thus can be usefully used in a composition for diagnosing Alzheimer's disease.

Therefore, the present invention can provide a composition for diagnosing Alzheimer's disease marker containing the Eef1a1 gene, and can provide a composition for diagnosing Alzheimer's disease, including a substance for measuring the expression level of the Eef1a1 gene.

In addition, the expression level of the Eef1a1 gene may be preferably an RNA level expressed from the Eef1a1 gene, and more preferably an mRNA level.

The material for measuring the expression level of the Eef1a1 gene may include a primer or probe specific for the Eef1a1 gene. In the present invention, the primer or probe specific for the Eef1a1 gene may be a primer or probe capable of specifically amplifying the entire Eef1a1 gene or a partial region of the gene, and the primer or probe is designed through a method known in the art. can do.

In addition, the biomarker for the diagnosis of Alzheimer's disease in the present invention may be the Eef1a1 gene consisting of SEQ ID NO: 1, preferably, the base sequence corresponding to the 4th exon region in the Eef1a1 gene sequence consisting of SEQ ID NO: 1 (sequence in FIG. 4) in the nucleotide sequence indicated in yellow).

In the present invention, the term "primer" refers to a single compound capable of serving as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and a polymerase) at a suitable temperature and in a suitable buffer. -stranded oligonucleotides. The suitable length of the primer may vary depending on various factors, such as temperature and the use of the primer. In addition, the sequence of the primer does not need to have a sequence that is completely complementary to a partial sequence of the template, it is sufficient as long as it has sufficient complementarity within a range capable of hybridizing with the template to perform an intrinsic function of the primer. Therefore, the primer in the present invention does not need to have a perfectly complementary sequence to the nucleotide sequence of the gene as a template, and it is sufficient if it hybridizes to this gene sequence and has sufficient complementarity within the range to act as a primer. In addition, it is preferable that the primer according to the present invention can be used in a gene amplification reaction.

The amplification reaction refers to a reaction for amplifying a nucleic acid molecule, and amplification reactions of these genes are well known in the art, for example, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), ligase enzyme chain reaction (LCR), electron mediated amplification (TMA), nucleic acid sequence substrate amplification (NASBA), and the like.

In the present invention, the term "probe" refers to a linear oligomer of natural or modified monomers or linkages, includes deoxyribonucleotides and ribonucleotides, and can specifically hybridize to a target nucleotide sequence, It refers to those that exist or are artificially synthesized. The probe according to the present invention may be single-stranded, preferably an oligodeoxyribonucleotide. Probes of the invention may include native dNMPs (ie, dAMP, dGMP, dCMP and dTMP), nucleotide analogs or derivatives. In addition, the probe of the present invention may also contain ribonucleotides. For example, the probes of the present invention include backbone modified nucleotides, such as peptide nucleic acids (PNA) (M. Egholm et al., Nature, 365:566-568 (1993)), phosphorothioate DNA, phosphorodithioate DNA, phosphoroamidate DNA, amide-linked DNA, MMI-linked DNA, 2'-O-methyl RNA, alpha-DNA and methylphosphonate DNA, sugar modified nucleotides such as 2'-O-methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'-O-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl DNA, hexose DNA, pyranosyl RNA and anhydrohexy Tall DNA, and nucleotides with base modifications such as C-5 substituted pyrimidines (substituents are fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, Tityl-, propynyl-, alkynyl-, thiazolyl-, imidazoryl-, pyridyl- including), 7-deazapurine having a C-7 substituent (substituents are fluoro-, bromo-, chloro- , iodo-, methyl-, ethyl-, vinyl-, formyl-, alkynyl-, alkenyl-, thiazolyl-, imidazoryl-, pyridyl-), inosine and diaminopurine. .

In addition, the present invention provides a kit for diagnosing Alzheimer's disease, comprising the marker for diagnosing Alzheimer's disease or the composition for diagnosing Alzheimer's disease according to the present invention.

The kit for diagnosing Alzheimer's disease of the present invention may include a primer or probe capable of measuring the expression level of the Eef1a1 gene, which is the marker gene, and the definitions thereof are as described above.

If the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally contain reagents necessary for PCR amplification, such as a buffer, a DNA polymerase (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermostable DNA polymerase obtained from Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), a DNA polymerase cofactor, and dNTPs.

Furthermore, the kit according to the present invention may be manufactured as a plurality of separate packaging or compartments including reagent components, and the kit of the present invention may be a diagnostic kit including essential elements necessary for performing a DNA chip.

The DNA chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, and reagents, agents, enzymes, and the like for producing a fluorescently-labeled probe. In addition, the substrate may include cDNA corresponding to a quantitative control gene or a fragment thereof.

In addition, the present invention, (a) measuring the expression level of the Eef1a1 gene from a biological sample of a patient suspected of Alzheimer's disease; And (b) provides an information providing method for predicting or diagnosing the onset of Alzheimer's disease, comprising comparing the expression level of the Eef1a1 gene with the expression level of the corresponding gene in a normal control sample.

The method of measuring the expression level of a gene in the above may be performed including a known process of isolating RNA from a biological sample using a known technique.

In the present invention, the "biological sample" refers to a sample collected from a living body in which the expression level of the gene according to the occurrence or progression of Alzheimer's disease is different from that of a normal control, and the sample includes, for example, but is not limited thereto. However, cells, blood, serum, plasma, saliva, tissue and urine may be included, and preferably plasma.

Measurement of the expression level of the gene is preferably to measure the level of mRNA, and as a method for measuring the level of mRNA, reverse transcription polymerase chain reaction (RT-PCR), real-time reverse transcription polymerase chain reaction, RNase protection assay, Northern blots and DNA chips, but are not limited thereto.

Therefore, the present invention can confirm the expression amount of the marker gene in the control group and the expression amount of the marker gene in the Alzheimer's disease patient or suspected patient through the detection methods as described above, and compare the expression level with the control group of Alzheimer's disease It is possible to predict and diagnose the onset, advanced stage, or prognosis.

More specifically, when the mRNA level of the Eef1a1 gene is increased as a result of measuring the mRNA level of the Eef1a1 gene compared to a normal control, it may be determined that Alzheimer's disease has occurred.

Hereinafter, the present invention will be described in more detail by way of Examples. These examples are merely for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited to these examples.

<Example 1>

Discovery of Eef1a1 as a diagnostic biomarker for Alzheimer's disease

<1-1> Isolation of plasma and total RNA from the blood of an Alzheimer's disease-inducing individual

In order to discover a new biomarker that can easily diagnose the onset of Alzheimer's disease, the present inventors extracted blood from a 12-week-old Alzheimer's disease-induced animal model 5XFDA mouse, and then used an ultracentrifuge at 100,000 xg. Only plasma was separated by centrifugation at a speed of 4°C for 1 hour. Afterwards, total RNA was extracted by the Trizol method to extract total RNA in the obtained plasma, and the following process was further performed to obtain high-purity RNA. Trizol reagent was added in a ratio equal to the volume of the obtained plasma (1:1), carefully mixed with a micropipette, and then incubated at room temperature for about 1 hour. Thereafter, RNA extraction was performed by adding 1/5 of the total volume of high-purity chloroform. In particular, when purifying RNA from plasma, RNA was precipitated by adding 100% isopropanol. This step is an important step to obtain RNA capable of genomic analysis from a small amount of plasma. The precipitation step using isopropanol is performed once. Further iterations were performed for a total of two times. The purified RNA was measured for concentration and purity using a nano drop, and it was confirmed that the 260/280 ratio of the extracted RNA was maintained between 1.8 and 2.0.

<1-2> Genome analysis of total RNA in plasma and discovery of Eef1a1

In order to identify new genes that are increased dependently on Alzheimer's disease using blood-derived plasma as a sample, a whole-genome analysis method was performed on the total RNA of plasma derived from Alzheimer's disease mouse blood obtained in <1-1>. For this purpose, a library for whole genome analysis was prepared using the TruSeq Stranded Total RNA LT Kit known in the art, and the expression change of IncRNA in the blood-derived plasma was analyzed through Illumina HiSeq 4000 Next Generation sequencing analysis, The results are shown in FIG. 1 .

Here, the IncRNA (long non-coding RNA) is a recently discovered new class of transcripts that are invasively transcribed into the genome, and are known as important regulators of the epigenome. These long noncoding RNAs (lncRNAs) have recently been re-emerged as Regulatory RNAs, and in particular, play a major role in epigenetic, regulation of transcription, cancer formation or embryonic development, nervous system disorders, or other essential biological processes. is known However, the function of lncRNA is still only partially understood, and studies to discover specific lncRNAs that can be used as biomarkers for specific diseases are lacking.

On the other hand, as a result of specific gene analysis showing a change in the expression level in the plasma of the Alzheimer's-affected group compared to the normal group through sequencing analysis, it was confirmed that the RNA amount of Eef1a1 was significantly increased in the Alzheimer's-affected group (see Fig. 2) . Furthermore, as a result of calculating the expression value by extracting the FPKM (Fragment per kilobase of trasncript per million) value from the derived genome analysis information, the expression level of the Eef1a1 gene was increased by about 200% in the Alzheimer's disease group compared to the normal group. was found (see Fig. 3).

Through these results, the present inventors found that the expression of Eef1a1 RNA is specifically increased when Alzheimer's disease is induced, and that the amount of Eef1a1 RNA in the blood plasma is present in a higher amount than in the normal group. Accordingly, it was found that when Alzheimer's disease is induced, Eef1a1 RNA is overexpressed and the overexpressed Eef1a1 RNA exists in the form of circulating RNA that circulates in the blood. Furthermore, it can be seen that this can be used as a new biomarker for the diagnosis of Alzheimer's disease. there was.

<Example 2>

Preparation of primers for Eef1a1 detection

In order to easily detect Eef1a1 newly discovered as an Alzheimer's disease diagnostic marker in <Example 1>, a primer set was prepared as follows. For the purified RNA obtained in Example 1, cDNA was synthesized using a random primer and reverse transcriptase, and the synthesized cDNA was 20ng/ After dilution with ul, an amount of 30 ng was used when performing the following experiment. A primer set for a region capable of specifically detecting the Eef1a1 gene was designed as follows based on RNA obtained from the normal group and the Alzheimer's disease-inducing mouse group. Here, the cDNA sequence of the Eef1a1 gene of the present invention is shown in SEQ ID NO: 1 and FIG. 4 .

Eef1a1 forward primer (SEQ ID NO: 3)

: 5’-CGAGGAAATCGTTAAGGAAGTC-3’

Eef1a1 reverse primer (SEQ ID NO: 4)

: 5'- CACTTGGCTCCAGCATGTTG - 3'

The primer set for detecting Eef1a1 prepared in the present invention is a primer capable of amplifying the exon 4 region of Eef1a1 indicated in yellow among the Eef1a1 cDNA sequence consisting of a total of 8 exons shown in FIG. As the region was confirmed to have the highest expression level at the time of Alzheimer's disease, in the present invention, a primer set for detecting Eef1a1 of SEQ ID NOs: 3 and 4 that can specifically target the exon 4 region was designed.

As a result of analyzing the amplified DNA product by performing RT-qPCR using the primer set for detecting Eef1a1 of the present invention, it was confirmed that the Eef1a1 nucleotide sequence of SEQ ID NO: 2 having a size of 116 bp was amplified.

In addition, in the case of using the primer set of the present invention, the amplification positions of the loci detected in the Eef1a1 region are shown in FIG. 5 . In FIG. 5, a region in a blue semi-transparent box indicates a region detectable by the primer set of the present invention.

<Example 3>

Diagnosis of Alzheimer's disease using primers for detecting Eef1a1 in plasma samples

The present inventors performed the following experiment to determine whether the onset of Alzheimer's disease can be diagnosed by analyzing the expression level of Eef1a1 in a plasma sample using the primer set for detecting Eef1a1 designed in Example 2 above. did

First, plasma was obtained from the blood of the normal mouse group and the Alzheimer's-induced mouse group obtained in the above Example, and then RNA was isolated from each, and RT-qPCR was performed using the Eef1a1 detection primer set of the present invention.

As a result, as shown in FIG. 6 , as a result of RT-qPCR analysis using the primer set of the present invention, it was confirmed that the expression level of Eef1a1 in the plasma of the Alzheimer's-induced group was significantly increased by about 2 times compared to the normal group. could

<Example 4>

Analysis of Eef1a1 Expression Level Changes in Brain Tissues of Alzheimer's Induced Subjects

The present inventors performed the following experiment in order to confirm whether Alzheimer's disease can be diagnosed by changing the expression level of Eef1a1 even in brain tissue.

After separating brain tissue (Cortex) from the Alzheimer's-induced 5XFDA mouse group and the normal mouse group used in Example 1, a whole genome analysis was performed. analyzed.

As a result, as shown in FIG. 7 , it was confirmed that the expression of the Eef1a1 gene was specifically increased in the brain tissue of the Alzheimer's-induced mouse compared to the normal brain tissue in the total RNA-sequence analysis result.

Therefore, through these experimental results, the present inventors found that Eef1a1 can be used as a new biomarker for the diagnosis of Alzheimer's disease, and the expression of Eef1a1 is particularly increased in plasma at the time of Alzheimer's disease. It was found that it can quickly diagnose Alzheimer's disease. In addition, it was found that modulators capable of regulating the expression or activity of Eef1a1 can become new therapeutic targets for Alzheimer's disease.

So far, the present invention has been looked at with respect to preferred embodiments thereof. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> Korea Brain Research Institute <120> Use of Eef1a1 for Diagnosis of Alzheimer's Disease <130> NPDC-86594 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 1364 <212> DNA <213> Artificial Sequence <220> <223> Eef1a1 cDNA sequence <400> 1 atgggaaagg aaaagactca catcaacatc atcgtaatcg gacacgtagc cagctgatct 60 acaaatgtgg tggaatcgac aagcgaacca tcgaaaagtt tgagaaggag gctgctgaga 120 tgggaaaggg ctccttcaag tacgccgggg tcttagacaa actgaaagct gagcgtgagc 180 gtggtatcac tattgacatc tccctgtgga aatttgagac cagcaaatac tatgtgacca 240 tcattgatgc cccaggacac agagacttca tcaaaaacat gattacaggc acatcccagg 300 ctgactgtgc gtcctgattg ttgctgctgg tgttggtgaa tttgaagctg gtatctccaa 360 gaaccggcag acccgcgagc atgctcttct ggcttacacc ctgggtgtga aacagctgat 420 tgttggtgtc aacaaaatgg attccaccga gccaccatac agtcagaaga gatacgagga 480 aatcgttaag gaagtcagca cctacattaa gaaaattggc tacaaccctg acacagtagc 540 atttgtgcca atttctggtt ggaatggtga caacatgctg gagccaagtg ctaatatgcc 600 ttggttcaag ggatggaaag tcacccgcaa agatggcagt gccagtggca ccacgctgct 660 ggaagcgttg gattgtatcc taccaccaac tcgtccaact gacaagcctc tgcgactgcc 720 cctccaggat gtctataaaa ttggaggcat tggcactgtc cctgtgggcc gagtggagac 780 tagtgttctc aaacctggca tggtggttac ctttgctcca gtcaatgtaa caactgaagt 840 caagtctgtt gaaattcacc atgaagcttt gagtgaagct cttcctgggg acaatgtggg 900 cttcaatgta acgaacgtgt tggtctaaga tgttagacga ggcaatgttg ctggtgacag 960 caaaaacgac ccaccaatgg aagcagctgg cttcactgct caggtgatta tcctgaacca 1020 tccaggccaa atcagtgctg gctatgctcc tgttctggac tgtcacacag cgcacatagc 1080 atgcaagttt gctgagctta aagaaaagat cgatcgtcgt tctggtaaga agctggaaga 1140 tgggccccaa attcctgaag tctggcgatg ctgccattgt tgatatggtc cctggcaagc 1200 ccatgtgtgt tgagagcttc tctgactatc ctccacttgg tcgttttgct gttcgtgaca 1260 tgaggcagac agttgctgtg ggtgtcatca aagctgtgga caagaaggct gctggagctg 1320 gcaaagtcac caagtctgcc cagaaagctc agaaggctaa atga 1364 <210> 2 <211> 116 <212> DNA <213> Artificial Sequence <220> <223> Eef1a1 PCR product sequence (116bp) <400> 2 cgaggaaatc gttaaggaag tcagcaccta cattaagaaa attggctaca accctgacac 60 agtagcattt gtgccaattt ctggttggaa tggtgacaac atgctggagc caagtg 116 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Eef1a1 F primer <400> 3 cgaggaaatc gttaaggaag tc 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Eef1a1 R primer <400> 4 cacttggctc cagcatgttg 20

Claims (11)

Eef1a1 (Elongation factor 1-alpha 1) containing the gene, Alzheimer's disease diagnostic marker composition. According to claim 1,
The Eef1a1 gene is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 1, Alzheimer's disease diagnostic marker composition. A composition for diagnosing Alzheimer's disease, comprising a material for measuring the expression level of Eef1a1 (Elongation factor 1-alpha 1) gene. 4. The method of claim 3,
The material is characterized in that the primer or probe capable of specifically binding to the Eef1a1 gene, Alzheimer's disease diagnosis composition. 5. The method of claim 4,
The primer is characterized in that the primer set of SEQ ID NO: 3 and SEQ ID NO: 4, Alzheimer's disease diagnosis composition. A kit for diagnosing Alzheimer's disease, comprising the composition of any one of claims 3 to 5. (a) measuring the expression level of Eef1a1 (Elongation factor 1-alpha 1) gene from a biological sample of a patient suspected of Alzheimer's disease; and
(b) comprising comparing the expression level of the Eef1a1 gene with the expression level of the corresponding gene in a normal control sample,
A method of providing information for predicting or diagnosing the onset of Alzheimer's disease. 8. The method of claim 7,
As a result of measuring the expression level of the Eef1a1 gene, when the expression level of the Eef1a1 gene is increased compared to the normal control, predicting or diagnosing the onset of Alzheimer's disease, further comprising the step of determining that Alzheimer's disease has occurred How to provide information for 8. The method of claim 7,
The biological sample is blood, plasma or brain tissue, characterized in that the information providing method for predicting or diagnosing the onset of Alzheimer's disease. 8. The method of claim 7,
The measurement is information for predicting or diagnosing the onset of Alzheimer's disease, characterized in that reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, or Northern blot How to provide. 11. The method of claim 10,
The measurement is a method for predicting or diagnosing the onset of Alzheimer's disease, characterized in that the measurement is performed by a real time-polymerase chain reaction using the primer set of SEQ ID NO: 3 and SEQ ID NO: 4 .

Images