KR20210146138A - Guide RNA for editing ms1-like gene and use thereof - Google Patents

Abstract

The present invention relates to a guide RNA (gRNA) for editing a tomato pollen development-related gene and to a use thereof, and more specifically, to a guide RNA for editing a tomato-derived ms1-like gene and to a use thereof. According to the present invention, it is possible to be applied to the production of male sterility by knocking out a pollen development-related gene using gRNA, thereby reducing the production cost of tomato hybrid seeds.

Description

Guide RNA for editing tomato pollen development-related gene and its use {Guide RNA for editing ms1-like gene and use thereof}

The present invention relates to a guide RNA (gRNA) for editing a tomato pollen development-related gene and use thereof. Specifically, it relates to a guide RNA for editing a tomato-derived ms1-like gene and its use.

Male sterility of crops refers to the loss of male ability through artificial or natural genetic mutation. This is a kind of mutation, and it is a phenomenon in which pollen with fertilization ability cannot be produced due to a defect in the male organ, that is, surgery.

Male sterility can be divided into pollen sterility, male sterility, functional sterility of pollen, etc., and hybrid seeds can be produced using these characteristics of male sterility. In other words, in the case of bisexual plants, they must go through a process of removing stamens prior to breeding, which is a very cumbersome and labor-intensive process. If a line with male sterility is used as a maternal line, it has the advantage of being able to artificially pollinate as it is without sterilization or create a hybrid line through natural crossbreeding. Genetic male infertility (GMS) is a recessive mutation in a gene in the nucleus involved in pollen production, and infertility is recessive. However, in this genetic male infertility, the maintenance of fertility and infertility are separated by crossing the heterozygote to the infertility.

On the other hand, tomatoes are one of the major crops in the world, and the consumption of tomatoes for processing worldwide is steadily increasing, and the seed demand is increasing. However, since the cost of seed production is higher than the selling cost, there is an urgent need to prepare an efficient seed production system. Tomatoes have various genetic male sterility, but it is difficult to maintain the male sterility line of pure tomatoes, so it is not actively used commercially.

Many studies have been conducted on male infertility in tomatoes. However, in male infertility, studies on various basic mechanisms and gene functions affecting the development of pollen are very weak. Genetic male infertility in cultivar tomatoes is a common phenomenon and has been reported to be regulated by a single recessive gene in many mutant individuals. In tomato, it is known that there are about 45 genes related to male sterility of pollen.

Accordingly, the present inventors made efforts to produce male sterile tomatoes by constructing a tomato male sterility utilization system that can significantly reduce hybrid seed production costs. As a result, the ms1-like gene has a high probability of gene sequence using tomato gene editing guide RNA. By confirming that the mutation occurred, the present invention was completed.

Republic of Korea Patent Registration No. 10-1242434

An object of the present invention is to provide a tomato gene editing guide RNA comprising the same or complementary nucleotide sequence as SEQ ID NO: 3 and a tomato gene editing vector comprising the guide RNA.

In addition, the present invention aims to provide a composition for tomato gene editing comprising the guide RNA or the vector for gene editing.

Another object of the present invention is to provide a transgenic plant in which the tomato gene is corrected by transducing the vector and a method for producing the transgenic plant.

In order to achieve the above object, the present invention can provide a guide RNA for editing tomato gene consisting of the same or complementary nucleotide sequence to SEQ ID NO: 3.

In addition, the present invention can provide a guide RNA, characterized in that the tomato gene is an ms1-like gene consisting of SEQ ID NO: 1.

In addition, the present invention may provide a vector for editing tomato gene comprising the guide RNA.

In addition, the present invention can provide a vector, characterized in that the tomato gene is an ms1-like gene consisting of SEQ ID NO: 1.

In addition, the present invention can provide a vector characterized in that it further comprises a nucleotide sequence encoding the cas9 protein.

In addition, the present invention may provide a composition for tomato gene editing comprising the guide RNA or the vector for gene editing.

In addition, the present invention can provide a transgenic plant in which the tomato gene is corrected by transducing the vector.

In addition, the present invention may provide a plant, characterized in that the plant is a male infertility mutant.

In addition, the present invention comprises the steps of preparing a tomato gene correction vector comprising a guide RNA consisting of the same or complementary nucleotide sequence to SEQ ID NO: 3; and transducing the vector into the plant to correct the tomato gene, it may provide a method for producing a transgenic plant.

In addition, the present invention can provide a method for producing a transgenic plant, characterized in that the tomato gene is an ms1-like gene consisting of SEQ ID NO: 1.

In addition, the present invention may provide a method for producing a transgenic plant, characterized in that the plant is a male infertility mutant.

According to the present invention, it can be applied to the production of male sterility by knocking out pollen development-related genes using gRNA, thereby reducing the production cost of tomato hybrid seeds.

1 shows the gRNA positions selected for the ms1-like gene. gRNAs are indicated in red.
Figure 2 shows the location of the ms10 ^{35 gene selected gRNA.} gRNAs are indicated in red.
3 shows a schematic diagram of a gRNA, CRISPR/Cas9 vector for production of a tomato gene edit.
4 shows the results of analyzing the nucleotide sequence by performing PCR by extracting gDNA from the transformed tomato transformed with the vector using the gRNA of the ms1-like gene and the ^{ms10 35 gene.}

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are those well known and commonly used in the art.

As a result of the present invention, the present inventors made efforts to produce male sterile tomatoes by constructing a tomato male sterility utilization system that can significantly reduce hybrid seed production costs. This was completed by confirming that the mutation occurred in the gene sequence.

The present invention, in one aspect, relates to a guide RNA for tomato gene editing consisting of a nucleotide sequence identical to or complementary to SEQ ID NO: 3.

"Guide RNA (gRNA)" of the present invention is a type of RNA (ribonucleic acid), and refers to RNA that recognizes and finds DNA to be edited in genome editing that corrects a specific gene in humans or animals and plants do.

Gene editing technology includes engineered nuclease, and CRISPRCas9 is a type of gene editing technology.

In the present invention, "CRISPR-Cas9" is designed to cut a desired gene sequence using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system known as the immune system of microorganisms. as a guide RNA specific to the target gene. In this case, the guide RNA should have a target gene region of 20 bp in length and a PAM sequence (5'-NGG -3') at the 3' side of the sequence. When the guide RNA recognizes the target gene, the Cas9 protein binds to the guide RNA and acts as a nuclease to cut between the top 3-4 bp from the PAM sequence in the target gene region, causing DNA double strand break (DSB) do. A double-stranded break can lead to sequence correction.

The guide RNA may target a specific sequence of a tomato-derived ms1-like gene (3085bp, Solyc04g00842), and the ms1-like gene may consist of the nucleotide sequence of SEQ ID NO: 1.

The ms1-like gene is a kind of tomato pollen development-related gene, and can be usefully used in male infertility mutants.

In another aspect of the present invention, it relates to a vector for editing tomato gene comprising the guide RNA.

The vector for gene editing of the present invention refers to a vector for plant transformation into which a guide RNA specifically recognized to correct a tomato gene, specifically, an ms1-like gene is introduced.

The vector according to the present invention may further include a nucleotide sequence encoding a cas9 protein.

The vector may be functionally linked with an expression control sequence so that the expression of a desired gene can be suppressed or the expression of a gene can be enhanced. For example, the vector includes a signal sequence or leader sequence for membrane targeting or secretion in addition to expression control elements such as a promoter, operator, initiation codon, stop codon, polyadenylation signal, and enhancer, and can be prepared in various ways depending on the purpose. . In addition, the vector may include a selectable marker, and the vector may be self-replicating or integrated into host DNA.

The vector of the present invention may be prepared using a genetic recombination technique well known in the art, and for site-specific DNA cleavage and ligation, an enzyme generally known in the art may be used.

In one embodiment of the present invention, the gDNA of the green tomato transformant was extracted, PCR was performed with ms1_check_F/R, and the amplified product was cloned into the pGEM T-easy vector and the nucleotide sequence was analyzed. As a result, it was confirmed that one base was added, one base was deleted, and five bases were deleted in the ms1-like gene, but it was confirmed that the gene sequence mutation did not occur in the ^{ms10 35 gene (Fig. 4).} . That is, it was confirmed that transduction of gRNA consisting of the same or complementary nucleotide sequence as SEQ ID NO: 3 efficiently induces sequence mutation (gene correction) of the ms1-like gene of tomato.

In another aspect of the present invention, there is provided a composition for editing tomato genes, specifically ms1-like genes, including the guide RNA or the vector for gene editing.

The composition for ms1-like gene editing of the present invention includes a guide RNA for tomato gene editing comprising the same or complementary nucleotide sequence as SEQ ID NO: 3 or a gene editing vector containing the same.

In another aspect of the present invention, a transgenic plant in which a tomato gene, specifically, an ms1-like gene, is corrected by transducing the vector is provided.

In the present invention, “transformation” refers to a phenomenon in which DNA enters the cell and changes the genetic trait when DNA, which is a genetic material, is injected into a living cell of another lineage. Also called conversion.

In the present invention, "transformation" of a plant with the vector can be performed by transformation techniques known to those skilled in the art. Specifically, transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome-mediated method ( liposome-mediated method, In planta transformation, Vacuum infiltration method, floral meristem dipping method, and Agrobacteria spraying method can

In the present invention, the term "plant" is understood to include not only mature plants, but also plant cells, plant tissues, and seeds of plants that can develop into mature plants.

In the present invention, the plants include vegetable crops including tomatoes, Arabidopsis thaliana, Chinese cabbage, radish, red pepper, strawberry, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion or carrot; food crops including rice, wheat, barley, maize, soybean, potato, wheat, red bean, oat or sorghum; special crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut or rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, poplars, grapes, tangerines, persimmons, plums, apricots or bananas; flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies or tulips; And ryegrass, red clover, orchard grass, alpha alpha, tall fescue or any one selected from the group consisting of forage crops including perennial ryegrass, specifically ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, It is a special crop containing perilla, peanut or rapeseed, and more specifically may be a tomato.

Therefore, the "plant" of the present invention is characterized in that it is transformed into a male infertility mutant by inducing ml1-like gene correction (sequence mutation), specifically, gene insertion or deletion.

In another aspect of the present invention, preparing a tomato gene correction vector comprising a guide RNA consisting of a nucleotide sequence identical to or complementary to SEQ ID NO: 3 and transducing the vector into a plant to correct the tomato gene It provides a method for producing a transgenic plant comprising the.

In the present invention, tomato gene, specifically, ms1-like gene correction means inducing insertion or deletion of the ms1-like gene into a specific region by the guide RNA transduced into the plant. Specifically, the gene may be corrected using the cas9 protein of the gene editing system.

Accordingly, the method of the present invention may include the step of transducing the plant with a cas9 protein additionally treated or a vector expressing the cas9 protein.

In addition, the gene editing vector of the present invention may further include a gene encoding a cas9 protein to simultaneously transduce the guide RNA and the cas9 protein.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

[Example 1] Selection of genes related to tomato pollen development

Among the tomatoes-derived pollen development-related genes, the ms1-like gene (3085bp, Solyc04g008420) of SEQ ID NO: 1 in Table 1 and the ms10 ³⁵ gene (1002 bp, Solyc02g079810) of SEQ ID NO: 2 were selected.

gene name SEQ ID NO: order ms1-like
(Solyc04g008420) SEQ ID NO: 1 ATGTCGACTTTAGATCTGAGCGGATCGAAGAAAAGGAAGAGGAATAATAATGAGAGGGTATCATTTAAGTTCAAGAATTTTGGTGAACAAGGGTTTCCTATAGAGTTCATTGGGTGCAATTTTGACCAAAATGTTAAACTTCTTTTGGAATTTGCACAACAAGAAAATGGGAGTATTTGGTCATTTCAATTGGAAGTTCATAGACATCCACCAATGCATGTGTTCCTATTTGTTGTTGAAGAACAAGTTGAATTGTCACTCAATCCTCATTGCAAACATTGTCAATACATAGGTAATATCACTACCGAAAATTATTACAAGTTCACGTGAAATTTAAATTCTAAATCTGTCACGGAAAAAAAAAGAAATTAATAGAACATTTGGAACATATAGTGATTAGTAACTTCATTTGTTAGGTTTGTGTTTGGTGAAATTAAATCAAATACTAAGTGAAATTACTAAAATATAGTACTAAAAAAATTAAATTTGCTTTGCATGACTTTTATGTTATTAATATAAATCAAATTCTCTTAATTTCTTTCGTATATTTACCTTTTCATATTTTAACTTTCTTAATGAAAAACTAGTTATGCCACCGTTTAACTATCGACGTATAAAAGTTAAACTCATCAAAGTACTTATGCATGGCCTCAGGATGGGGCAACAATTTGATGTGCAACAAGAAGTACCATTTTCTATTGGCTTCAAAGGACACAATTGGAGCTTGTGTAGAAGGAGGAAATGGACAAAAATACAAATATAAAACAGATGTTAATAATATTATTGGTGGAGAAATAATTAAAAGTAAGTTAAATTTGATAGAAATAGAAGGTCATATGATGCATGGTGTGTTTCATTCTAATGGTTTTGGGCATTTGATTTGTGTCAATGGATCATTGGAAACTCCTACTTCTTCTGACTTGCCTGGTCACTCAATTATGGACTTTTGGGATCGACTTTGCATTGGACTTCGTGCTAGGTTTGTCATCATCAACTTAAT TTACTATTTTCGTTTTATTTTATCTGACGGGGTTTGATTCAACTTGAAATTTGACTAACAAAGAAAATATATATAATTTATGATTTTAAACTTATTAGAACATATTTGTAATCGGGTGCGGAGTTAAAATGCCACAATTGATGAAAGCTGCATACATTATATATACAAGATCAATAAAATTTCATGTAACATAACGATAATTGCTTGTTTTCTTCCTGCGTTTACTTTTTTATATATATTTCGTCTCTACTATCTTTGTAGCTGAAAAAATAGTAGAATAGAAAGTTTAAAAGTTACATTATTTTGAAATACATAAATATGCCTTTCGTTATAGAACATTATAAACAAATATCACATAAAACGAAACAAAAATACACTAGTGTATGTTCAAACTGTTTTGTTAGGAGTAGTGTCATGTTAAACTCTGTGTTCAATCAAGCACACATTGCATAAAACGATACACAAGGAGTATCTTTTATGCTTTTATGCACCCCTTAGCCTTAATCATCGTATTTATCTAAATTATATATCCTTCATTTTCCTTTAAACTTGCACTTAAAGTCATAAATAACTTTCTACTTTTTCAAAAAGTCAACAACTTTAGATTATCAAAATGATTAATATTTGAGATCGAAAACAATAATAATTTCTCTATGTTTTTGAAGGAAAGTAAGCTTAAGAGATATCTCAACAAAGAAAGGGATGGATCTAAGGCTACTCAACACATTAGCCTATGGTGAGCCATGGTTTGGTCGATGGGGTTACAAATTTGGGCGTGGGAGCTTTGGTGTTACACAAGAAACATATCAAAGTGCAATTAATGCCTTACAAAACATGCCATTAGCTTTATTAGCACATCATCATCACCATATAGGGATTATAAATATTAATGAGATATTAATAGTGTTATCAAGGTACCAAATGTTATCTGGTCACTCATTAGTCACACTTTGTGATGCCTTTCATTTCATGTTGGAGCTCAAATCAAGGATCCCAAAGG AAAACAATAATCTTACCTCATGTTATCCAGGGCTATTAGTTGACACAACTTGTAGATGGTCACCTAAACGCGTTGAAATGGCTATTAGGGTTGTTGTGGAAGCCCTAAAAGGGGCTAAATCGCGATGGGTGTCTAGGCAAGAGGTTCGTGATGCTGCTCGTGCTTATATTGGTGATACAGGGTTGCTTGATTTCGTTCTCAAGTCATTAGGGAATCATATTGTTGGTAAGTATCTGGTTCGTCGATGCTTAAATCCAGTGACTAAAGTTTTGGAATATTGTTTAGAGGATATATCTAAAGCATTTCCTAAACAAGATCAAGGTTTTAGGGTCAATGACTCAAAAGGGAAACAACAATACAAAATCACATTGGCGCAACTTATGAAGGACATACATTTCTTGTACAACAATATTCTAAAAGAGCATAAGGGATTAATGTCAAATTATACGGGCGTCTTTGCTACAATCCCAACAGCTTCTAGAATAATCCTAGACACGAAGTACTTCCTCAAGGAATACAGAGAGGTATCAGAGCCAGATACAAGAATTGAACCAGATAAATCCAAGATTTATTGCGCGATTATGTTGGCAATCAAGGATGGATTTGGTGTTGAAGAAAAAGTAATGACCCCATTTGAGTGTTTCTTAATGAGAAAAGATGTGACATTTGATGAGCTAAAAATTGAAGTTGAAAAGGCTTTTGGGGATATTTATTTGGGATTAAGGAACTTTACCACAAGATCAATTAACAACTTGATAAGCCCAATTAGTGGAATAGAATTGGTGTTTAATGTGGTGAAACCAGGAAGCAAGATTGTTTTAGGAGGGGTAATAATGTCAAATAATGATGATATTAATATTATTAATAATGGAGGGATATTTGAAGGAATTAAGAATAATAATATTATTATGGATTGTATTTGTGGGACTAAAGATGAAGATGGTGAAAGGATGATTTGTTGTGATATTTGTGAAGTTTGGCAACACACTAGGTGTGTTAA TATACCAAATCATGAAGCAATTCCAGATATATTTCTTTGTAATAAGTGTGAGCAAGATATCTTACAATTTCCTTCATTACCTTAG ms10 ³⁵
(Solyc02g079810) SEQ ID NO: 2 ATGGAATTCCCCAGTACCCCATTTGATAATTCAAACAACTCTGAAGAAAGGGAAGTAGGAAGAAGAACAGATAAAAGGAAGCAAATTGATGGTGAAGTTAAAGAATACAAATCCAAGAACCTTAAGGCTGAGAGAAATAGGCGTCAAAAACTTAGCGAAAGGCTTCTTCAATTACGCTCATTGGTCCCAAACATAACAAATGCAATGAATCAAAAACCTTCATTCTTTACATAGTTTCATAAAGAATGAATTTTTTTAAAAAAAATCTAAAAAAGTTTAAATTCTTGTCTGATTTCAGATGACAAAAGAAACCATAATCACTGACGCCATCACCTACATTAGGGAGCTACAAATGAATGTGGACAACCTAAGTGAGCAGCTTCTTGAAATGGAAGCAACTCAGGGGGAGGAACTGGAGACAAAAAATGAAGAGATTATCGATACTGCAGACGAGATGGGTAAATGGGGCATAGAGGTAGGTAACTTTATGTATAAAACCAAAGTTTCAATCTTTGATATTCTTGAATTATAAGGACAGTAAAACAACTTTGATCTTTGTTTTTCTAAAACAGCCTGAAGTTCAAGTGGCTAACATTGGCCCAACTAAGCTTTGGATAAAAATAGTCTGCCAAAAGAAAAGAGGTGGATTAACTAAACTGATGGAGGCAATGAATGCTCTTGGATTTGATATAAATGACACCAGTGCCACTGCCTCTAAAGGAGCTATTCTTATTACTTCATCTGTGGAGGTAGGAGAAACATATGTTAAAAAAGTAATCTTTTTAGTAGCGATAAAGAAACTATTGCCCGAAAATATCAAGATTTGTAATAGTACAAAAAGGAGATCTTGCTTAGCACCTTGTACTGTGTGTGCTGCAATTATTAGCAACATAAACAATTTATAAATCTTTCTGTGTATTATTTCAGGTGGTTAGAGGTGGACTAACTGAAGCTAATCGAATCAGAGAGATCTTACTGGAGATCATCCACGGAATCTACT AG

[Example 2] Selection of gRNA for production of tomato gene edit

Tomato-derived gRNA (guide RNA) for deleting the ms1-like gene and ms10 ³⁵ gene, respectively, was selected (Table 2, FIGS. 1 and 2).

gRNA name SEQ ID NO: gRNA sequence g_ms1-like SEQ ID NO: 3 5’-CATTAGCCTATTGGTGAGCCA-3’ g_ms10 ³⁵ SEQ ID NO: 4 5’-ATACAAATCCAAGAACCTTA-3’

[Example 3] CRISPR/Cas9 vector production Tomato gene edit production

A CRISPR/Cas9 vector was prepared by using the gRNA of Table 2 above using the Golden gateway method. To prepare the vector, first make an entry vector with the gRNA prepared above, and cut and ligation it with the Cas9 sequence (NCBI Reference Sequence: WP_012560673.1) and NPTII sequence (GenBank: QGV13007.1) to the target vector (destination vector) ) was inserted into pAGM4723. A schematic diagram of a gRNA, CRISPR/Cas9 vector for the production of a tomato gene edit is shown in FIG. 3 .

The produced CRISPR/Cas9 vector was transformed into Agrobacterium tumefaciens EHA105 and then infected with tomato cotyledons to produce a tomato gene edit and cultured in a greenhouse. The temperature of the greenhouse was 25±2° C., and cultured in the greenhouse under light conditions for 16 hours and dark conditions for 8 hours.

[Example 4] Tomato gene edit molecular biological analysis

The gDNA of the green tomato transformant was extracted, PCR was performed with ms1_check_F/R, and the amplified product was cloned into pGEM T-easy vector and sequenced. As a result, the ms1-like gene had a high probability that the gene sequence was mutated. Specifically, in the ms1-like gene, it was confirmed that one base was added, one base was deleted, and five bases were deleted.

On the other hand, as a result of the nucleotide sequence analysis of the PCR product amplified using the ^ms10 35_check_F/R primer in the same way, it was confirmed that the gene sequence mutation of the ^{ms10 35 gene did not occur.}

Through this, it can be confirmed that the ms1-like gene consisting of the same or complementary nucleotide sequence as SEQ ID NO: 3 can be usefully utilized for preparing tomato male infertility mutants.

<110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Guide RNA for editing ms1-like gene and use thereof <130> DP20200034 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 3085 <212> DNA <213> Artificial Sequence <220> <223> ms1-like gene <400> 1 atgtcgactt tagatctgag cggatcgaag aaaaggaaga ggaataataa tgagagggta 60 tcatttaagt tcaagaattt tggtgaacaa gggtttccta tagagttcat tgggtgcaat 120 tttgaccaaa atgttaaact tcttttggaa tttgcacaac aagaaaatgg gagtatttgg 180 tcatttcaat tggaagttca tagacatcca ccaatgcatg tgttcctatt tgttgttgaa 240 gaacaagttg aattgtcact caatcctcat tgcaaacatt gtcaatacat aggtaatatc 300 actaccgaaa attattacaa gttcacgtga aatttaaatt ctaaatctgt cacggaaaaa 360 aaaagaaatt aatagaacat ttggaacata tagtgattag taacttcatt tgttaggttt 420 gtgtttggtg aaattaaatc aaatactaag tgaaattact aaaatatagt actaaaaaaa 480 ttaaatttgc tttgcatgac ttttatgtta ttaatataaa tcaaattctc ttaatttctt 540 tcgtatattt accttttcat attttaactt tcttaatgaa aaactagtta tgccaccgtt 600 taactatcga cgtataaaag ttaaactcat caaagtactt atgcatggcc tcaggatggg 660 gcaacaattt gatgtgcaac aagaagtacc attttctatt ggcttcaaag gacacaattg 720 gagcttgtgt agaaggagga aatggacaaa aatacaaata taaaacagat gttaataata 780 ttaattggtgg agaaataatt aaaagtaagt taaatttgat agaaatagaa ggtcatatga 840 tgcatggtgt gtttcattct aatggttttg ggcatttgat ttgtgtcaat ggatcattgg 900 aaactcctac ttcttctgac ttgcctggtc actcaattat ggacttttgg gatcgacttt 960 gcattggact tcgtgctagg tttgtcatca tcaacttaat ttactatttt cgttttattt 1020 tatctgacgg ggtttgattc aacttgaaat ttgactaaca aagaaaatat atataattta 1080 tgattttaaa cttattagaa catatttgta atcgggtgcg gagttaaaat gccacaattg 1140 atgaaagctg catacattat atatacaaga tcaataaaat ttcatgtaac ataacgataa 1200 ttgcttgttt tcttcctgcg tttacttttt tatatatatt tcgtctctac tatctttgta 1260 gctgaaaaaa tagtagaata gaaagtttaa aagttacatt attttgaaat acataaatat 1320 gcctttcgtt atagaacatt ataaacaaat atcacataaa acgaaacaaa aatacactag 1380 tgtatgttca aactgttttg ttaggagtag tgtcatgtta aactctgtgt tcaatcaagc 1440 acacattgca taaaacgata cacaaggagt atcttttatg cttttatgca ccccttagcc 1500 ttaatcatcg tatttatcta aattatatat ccttcatttt cctttaaact tgcacttaaa 1560 gtcataaata actttctact ttttcaaaaa gtcaacaact ttagattatc aaaatgatta 1620 atatttgaga tcgaaaacaa taataatttc tctatgtttt tgaaggaaag taagcttaag 1680 agatatctca acaaagaaag ggatggatct aaggctactc aacacattag cctatggtga 1740 gccatggttt ggtcgatggg gttacaaatt tgggcgtggg agctttggtg ttacacaaga 1800 aacatatcaa agtgcaatta atgccttaca aaacatgcca ttagctttat tagcacatca 1860 tcatcaccat atagggatta taaatattaa tgagatatta atagtgttat caaggtacca 1920 aatgttatct ggtcactcat tagtcacact ttgtgatgcc tttcatttca tgttggagct 1980 caaatcaagg atcccaaagg aaaacaataa tcttacctca tgttatccag ggctattagt 2040 tgacacaact tgtagatggt cacctaaacg cgttgaaatg gctattaggg ttgttgtgga 2100 agccctaaaa ggggctaaat cgcgatgggt gtctaggcaa gaggttcgtg atgctgctcg 2160 tgcttatatt ggtgatacag ggttgcttga tttcgttctc aagtcattag ggaatcatat 2220 tgttggtaag tatctggttc gtcgatgctt aaatccagtg actaaagttt tggaatattg 2280 tttagaggat atatctaaag catttcctaa acaagatcaa ggttttaggg tcaatgactc 2340 aaaagggaaa caacaataca aaatcacatt ggcgcaactt atgaaggaca tacatttctt 2400 gtacaacaat attctaaaag agcataaggg attaatgtca aattatacgg gcgtctttgc 2460 tacaatccca acagcttcta gaataatcct agacacgaag tacttcctca aggaatacag 2520 agaggtatca gagccagata caagaattga accagataaa tccaagattt attgcgcgat 2580 tatgttggca atcaaggatg gatttggtgt tgaagaaaaa gtaatgaccc catttgagtg 2640 tttcttaatg agaaaagatg tgacatttga tgagctaaaa attgaagttg aaaaggcttt 2700 tggggatatt tatttgggat taaggaactt taccacaaga tcaattaaca acttgataag 2760 cccaattagt ggaatagaat tggtgtttaa tgtggtgaaa ccaggaagca agattgtttt 2820 aggaggggta ataatgtcaa ataatgatga tattaatatt attaataatg gagggatatt 2880 tgaaggaatt aagaataata atattattat ggattgtatt tgtgggacta aagatgaaga 2940 tggtgaaagg atgatttgtt gtgatatttg tgaagtttgg caacacacta ggtgtgttaa 3000 tataccaaat catgaagcaa ttccagatat atttctttgt aataagtgtg agcaagatat 3060 cttacaattt ccttcattac cttag 3085 <210> 2 <211> 1002 <212> DNA <213> Artificial Sequence <220> <223> ms1035 gene <400> 2 atggaattcc ccagtacccc atttgataat tcaaacaact ctgaagaaag ggaagtagga 60 agaagaacag ataaaaggaa gcaaattgat ggtgaagtta aagaatacaa atccaagaac 120 cttaaggctg agagaaatag gcgtcaaaaa cttagcgaaa ggcttcttca attacgctca 180 ttggtcccaa acataacaaa tgcaatgaat caaaaacctt cattctttac atagtttcat 240 aaagaatgaa tttttttaaa aaaaatctaa aaaagtttaa attcttgtct gatttcagat 300 gacaaaagaa accataatca ctgacgccat cacctacatt agggagctac aaatgaatgt 360 ggacaaccta agtgagcagc ttcttgaaat ggaagcaact cagggggagg aactggagac 420 aaaaaatgaa gagattatcg atactgcaga cgagatgggt aaatggggca tagaggtagg 480 taactttatg tataaaacca aagtttcaat ctttgatatt cttgaattat aaggacagta 540 aaacaacttt gatctttgtt tttctaaaac agcctgaagt tcaagtggct aacattggcc 600 caactaagct ttggataaaa atagtctgcc aaaagaaaag aggtggatta actaaactga 660 tggaggcaat gaatgctctt ggatttgata taaatgacac cagtgccact gcctctaaag 720 gagctattct tattacttca tctgtggagg taggagaaac atatgttaaa aaagtaatct 780 ttttagtagc gataaagaaa ctattgcccg aaaatatcaa gatttgtaat agtacaaaaa 840 ggagatcttg cttagcacct tgtactgtgt gtgctgcaat tattagcaac ataaacaatt 900 tataaatctt tctgtgtatt atttcaggtg gttagaggtg gactaactga agctaatcga 960 atcagagaga tcttactgga gatcatccac ggaatctact ag 1002 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> g_ms1-like <400> 3 cattagccta tggtgagcca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> g_ms1035 <400> 4 atacaaatcc aagaacctta 20

Claims (11)

Guide RNA for tomato gene editing consisting of the same or complementary nucleotide sequence as SEQ ID NO: 3. According to claim 1, wherein the tomato gene is characterized in that the ms1-like gene consisting of SEQ ID NO: 1, guide RNA. A vector for editing tomato gene comprising the guide RNA of claim 1. The vector according to claim 3, wherein the tomato gene is an ms1-like gene consisting of SEQ ID NO: 1. The vector according to claim 3, further comprising a nucleotide sequence encoding a cas9 protein. A composition for tomato gene editing comprising the guide RNA of claim 1 or the vector for gene editing of claim 3 . A transgenic plant in which the tomato gene is corrected by transducing the vector of claim 3 or 5. The plant according to claim 7, wherein the plant is a male infertility mutant. Preparing a tomato gene correction vector comprising a guide RNA consisting of the same or complementary nucleotide sequence as SEQ ID NO: 3; and
Transducing the vector into a plant comprising the step of correcting the tomato gene,
A method for producing a transgenic plant. The method according to claim 9, wherein the tomato gene is an ms1-like gene consisting of SEQ ID NO: 1. The method according to claim 9, wherein the plant is a male sterility mutant.

Images