KR20210124566A - Kit for analyzing phthalic based material using aptamer and method for analyzing phthalic based material using the same - Google Patents

Abstract

Provided are a kit for detecting a phthalate-based material using aptamer and a method for detecting phthalate-based material using the same. The kit comprises: a specimen injection pad; a specimen developing pad; and a combining pad for connecting the specimen injection pad and the specimen developing pad, wherein the specimen developing pad comprises aptamer of SEQ ID NO: 1 specifically combined to a phthalate-based material, an aptamer degenerated material combined with the aptamer, and a combining material combined with the aptamer degenerated material. The combining pad comprises quantum dots, and nucleic acid combined with the quantum dots and having complementary sequence to the aptamer. According to the present invention, the phthalate-based material can be detected at high sensitivity.

Description

A kit for detecting a phthalate-based substance using an aptamer and a method for detecting a phthalate-based substance using the same

The present invention relates to a kit for detecting a phthalate-based substance using an aptamer and a method for detecting a phthalate-based substance using the same. More particularly, the present invention relates to a kit capable of detecting a phthalate-based material using an aptamer and quantum dots, and a method for detecting a phthalate-based material using the same.

Recently, as AI and automation technologies are increasing throughout the industry, there is a demand for detection technology for chemical substances. Among chemical substances, phthalate-based substances are being regulated. Countries around the world have made a tentative decision that six types of phthalate-based substances, including diethylhexyl phthalate (DEHP), are harmful to the human body, and have been managing these phthalate-based substances as suspected environmental hormones that cause endocrine disorders since 1999.

Looking at the technology for detecting phthalate-based substances, gas chromatography-mass spectrometry (GC-MS) equipped with a pyrolyzer/thermal deseorption accessory (thermal deseorption accessory) Py/TD-GC-MS) is used to analyze phthalate-based materials. Although the GC-MS analysis method has high accuracy, it takes a long time for pre-treatment (over 50 minutes) for analysis, and additional cleaning and pre-treatment facility management are required. The Py/TD-GC-MS analysis method has a short pre-treatment time and does not require additional facility management, but has a limitation in that the accuracy is lowered.

Korean Patent Registration No. 10-1971449 describes a single-stranded DNA aptamer that specifically binds to phthalate. However, in this method, the means for determining the presence or absence of phthalate is not clear, so even if an aptamer is used, it may be difficult to know the presence or absence of phthalate by a simple method.

On the other hand, as the phthalate-based material is present anywhere, it should be able to easily detect the phthalate-based material anywhere in the field that needs to be detected. For this, it should be possible to discriminate with high sensitivity even in the solid phase.

An object of the present invention is to provide a kit for detecting a phthalate-based substance, capable of detecting a phthalate-based substance.

Another object of the present invention is to provide a kit for detecting phthalate-based substances, which can detect phthalate-based substances with high sensitivity and can detect them in a simple manner even in the field.

The above object of the present invention is solved by a kit and a detection method for detecting a phthalate-based substance using the following aptamer.

A kit for detecting a phthalate-based material using an aptamer of the present invention includes a sample injection pad, a sample development pad, and a bonding pad connecting the sample injection pad and the sample development pad, wherein the sample development pad is attached to the phthalate-based material. Aptamer of SEQ ID NO: 1 that specifically binds; an aptamer-modified material bound to the aptamer; and a binding material bonded to the aptamer-modified material, wherein the bonding pad comprises: quantum dots; and a nucleic acid that is bound to the quantum dot and has a complementary sequence to the aptamer.

In one embodiment, the phthalate-based material may include at least one of diethylhexyl phthalate (DEHP), benzylbutyl phthalate (BBP), dibutyl phthalate (DBP), and diisobutyl phthalate (DIBP).

In one embodiment, the aptamer may be fixed to the sample development pad by binding the aptamer-modified material and the binding material.

In one embodiment, the aptamer-modified material may be biotin, and the binding material may be streptavidin.

In one embodiment, the quantum dot may include a core and a shell surrounding the core.

In one embodiment, the quantum dots may further include one or more of a stabilizing layer, a ligand, and a ligand layer.

In one embodiment, the quantum dots may be made of CdSe and ZnS.

In one embodiment, the presence of the phthalate-based material may be confirmed by a decrease or absence of a luminescence signal due to a reaction between the aptamer and the phthalate-based material.

In one embodiment, the kit for detecting a phthalate-based material using the aptamer may further include at least one of an absorption pad and a light irradiation unit.

The method for detecting a phthalate-based substance of the present invention includes using a kit for detecting a phthalate-based substance using the aptamer of the present invention.

According to the present invention, a kit for detecting a phthalate-based substance capable of detecting a phthalate-based substance is provided.

According to the present invention, a kit for detecting a phthalate-based substance that can detect a phthalate-based substance with high sensitivity and can be detected by a simple method even in the field is provided.

1 illustrates a cross-sectional view (FIG. 1 (a)) of a kit according to an embodiment of the present invention and its driving mechanism (FIG. 1 (b) and (c)).
2 is a schematic diagram of binding DEHP modified to have a carboxylic acid group to a magnetic bead.
3 is a schematic diagram of a method for assaying the binding affinity of the aptamer of SEQ ID NO: 1 to DEHP.
4 is a Kd analysis result of the aptamer of SEQ ID NO: 1 for DEHP. In FIG. 4 , the X-axis is the DEHP concentration, and the Y-axis is the luminescence value (FLU).
5a and 5b show the results of the kit implementation of FIG. 1 according to the concentration of DEHP in Example 5, respectively.

As used herein, the term “phthalate-based material” refers to an ester of substituted or unsubstituted phthalic acid.

In one embodiment, the phthalate-based material may include at least one of diethylhexyl phthalate (DEHP), benzylbutyl phthalate (BBP), dibutyl phthalate (DBP), and diisobutyl phthalate (DIBP), but is limited thereto. doesn't happen

As used herein, the term “quantum dot” refers to a semiconductor nanoparticle, and refers to a particle having a characteristic of emitting different light depending on the size of the particle due to the quantum isolation effect.

As used herein, "sample" is a concept encompassing samples in which a phthalate-based material may be present.

In one embodiment, the sample may include a liquid sample obtained by pretreatment of various chemical products, water, soil, and air available from the environment. The pretreatment may include, but is not limited to, extraction, dissolution, and the like.

As used herein, "nucleic acid" may refer to DNA, a single-stranded strand of DNA, or RNA.

As used herein, the term "first sequence" refers to a sequence complementary to at least a portion of an aptamer or including a sequence complementary to at least a portion of an aptamer.

As used herein, the term “second sequence” refers to a sequence present in the control region of the sample development pad.

As used herein, the term “third sequence” refers to a sequence that includes a sequence complementary to at least a portion of the second sequence or is complementary to at least a portion of the second sequence.

Hereinafter, a kit for detecting a phthalate-based substance using an aptamer according to an embodiment of the present invention will be described in more detail.

The present invention is a kit (hereinafter, referred to as "kit") for detecting a phthalate-based material using an aptamer, using an aptamer of SEQ ID NO: 1 that is fixed to a sample development pad and specifically binds to a phthalate-based material, Quantum dots included in the bonding pad are used as a means of determining the presence or absence of a phthalate-based material, that is, the presence of a phthalate-based material in the sample. Through this, the present invention can detect a phthalate-based material with high sensitivity.

In one embodiment, the kit of the present invention may have a detection limit of 700 ppm or less of a phthalate-based material.

In one embodiment, the kit of the present invention can detect one or more of diethylhexyl phthalate (DEHP), benzylbutyl phthalate (BBP), dibutyl phthalate (DBP), and diisobutyl phthalate (DIBP) among phthalate-based substances. can

In the kit of the present invention, the aptamer is bound to an aptamer-modified substance. Through this, the kit of the present invention allows the aptamer to be fixed to the sample development pad by binding the modified material and the binding material described in detail below, and can facilitate the detection of the phthalate-based material even in a solid phase. In addition, the kit of the present invention can easily and conveniently determine the presence or absence of a phthalate-based material, and can be determined with high sensitivity. That is, it is possible to determine the presence or absence of a phthalate-based material with high sensitivity compared to the analysis in which the quantum dots bound to the aptamer are included in the liquid phase and the sample is injected.

In one embodiment, the aptamer-modified material may be biotin.

In one embodiment, the binding agent may be streptavidin.

The kit of the present invention includes a sample injection pad, a sample development pad, and a bonding pad connecting the sample injection pad and the sample development pad. The sample development pad includes an aptamer of SEQ ID NO: 1 that specifically binds to a phthalate-based material. The quantum dots are included in the bonding pad.

In the kit of the present invention, a test region and a control region may be present on the sample development pad.

When a phthalate-based material is present in the sample, the test region does not emit light or decreases light emission compared to the control region, thereby directly confirming the presence of the phthalate-based material. The test area may be an area having a predetermined width or may be a single line.

The control region is an indicator indicating that the sample has completely moved through the sample development pad, and may increase the reliability of the analysis of the phthalate-based material. The control region may be a region having a predetermined width or may be a single line.

The test area and control area may be located anywhere on the sample deployment pad. Preferably, since the test region is located closer to the bonding pad than the control region, it is possible to ensure that the sample has moved through the sample development pad, thereby increasing the analysis reliability of the phthalate-based material.

The kit of the present invention may further include an absorbent pad connected to the sample development pad.

The absorbent pad allows the sample that has passed through the sample development pad, specifically, the control region, to be absorbed and removed, so that the phthalate-based material can be detected by a simple method using the kit of the present invention in a field requiring detection of the phthalate-based material.

The kit for detecting a phthalate-based material of the present invention may further include a light irradiation unit for irradiating light to the sample development pad.

The light irradiation unit may be one that emits ultraviolet rays. The light irradiation unit directly irradiates light to the test area and the control area existing on the sample development pad. The light irradiation unit may be present in a position that does not interfere with the flow of the fluid in the sample development pad, and the light irradiation may be performed in a range, intensity, and time that does not interfere with the reaction between the aptamer and the phthalate-based material in the sample development pad. . The light irradiation unit may make it possible to easily check the reaction between the aptamer and the phthalate-based material on the sample development pad, and induce fluorescence of the quantum dots. Accordingly, the presence or absence of a phthalate-based material may be measured and/or detected.

Hereinafter, a kit for detecting a phthalate-based material according to an embodiment of the present invention will be described with reference to FIG. 1 .

In FIG. 1 (a) is a cross-sectional view of a kit according to an embodiment of the present invention, and in FIG. 1 (b) describes the operation mechanism of the kit when a sample containing no phthalate-based material is injected into the sample injection pad, and , (c) in FIG. 1 describes the operation mechanism of the kit when a sample containing a phthalate-based material is injected into the sample injection pad.

Referring to FIG. 1A , the kit includes a sample injection pad 100 , a bonding pad 200 , a sample development pad 300 , and an absorption pad 400 .

The sample injection pad 100 is a pad into which a sample to be measured is injected.

The bonding pad 200 connects the sample injection pad 100 and the sample development pad 300 .

The absorbent pad 400 is connected to the sample development pad 300 . Through this, the sample injected into the sample injection pad 100 sequentially moves the bonding pad 200 , the sample development pad 300 , and the absorption pad 400 , thereby enabling analysis of the phthalate-based material in the sample.

At least one of the sample injection pad 100 , the bonding pad 200 , the sample development pad 300 , and the absorption pad 400 may be formed of a material commonly known to those skilled in the art in the kit. For example, the material is a porous thin film material, and may include, for example, one or more of nylon, polyester, cellulose, polysulfone, polyvinylidene fluoride, cellulose acetate, polyurethane, glass fiber, and nitrocellulose. can, but is not limited thereto.

At least one of the sample injection pad 100 , the bonding pad 200 , the sample development pad 300 , and the absorption pad 400 may be composed of only the above-described material, but in order to further facilitate the development of the sample, It may further include a reagent. The developing reagent may include, but is not limited to, a buffer solution, an aqueous solvent including distilled water, an organic solvent, and the like. However, the developing reagent should not denaturate the aptamer and/or various nucleic acids and/or sequences (including antisense and probes) described in the present invention, and should not affect the presence and/or concentration of phthalate-based substances.

Although not shown in FIG. 1 , the sample injection pad 100 , the bonding pad 200 , the sample development pad 300 , and the absorption pad 400 may be integrally formed and included in an external container storing them.

A test area 310 and a control area 320 are sequentially formed on the sample development pad 300 from the bonding pad 200 .

The test region 310 includes an aptamer 311 that specifically binds to a phthalate-based material.

First, the aptamer 311 specifically binding to the phthalate-based material will be described.

The aptamer 311 includes a DNA sequence itself selected to specifically bind to a phthalate-based material or a single-stranded sequence including the corresponding DNA sequence.

Aptamer (311) is the following SEQ ID NO: 1. Preferably, the aptamer of SEQ ID NO: 1 can bind specifically to DEHP:

SEQ ID NO: 1: 5'-CGTGATTGTGGATTTTTAACGTTGAGGAACCATTGTTATGTTTAGCTGCCGA -3'

In one embodiment, the aptamer may have a binding efficiency of 50% or more to a phthalate-based material, preferably 50% to 90%. In the above range, the binding efficiency for the phthalate-based material is high, and thus the detection limit for the phthalate-based material may be lowered. The "binding efficiency" may be measured by an ELISA method of measuring binding force.

In one embodiment, the aptamer may have a binding force to a phthalate-based material of less than 1 μM, preferably 0.3 μM or more and less than 1 μM. In the above range, the binding efficiency for the phthalate-based material is high, and thus the detection limit for the phthalate-based material may be lowered. The "binding force" can be measured by the binding force measurement method of the ELISA method.

In the kit of the present invention, the aptamer may bind to the above-described four phthalate-based substances, that is, DEHP, BBP, DBP, and DIBP. Preferably, the aptamer of SEQ ID NO: 1 is capable of binding to DEHP.

The aptamer 311 is 5' or 3' modified by the aptamer-modified material 312 in order to be fixed to the sample development pad 300 , more specifically, the test region 310 . The aptamer 311 may be modified by the aptamer-modified material 312 to be fixed to the test region 310 of the sample development pad 300 through the binding between the binding material 313 and the aptamer-modified material 311 . have.

The aptamer-modified material 312 may be biotin. The binding material 313 may be streptavidin.

The bonding pad 200 includes quantum dots 211 .

In one embodiment, the bonding pad 200 may not contain an aptamer that specifically binds to the above-described phthalate-based material.

First, the quantum dots 211 used in the present invention will be described.

A quantum dot may include a core and a shell surrounding the core. Quantum dots may be composed of only a core and a shell, but may further include a stabilizing layer between the core and the shell, or may further include a stabilizing layer on the outside of the shell, that is, opposite to the core, or outside of the shell, that is, opposite to the core. It may further include a ligand (or a ligand layer). The ligand layer refers to a layer in which a space occupied by a ligand is formed.

The core, the shell, and the stabilizing layer may each include at least one of a Group 12-16 compound, a Group 13-15 compound, and a Group 14-16 compound.

Group 12-16 compounds include cadmium sulfide (CdS), cadmium selenide (CdSe), cadmium thelenide (CdTe), zinc sulfide (ZnS), zinc selenide (ZnSe), zinc thelenide (ZnTe), mercury sulfide ( HgS), Mercury Selenide (HgSe), Mercury Telenide (HgTe), Zinc Oxide (ZnO), Cadmium Oxide (CdO), Mercury Oxide (HgO), Cadmium Selenium Sulfide (CdSeS), Cadmium Selenium Telenide (CdSeTe), Cadmium Sulfide Telenide (CdSTe), Cadmium Zinc Sulfide (CdZnS), Cadmium Zinc Selenide (CdZnSe), Cadmium Sulfide Selenide (CdSSe), Cadmium Zinc Telenide (CdZnTe), Cadmium Mercury Sulfide (CdHgS), Cadmium Mercury Selenide (CdHgSe), Cadmium Mercury Telenide (CdHgTe), Zinc Selenium Sulfide (ZnSeS), Zinc Selenium Telenide (ZnSeTe), Zinc Sulfide Telenide (ZnSTe), Mercury Selenium Sulfide (HgSeS), Mercury Selenium Telenide (HgSeTe), Mercurysulfide Telenide (HgSTe), Mercury Zinc Sulfide (HgZnS), Mercury Zinc Selenide (HgZnSe), Cadmium Zinc Oxide (CdZnO), Cadmium Mercury Oxide (CdHgO), Zinc Mercury Oxide (ZnHgO), Zinc Selenium Oxide (ZnSeO) , Zinc Telenium Oxide (ZnTeO), Zinc Sulfide Oxide (ZnSO), Cadmium Selenium Oxide (CdSeO), Cadmium Telenium Oxide (CdTeO), Cadmium Sulfide Oxide (CdSO), Mercury Selenium Oxide (HgSeO), Mercury Telenium Oxide ( HgTeO), Mercurysulfide Oxide (HgSO), Cadmium Zinc Selenium Sulfide (CdZnSeS), Cadmium Zinc Selenium Telenide (CdZnSeTe), Cadmium Zinc Sulfide Telenide (CdZnSTe), Cadmium Mercury Selenium Sulfide (CdHgSeS), Cadmium Mercury Selenium Sulfide (CdHgSeS) CdHgSeTe), Cadmium Mercury Sulfide Telenide (CdHgSTe), Mercury Zinc Selenium Sulfide (HgZnSeS), Mercury Zinc Selenium Telenide (HgZnSeTe), Mercury Zinc Sulfide Telenide (HgZnSTe), Cadmium Zinc Selenide Cadmium Zinc Telenium Oxide (CdZnTeO), Cadmium Zinc Sulfide Oxide (CdZnSO), Cadmium Mercury Selenium Oxide (CdHgSeO), Cadmium Mercury Selenium Oxide (CdHgTeO), Cadmium Mercury Sulfide Oxide (CdHgSO) It may include at least one of selenium oxide (ZnHgSeO), zinc mercury terenium oxide (ZnHgTeO), and zinc mercury sulfide oxide (ZnHgSO).

Group 13-15 compounds are gallium phosphorus (GaP), gallium arsenide (GaAs), gallium antimony (GaSb), gallium nitride (GaN), aluminum phosphorus (AlP), aluminum arsenide (AlAs), aluminum Antimony (AlSb), aluminum nitride (AlN), indium phosphorus (InP), indium arsenide (InAs), indium antimony (InSb), indium nitride (InN), gallium phosphorous arsenide (GaPAs), Gallium phosphorus antimony (GaPSb), gallium phosphorus nitride (GaPN), gallium arsenide nitride (GaAsN), gallium antimony nitride (GaSbN), aluminum phosphorous arsenide (AlPAs), aluminum phosphorus antimony (AlPSb), aluminum phosphorus nitride (AlPN), aluminum arsenide nitride (AlAsN), aluminum antimony nitride (AlSbN), indium phosphorus arsenide (InPAs), indium phosphorus antimony (InPSb), indium phosphorus nitride (InPN), indium arsenide nitride (InAsN), indium antimony nitride (InSbN), aluminum gallium phosphorus (AlGaP), aluminum gallium arsenide (AlGaAs), aluminum gallium antimony (AlGaSb), Aluminum gallium nitride (AlGaN), aluminum arsenide nitride (AlAsN), aluminum antimony nitride (AlSbN), indium gallium phosphorus (InGaP), indium gallium arsenide (InGaAs), indium gallium antimony (InGaSb), Indium gallium nitride (InGaN), indium arsenide nitride (InAsN), indium antimony nitride (InSbN), aluminum indium phosphorus (AlInP), aluminum indium arsenide (AlInAs), aluminum indium antimony (AlInSb), Aluminum indium nitride (AlInN), aluminum arsenide nitride (AlAsN), aluminum antimony nitride (AlSbN), aluminum phosphorus nitride (AlPN), gallium aluminum phosphorous arsenide (GaAlPAs), gallium aluminum phosphorus anti Mono (GaAlPSb), gallium indium phosphorus arsenide (GaInPAs), gallium phosphorus Aluminum aluminum arsenide (GaInAlAs), gallium aluminum phosphorus nitride (GaAlPN), aluminum aluminum arsenide nitride (GaAlAsN), gallium aluminum antimony nitride (GaAlSbN), gallium indium phosphorus nitride (GaInPN), gallium indium Arsenide nitride (GaInAsN), gallium indium aluminum nitride (GaInAlN), gallium antimony phosphorus nitride (GaSbPN), gallium arsenide phosphorus nitride (GaAsPN), gallium arsenide antimony nitride (GaAsSbN), Gallium indium phosphorus antimony (GaInPSb), gallium indium phosphorus nitride (GaInPN), gallium indium antimony nitride (GaInSbN), gallium phosphorus antimony nitride (GaPSbN), indium aluminum phosphorous arsenide (InAlPAs) , Indium aluminum phosphorus nitride (InAlPN), indium phosphorus arsenide nitride (InPAsN), indium aluminum antimony nitride (InAlSbN), indium phosphorus antimony nitride (InPSbN), indium arsenide antimony nitride (InAsSbN) and indium aluminum phosphorus antimony (InAlPSb).

Group 14-16 compounds are tin oxide (SnO), tin sulfide (SnS), tin selenide (SnSe), tin thelenide (SnTe), lead sulfide (PbS), lead selenide (PbSe), lead thelenide ( PbTe), germanium oxide (GeO), germanium sulfide (GeS), germanium selenide (GeSe), germanium telenide (GeTe), tin selenium sulfide (SnSeS), tin selenium telenide (SnSeTe), tin sulfide Telenide (SnSTe), lead selenium sulfide (PbSeS), lead selenium thelenide (PbSeTe), lead sulfide teleenide (PbSTe), tin lead sulfide (SnPbS), tin lead selenide (SnPbSe), tin lead thelenide (SnPbTe) ), tin oxide sulfide (SnOS), tin oxide selenide (SnOSe), tin oxide telenide (SnOTe), germanium oxide sulfide (GeOS), germanium oxide selenide (GeOSe), germanium oxide telenide (GeOTe) , tin lead sulfide selenide (SnPbSSe), tin lead sulfide selenide (SnPbSeTe), and tin lead sulfide selenide (SnPbSTe).

The diameter of the core may be 1 nm to 6 nm, specifically 1.2 nm to 5 nm, more specifically 2 nm to 5 nm. In the above range, two or more stable layers may be included, and the optical efficiency of quantum dots is excellent.

The thickness of the shell may be 0.5 nm to 10 nm, specifically 0.5 nm to 8 nm, more specifically 0.5 nm to 6 nm. In the above range, the stability of the quantum dot is increased. The shell may include two or more shells.

The stabilizing layer may be included as one layer in the quantum dot, but may be included as two or more layers. That is, a first stabilizing layer may be included between the core and the shell, and a second stabilizing layer may be included outside the shell. Alternatively, the core and the shell, and the outer layer of the shell may include a first stabilizing layer and a second stabilizing layer from the shell.

The ligand (or ligand layer) may include at least one of a water-soluble ligand and a fat-soluble ligand.

Fat-soluble ligands are tri-n-octylphosphine oxide, decylamine, didecylamine, tridecylamine, tetradecylamine, pentadecylamine (pentadecylamine), hexadecylamine, octadecylamine, undecylamine, dioctadecylamine, N,N-dimethyldecylamine, N, N,N-dimethyldodecylamine, N,N-dimethylhexadecylamine, N,N-dimethyltetradecylamine, N,N- Dimethyltridecylamine (N,N-dimethyltridecylamine), N,N-dimethylundecylamine (N,N-dimethylundecylamine), N-decylamine (N-decylamine), N-methyloctadecylamine (N-methyloctadecylamine), Didodecylamine, tridodecylamine, cyclododecylamine, N-methyldodecylamine, trioctylamine, lauric acid, palmitic acid, oleic acid, stearic acid, myristicacid, elaidic acid, eicosanoic acid, heneicosanoic acid , tricosanoic acid, docosanoic acid, tetracosanoic acid, hexacosanoic acid, heptacosanoic ac id), octacosanoic acid, and cis-13-docosenoic acid.

Water-soluble ligands include silica, polyethylene glycol (PEG), mercaptopropionic acid (MPA), cysteamine, mercapto-acetic acid, mercapto-undecanol, 2-mercaptoethanol (2-mercapto-ethanol), 1-thio-glycerol (1-thio glycerol), deoxyribonucleic acid (DNA), mercapto acetic acid, mercapto-undecanoic acid ), 1-mercapto-6-phenyl hexane (1-mercapto-6-phenyl-hexane), 1,16-dimercapto-hexadecane (1,16-dimecapto-hexadecane), 18-mercapto-octadecylamine (18-mercapto-octadecyl amine), tri-octyl phosphine, 6-mercapto-hexane, 6-mercapto-hexanoic acid , 16-mercapto-hexadecanoic acid (16-mercapto-hexadecanoic acid), 18-mercapto-octadecylamine (18-mercapto-octadecyl amine), 6-mercapto-hexylamine (6-mercapto-hexyl) amine) or 8-hydroxy-octylthiol, 1-thio-glycerol, mercapto-acetic acid, mercapto-undecanoic acid acid), hydroxamate, a derivative of hydroxamic acid, and ethylene diamine (ethylene diamine).

The quantum dots may have an average particle diameter of 6 to 30 nm, specifically 6 to 20 nm. Within the above range, there may be an advantage of excellent optical properties.

In quantum dots, the core may include cadmium and selenium. The shell and the stabilizing layer may each include at least one of cadmium, selenium, zinc, and sulfur. Preferably, the core, shell and stabilizing layer may each comprise cadmium. Preferably, the content (mol%) of cadmium or selenium may increase toward the core of the quantum dot.

Quantum dots may be prepared by conventional methods known to those skilled in the art, and more detailed information follows prior art known in relation to quantum dots.

In one embodiment, the quantum dots may be made of CdSe and ZnS.

In the binding pad 200 , the quantum dots 211 are bound to a predetermined nucleic acid 212 . By including a predetermined nucleic acid 212, the movement of the quantum dots 211 can be facilitated. The quantum dots may be bound to 5' or 3' of the nucleic acid 212 .

In one embodiment, the binding pad may include a conjugate in which the nucleic acid 212 is bound to the quantum dot 211 .

Hereinafter, the nucleic acid 212 to which the quantum dots 211 are bound will be described.

The nucleic acid 212 to which the quantum dot 211 is bound includes a sequence complementary to the above-described aptamer 311, that is, a first sequence. Through this, the nucleic acid 212 to which the quantum dots 211 are bound is specifically bound to the aptamer 311 present in the test region 310 of the sample deployment pad 300 to determine the presence or absence of a phthalate-based material in the sample. make it possible This will be described in more detail in (b) and (c) of FIG. 1 below.

The nucleic acid 212 to which the quantum dot 211 is bound may further include a sequence complementary to the sequence 321 (eg, the second sequence) present in the control region 320 described in detail below, for example, a third sequence. have. Through this, it is possible to confirm that the sample has moved to the control region of the sample development pad, thereby increasing the analysis reliability of the detection of the phthalate-based material.

In one embodiment, the nucleic acid 212 to which the quantum dot 211 is bound may include both a first sequence and a third sequence.

Preferably, the nucleic acid 212 to which the quantum dot 211 is bound is a sequence present in the control region detailed below in the order of 5' to 3', that is, a sequence complementary to the second sequence, that is, the third sequence, and the above-described app. It may include a single-stranded sequence comprising a first sequence that is a complementary sequence to the tamer. A quantum dot may be bound to the 5' end of the sequence.

In one embodiment, the nucleic acid 212 may be 5'-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3' (SEQ ID NO: 2).

In one embodiment, the nucleic acid 212 may be modified to have a thiol group at the 5' end to facilitate binding to the quantum dots (eg, 5'-thiol-CAATGGTTCCTCAA-CCCCCCCCCCCCCC-3').

Preferably, the third sequence may be different from the first sequence.

The control region 320 includes a conventional means for confirming that the sample injected into the sample injection pad 100 completely moves the test region 310 through the bonding pad 200 and the sample development pad 300 . may include In the present invention, to the extent that quantum dots are used for detection of phthalate-based substances, a detection means using quantum dots is used in the control region as well.

The control region 320 may include a second sequence 321 . Through this, the nucleic acid 212 present in the binding pad moves to the control region, and the second sequence and the third sequence are complementary to each other, thereby finally emitting light by the quantum dots, thereby increasing analysis reliability.

The second sequence 321 may also be immobilized on the control region 320 .

In one embodiment, the second sequence may be 5'-GGGGGGGGGG-3' (SEQ ID NO: 3).

A method for fixing the second sequence 321 is not particularly limited. For example, the second sequence 321 is denatured with a denatured substance 322 , and a binding reaction between the denatured substance 322 and the binding substance 323 is performed by the binding substance 323 immobilized on the control region 320 . can be fixed through

In one embodiment, the modified material 322 may be biotin.

In one embodiment, the binding agent 323 may be streptavidin.

An operation mechanism of the kit will be described with reference to FIG. 1B , when a sample not containing a phthalate-based material is injected into the sample injection pad.

Referring to FIG. 1B , a sample 500 that does not include a phthalate-based material is injected into the sample injection pad 100 .

The injected sample 500 passes through the sample injection pad 100 and sequentially moves through the bonding pad 200, the test area 310 of the sample development pad 300, and the control area 320, and then the absorption pad ( 400) and finally move.

As the sample 500 moves from the binding pad 200 to the sample development pad 300 , the quantum dot 211-bound nucleic acid 212 binder existing in the binding pad 200 also moves to the sample development pad. The quantum dot-coupled nucleic acid conjugate may be a conjugate in which a first sequence and a third sequence are bonded to quantum dots.

When the quantum dot-coupled nucleic acid binder reaches the test region 310 , it binds to the aptamer 311 present in the test region. The quantum dot-coupled nucleic acid binder remaining after passing through the test region 310 binds to the second sequence 321 present in the control region 320 .

By irradiating light through a light irradiation unit (not shown in Fig. 1), both the test region (indicated by T in Fig. 1 (b)) and the control region (indicated by C in Fig. 1 (b)) emit light. do. Through this, it can be confirmed that there is no phthalate-based material in the sample and the analysis of the sample has been reliably completed.

An operation mechanism of the kit will be described with reference to FIG. 1C , when the sample 600 containing the phthalate-based material 610 is injected into the sample injection pad.

The presence of the phthalate-based material 610 in the sample may be confirmed by a decrease or absence of a light emission signal due to a reaction between the aptamer 311 and the phthalate-based material 610 .

Referring to FIG. 1C , as in FIG. 1B , the quantum dots 211 existing in the binding pad 200 as the sample 600 moves from the binding pad 200 to the sample development pad 300 . The bound nucleic acid 212 conjugate also moves to the sample development pad 300 .

When the quantum dot 211-bound nucleic acid 212 conjugate reaches the test region 310, the phthalate-based material 610 in the sample also reaches the test region. The aptamer 311 present in the test region 310 binds to the phthalate-based material 610 in the sample before binding to the quantum dot 211-coupled nucleic acid 212 binder.

Conversely, the quantum dot 211 bound nucleic acid 212 cannot bind to the aptamer 311 . The quantum dot-coupled nucleic acid 212 may be removed from the kit by a method such as washing.

The quantum dot-coupled nucleic acid binder remaining after passing through the test region 310 binds to the second sequence 321 present in the control region. By irradiating light through the light irradiation unit, the test area (indicated by T in FIG. 1C ) does not emit light, but the control area (indicated by C in FIG. 1C ) emits light. Through this, it can be confirmed that the phthalate-based material is present in the sample and that the analysis of the sample is also reliably completed. In FIG. 1(c) as compared to FIG. 1(b), the emission signal in the test region is decreased or absent, so that it can be confirmed that the phthalate-based material is present in the sample due to the decrease or absence of the emission signal.

Hereinafter, a method for detecting a phthalate-based material according to an embodiment of the present invention will be described.

The method for detecting a phthalate-based substance of the present invention includes using the phthalate-based substance detection kit of the present invention.

Specifically, a sample to be analyzed for the presence or absence of a phthalate-based material is injected into a sample injection pad of a phthalate-based material detection kit, the phthalate-based material kit is left under a predetermined condition, and a light irradiation unit is irradiated to emit light from quantum dots It may include the step of confirming.

The phthalate-based material kit of the present invention utilizes complementary binding of various nucleic acid sequences including aptamers. Therefore, after injecting the sample into the sample injection pad, the phthalate-based material kit may be left under a predetermined condition in order to facilitate the complementary binding.

The method of the present invention may further include washing the sample injection pad, the bonding pad, the sample development pad, and the absorption pad after leaving the phthalate-based material kit under a predetermined condition. As the washing solution, conventional types known to those skilled in the art may be used.

Hereinafter, the configuration and operation of the present invention will be described in more detail through preferred embodiments of the present invention. However, this is presented as a preferred example of the present invention and cannot be construed as limiting the present invention in any sense.

<Example 1> Synthesis of phthalate

DEHP modified with a carboxyl group (-COOH) was purchased from Toronto Research Chemical.

DEHP modified with a carboxyl group was fixed in the same manner as in FIG. 2 to fix the magnetic bead.

Referring to FIG. 2 , in order to fix DEHP modified with a carboxyl group to the beads, EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) was added to the DEHP modified with a carboxyl group and reacted with an amine Beads with groups (NH ₂ ) were added and reacted.

<Example 2> Aptamer discovery for detection of phthalate-based substances

In order to discover an aptamer for phthalate immobilized on the beads, a library was synthesized and purchased from IDTDNA. As primers for amplifying the library, (1) Forward 5'-GATGTGAGTGTGGACGAG-3' (SEQ ID NO: 4), (2) Reverse 5'-GTGTCTCGGTTGTGGTG-3' (SEQ ID NO: 5) was constructed and used. Buffer used for binding was 1X PBST pH7.5 and MgCl ₂ 5mM was added using a solution. A total of 10 SELEX rounds were performed, and the nucleotide sequence of the aptamer of SEQ ID NO: 1 (5'-CGTGATTGGATTTTTAACGTTGAGGAACCATTGTTATGTTTTAGCTGCCGA-3') was obtained through nucleotide sequence analysis.

<Example 3> Verification of phthalate aptamer binding force

In order to evaluate the performance of the aptamer of SEQ ID NO: 1, the binding force was measured using the ELISA method as shown in the figure shown in FIG. 3 .

Referring to FIG. 3, the biotin-coupled aptamer of SEQ ID NO: 1 and the magnetic bead-bound DEHP prepared in Example 1 are combined and reacted (Equilibrium Binding), and the degree of the aptamer and phthalate that have reacted with each other is detected ( Chemiluminescence), it consists of a process of analyzing the obtained data and analyzing the Kd (dissociation constant) value between the phthalate and the aptamer (Data analysis).

Biotin-aptamer was added at a concentration of 50 nmol to 100 ul of binding buffer in each well of the microplate, and then the temperature was lowered at 0.1° C./sec from 95° C. to 37° C. to maintain a stable structure. And the biotin-aptamer and the phthalate-coupled magnetic beads prepared in Example 1 were each subjected to a binding reaction at 1300 rpm for 1 hour. After that, it was washed 3 times with 100ul of binding buffer, and streptavidin-HRP was diluted 1:2000 in binding buffer, 100ul of each was put into the binding reaction well, and the binding reaction was performed at 1300rpm at room temperature for 30 minutes. After washing 3 times with 100ul of binding buffer again, the luminescence value was measured by reacting with ECL solution and measuring Chemiluminescence. The results are shown in FIG. 4 .

Referring to FIG. 4 , it can be seen that the luminescence value increased as the DEHP concentration increased. The Kd for DEHP of the aptamer of SEQ ID NO: 1 is 375 nM.

<Example 4> Preparation of sequences for implementing a diagnostic kit

A sequence for implementing the phthalate diagnostic kit of FIG. 1 of the present invention was prepared.

The sequence used for the control region used in this Example is 5'-GGGGGGGGGG-3' (SEQ ID NO: 3), and it was modified to 5'-biotin-GGGGGGGGGG-3' for fixation in the control region in the sample development pad.

The nucleic acid to which the quantum dots are bound used in the binding pad used in this Example includes a sequence forming a partial complementary bond with SEQ ID NO: 1; And an oligomer modified to have both a nucleotide sequence complementary to the sequence used in the control region and to have a thiol group (-SH) at the 5' end was synthesized. The nucleotide sequence of the nucleic acid to which the quantum dots are bound is 5'-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3' (SEQ ID NO: 2), and 5'-thiol-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3' was denatured.

The binding of the 5'-thiol-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3' to the quantum dot (core: CdSe, shell: ZnS) is a nucleic acid having a thiol group on the surface of the quantum dot using the property that the quantum dot forms a specific bond with the thiol group of the nucleic acid. A nucleic acid to which quantum dots were bound was prepared by reacting for 48 hours to bind.

<Example 5> Implementation of a diagnostic kit

As shown in FIG. 1 , a sample injection pad was connected to one side of the bonding pad, and a sample development pad was connected to the other side of the bonding pad. A diagnostic kit was implemented by connecting an absorbent pad to the other side of the sample development pad.

The binding pad was fixed by adding the nucleic acid to which the quantum dots prepared in Example 4 were bound, a sugar compound, and a surfactant. The test area of the sample development pad was biotinylated for phthalate aptamer (SEQ ID NO: 1), which was reacted with streptavidin and immobilized on the test area. In the control region of the sample development pad, the biotinylated control nucleic acid (SEQ ID NO: 3) prepared in Example 4 was reacted with streptavidin and immobilized in the control region. The kit was assembled by putting it in a device made of plastic to facilitate the development of the sample.

In order to confirm the implementation of the diagnostic kit of the present invention, the DEHP phthalate reagent was sequentially diluted to prepare a sample concentration of 300 ppm to 1,500 ppm. 100 μl of each DEHP phthalate sample was instilled in a diagnostic kit, and fluorescence intensity was measured 10 minutes later using the equipment.

As a result, as the DEHP phthalate concentration increased as shown in FIG. 5A, it was confirmed that the fluorescence intensity by the quantum dots in the test region was weakened. It was confirmed that the measured value decreased with increasing time. This is a result proving that DEHP phthalate aptamer increased the binding to phthalate as the phthalate concentration increased, while the complementary binding to the quantum dot-nucleic acid conjugate decreased. Therefore, it was confirmed that the phthalate diagnostic kit of the present invention was implemented.

So far, with respect to the present invention, the preferred embodiments have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in modified forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> ZEUS <120> KIT FOR ANALYZING PHTHALIC BASED MATERIAL USING APTAMER AND METHOD FOR ANALYZING PHTHALIC BASED MATERIAL USING THE SAME <130> AHP19034 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> APTAMER <400> 1 cgtgatgtgg atttttaacg ttgaggaacc attgttatgt ttagctgccg a 51 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PARTIAL COMPLEMENTARY SEQUENCE OF APTAMER <400> 2 caatggttcc tcaacccccc ccccccc 27 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> CONTROL SEQUENCE <400> 3 gggggggggg 10 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> FORWARD PRIMER <400> 4 gatgtgagtg tgtgacgag 19 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> REVERSE PRIMER <400> 5 gtgtctcggt tgtggtg 17

Claims (9)

a sample injection pad, a sample development pad, and a bonding pad connecting the sample injection pad and the sample development pad;
The sample deployment pad may include: an aptamer of SEQ ID NO: 1 specifically binding to a phthalate-based material; an aptamer-modified material bound to the aptamer; and a binding material bound to the aptamer-modified material,
The bonding pad may include quantum dots; And It is coupled to the quantum dots and comprising a nucleic acid having a sequence complementary to the aptamer, a kit for detecting a phthalate-based substance using an aptamer.
The method of claim 1, wherein the phthalate-based material comprises at least one of diethylhexyl phthalate (DEHP), benzylbutyl phthalate (BBP), dibutyl phthalate (DBP), and diisobutyl phthalate (DIBP). A kit for detecting phthalate-based substances using an aptamer.
The kit for detecting a phthalate-based substance using an aptamer according to claim 1, wherein the aptamer is fixed to the sample development pad by binding of the aptamer-modified substance and the binding substance.
The kit for detecting a phthalate-based substance using an aptamer according to claim 1, wherein the aptamer-modified substance is biotin, and the binding substance is streptavidin.
The kit for detecting phthalate-based substances using an aptamer according to claim 1, wherein the quantum dots include a core and a shell surrounding the core.
The kit for detecting a phthalate-based substance using an aptamer according to claim 5, wherein the quantum dot further comprises at least one of a stable layer, a ligand, and a ligand layer.
The kit for detecting phthalate-based substances using an aptamer according to claim 1, wherein the quantum dots are made of CdSe and ZnS.
The kit for detecting a phthalate-based material using an aptamer according to claim 1, wherein the presence of the phthalate-based material is confirmed by a decrease or absence of a luminescence signal due to a reaction between the aptamer and the phthalate-based material.
A method for detecting a phthalate-based substance, comprising the step of using a kit for detecting a phthalate-based substance using the aptamer of any one of claims 1 to 8.

Images