KR20210124566A - Kit for analyzing phthalic based material using aptamer and method for analyzing phthalic based material using the same - Google Patents
Kit for analyzing phthalic based material using aptamer and method for analyzing phthalic based material using the same Download PDFInfo
- Publication number
- KR20210124566A KR20210124566A KR1020200040879A KR20200040879A KR20210124566A KR 20210124566 A KR20210124566 A KR 20210124566A KR 1020200040879 A KR1020200040879 A KR 1020200040879A KR 20200040879 A KR20200040879 A KR 20200040879A KR 20210124566 A KR20210124566 A KR 20210124566A
- Authority
- KR
- South Korea
- Prior art keywords
- phthalate
- aptamer
- pad
- kit
- based material
- Prior art date
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/544—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being organic
- G01N33/548—Carbohydrates, e.g. dextran
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/544—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being organic
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
- G01N33/54346—Nanoparticles
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54366—Apparatus specially adapted for solid-phase testing
- G01N33/54386—Analytical elements
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/588—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with semiconductor nanocrystal label, e.g. quantum dots
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2430/00—Assays, e.g. immunoassays or enzyme assays, involving synthetic organic compounds as analytes
Abstract
Description
본 발명은 앱타머(aptamer)를 이용한 프탈레이트계 물질 검출용 키트 및 이를 이용한 프탈레이트계 물질 검출 방법에 관한 것이다. 보다 상세하게는 본 발명은 앱타머와 양자점을 이용하여 프탈레이트계 물질을 검출할 수 있는 키트 및 이를 이용한 프탈레이트계 물질 검출 방법에 관한 것이다.The present invention relates to a kit for detecting a phthalate-based substance using an aptamer and a method for detecting a phthalate-based substance using the same. More particularly, the present invention relates to a kit capable of detecting a phthalate-based material using an aptamer and quantum dots, and a method for detecting a phthalate-based material using the same.
최근 산업 전반에 AI, 자동화 기술이 증가되면서 화학 물질에 대한 검출 기술이 요망되고 있다. 화학 물질 중에서도 프탈레이트계 물질은 규제가 심화되고 있다. 세계 각국은 디에틸헥실 프탈레이트(DEHP) 등 6종의 프탈레이트계 물질이 인체에 유해하다는 잠정 결정을 내리고, 이들 프탈레이트계 물질을 1999년부터 내분비계 장애를 일으키는 환경 호르몬 추정 물질로 관리하고 있다.Recently, as AI and automation technologies are increasing throughout the industry, there is a demand for detection technology for chemical substances. Among chemical substances, phthalate-based substances are being regulated. Countries around the world have made a tentative decision that six types of phthalate-based substances, including diethylhexyl phthalate (DEHP), are harmful to the human body, and have been managing these phthalate-based substances as suspected environmental hormones that cause endocrine disorders since 1999.
프탈레이트계 물질을 검출하는 기술을 살펴보면, 기체 크로마토그래피-질량 스페트로메터리(GC-MS), 열분해기(pyrolyzer)/열탈착 보조기(thermal deseorption accessory)를 구비한 기체 크로마토그래피-질량 스펙트로메터리(Py/TD-GC-MS)를 사용해서 프탈레이트계 물질을 분석하고 있다. GC-MS 분석 방법은 정확도는 높지만 분석하는데 전처리 시간이 50분 이상으로 오래 걸리고 추가로 세척 및 전처리 설비 관리가 필요하다. Py/TD-GC-MS 분석 방법은 전처리 시간이 짧고 추가적인 설비 관리는 필요없지만 정확도가 떨어지는 한계가 있다.Looking at the technology for detecting phthalate-based substances, gas chromatography-mass spectrometry (GC-MS) equipped with a pyrolyzer/thermal deseorption accessory (thermal deseorption accessory) Py/TD-GC-MS) is used to analyze phthalate-based materials. Although the GC-MS analysis method has high accuracy, it takes a long time for pre-treatment (over 50 minutes) for analysis, and additional cleaning and pre-treatment facility management are required. The Py/TD-GC-MS analysis method has a short pre-treatment time and does not require additional facility management, but has a limitation in that the accuracy is lowered.
한국등록특허 제10-1971449에 의하면 프탈레이트에 특이적으로 결합하는 단일가닥 DNA 앱타머(aptamer)를 기술하고 있다. 그러나, 이 방법의 경우 프탈레이트의 존부에 대한 판별 수단이 명확하지 않아서 앱타머를 사용한다고 하더라도 프탈레이트의 존부를 간이한 방법으로 알기가 어려울 수 있다.Korean Patent Registration No. 10-1971449 describes a single-stranded DNA aptamer that specifically binds to phthalate. However, in this method, the means for determining the presence or absence of phthalate is not clear, so even if an aptamer is used, it may be difficult to know the presence or absence of phthalate by a simple method.
한편, 프탈레이트계 물질은 어디에서든 존재하는 만큼 검출 필요가 있는 현장 어디에서든 프탈레이트계 물질을 쉽게 검출할 수 있어야 한다. 이를 위해서는 고상에서도 고민감도로 판별할 수 있어야 한다.On the other hand, as the phthalate-based material is present anywhere, it should be able to easily detect the phthalate-based material anywhere in the field that needs to be detected. For this, it should be possible to discriminate with high sensitivity even in the solid phase.
본 발명의 과제는 프탈레이트계 물질을 검출할 수 있는, 프탈레이트계 물질 검출용 키트를 제공하는 것이다.An object of the present invention is to provide a kit for detecting a phthalate-based substance, capable of detecting a phthalate-based substance.
본 발명의 다른 과제는 프탈레이트계 물질을 고민감도로 검출할 수 있으며 현장에서도 간이한 방법으로 검출할 수 있게 하는, 프탈레이트계 물질 검출용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for detecting phthalate-based substances, which can detect phthalate-based substances with high sensitivity and can detect them in a simple manner even in the field.
본 발명의 상기 과제는 이하의 앱타머(apatamer)를 이용한 프탈레이트계 물질 검출용 키트 및 검출 방법에 의해 해결된다.The above object of the present invention is solved by a kit and a detection method for detecting a phthalate-based substance using the following aptamer.
본 발명의 앱타머를 이용한 프탈레이트계 물질 검출용 키트는 시료 주입 패드, 시료 전개 패드, 및 상기 시료 주입 패드와 상기 시료 전개 패드를 연결하는 결합 패드를 구비하고, 상기 시료 전개 패드는 프탈레이트계 물질에 특이적으로 결합하는 서열번호 1의 앱타머; 상기 앱타머에 결합된 앱타머 변성 물질; 및 상기 앱타머 변성 물질에 결합된 결합 물질을 포함하고, 상기 결합 패드는 양자점; 및 상기 양자점에 결합되고 상기 앱타머에 대한 상보적인 서열을 갖는 핵산을 포함한다.A kit for detecting a phthalate-based material using an aptamer of the present invention includes a sample injection pad, a sample development pad, and a bonding pad connecting the sample injection pad and the sample development pad, wherein the sample development pad is attached to the phthalate-based material. Aptamer of SEQ ID NO: 1 that specifically binds; an aptamer-modified material bound to the aptamer; and a binding material bonded to the aptamer-modified material, wherein the bonding pad comprises: quantum dots; and a nucleic acid that is bound to the quantum dot and has a complementary sequence to the aptamer.
일 구체예에서, 상기 프탈레이트계 물질은 디에틸헥실 프탈레이트(DEHP), 벤질부틸 프탈레이트(BBP), 디부틸 프탈레이트(DBP), 디이소부틸 프탈레이트(DIBP) 중 1종 이상을 포함할 수 있다.In one embodiment, the phthalate-based material may include at least one of diethylhexyl phthalate (DEHP), benzylbutyl phthalate (BBP), dibutyl phthalate (DBP), and diisobutyl phthalate (DIBP).
일 구체예에서, 상기 앱타머는 상기 앱타머 변성 물질과 상기 결합 물질의 결합에 의해 상기 시료 전개 패드에 고정될 수 있다.In one embodiment, the aptamer may be fixed to the sample development pad by binding the aptamer-modified material and the binding material.
일 구체예에서, 상기 앱타머 변성 물질은 비오틴이고, 상기 결합 물질은 스트렙트아비딘일 수 있다.In one embodiment, the aptamer-modified material may be biotin, and the binding material may be streptavidin.
일 구체예에서, 상기 양자점은 코어 및 상기 코어를 둘러싸는 쉘을 포함할 수 있다.In one embodiment, the quantum dot may include a core and a shell surrounding the core.
일 구체예에서, 상기 양자점은 안정층, 리간드, 리간드층 중 1종 이상을 추가로 포함할 수 있다.In one embodiment, the quantum dots may further include one or more of a stabilizing layer, a ligand, and a ligand layer.
일 구체예에서, 상기 양자점은 CdSe 및 ZnS로 이루어질 수 있다.In one embodiment, the quantum dots may be made of CdSe and ZnS.
일 구체예에서, 상기 프탈레이트계 물질의 존재는 상기 앱타머와 상기 프탈레이트계 물질 간의 반응으로 인한 발광 시그널의 감소 또는 부재에 의해 확인될 수 있다.In one embodiment, the presence of the phthalate-based material may be confirmed by a decrease or absence of a luminescence signal due to a reaction between the aptamer and the phthalate-based material.
일 구체예에서, 상기 앱타머를 이용한 프탈레이트계 물질 검출용 키트는 흡수 패드, 광 조사 유닛 중 1종 이상을 추가로 포함할 수 있다.In one embodiment, the kit for detecting a phthalate-based material using the aptamer may further include at least one of an absorption pad and a light irradiation unit.
본 발명의 프탈레이트계 물질 검출 방법은 본 발명의 앱타머를 이용한 프탈레이트계 물질 검출용 키트를 사용하는 단계를 포함한다.The method for detecting a phthalate-based substance of the present invention includes using a kit for detecting a phthalate-based substance using the aptamer of the present invention.
본 발명에 따르면 프탈레이트계 물질을 검출할 수 있는, 프탈레이트계 물질 검출용 키트를 제공하였다.According to the present invention, a kit for detecting a phthalate-based substance capable of detecting a phthalate-based substance is provided.
본 발명에 따르면 프탈레이트계 물질을 고민감도로 검출할 수 있으며 현장에서도 간이한 방법으로 검출할 수 있게 하는, 프탈레이트계 물질 검출용 키트를 제공하였다.According to the present invention, a kit for detecting a phthalate-based substance that can detect a phthalate-based substance with high sensitivity and can be detected by a simple method even in the field is provided.
도 1은 본 발명의 일 실시예에 따른 키트의 단면도(도 1의 (a)) 및 그의 구동 기작(도 1의 (b)와 (c))을 설명한다.
도 2는 카르복시산기를 갖도록 변형된 DEHP를 마그네틱 비드에 결합하는 모식도이다.
도 3은 DEHP에 대한 서열번호 1의 앱타머의 결합력 검정 방법의 모식도이다.
도 4는 DEHP에 대한 서열번호 1의 앱타머의 Kd 분석 결과이다. 도 4에서 X축은 DEHP 농도이고, Y축은 발광값(FLU)이다.
도 5a, 도 5b는 각각 실시예 5에서 DEHP의 농도에 따른 도 1의 키트 구현의 결과를 나타낸 것이다.1 illustrates a cross-sectional view (FIG. 1 (a)) of a kit according to an embodiment of the present invention and its driving mechanism (FIG. 1 (b) and (c)).
2 is a schematic diagram of binding DEHP modified to have a carboxylic acid group to a magnetic bead.
3 is a schematic diagram of a method for assaying the binding affinity of the aptamer of SEQ ID NO: 1 to DEHP.
4 is a Kd analysis result of the aptamer of SEQ ID NO: 1 for DEHP. In FIG. 4 , the X-axis is the DEHP concentration, and the Y-axis is the luminescence value (FLU).
5a and 5b show the results of the kit implementation of FIG. 1 according to the concentration of DEHP in Example 5, respectively.
본 명세서에서 "프탈레이트계 물질"은 치환 또는 비치환된 프탈릭산(phthalic acid)의 에스테르를 의미한다.As used herein, the term “phthalate-based material” refers to an ester of substituted or unsubstituted phthalic acid.
일 구체예에서, 프탈레이트계 물질은 디에틸헥실 프탈레이트(DEHP), 벤질부틸 프탈레이트(BBP), 디부틸 프탈레이트(DBP), 디이소부틸 프탈레이트(DIBP) 중 1종 이상을 포함할 수 있지만, 이에 제한되지 않는다.In one embodiment, the phthalate-based material may include at least one of diethylhexyl phthalate (DEHP), benzylbutyl phthalate (BBP), dibutyl phthalate (DBP), and diisobutyl phthalate (DIBP), but is limited thereto. doesn't happen
본 명세서에서 "양자점"은 반도체 나노 입자이며, 양자 고립 효과에 의해 입자의 크기에 따라 다른 빛을 발광하는 특성을 가지는 입자를 의미한다.As used herein, the term “quantum dot” refers to a semiconductor nanoparticle, and refers to a particle having a characteristic of emitting different light depending on the size of the particle due to the quantum isolation effect.
본 명세서에서 "시료"는 프탈레이트계 물질이 존재할 수 있는 시료들을 포괄하는 개념이다.As used herein, "sample" is a concept encompassing samples in which a phthalate-based material may be present.
일 구체예에서, 시료는 각종 화학 제품을 전처리함으로써 얻은 액상의 시료, 환경으로부터 입수가능한 물, 토양, 공기를 포괄하는 의미일 수 있다. 상기 전처리는 추출, 용해 등을 포함할 수 있지만, 이에 제한되지 않는다.In one embodiment, the sample may include a liquid sample obtained by pretreatment of various chemical products, water, soil, and air available from the environment. The pretreatment may include, but is not limited to, extraction, dissolution, and the like.
본 명세서에서 "핵산"은 DNA, DNA의 단일 가닥 스트랜드(strand), 또는 RNA를 의미할 수 있다.As used herein, "nucleic acid" may refer to DNA, a single-stranded strand of DNA, or RNA.
본 명세서에서 "제1서열"은 앱타머 중 적어도 일부와 상보적인 서열을 포함하거나 또는 앱타머 중 적어도 일부와 상보적인 서열을 의미한다.As used herein, the term "first sequence" refers to a sequence complementary to at least a portion of an aptamer or including a sequence complementary to at least a portion of an aptamer.
본 명세서에서 "제2서열"은 시료 전개 패드 중 대조군 영역에 존재하는 서열을 의미한다.As used herein, the term “second sequence” refers to a sequence present in the control region of the sample development pad.
본 명세서에서 "제3서열"은 제2서열 중 적어도 일부와 상보적인 서열을 포함하거나 또는 제2서열 중 적어도 일부와 상보적인 서열을 의미한다.As used herein, the term “third sequence” refers to a sequence that includes a sequence complementary to at least a portion of the second sequence or is complementary to at least a portion of the second sequence.
이하, 본 발명의 일 실시예에 따른 앱타머를 이용한 프탈레이트계 물질을 검출하는 키트를 보다 상세하게 설명한다.Hereinafter, a kit for detecting a phthalate-based substance using an aptamer according to an embodiment of the present invention will be described in more detail.
본 발명은 앱타머를 이용한 프탈레이트계 물질을 검출하는 키트(이하, "키트"라고 함)로서, 시료 전개 패드에 고정되고 프탈레이트계 물질에 특이적으로 결합하는 서열번호 1의 앱타머를 사용하고, 프탈레이트계 물질의 존부 즉 시료 중 프탈레이트계 물질이 존재하고 있음을 판단하는 수단으로 결합 패드에 포함된 양자점을 사용한다. 이를 통해, 본 발명은 프탈레이트계 물질을 고 감도로 검출하도록 할 수 있다.The present invention is a kit (hereinafter, referred to as "kit") for detecting a phthalate-based material using an aptamer, using an aptamer of SEQ ID NO: 1 that is fixed to a sample development pad and specifically binds to a phthalate-based material, Quantum dots included in the bonding pad are used as a means of determining the presence or absence of a phthalate-based material, that is, the presence of a phthalate-based material in the sample. Through this, the present invention can detect a phthalate-based material with high sensitivity.
일 구체예에서, 본 발명의 키트는 프탈레이트계 물질의 검출 한계가 700ppm 이하가 될 수 있다.In one embodiment, the kit of the present invention may have a detection limit of 700 ppm or less of a phthalate-based material.
일 구체예에서, 본 발명의 키트는 프탈레이트계 물질 중 디에틸헥실 프탈레이트(DEHP), 벤질부틸 프탈레이트(BBP), 디부틸 프탈레이트(DBP), 디이소부틸 프탈레이트(DIBP) 중 1종 이상을 검출할 수 있다.In one embodiment, the kit of the present invention can detect one or more of diethylhexyl phthalate (DEHP), benzylbutyl phthalate (BBP), dibutyl phthalate (DBP), and diisobutyl phthalate (DIBP) among phthalate-based substances. can
본 발명의 키트에서, 앱타머는 앱타머 변성 물질에 결합되어 있다. 이를 통해, 본 발명의 키트는 상기 변성 물질과 하기 상술되는 결합 물질이 결합함으로써 앱타머가 시료 전개 패드에 고정되도록 하고 고상에서도 프탈레이트계 물질의 검출을 용이하게 할 수 있다. 또한, 본 발명의 키트는 프탈레이트계 물질의 존재 여부를 용이하고 간편하게 판단할 수 있게 하며 고민감도로 판단하게 할 수 있다. 즉, 액상에서 앱타머에 결합된 양자점을 포함시키고 시료를 주입하는 분석 대비 고민감도로 프탈레이트계 물질의 존부를 판단하도록 할 수 있다.In the kit of the present invention, the aptamer is bound to an aptamer-modified substance. Through this, the kit of the present invention allows the aptamer to be fixed to the sample development pad by binding the modified material and the binding material described in detail below, and can facilitate the detection of the phthalate-based material even in a solid phase. In addition, the kit of the present invention can easily and conveniently determine the presence or absence of a phthalate-based material, and can be determined with high sensitivity. That is, it is possible to determine the presence or absence of a phthalate-based material with high sensitivity compared to the analysis in which the quantum dots bound to the aptamer are included in the liquid phase and the sample is injected.
일 구체예에서, 앱타머 변성 물질은 비오틴(biotin)일 수 있다.In one embodiment, the aptamer-modified material may be biotin.
일 구체예에서, 결합 물질은 스트렙트아비딘(streptavidin)일 수 있다.In one embodiment, the binding agent may be streptavidin.
본 발명의 키트는 시료 주입 패드, 시료 전개 패드, 상기 시료 주입 패드와 상기 시료 전개 패드를 연결하는 결합 패드를 구비한다. 상기 시료 전개 패드에는 프탈레이트계 물질에 특이적으로 결합하는 서열번호 1의 앱타머가 포함된다. 상기 양자점은 상기 결합 패드에 포함된다. The kit of the present invention includes a sample injection pad, a sample development pad, and a bonding pad connecting the sample injection pad and the sample development pad. The sample development pad includes an aptamer of SEQ ID NO: 1 that specifically binds to a phthalate-based material. The quantum dots are included in the bonding pad.
본 발명의 키트에서 시료 전개 패드에는 테스트 영역 및 대조군 영역이 존재할 수 있다.In the kit of the present invention, a test region and a control region may be present on the sample development pad.
테스트 영역은 시료 중 프탈레이트계 물질이 존재할 경우 대조군 영역 대비 발광되지 않거나 발광이 감소됨으로써 프탈레이트계 물질의 존재를 직접적으로 확인하게 한다. 테스트 영역은 소정의 폭을 갖는 영역이 될 수도 있고 하나의 라인이 될 수도 있다.When a phthalate-based material is present in the sample, the test region does not emit light or decreases light emission compared to the control region, thereby directly confirming the presence of the phthalate-based material. The test area may be an area having a predetermined width or may be a single line.
대조군 영역은 시료 전개 패드를 통해 시료가 완전히 이동하였음을 알려주는 지표로서 프탈레이트계 물질 분석의 신뢰성을 높여줄 수 있다. 대조군 영역은 소정의 폭을 갖는 영역이 될 수도 있고 하나의 라인이 될 수도 있다.The control region is an indicator indicating that the sample has completely moved through the sample development pad, and may increase the reliability of the analysis of the phthalate-based material. The control region may be a region having a predetermined width or may be a single line.
테스트 영역과 대조군 영역은 시료 전개 패드 중 임의의 위치에 있을 수 있다. 바람직하게는 테스트 영역이 대조군 영역 대비 결합 패드에 더 인접하여 위치함으로써 시료가 시료 전개 패드를 통해 이동하였음을 보증하여 프탈레이트계 물질의 분석 신뢰성을 높여 줄 수 있다.The test area and control area may be located anywhere on the sample deployment pad. Preferably, since the test region is located closer to the bonding pad than the control region, it is possible to ensure that the sample has moved through the sample development pad, thereby increasing the analysis reliability of the phthalate-based material.
본 발명의 키트는 시료 전개 패드에 연결된 흡수 패드를 더 포함할 수 있다. The kit of the present invention may further include an absorbent pad connected to the sample development pad.
흡수 패드는 시료 전개 패드 구체적으로는 대조군 영역을 통과한 시료가 흡수되어 제거되도록 함으로써 프탈레이트계 물질 검출이 필요한 현장에서 본 발명의 키트를 사용하여 간이한 방법으로 프탈레이트계 물질을 검출하도록 할 수 있다.The absorbent pad allows the sample that has passed through the sample development pad, specifically, the control region, to be absorbed and removed, so that the phthalate-based material can be detected by a simple method using the kit of the present invention in a field requiring detection of the phthalate-based material.
본 발명의 프탈레이트계 물질을 검출하는 키트는 시료 전개 패드에 광을 조사하는 광 조사 유닛을 더 포함할 수 있다. The kit for detecting a phthalate-based material of the present invention may further include a light irradiation unit for irradiating light to the sample development pad.
광 조사 유닛은 자외선을 방출하는 것일 수 있다. 광 조사 유닛은 시료 전개 패드에 존재하는 테스트 영역과 대조군 영역에 광을 직접 조사한다. 광 조사 유닛은 시료 전개 패드에서 유체의 흐름에 간섭하지 않는 위치에 존재할 수 있고, 광 조사는 시료 전개 패드에서 앱타머와 프탈레이트계 물질의 반응에 간섭하지 않는 범위, 강도 및 시간으로 수행될 수 있다. 광 조사 유닛은 시료 전개 패드에서 앱타머와 프탈레이트계 물질의 반응을 쉽게 확인할 수 있게 할 수 있으며, 양자점의 형광을 유발한다. 이에 따라 프탈레이트계 물질의 존재 여부를 측정 및/또는 검출할 수 있다.The light irradiation unit may be one that emits ultraviolet rays. The light irradiation unit directly irradiates light to the test area and the control area existing on the sample development pad. The light irradiation unit may be present in a position that does not interfere with the flow of the fluid in the sample development pad, and the light irradiation may be performed in a range, intensity, and time that does not interfere with the reaction between the aptamer and the phthalate-based material in the sample development pad. . The light irradiation unit may make it possible to easily check the reaction between the aptamer and the phthalate-based material on the sample development pad, and induce fluorescence of the quantum dots. Accordingly, the presence or absence of a phthalate-based material may be measured and/or detected.
이하, 본 발명의 일 실시예에 따른 프탈레이트계 물질의 검출 키트를 도 1을 참고하여 설명한다.Hereinafter, a kit for detecting a phthalate-based material according to an embodiment of the present invention will be described with reference to FIG. 1 .
도 1에서 (a)는 본 발명의 일 실시예에 따른 키트의 단면도이고, 도 1에서 (b)는 프탈레이트계 물질을 함유하지 않는 시료를 시료 주입 패드에 주입하였을 때 키트의 작동 기작을 설명하고, 도 1에서 (c)는 프탈레이트계 물질을 함유하는 시료를 시료 주입 패드에 주입하였을 때 키트의 작동 기작을 설명한다.In FIG. 1 (a) is a cross-sectional view of a kit according to an embodiment of the present invention, and in FIG. 1 (b) describes the operation mechanism of the kit when a sample containing no phthalate-based material is injected into the sample injection pad, and , (c) in FIG. 1 describes the operation mechanism of the kit when a sample containing a phthalate-based material is injected into the sample injection pad.
도 1의 (a)를 참고하면, 키트는 시료 주입 패드(100), 결합 패드(200), 시료 전개 패드(300), 흡수 패드(400)를 포함한다.Referring to FIG. 1A , the kit includes a
시료 주입 패드(100)는 측정하고자 하는 시료가 주입되는 패드이다. The
결합 패드(200)는 시료 주입 패드(100)와 시료 전개 패드(300)를 연결한다. The
흡수 패드(400)는 시료 전개 패드(300)에 연결되어 있다. 이를 통해 시료 주입 패드(100)에 주입된 시료는 결합 패드(200), 시료 전개 패드(300), 흡수 패드(400)를 순차적으로 이동함으로써 시료 중 프탈레이트계 물질의 분석을 가능하게 한다.The
시료 주입 패드(100), 결합 패드(200), 시료 전개 패드(300), 흡수 패드(400) 중 1종 이상은 키트에서 당업자에게 통상적으로 알려진 소재로 형성될 수 있다. 예를 들면, 상기 소재는 다공성의 박막형 소재로서, 예를 들면 나일론, 폴리에스테르, 셀룰로스, 폴리설폰, 폴리비닐리덴플루오라이드, 셀룰로스 아세테이트, 폴리우레탄, 유리 섬유, 니트로 셀룰로스 중 1종 이상을 포함할 수 있지만, 이에 제한되는 것은 아니다.At least one of the
시료 주입 패드(100), 결합 패드(200), 시료 전개 패드(300), 흡수 패드(400) 중 1종 이상은 상술한 소재만으로 구성될 수도 있지만, 시료의 전개를 더 용이하게 하기 위하여, 전개 시약을 더 포함할 수 있다. 전개 시약으로는 완충액, 증류수 등을 포함하는 수계 용매, 유기 용매 등을 포함할 수 있지만, 이에 제한되는 것이 아니다. 단 전개 시약은 앱타머 및/또는 본 발명에서 서술되는 각종 핵산 및/또는 서열(안티센스, 프로브 포함)을 변성시키지 않으며, 프탈레이트계 물질의 존부 및/또는 농도에 영향을 주지 않는 것이어야 한다.At least one of the
도 1에서 도시되지 않았지만, 시료 주입 패드(100), 결합 패드(200), 시료 전개 패드(300), 흡수 패드(400)는 일체로 형성되어 이들을 보관하는 외부 용기에 포함될 수 있다.Although not shown in FIG. 1 , the
시료 전개 패드(300)에는 결합 패드(200)로부터 테스트 영역(310)과 대조군 영역(320)이 순차적으로 형성되어 있다.A
테스트 영역(310)에는 프탈레이트계 물질에 특이적으로 결합하는 앱타머(311)가 포함된다.The
먼저, 프탈레이트계 물질에 특이적으로 결합하는 앱타머(311)에 대해 설명한다.First, the
앱타머(311)는 프탈레이트계 물질에 특이적으로 결합하도록 선택된 DNA 서열 자체 또는 해당 DNA 서열을 포함하는 단일 가닥 스트랜드 서열을 포함한다.The
앱타머(311)는 하기 서열번호 1이다. 바람직하게는, 서열번호 1의 앱타머는 DEHP에 특이적으로 결합될 수 있다:Aptamer (311) is the following SEQ ID NO: 1. Preferably, the aptamer of SEQ ID NO: 1 can bind specifically to DEHP:
서열번호 1: 5'- CGTGATGTGGATTTTTAACGTTGAGGAACCATTGTTATGTTTAGCTGCCGA -3'SEQ ID NO: 1: 5'-CGTGATTGTGGATTTTTAACGTTGAGGAACCATTGTTATGTTTAGCTGCCGA -3'
일 구체예에서, 앱타머는 프탈레이트계 물질에 대한 결합 효율이 50% 이상, 바람직하게는 50% 내지 90%가 될 수 있다. 상기 범위에서, 프탈레이트계 물질에 대한 결합 효율이 높아 프탈레이트계 물질에 대한 검출 한계를 낮출 수 있다. 상기 "결합 효율"은 ELISA 방식의 결합력 측정 방법으로 측정할 수 있다.In one embodiment, the aptamer may have a binding efficiency of 50% or more to a phthalate-based material, preferably 50% to 90%. In the above range, the binding efficiency for the phthalate-based material is high, and thus the detection limit for the phthalate-based material may be lowered. The "binding efficiency" may be measured by an ELISA method of measuring binding force.
일 구체예에서, 앱타머는 프탈레이트계 물질에 대한 결합력이 1μM 미만, 바람직하게는 0.3μM 이상 1μM 미만이 될 수 있다. 상기 범위에서, 프탈레이트계 물질에 대한 결합 효율이 높아 프탈레이트계 물질에 대한 검출 한계를 낮출 수 있다. 상기 "결합력"은 ELISA 방식의 결합력 측정 방법으로 측정할 수 있다.In one embodiment, the aptamer may have a binding force to a phthalate-based material of less than 1 μM, preferably 0.3 μM or more and less than 1 μM. In the above range, the binding efficiency for the phthalate-based material is high, and thus the detection limit for the phthalate-based material may be lowered. The "binding force" can be measured by the binding force measurement method of the ELISA method.
본 발명의 키트에서 앱타머는 상술한 4종의 프탈레이트계 물질 즉 DEHP, BBP, DBP, DIBP에 결합할 수 있다. 바람직하게는, 서열번호 1의 앱타머는 DEHP에 결합될 수 있다.In the kit of the present invention, the aptamer may bind to the above-described four phthalate-based substances, that is, DEHP, BBP, DBP, and DIBP. Preferably, the aptamer of SEQ ID NO: 1 is capable of binding to DEHP.
앱타머(311)는 시료 전개 패드(300), 보다 상세하게는 테스트 영역(310)에 고정되기 위하여 앱타머 변성 물질(312)에 의해 5' 또는 3'이 변성된다. 앱타머(311)는 앱타머 변성 물질(312)에 의해 변성됨으로써 결합 물질(313)-앱타머 변성 물질(311) 간의 결합을 통해 시료 전개 패드(300)의 테스트 영역(310)에 고정될 수 있다.The
앱타머 변성 물질(312)은 비오틴일 수 있다. 결합 물질(313)은 스트렙트아비딘일 수 있다. The aptamer-modified
결합 패드(200)에는 양자점(211)이 포함된다.The
일 구체예에서, 결합 패드(200)에는 상술한 프탈레이트계 물질에 특이적으로 결합하는 앱타머가 존재하지 않을 수 있다.In one embodiment, the
먼저, 본 발명에서 사용되는 양자점(211)에 대해 설명한다.First, the
양자점은 코어 및 코어를 둘러싸는 쉘을 포함할 수 있다. 양자점은 코어와 쉘만으로 구성될 수도 있으나, 코어와 쉘 사이에 안정층을 더 구비할 수도 있거나, 쉘의 외측 즉 코어와 대향하여 안정층을 더 구비할 수도 있거나 또는 쉘의 외측 즉 코어와 대향하여 리간드(또는 리간드층)을 더 구비할 수도 있다. 리간드층은 리간드가 차지하는 공간이 형성되는 층을 의미한다.A quantum dot may include a core and a shell surrounding the core. Quantum dots may be composed of only a core and a shell, but may further include a stabilizing layer between the core and the shell, or may further include a stabilizing layer on the outside of the shell, that is, opposite to the core, or outside of the shell, that is, opposite to the core. It may further include a ligand (or a ligand layer). The ligand layer refers to a layer in which a space occupied by a ligand is formed.
코어, 쉘, 안정층은 각각 12족-16족계 화합물, 13족-15족계 화합물, 14족-16족계 화합물 중 1종 이상을 포함할 수 있다.The core, the shell, and the stabilizing layer may each include at least one of a Group 12-16 compound, a Group 13-15 compound, and a Group 14-16 compound.
12족-16족계 화합물은 카드뮴설파이드(CdS), 카드뮴셀레나이드(CdSe), 카드뮴텔레나이드(CdTe), 징크설파이드(ZnS), 징크셀레나이드(ZnSe), 징크텔레나이드(ZnTe), 머큐리설파이드(HgS), 머큐리셀레나이드(HgSe), 머큐리텔레나이드(HgTe), 징크옥사이드(ZnO), 카드뮴옥사이드(CdO), 머큐리옥사이드(HgO), 카드뮴셀레늄설파이드(CdSeS), 카드뮴셀레늄텔레나이드(CdSeTe), 카드뮴설파이드텔레나이드(CdSTe), 카드뮴징크설파이드(CdZnS), 카드뮴징크셀레나이드(CdZnSe), 카드뮴설파이드셀레나이드(CdSSe), 카드뮴징크텔레나이드(CdZnTe), 카드뮴머큐리설파이드(CdHgS), 카드뮴머큐리셀레나이드(CdHgSe), 카드뮴머큐리텔레나이드(CdHgTe), 징크셀레늄설파이드(ZnSeS), 징크셀레늄텔레나이드(ZnSeTe), 징크설파이드텔레나이드(ZnSTe), 머큐리셀레늄설파이드(HgSeS), 머큐리셀레늄텔레나이드(HgSeTe), 머큐리설파이드텔레나이드(HgSTe), 머큐리징크설파이드(HgZnS), 머큐리징크셀레나이드(HgZnSe), 카드뮴징크옥사이드(CdZnO), 카드뮴머큐리옥사이드(CdHgO), 징크머큐리옥사이드(ZnHgO), 징크셀레늄옥사이드(ZnSeO), 징크텔레늄옥사이드(ZnTeO), 징크설파이드옥사이드(ZnSO), 카드뮴셀레늄옥사이드(CdSeO), 카드뮴텔레늄옥사이드(CdTeO), 카드뮴설파이드옥사이드(CdSO), 머큐리셀레늄옥사이드(HgSeO), 머큐리텔레늄옥사이드(HgTeO), 머큐리설파이드옥사이드(HgSO), 카드뮴징크셀레늄설파이드(CdZnSeS), 카드뮴징크셀레늄텔레나이드(CdZnSeTe), 카드뮴징크설파이드텔레나이드(CdZnSTe), 카드뮴머큐리셀레늄설파이드(CdHgSeS), 카드뮴머큐리셀레늄텔레나이드(CdHgSeTe), 카드뮴머큐리설파이드텔레나이드(CdHgSTe), 머큐리징크셀레늄설파이드(HgZnSeS), 머큐리징크셀레늄텔레나이드(HgZnSeTe), 머큐리징크설파이드텔레나이드(HgZnSTe), 카드뮴징크셀레늄옥사이드(CdZnSeO), 카드뮴징크텔레늄옥사이드(CdZnTeO), 카드뮴징크설파이드옥사이드(CdZnSO), 카드뮴머큐리셀레늄옥사이드(CdHgSeO), 카드뮴머큐리텔레늄옥사이드(CdHgTeO), 카드뮴머큐리설파이드옥사이드(CdHgSO), 징크머큐리셀레늄옥사이드(ZnHgSeO), 징크머큐리텔레늄옥사이드(ZnHgTeO) 및 징크머큐리설파이드옥사이드(ZnHgSO) 중 하나 이상을 포함할 수 있다.Group 12-16 compounds include cadmium sulfide (CdS), cadmium selenide (CdSe), cadmium thelenide (CdTe), zinc sulfide (ZnS), zinc selenide (ZnSe), zinc thelenide (ZnTe), mercury sulfide ( HgS), Mercury Selenide (HgSe), Mercury Telenide (HgTe), Zinc Oxide (ZnO), Cadmium Oxide (CdO), Mercury Oxide (HgO), Cadmium Selenium Sulfide (CdSeS), Cadmium Selenium Telenide (CdSeTe), Cadmium Sulfide Telenide (CdSTe), Cadmium Zinc Sulfide (CdZnS), Cadmium Zinc Selenide (CdZnSe), Cadmium Sulfide Selenide (CdSSe), Cadmium Zinc Telenide (CdZnTe), Cadmium Mercury Sulfide (CdHgS), Cadmium Mercury Selenide (CdHgSe), Cadmium Mercury Telenide (CdHgTe), Zinc Selenium Sulfide (ZnSeS), Zinc Selenium Telenide (ZnSeTe), Zinc Sulfide Telenide (ZnSTe), Mercury Selenium Sulfide (HgSeS), Mercury Selenium Telenide (HgSeTe), Mercurysulfide Telenide (HgSTe), Mercury Zinc Sulfide (HgZnS), Mercury Zinc Selenide (HgZnSe), Cadmium Zinc Oxide (CdZnO), Cadmium Mercury Oxide (CdHgO), Zinc Mercury Oxide (ZnHgO), Zinc Selenium Oxide (ZnSeO) , Zinc Telenium Oxide (ZnTeO), Zinc Sulfide Oxide (ZnSO), Cadmium Selenium Oxide (CdSeO), Cadmium Telenium Oxide (CdTeO), Cadmium Sulfide Oxide (CdSO), Mercury Selenium Oxide (HgSeO), Mercury Telenium Oxide ( HgTeO), Mercurysulfide Oxide (HgSO), Cadmium Zinc Selenium Sulfide (CdZnSeS), Cadmium Zinc Selenium Telenide (CdZnSeTe), Cadmium Zinc Sulfide Telenide (CdZnSTe), Cadmium Mercury Selenium Sulfide (CdHgSeS), Cadmium Mercury Selenium Sulfide (CdHgSeS) CdHgSeTe), Cadmium Mercury Sulfide Telenide (CdHgSTe), Mercury Zinc Selenium Sulfide (HgZnSeS), Mercury Zinc Selenium Telenide (HgZnSeTe), Mercury Zinc Sulfide Telenide (HgZnSTe), Cadmium Zinc Selenide Cadmium Zinc Telenium Oxide (CdZnTeO), Cadmium Zinc Sulfide Oxide (CdZnSO), Cadmium Mercury Selenium Oxide (CdHgSeO), Cadmium Mercury Selenium Oxide (CdHgTeO), Cadmium Mercury Sulfide Oxide (CdHgSO) It may include at least one of selenium oxide (ZnHgSeO), zinc mercury terenium oxide (ZnHgTeO), and zinc mercury sulfide oxide (ZnHgSO).
13족-15족계 화합물은 갈륨포스포러스(GaP), 갈륨아세나이드(GaAs), 갈륨안티모니(GaSb), 갈륨나이트라이드(GaN), 알루미늄포스포러스(AlP), 알루미늄아세나이드(AlAs), 알루미늄안티모니(AlSb), 알루미늄나이트라이드(AlN), 인듐포스포러스(InP), 인듐아세나이드(InAs), 인듐안티모니(InSb), 인듐나이트라이드(InN), 갈륨포스포러스아세나이드(GaPAs), 갈륨포스포러스안티모니(GaPSb), 갈륨포스포러스나이트라이드(GaPN), 갈륨아세나이드나이트라이드(GaAsN), 갈륨안티모니나이트라이드(GaSbN), 알루미늄포스포러스아세나이드(AlPAs), 알루미늄포스포러스안티모니(AlPSb), 알루미늄포스포러스나이트라이드(AlPN), 알루미늄아세나이드나이트라이드(AlAsN), 알루미늄안티모니나이트라이드(AlSbN), 인듐포스포러스아세나이드(InPAs), 인듐포스포러스안티모니(InPSb), 인듐포스포러스나이트라이드(InPN), 인듐아세나이드나이트라이드(InAsN), 인듐안티모니나이트라이드(InSbN), 알루미늄갈륨포스포러스(AlGaP), 알루미늄갈륨아세나이드(AlGaAs), 알루미늄갈륨안티모니(AlGaSb), 알루미늄갈륨나이트라이드(AlGaN), 알루미늄아세나이드나이트라이드(AlAsN), 알루미늄안티모니나이트라이드(AlSbN), 인듐갈륨포스포러스(InGaP), 인듐갈륨아세나이드(InGaAs), 인듐갈륨안티모니(InGaSb), 인듐갈륨나이트라이드(InGaN), 인듐아세나이드나이트라이드(InAsN), 인듐안티모니나이트라이드(InSbN), 알루미늄인듐포스포러스(AlInP), 알루미늄인듐아세나이드(AlInAs), 알루미늄인듐안티모니(AlInSb), 알루미늄인듐나이트라이드(AlInN), 알루미늄아세나이드나이트라이드(AlAsN), 알루미늄안티모니나이트라이드(AlSbN), 알루미늄포스포러스나이트라이드(AlPN), 갈륨알루미늄포스포러스아세나이드(GaAlPAs), 갈륨알루미늄포스포러스안티모니(GaAlPSb), 갈륨인듐포스포러스아세나이드(GaInPAs), 갈륨인듐알루미늄아세나이드(GaInAlAs), 갈륨알루미늄포스포러스나이트라이드(GaAlPN), 륨알루미늄아세나이드나이트라이드(GaAlAsN), 갈륨알루미늄안티모니나이트라이드(GaAlSbN), 갈륨인듐포스포러스나이트라이드(GaInPN), 갈륨인듐아세나이드나이트라이드(GaInAsN), 갈륨인듐알루미늄나이트라이드(GaInAlN), 갈륨안티모니포스포러스나이트라이드(GaSbPN), 갈륨아세나이드포스포러스나이트라이드(GaAsPN), 갈륨아세나이드안티모니나이트라이드(GaAsSbN), 갈륨인듐포스포러스안티모니(GaInPSb), 갈륨인듐포스포러스나이트라이드(GaInPN), 갈륨인듐안티모니나이트라이드(GaInSbN), 갈륨포스포러스안티모니나이트라이드(GaPSbN), 인듐알루미늄포스포러스아세나이드(InAlPAs), 인듐알루미늄포스포러스나이트라이드(InAlPN), 인듐포스포러스아세나이드나이트라이드(InPAsN), 인듐알루미늄안티모니나이트라이드(InAlSbN), 인듐포스포러스안티모니나이트라이드(InPSbN), 인듐아세나이드안티모니나이트라이드(InAsSbN) 및 인듐알루미늄포스포러스안티모니(InAlPSb) 중 하나 이상을 포함할 수 있다.Group 13-15 compounds are gallium phosphorus (GaP), gallium arsenide (GaAs), gallium antimony (GaSb), gallium nitride (GaN), aluminum phosphorus (AlP), aluminum arsenide (AlAs), aluminum Antimony (AlSb), aluminum nitride (AlN), indium phosphorus (InP), indium arsenide (InAs), indium antimony (InSb), indium nitride (InN), gallium phosphorous arsenide (GaPAs), Gallium phosphorus antimony (GaPSb), gallium phosphorus nitride (GaPN), gallium arsenide nitride (GaAsN), gallium antimony nitride (GaSbN), aluminum phosphorous arsenide (AlPAs), aluminum phosphorus antimony (AlPSb), aluminum phosphorus nitride (AlPN), aluminum arsenide nitride (AlAsN), aluminum antimony nitride (AlSbN), indium phosphorus arsenide (InPAs), indium phosphorus antimony (InPSb), indium phosphorus nitride (InPN), indium arsenide nitride (InAsN), indium antimony nitride (InSbN), aluminum gallium phosphorus (AlGaP), aluminum gallium arsenide (AlGaAs), aluminum gallium antimony (AlGaSb), Aluminum gallium nitride (AlGaN), aluminum arsenide nitride (AlAsN), aluminum antimony nitride (AlSbN), indium gallium phosphorus (InGaP), indium gallium arsenide (InGaAs), indium gallium antimony (InGaSb), Indium gallium nitride (InGaN), indium arsenide nitride (InAsN), indium antimony nitride (InSbN), aluminum indium phosphorus (AlInP), aluminum indium arsenide (AlInAs), aluminum indium antimony (AlInSb), Aluminum indium nitride (AlInN), aluminum arsenide nitride (AlAsN), aluminum antimony nitride (AlSbN), aluminum phosphorus nitride (AlPN), gallium aluminum phosphorous arsenide (GaAlPAs), gallium aluminum phosphorus anti Mono (GaAlPSb), gallium indium phosphorus arsenide (GaInPAs), gallium phosphorus Aluminum aluminum arsenide (GaInAlAs), gallium aluminum phosphorus nitride (GaAlPN), aluminum aluminum arsenide nitride (GaAlAsN), gallium aluminum antimony nitride (GaAlSbN), gallium indium phosphorus nitride (GaInPN), gallium indium Arsenide nitride (GaInAsN), gallium indium aluminum nitride (GaInAlN), gallium antimony phosphorus nitride (GaSbPN), gallium arsenide phosphorus nitride (GaAsPN), gallium arsenide antimony nitride (GaAsSbN), Gallium indium phosphorus antimony (GaInPSb), gallium indium phosphorus nitride (GaInPN), gallium indium antimony nitride (GaInSbN), gallium phosphorus antimony nitride (GaPSbN), indium aluminum phosphorous arsenide (InAlPAs) , Indium aluminum phosphorus nitride (InAlPN), indium phosphorus arsenide nitride (InPAsN), indium aluminum antimony nitride (InAlSbN), indium phosphorus antimony nitride (InPSbN), indium arsenide antimony nitride (InAsSbN) and indium aluminum phosphorus antimony (InAlPSb).
14족-16족계 화합물은 틴옥사이드(SnO), 틴설파이드(SnS), 틴셀레나이드(SnSe), 틴텔레나이드(SnTe), 리드설파이드(PbS), 리드셀레나이드(PbSe), 리드텔레나이드(PbTe), 저마늄옥사이드(GeO), 저마늄설파이드(GeS), 저마늄셀레나이드(GeSe), 저마늄텔레나이드(GeTe), 틴셀레늄설파이드(SnSeS), 틴셀레늄텔레나이드(SnSeTe), 틴설파이드텔레나이드(SnSTe), 리드셀레늄설파이드(PbSeS), 리드셀레늄텔레나이드(PbSeTe), 리드설파이드텔레나이드(PbSTe), 틴리드설파이드(SnPbS), 틴리드셀레나이드(SnPbSe), 틴리드텔레나이드(SnPbTe), 틴옥사이드설파이드(SnOS), 틴옥사이드셀레나이드(SnOSe), 틴옥사이드텔레나이드(SnOTe), 저마늄옥사이드설파이드(GeOS), 저마늄옥사이드셀레나이드(GeOSe), 저마늄옥사이드텔레나이드(GeOTe), 틴리드설파이드셀레나이드(SnPbSSe), 틴리드셀레늄텔레나이드(SnPbSeTe) 및 틴리드설파이드텔레나이드(SnPbSTe) 중 하나 이상을 포함할 수 있다.Group 14-16 compounds are tin oxide (SnO), tin sulfide (SnS), tin selenide (SnSe), tin thelenide (SnTe), lead sulfide (PbS), lead selenide (PbSe), lead thelenide ( PbTe), germanium oxide (GeO), germanium sulfide (GeS), germanium selenide (GeSe), germanium telenide (GeTe), tin selenium sulfide (SnSeS), tin selenium telenide (SnSeTe), tin sulfide Telenide (SnSTe), lead selenium sulfide (PbSeS), lead selenium thelenide (PbSeTe), lead sulfide teleenide (PbSTe), tin lead sulfide (SnPbS), tin lead selenide (SnPbSe), tin lead thelenide (SnPbTe) ), tin oxide sulfide (SnOS), tin oxide selenide (SnOSe), tin oxide telenide (SnOTe), germanium oxide sulfide (GeOS), germanium oxide selenide (GeOSe), germanium oxide telenide (GeOTe) , tin lead sulfide selenide (SnPbSSe), tin lead sulfide selenide (SnPbSeTe), and tin lead sulfide selenide (SnPbSTe).
코어의 직경은 1 nm 내지 6 nm, 구체적으로 1.2 nm 내지 5 nm, 더욱 구체적으로 2 nm 내지 5 nm일 수 있다. 상기의 범위에서 안정층을 2 이상 포함할 수 있고, 양자점의 광학적 효율이 우수한 장점이 있다. The diameter of the core may be 1 nm to 6 nm, specifically 1.2 nm to 5 nm, more specifically 2 nm to 5 nm. In the above range, two or more stable layers may be included, and the optical efficiency of quantum dots is excellent.
쉘의 두께는 0.5 nm 내지 10 nm, 구체적으로 0.5 nm 내지 8 nm, 더욱 구체적으로 0.5 nm 내지 6 nm일 수 있다. 상기의 범위에서 양자점의 안정성이 높아지는 있다. 상기 쉘은 2 이상의 쉘을 포함할 수 있다.The thickness of the shell may be 0.5 nm to 10 nm, specifically 0.5 nm to 8 nm, more specifically 0.5 nm to 6 nm. In the above range, the stability of the quantum dot is increased. The shell may include two or more shells.
안정층은 양자점에 1층으로 포함될 수도 있으나, 2개 이상의 층으로 포함될 수도 있다. 즉, 코어와 쉘 사이에 제1안정층을 포함하고, 쉘의 외측에 제2안정층을 포함할 수 있다. 또는 코어와 쉘, 및 쉘의 외층에 쉘로부터 제1안정층, 제2안정층을 포함할 수 있다.The stabilizing layer may be included as one layer in the quantum dot, but may be included as two or more layers. That is, a first stabilizing layer may be included between the core and the shell, and a second stabilizing layer may be included outside the shell. Alternatively, the core and the shell, and the outer layer of the shell may include a first stabilizing layer and a second stabilizing layer from the shell.
리간드(또는 리간드층)는 수용성 리간드, 지용성 리간드 중 1종 이상을 포함할 수 있다. The ligand (or ligand layer) may include at least one of a water-soluble ligand and a fat-soluble ligand.
지용성 리간드는 트리-n-옥틸포스핀옥사이드(tri-n-octylphosphine oxide), 데실아민(decylamine), 디데실아민(didecylamine), 트리데실아민(tridecylamine), 테트라데실아민(tetradecylamine), 펜타데실아민(pentadecylamine), 헥사데실아민(hexadecylamine), 옥타데실아민(octadecylamine), 운데실아민(undecylamin), 디옥타데실아민(dioctadecylamine), N,N-디메틸데실아민(N,N-dimethyldecylamine), N,N-디메틸도데실아민(N,N-dimethyldodecylamine), N,N-디메틸헥사데실아민(N,N-dimethylhexadecylamine), N,N-디메틸테트라데실아민(N,N-dimethyltetradecylamine), N,N-디메틸트리데실아민(N,N-dimethyltridecylamine), N,N-디메틸운데실아민(N,N-dimethylundecylamine), N-데실아민(N-decylamine), N-메틸옥타데실아민(N-methyloctadecylamine), 디도데실아민(didodecylamine), 트리도데실아민(tridodecylamine), 사이클로도데실아민(cyclododecylamine), N-메틸도데실아민(N-methyldodecylamine), 트리옥틸아민(trioctylamine), 라우르산(lauric acid), 팔미트산(palmiticacid), 올레산(oleic acid), 스테아르산(stearic acid), 미리스트산(myristicacid), 엘라이드산(elaidic acid), 아라킨산(eicosanoic acid), 헨에이코산산(heneicosanoic acid), 트리코산산(tricosanoic acid), 도코사노산(docosanoic acid), 테트라코사논산(tetracosanoic acid), 헥사코사논산(hexacosanoic acid), 헵타코사논산(heptacosanoic acid), 옥타코사논산(octacosanoic acid) 및 시스-13-도코세논산(cis-13-docosenoic acid) 중 하나 이상을 포함할 수 있다.Fat-soluble ligands are tri-n-octylphosphine oxide, decylamine, didecylamine, tridecylamine, tetradecylamine, pentadecylamine (pentadecylamine), hexadecylamine, octadecylamine, undecylamine, dioctadecylamine, N,N-dimethyldecylamine, N, N,N-dimethyldodecylamine, N,N-dimethylhexadecylamine, N,N-dimethyltetradecylamine, N,N- Dimethyltridecylamine (N,N-dimethyltridecylamine), N,N-dimethylundecylamine (N,N-dimethylundecylamine), N-decylamine (N-decylamine), N-methyloctadecylamine (N-methyloctadecylamine), Didodecylamine, tridodecylamine, cyclododecylamine, N-methyldodecylamine, trioctylamine, lauric acid, palmitic acid, oleic acid, stearic acid, myristicacid, elaidic acid, eicosanoic acid, heneicosanoic acid , tricosanoic acid, docosanoic acid, tetracosanoic acid, hexacosanoic acid, heptacosanoic ac id), octacosanoic acid, and cis-13-docosenoic acid.
수용성 리간드는 실리카, PEG(polyethylene glycol), 머캡토 프로피온산(MPA), 시스테아민(cysteamine), 메르캡토 아세트산(mercapto-acetic acid), 머캡토 운데카놀(mercapto-undecanol), 2-머캡토 에탄올(2-mercapto-ethanol), 1-티오-글리세롤(1-thio glycerol), 데옥시리보뉴클레익 에시드 (DNA), 머캡토 아세트산(mercapto acetic acid), 머캡토 운데카노산(mercapto-undecanoic acid), 1-머캡토-6-페닐 헥산 (1-mercapto-6-phenyl-hexane), 1,16-디머캡토-헥사데칸(1,16-dimecapto-hexadecane), 18-머캡토-옥타데실아민(18-mercapto-octadecyl amine), 트리옥틸포스핀(tri-octyl phosphine), 6-머캡토-헥산(6-mercapto-hexane), 6-머캡토-헥사노익 산(6-mercapto-hexanoic acid), 16-머캡토-헥사데카노익 산(16-mercapto-hexadecanoic acid), 18-머캡토-옥타데실아민(18-mercapto-octadecyl amine), 6-머캡토-헥실아민(6-mercapto-hexyl amine) 또는 8-히드록시-옥틸티올(8-hydroxy-octylthiol), 1-싸이오-글리세롤(1-thio-glycerol), 머캡토 아세트산(mercapto-acetic acid), 머캡토운데카노산(mercapto-undecanoic acid), 하이드록사메이트(hydroxamate), 하이드록사믹 산의 유도체 및 에틸렌디아민(ethylene diaminie) 중 하나 이상을 포함할 수 있다.Water-soluble ligands include silica, polyethylene glycol (PEG), mercaptopropionic acid (MPA), cysteamine, mercapto-acetic acid, mercapto-undecanol, 2-mercaptoethanol (2-mercapto-ethanol), 1-thio-glycerol (1-thio glycerol), deoxyribonucleic acid (DNA), mercapto acetic acid, mercapto-undecanoic acid ), 1-mercapto-6-phenyl hexane (1-mercapto-6-phenyl-hexane), 1,16-dimercapto-hexadecane (1,16-dimecapto-hexadecane), 18-mercapto-octadecylamine (18-mercapto-octadecyl amine), tri-octyl phosphine, 6-mercapto-hexane, 6-mercapto-hexanoic acid , 16-mercapto-hexadecanoic acid (16-mercapto-hexadecanoic acid), 18-mercapto-octadecylamine (18-mercapto-octadecyl amine), 6-mercapto-hexylamine (6-mercapto-hexyl) amine) or 8-hydroxy-octylthiol, 1-thio-glycerol, mercapto-acetic acid, mercapto-undecanoic acid acid), hydroxamate, a derivative of hydroxamic acid, and ethylene diamine (ethylene diamine).
양자점은 평균 입경이 6 내지 30nm, 구체적으로 6 내지 20nm가 될 수 있다. 상기 범위에서, 광학 특성이 우수한 장점이 있을 수 있다.The quantum dots may have an average particle diameter of 6 to 30 nm, specifically 6 to 20 nm. Within the above range, there may be an advantage of excellent optical properties.
양자점에서, 코어는 카드뮴, 셀레늄을 포함할 수 있다. 쉘 및 안정층은 각각 카드뮴, 셀레늄, 아연, 황 중 1종 이상을 포함할 수 있다. 바람직하게는, 코어, 쉘 및 안정층은 각각 카드뮴을 포함할 수 있다. 바람직하게는, 양자점은 코어로 갈수록 카드뮴 또는 셀레늄의 함량(몰%)이 증가할 수 있다.In quantum dots, the core may include cadmium and selenium. The shell and the stabilizing layer may each include at least one of cadmium, selenium, zinc, and sulfur. Preferably, the core, shell and stabilizing layer may each comprise cadmium. Preferably, the content (mol%) of cadmium or selenium may increase toward the core of the quantum dot.
양자점은 당업자에게 알려진 통상의 방법으로 제조될 수 있으며, 보다 상세한 내용은 양자점 관련하여 알려진 종래 기술에 따른다.Quantum dots may be prepared by conventional methods known to those skilled in the art, and more detailed information follows prior art known in relation to quantum dots.
일 구체예에서, 양자점은 CdSe 및 ZnS로 이루어진 것일 수 있다.In one embodiment, the quantum dots may be made of CdSe and ZnS.
결합 패드(200)에서, 양자점(211)은 소정의 핵산(212)에 결합되어 있다. 소정의 핵산(212)을 포함함으로써 양자점(211)의 이동을 용이하게 할 수 있다. 양자점은 상기 핵산(212)의 5' 또는 3'에 결합될 수 있다.In the
일 구체예에서, 결합 패드는 양자점(211)에 핵산(212)이 결합된 결합체(conjugate)를 포함할 수 있다.In one embodiment, the binding pad may include a conjugate in which the
이하, 양자점(211)이 결합된 핵산(212)에 대해 설명한다.Hereinafter, the
양자점(211)이 결합된 핵산(212)은 상술된 앱타머(311)에 대한 상보적인 서열 즉 제1서열을 포함한다. 이를 통해 양자점(211)이 결합된 핵산(212)은 시료 전개 패드(300) 중 테스트 영역(310)에 존재하는 앱타머(311)에 특이적으로 결합함으로써 시료 중 프탈레이트계 물질의 존부를 판단할 수 있게 한다. 이에 대해서는 하기 도 1의 (b), (c)에서 보다 상세하게 설명한다.The
양자점(211)이 결합된 핵산(212)은 하기 상술되는 대조군 영역(320)에 존재하는 서열(321)(예를 들면 제2서열)에 상보적인 서열 예를 들면 제3서열을 더 포함할 수 있다. 이를 통해 시료 전개 패드 중 대조군 영역까지 시료가 이동하였음을 확인할 수 있도록 함으로써 프탈레이트계 물질의 검출의 분석 신뢰성을 높일 수 있다.The
일 구체예에서, 양자점(211)이 결합된 핵산(212)은 제1서열과 제3서열을 모두 포함할 수 있다.In one embodiment, the
바람직하게는, 양자점(211)이 결합된 핵산(212)은 5'으로부터 3'의 순서로 하기 상술되는 대조군 영역에 존재하는 서열 즉 제2서열에 상보적인 서열 즉 제3서열과, 상술된 앱타머에 대한 상보적인 서열인 제1서열을 포함하는 단일 가닥 스트랜드 서열을 포함할 수 있다. 양자점은 상기 서열의 5' 말단에 결합될 수 있다.Preferably, the
일 구체예에서, 핵산(212)은 5'-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3'(서열번호 2)이 될 수 있다.In one embodiment, the
일 구체예에서, 핵산(212)은 양자점과의 결합을 용이하게 하기 위하여 5' 말단에 티올기를 갖도록 변형될 수 있다(예: 5'-티올-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3').In one embodiment, the
바람직하게는, 상기 제3서열은 제1서열 대비 다를 수 있다.Preferably, the third sequence may be different from the first sequence.
대조군 영역(320)은 시료 주입 패드(100)에 주입된 시료가 결합 패드(200)와 시료 전개 패드(300)를 통해 테스트 영역(310)을 완전히 이동함을 확인하게 할 수 있는 통상의 수단을 포함할 수 있다. 본 발명에서는 프탈레이트계 물질의 검출에 양자점을 사용하는 만큼, 대조군 영역에서도 양자점을 이용한 검출 수단을 활용하였다.The
대조군 영역(320)은 제2서열(321)을 포함할 수 있다. 이를 통해 상기 결합 패드에 존재하는 핵산(212)이 대조군 영역까지 이동하고 제2서열과 제3서열의 상보적인 결합을 함으로써 최종적으로는 양자점에 의해 발광함으로써 분석 신뢰성을 높일 수 있다. The
제2서열(321) 역시 대조군 영역(320)에 고정될 수 있다.The
일 구체예에서, 제2서열은 5'-GGGGGGGGGG-3'(서열번호 3)이 될 수 있다.In one embodiment, the second sequence may be 5'-GGGGGGGGGG-3' (SEQ ID NO: 3).
제2서열(321)을 고정시킬 수 있는 방법은 특별히 제한되지 않는다. 예를 들면, 제2서열(321)은 변성 물질(322)로 변성화되고, 대조군 영역(320)에 고정된 결합 물질(323)에 의해 변성 물질(322)과 결합 물질(323) 간의 결합 반응을 통해 고정될 수 있다.A method for fixing the
일 구체예에서, 변성 물질(322)은 비오틴일 수 있다.In one embodiment, the modified
일 구체예에서, 결합 물질(323)은 스트렙트아비딘일 수 있다.In one embodiment, the binding
도 1의 (b)를 참조하여, 프탈레이트계 물질을 함유하지 않는 시료를 시료 주입 패드에 주입하였을 때 키트의 작동 기작을 설명한다.An operation mechanism of the kit will be described with reference to FIG. 1B , when a sample not containing a phthalate-based material is injected into the sample injection pad.
도 1의 (b)를 참조하면, 시료 주입 패드(100)에 프탈레이트계 물질을 포함하지 않는 시료(500)가 주입된다. Referring to FIG. 1B , a
주입된 시료(500)는 시료 주입 패드(100)를 통과하고 결합 패드(200), 시료 전개 패드(300)의 테스트 영역(310), 대조군 영역(320)을 순차적으로 이동한 다음, 흡수 패드(400)를 최종적으로 통과하면서 이동하게 된다. The injected
시료(500)가 결합 패드(200)로부터 시료 전개 패드(300)로 이동함으로써 결합 패드(200)에 존재하던 양자점(211) 결합된 핵산(212) 결합체 역시 시료 전개 패드로 이동한다. 양자점 결합된 핵산 결합체는 양자점에 제1서열과 제3서열이 결합된 결합체일 수 있다.As the
양자점 결합된 핵산 결합체가 테스트 영역(310)에 도달하게 되면, 이것은 테스트 영역에 존재하는 앱타머(311)에 결합하게 된다. 테스트 영역(310)을 통과한 후 남아있는 양자점 결합된 핵산 결합체는 대조군 영역(320)에 존재하는 제2서열(321)에 결합하게 된다.When the quantum dot-coupled nucleic acid binder reaches the
광 조사 유닛(도 1에서 도시되지 않음)을 통해 광을 조사함으로써 테스트 영역(도 1의 (b)에서 T로 표시됨)과 대조군 영역(도 1의 (b)에서 C로 표시됨)이 모두 발광하게 된다. 이를 통해 시료 중에는 프탈레이트계 물질이 존재하지 않으며 시료의 분석도 신뢰성있게 완료되었음을 확인할 수 있다.By irradiating light through a light irradiation unit (not shown in Fig. 1), both the test region (indicated by T in Fig. 1 (b)) and the control region (indicated by C in Fig. 1 (b)) emit light. do. Through this, it can be confirmed that there is no phthalate-based material in the sample and the analysis of the sample has been reliably completed.
도 1의 (c)를 참조하여, 프탈레이트계 물질(610)이 함유된 시료(600)를 시료 주입 패드에 주입하였을 때 키트의 작동 기작을 설명한다.An operation mechanism of the kit will be described with reference to FIG. 1C , when the
시료 중 프탈레이트계 물질(610)의 존재는 앱타머(311)와 프탈레이트계 물질(610) 간의 반응으로 인한 발광 시그널의 감소 또는 부재(不在)에 의해 확인될 수 있다.The presence of the phthalate-based
도 1의 (c)를 참조하면, 도 1의 (b)와 마찬가지로 시료(600)가 결합 패드(200)로부터 시료 전개 패드(300)로 이동함으로써 결합 패드(200)에 존재하던 양자점(211) 결합된 핵산(212) 결합체 역시 시료 전개 패드(300)로 이동한다.Referring to FIG. 1C , as in FIG. 1B , the
양자점(211) 결합된 핵산(212) 결합체가 테스트 영역(310)에 도달하게 되면, 시료 중 프탈레이트계 물질(610)도 테스트 영역에 도달하게 된다. 테스트 영역(310)에 존재하던 앱타머(311)는 양자점(211) 결합된 핵산(212) 결합체에 결합하기도 전에 시료 중 프탈레이트계 물질(610)에 결합하게 된다.When the quantum dot 211-bound
반대로 양자점(211) 결합된 핵산(212)은 앱타머(311)에 결합할 수 없게 된다. 양자점 결합된 핵산(212)은 세척 등의 방법에 의해 키트로부터 제거될 수 있다.Conversely, the
테스트 영역(310)을 통과한 후 남아있는 양자점 결합된 핵산 결합체는 대조군 영역에 존재하는 제2서열(321)에 결합하게 된다. 광 조사 유닛을 통해 광을 조사함으로써 테스트 영역(도 1의 (c)에서 T로 표시됨)에는 발광되지 않고 대조군 영역(도 1의 (c)에서 C로 표시됨)이 발광하게 된다. 이를 통해 시료 중에는 프탈레이트계 물질이 존재하며 시료의 분석도 신뢰성있게 완료되었음을 확인할 수 있다. 도 1의 (b) 대비 도 1의 (c)에서는 테스트 영역에서의 발광 시그널이 감소하거나 또는 전혀 없음으로써, 발광 시그널의 감소 또는 부재에 의해 시료 중 프탈레이트계 물질이 존재하고 있음을 확인할 수 있다.The quantum dot-coupled nucleic acid binder remaining after passing through the
이하, 본 발명의 일 실시예에 따른 프탈레이트계 물질의 검출 방법을 설명한다.Hereinafter, a method for detecting a phthalate-based material according to an embodiment of the present invention will be described.
본 발명의 프탈레이트계 물질의 검출 방법은 본 발명의 프탈레이트계 물질 검출 키트를 사용하는 단계를 포함한다.The method for detecting a phthalate-based substance of the present invention includes using the phthalate-based substance detection kit of the present invention.
구체적으로, 프탈레이트계 물질의 존부를 분석하고자 하는 시료를 프탈레이트계 물질 검출 키트 중 시료 주입 패드에 주입하고, 상기 프탈레이트계 물질 키트를 소정의 조건 하에 방치하고, 광 조사 유닛을 조사하여 양자점으로부터 발광 유무를 확인하는 단계를 포함할 수 있다. Specifically, a sample to be analyzed for the presence or absence of a phthalate-based material is injected into a sample injection pad of a phthalate-based material detection kit, the phthalate-based material kit is left under a predetermined condition, and a light irradiation unit is irradiated to emit light from quantum dots It may include the step of confirming.
본 발명의 프탈레이트계 물질 키트는 앱타머를 비롯하여 각종 핵산 서열의 상보적인 결합을 이용한다. 따라서, 시료 주입 패드에 시료를 주입한 후 상기 상보적인 결합이 용이하도록 하기 위하여 프탈레이트계 물질 키트를 소정의 조건 하에 방치할 수 있다. The phthalate-based material kit of the present invention utilizes complementary binding of various nucleic acid sequences including aptamers. Therefore, after injecting the sample into the sample injection pad, the phthalate-based material kit may be left under a predetermined condition in order to facilitate the complementary binding.
본 발명의 방법은 프탈레이트계 물질 키트를 소정의 조건 하에 방치한 후 시료 주입 패드, 결합 패드, 시료 전개 패드, 흡수 패드를 세척하는 단계를 더 포함할 수 있다. 세척액은 당업자에게 알려진 통상의 종류를 사용할 수 있다.The method of the present invention may further include washing the sample injection pad, the bonding pad, the sample development pad, and the absorption pad after leaving the phthalate-based material kit under a predetermined condition. As the washing solution, conventional types known to those skilled in the art may be used.
이하, 본 발명의 바람직한 실시예를 통해 본 발명의 구성 및 작용을 더욱 상세히 설명하기로 한다. 다만, 이는 본 발명의 바람직한 예시로 제시된 것이며 어떠한 의미로도 이에 의해 본 발명이 제한되는 것으로 해석될 수는 없다.Hereinafter, the configuration and operation of the present invention will be described in more detail through preferred embodiments of the present invention. However, this is presented as a preferred example of the present invention and cannot be construed as limiting the present invention in any sense.
<실시예 1> 프탈레이트 합성<Example 1> Synthesis of phthalate
카르복실기(-COOH)로 변형된 DEHP는 Toronto Research Chemical社로부터 구매하였다.DEHP modified with a carboxyl group (-COOH) was purchased from Toronto Research Chemical.
카르복실기로 변형된 DEHP를 마그네틱 비드에 고정하기 위해 도 2와 같은 방법으로 고정하였다. DEHP modified with a carboxyl group was fixed in the same manner as in FIG. 2 to fix the magnetic bead.
도 2를 참조하면, 카르복실기로 변형된 DEHP를 비드에 고정하기 위하여, 카르복실기로 변형된 DEHP에 EDC(1-에틸-3-(3-디메틸아미노프로필)카르보디이미드)를 첨가하고 반응한 후 아민 기(NH2)를 가진 비드를 첨가 및 반응하였다.Referring to FIG. 2 , in order to fix DEHP modified with a carboxyl group to the beads, EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) was added to the DEHP modified with a carboxyl group and reacted with an amine Beads with groups (NH 2 ) were added and reacted.
<실시예 2> 프탈레이트계 물질의 검출을 위한 앱타머 발굴<Example 2> Aptamer discovery for detection of phthalate-based substances
비드에 고정된 프탈레이트에 대한 앱타머를 발굴하기 위해 라이브러리를 IDTDNA社로부터 합성하여 구입하였다. 라이브러리를 증폭하기 위한 프라이머로 (1) Forward 5'-GATGTGAGTGTGTGACGAG-3'(서열번호: 4), (2) Reverse 5'-GTGTCTCGGTTGTGGTG-3' (서열번호: 5)를 제작하여 사용하였다. 결합에 사용된 buffer는 1X PBST pH7.5에 MgCl2가 5mM이 첨가된 용액을 사용하여 진행하였다. 총 10번의 SELEX round를 진행하였고 염기 서열 분석을 통해 서열번호 1(5'- CGTGATGTGGATTTTTAACGTTGAGGAACCATTGTTATGTTTAGCTGCCGA-3')의 앱타머의 염기 서열을 얻었다. In order to discover an aptamer for phthalate immobilized on the beads, a library was synthesized and purchased from IDTDNA. As primers for amplifying the library, (1) Forward 5'-GATGTGAGTGTGGACGAG-3' (SEQ ID NO: 4), (2) Reverse 5'-GTGTCTCGGTTGTGGTG-3' (SEQ ID NO: 5) was constructed and used. Buffer used for binding was 1X PBST pH7.5 and MgCl 2 5mM was added using a solution. A total of 10 SELEX rounds were performed, and the nucleotide sequence of the aptamer of SEQ ID NO: 1 (5'-CGTGATTGGATTTTTAACGTTGAGGAACCATTGTTATGTTTTAGCTGCCGA-3') was obtained through nucleotide sequence analysis.
<실시예 3> 프탈레이트 앱타머 결합력 검증<Example 3> Verification of phthalate aptamer binding force
서열번호 1의 앱타머의 성능 평가를 위해 도 3에 나와 있는 그림과 같은 방법으로 ELISA 방법을 이용한 결합력 측정을 진행하였다. In order to evaluate the performance of the aptamer of SEQ ID NO: 1, the binding force was measured using the ELISA method as shown in the figure shown in FIG. 3 .
도 3을 참조하면, 비오틴 결합된 서열번호 1의 앱타머와 실시예 1에서 제조된 마그네틱 비드 결합된 DEHP를 결합 반응시키고(Equilibrium Binding), 서로 결합 반응한 앱타머와 프탈레이트의 정도를 검출하고(Chemiluminescence), 얻은 데이터를 분석하여 프탈레이트와 앱타머 간의 Kd(dissociation constant) 값을 분석하는(Data analysis) 과정으로 구성된다.Referring to FIG. 3, the biotin-coupled aptamer of SEQ ID NO: 1 and the magnetic bead-bound DEHP prepared in Example 1 are combined and reacted (Equilibrium Binding), and the degree of the aptamer and phthalate that have reacted with each other is detected ( Chemiluminescence), it consists of a process of analyzing the obtained data and analyzing the Kd (dissociation constant) value between the phthalate and the aptamer (Data analysis).
마이크로플레이트의 각각의 웰에 100ul의 binding buffer에 비오틴-앱타머를 50nmol농도로 첨가한 뒤 안정한 구조를 유지하기 위해 95℃에서 37℃까지 0.1℃/sec로 온도를 낮추어 주었다. 그리고 비오틴-앱타머와 실시예 1에서 제조한 프탈레이트 결합된 마그네틱 비드를 각각 1시간 동안 1300rpm으로 결합 반응을 진행하였다. 그 후 100ul의 binding buffer로 3회 세척하고 스트렙타비딘-HRP를 binding buffer에 1:2000으로 희석하여 결합 반응한 well에 100ul씩 넣고 30분 동안 실온에서 1300rpm으로 결합 반응을 진행하였다. 다시 binding buffer 100ul로 3회 세척 후 ECL 용액과 반응하여 Chemiluminescence 측정함으로써 Luminescence 값을 측정하였다. 그 결과를 도 4에 나타내었다. Biotin-aptamer was added at a concentration of 50 nmol to 100 ul of binding buffer in each well of the microplate, and then the temperature was lowered at 0.1° C./sec from 95° C. to 37° C. to maintain a stable structure. And the biotin-aptamer and the phthalate-coupled magnetic beads prepared in Example 1 were each subjected to a binding reaction at 1300 rpm for 1 hour. After that, it was washed 3 times with 100ul of binding buffer, and streptavidin-HRP was diluted 1:2000 in binding buffer, 100ul of each was put into the binding reaction well, and the binding reaction was performed at 1300rpm at room temperature for 30 minutes. After washing 3 times with 100ul of binding buffer again, the luminescence value was measured by reacting with ECL solution and measuring Chemiluminescence. The results are shown in FIG. 4 .
도 4를 참조하면, DEHP 농도 증가에 따라 발광값이 증가하였음을 알 수 있다. 서열번호 1의 앱타머의 DEHP에 대한 Kd는 375nM이다.Referring to FIG. 4 , it can be seen that the luminescence value increased as the DEHP concentration increased. The Kd for DEHP of the aptamer of SEQ ID NO: 1 is 375 nM.
<실시예 4> 진단 키트 구현을 위한 서열 제조<Example 4> Preparation of sequences for implementing a diagnostic kit
본 발명의 도 1의 프탈레이트 진단 키트를 구현하기 위한 서열을 준비하였다.A sequence for implementing the phthalate diagnostic kit of FIG. 1 of the present invention was prepared.
본 실시예에서 사용한 대조군 영역에 사용되는 서열은 5'-GGGGGGGGGG-3'(서열번호 3)이며, 시료 전개 패드 중 대조군 영역에서의 고정을 위해 5'-biotin-GGGGGGGGGG-3'으로 변성되었다. The sequence used for the control region used in this Example is 5'-GGGGGGGGGG-3' (SEQ ID NO: 3), and it was modified to 5'-biotin-GGGGGGGGGG-3' for fixation in the control region in the sample development pad.
본 실시예에서 사용한 결합 패드에 사용되는 양자점이 결합되는 핵산은 서열번호 1과 일부 상보 결합을 이루는 서열; 및 상기 대조군 영역에 사용되는 서열과 상보 결합하는 염기 서열을 모두 갖도록 하였으며 5' 말단에는 티올기(-SH)를 갖도록 변형된 올리고머를 합성하였다. 상기 양자점이 결합되는 핵산의 염기 서열은 5'-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3' (서열번호 2)이고, 5'-thiol- CAATGGTTCCTCAA-CCCCCCCCCCCCC-3' 으로 변성시켰다.The nucleic acid to which the quantum dots are bound used in the binding pad used in this Example includes a sequence forming a partial complementary bond with SEQ ID NO: 1; And an oligomer modified to have both a nucleotide sequence complementary to the sequence used in the control region and to have a thiol group (-SH) at the 5' end was synthesized. The nucleotide sequence of the nucleic acid to which the quantum dots are bound is 5'-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3' (SEQ ID NO: 2), and 5'-thiol-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3' was denatured.
상기 5'-thiol-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3'과 양자점(코어: CdSe, 쉘: ZnS)의 결합은 양자점이 상기 핵산의 티올기와 특이적인 결합을 이루는 성질을 이용하여 양자점의 표면에 티올기가 있는 핵산이 결합하도록 48시간 동안 반응하여 양자점이 결합된 핵산을 제조하였다.The binding of the 5'-thiol-CAATGGTTCCTCAA-CCCCCCCCCCCCC-3' to the quantum dot (core: CdSe, shell: ZnS) is a nucleic acid having a thiol group on the surface of the quantum dot using the property that the quantum dot forms a specific bond with the thiol group of the nucleic acid. A nucleic acid to which quantum dots were bound was prepared by reacting for 48 hours to bind.
<실시예5> 진단 키트 구현<Example 5> Implementation of a diagnostic kit
도 1과 같이 결합 패드의 한쪽에는 시료 주입 패드를 연결시키고, 결합 패드의 다른 한쪽 에는 시료 전개 패드를 연결시켰다. 시료 전개 패드의 다른 한 쪽에는 흡수 패드를 연결시켜, 진단 키트를 구현하였다. As shown in FIG. 1 , a sample injection pad was connected to one side of the bonding pad, and a sample development pad was connected to the other side of the bonding pad. A diagnostic kit was implemented by connecting an absorbent pad to the other side of the sample development pad.
결합 패드에는 실시예 4에서 제조한 양자점이 결합된 핵산, 당 화합물 및 계면 활성제를 첨가하여 고정하였다. 시료 전개 패드의 테스트 영역에는 프탈레이트 앱타머 (서열번호 1)에 대하여 비오틴화하였고, 이를 스트렙트아비딘과 반응시켜 테스트 영역에 고정시켰다. 시료 전개 패드의 대조군 영역에는 실시예 4에서 제조된 비오틴화된 대조군 핵산(서열번호 3)을 스트렙트아비딘과 반응하여 대조군 영역에 고정시켰다. 키트는 시료의 전개를 원활히 하기 위하여 제작된 플라스틱의 디바이스에 넣어 조립하였다.The binding pad was fixed by adding the nucleic acid to which the quantum dots prepared in Example 4 were bound, a sugar compound, and a surfactant. The test area of the sample development pad was biotinylated for phthalate aptamer (SEQ ID NO: 1), which was reacted with streptavidin and immobilized on the test area. In the control region of the sample development pad, the biotinylated control nucleic acid (SEQ ID NO: 3) prepared in Example 4 was reacted with streptavidin and immobilized in the control region. The kit was assembled by putting it in a device made of plastic to facilitate the development of the sample.
본 발명의 진단 키트 구현을 확인하기 위하여 DEHP 프탈레이트 시약을 순차 희석하여 시료의 농도 300 ppm 내지 1,500 ppm이 되도록 준비하였다. 각각의 DEHP 프탈레이트 샘플을 진단 키트에 100 ㎕ 점적하여 10분 후 장비를 이용하여 형광 세기를 측정하였다. In order to confirm the implementation of the diagnostic kit of the present invention, the DEHP phthalate reagent was sequentially diluted to prepare a sample concentration of 300 ppm to 1,500 ppm. 100 μl of each DEHP phthalate sample was instilled in a diagnostic kit, and fluorescence intensity was measured 10 minutes later using the equipment.
그 결과 도 5a와 같이 DEHP 프탈레이트 농도가 증가할수록 테스트 영역에서의 양자점에 의한 형광 세기가 약해지는 것을 확인하였고, 테스트 영역의 형광 세기를 각각 측정한 결과 [도 5b]에서와 같이 DEHP 프탈레이트 농도가 증가할수록 측정값이 줄어드는 것을 확인하였다. 이는 DEHP 프탈레이트 앱타머가 프탈레이트 농도가 증가함에 따라 프탈레이트와의 결합이 증가하는 동시에 양자점-핵산 결합체와의 상보 결합은 줄어들었다는 것을 증명하는 결과이다. 따라서 본 발명의 프탈레이트 진단 키트가 구현되는 것을 확인하였다.As a result, as the DEHP phthalate concentration increased as shown in FIG. 5A, it was confirmed that the fluorescence intensity by the quantum dots in the test region was weakened. It was confirmed that the measured value decreased with increasing time. This is a result proving that DEHP phthalate aptamer increased the binding to phthalate as the phthalate concentration increased, while the complementary binding to the quantum dot-nucleic acid conjugate decreased. Therefore, it was confirmed that the phthalate diagnostic kit of the present invention was implemented.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.So far, with respect to the present invention, the preferred embodiments have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in modified forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.
<110> ZEUS <120> KIT FOR ANALYZING PHTHALIC BASED MATERIAL USING APTAMER AND METHOD FOR ANALYZING PHTHALIC BASED MATERIAL USING THE SAME <130> AHP19034 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> APTAMER <400> 1 cgtgatgtgg atttttaacg ttgaggaacc attgttatgt ttagctgccg a 51 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PARTIAL COMPLEMENTARY SEQUENCE OF APTAMER <400> 2 caatggttcc tcaacccccc ccccccc 27 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> CONTROL SEQUENCE <400> 3 gggggggggg 10 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> FORWARD PRIMER <400> 4 gatgtgagtg tgtgacgag 19 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> REVERSE PRIMER <400> 5 gtgtctcggt tgtggtg 17 <110> ZEUS <120> KIT FOR ANALYZING PHTHALIC BASED MATERIAL USING APTAMER AND METHOD FOR ANALYZING PHTHALIC BASED MATERIAL USING THE SAME <130> AHP19034 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> APTAMER <400> 1 cgtgatgtgg atttttaacg ttgaggaacc attgttatgt ttagctgccg a 51 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PARTIAL COMPLEMENTARY SEQUENCE OF APTAMER <400> 2 caatggttcc tcaacccccc ccccccc 27 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> CONTROL SEQUENCE <400> 3 gggggggggg 10 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> FORWARD PRIMER <400> 4 gatgtgagtg tgtgacgag 19 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> REVERSE PRIMER <400> 5 gtgtctcggt tgtggtg 17
Claims (9)
상기 시료 전개 패드는 프탈레이트계 물질에 특이적으로 결합하는 서열번호 1의 앱타머(aptamer); 상기 앱타머에 결합된 앱타머 변성 물질; 및 상기 앱타머 변성 물질에 결합된 결합 물질을 포함하고,
상기 결합 패드는 양자점; 및 및 상기 양자점에 결합되고 상기 앱타머에 대한 상보적인 서열을 갖는 핵산을 포함하는 것인, 앱타머를 이용한 프탈레이트계 물질 검출용 키트.
a sample injection pad, a sample development pad, and a bonding pad connecting the sample injection pad and the sample development pad;
The sample deployment pad may include: an aptamer of SEQ ID NO: 1 specifically binding to a phthalate-based material; an aptamer-modified material bound to the aptamer; and a binding material bound to the aptamer-modified material,
The bonding pad may include quantum dots; And It is coupled to the quantum dots and comprising a nucleic acid having a sequence complementary to the aptamer, a kit for detecting a phthalate-based substance using an aptamer.
The method of claim 1, wherein the phthalate-based material comprises at least one of diethylhexyl phthalate (DEHP), benzylbutyl phthalate (BBP), dibutyl phthalate (DBP), and diisobutyl phthalate (DIBP). A kit for detecting phthalate-based substances using an aptamer.
The kit for detecting a phthalate-based substance using an aptamer according to claim 1, wherein the aptamer is fixed to the sample development pad by binding of the aptamer-modified substance and the binding substance.
The kit for detecting a phthalate-based substance using an aptamer according to claim 1, wherein the aptamer-modified substance is biotin, and the binding substance is streptavidin.
The kit for detecting phthalate-based substances using an aptamer according to claim 1, wherein the quantum dots include a core and a shell surrounding the core.
The kit for detecting a phthalate-based substance using an aptamer according to claim 5, wherein the quantum dot further comprises at least one of a stable layer, a ligand, and a ligand layer.
The kit for detecting phthalate-based substances using an aptamer according to claim 1, wherein the quantum dots are made of CdSe and ZnS.
The kit for detecting a phthalate-based material using an aptamer according to claim 1, wherein the presence of the phthalate-based material is confirmed by a decrease or absence of a luminescence signal due to a reaction between the aptamer and the phthalate-based material.
A method for detecting a phthalate-based substance, comprising the step of using a kit for detecting a phthalate-based substance using the aptamer of any one of claims 1 to 8.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020200040879A KR102365359B1 (en) | 2020-04-03 | 2020-04-03 | Kit for analyzing phthalic based material using aptamer and method for analyzing phthalic based material using the same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020200040879A KR102365359B1 (en) | 2020-04-03 | 2020-04-03 | Kit for analyzing phthalic based material using aptamer and method for analyzing phthalic based material using the same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20210124566A true KR20210124566A (en) | 2021-10-15 |
KR102365359B1 KR102365359B1 (en) | 2022-02-22 |
Family
ID=78115504
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020200040879A KR102365359B1 (en) | 2020-04-03 | 2020-04-03 | Kit for analyzing phthalic based material using aptamer and method for analyzing phthalic based material using the same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102365359B1 (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101667148B1 (en) * | 2015-04-28 | 2016-10-17 | 이화여자대학교 산학협력단 | Microfluidic device for detecting target small molecule, method for preparing the same, and method for detecting target small molecule using the same |
KR20190136319A (en) * | 2018-05-30 | 2019-12-10 | 주식회사 제우스 | Method for detecting targent antigen and biological diagnosis device by using quantom-dot and quantom-dot bead comprising multifunctional ligand |
KR20200025249A (en) * | 2018-08-29 | 2020-03-10 | 이화여자대학교 산학협력단 | Aptamer for DEHP detection and DEHP detecting device using the same |
KR20210091861A (en) * | 2020-01-14 | 2021-07-23 | 주식회사 제우스 | Biosensor for analyzing harmful substance using aptamer and method for analyzing harmful substance using the same |
-
2020
- 2020-04-03 KR KR1020200040879A patent/KR102365359B1/en active IP Right Grant
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101667148B1 (en) * | 2015-04-28 | 2016-10-17 | 이화여자대학교 산학협력단 | Microfluidic device for detecting target small molecule, method for preparing the same, and method for detecting target small molecule using the same |
KR20190136319A (en) * | 2018-05-30 | 2019-12-10 | 주식회사 제우스 | Method for detecting targent antigen and biological diagnosis device by using quantom-dot and quantom-dot bead comprising multifunctional ligand |
KR20200025249A (en) * | 2018-08-29 | 2020-03-10 | 이화여자대학교 산학협력단 | Aptamer for DEHP detection and DEHP detecting device using the same |
KR20210091861A (en) * | 2020-01-14 | 2021-07-23 | 주식회사 제우스 | Biosensor for analyzing harmful substance using aptamer and method for analyzing harmful substance using the same |
Also Published As
Publication number | Publication date |
---|---|
KR102365359B1 (en) | 2022-02-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR102306679B1 (en) | Quantum dot and the method for preparing the same | |
US7566573B2 (en) | Dual standard curve immunoassay | |
KR102306678B1 (en) | Quantum dot and the method for preparing the same | |
CN111989571B (en) | Biosensor comprising linker material and quantum dot beads and target antigen detection method using the same | |
US11060997B2 (en) | Quantum dot biosensor | |
US20190265247A1 (en) | Detecting an analyte | |
KR20160095387A (en) | Quantum dot bead sensor and manufacturing method threof | |
Aoyagi et al. | Development of fluorescence change-based, reagent-less optic immunosensor | |
KR102498792B1 (en) | Method for detecting targent antigen and biological diagnosis device by using quantom-dot and quantom-dot bead comprising multifunctional ligand | |
CN112782138B (en) | Kit for detecting extracellular vesicles and application thereof | |
KR102365359B1 (en) | Kit for analyzing phthalic based material using aptamer and method for analyzing phthalic based material using the same | |
KR20210091861A (en) | Biosensor for analyzing harmful substance using aptamer and method for analyzing harmful substance using the same | |
TWI813039B (en) | System for analyzing analyte and method for analyzing analytes using the same | |
KR101938374B1 (en) | Fret-based target molecule detection system, kit thereof and method for detecting target molecule using the same | |
US20140255316A1 (en) | Biomarkers and use thereof | |
KR101812674B1 (en) | Particle including quantum dot for multiplexing analysis and method for manufacturing the same | |
Yuan et al. | Highly fluorescent, monolithic semiconductor nanorod clusters for ultrasensitive biodetection | |
KR102130887B1 (en) | Ascorbic acid detect method using Quantum dots - graphene oxide hybrid sensor | |
US20060263897A1 (en) | Nanoparticles for detecting analytes | |
KR20220166575A (en) | Diagnostic kits and diagnostic methods | |
KR20220166576A (en) | Diagnostic kits and diagnostic methods | |
Foubert | Use of different labels and detection platforms in immunochemical screening methods for (multi) mycotoxins | |
Osipov et al. | Metal nanoparticles as a new type of labels in rapid immunoassay methods | |
KR20220166743A (en) | Diagnostic kits and diagnostic methods |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |