KR20210111043A - A composition comprising HopQ for suppressing cancer metastasis - Google Patents

Abstract

The present invention relates to a composition for inhibiting cancer metastasis including Hrp outer protein Q (HopQ) protein. More particularly, the present invention relates to a pharmaceutical composition for inhibiting cancer metastasis and health-aid food for preventing or reducing cancer metastasis, including HopQ protein as an active ingredient, and a method for screening a cancer metastasis inhibitor. According to the present invention, HopQ protein interacts with 14-3-3 protein to inhibit expression or stability of vimentin protein and to suppress cancer cell migration, thereby inhibiting cancer metastasis effectively. Therefore, HopQ according to the present invention can be used advantageously for a pharmaceutical composition for inhibiting cancer metastasis and health-aid food for preventing or reducing cancer metastasis.

Description

A composition comprising HopQ for suppressing cancer metastasis

The present invention relates to cancer metastasis inhibition containing HopQ (Hrp outer protein Q), and more specifically, a pharmaceutical composition for inhibiting cancer metastasis containing HopQ protein, a health functional food for preventing or improving cancer metastasis, and cancer metastasis inhibitor screening it's about how

Melanoma is a tumor caused by melanocytes in the skin or mucous membranes and is the most lethal form of skin cancer because it spreads early through lymphatic vessels to the skin as well as lymph nodes and other organs. Melanoma occurs regardless of age, race, or sex, and is the leading cause of cancer death in women aged 25-30 years and the second leading cause of cancer death in women aged 30-35 years. The incidence of melanoma has doubled since 1973, and according to the melanoma research foundation (MRF), more than 192,000 people will be diagnosed with melanoma in the United States in 2019 and more than 7,000 will die.

Compared to the United States, there was little interest in melanoma in Asia, including Korea, due to the low incidence of melanoma, but according to the data released by the National Statistical Office, the recent number of melanoma cases in Korea was 121 in 1992, 266 in 2002, and 520 in 2012. It showed a 4.3-fold increase. In 2015, there were 570 new cases of melanoma, and the number of new cases is expected to increase continuously with the rapid increase of the elderly population in Korea.

About 40-60% of melanoma patients have a V600E mutation in Viraf (BRAF), a well-known oncogene. This mutation results in the activation of the BRAF kinase protein and overactivation of the mitogen-activated protein kinase (MAPK) signaling pathway, which is an essential regulator for cell proliferation and survival. If BRAF mutation is confirmed, vemurafenib and dabrafenib, which are anticancer drugs that inhibit BRAF, can be used. Although these anticancer drugs have a fast reaction rate and improved overall survival rate of melanoma patients, the MAPK pathway is inversely activated, resulting in resistance, hyperproliferative skin toxicity, and rare side effects, such as phenotypic cell carcinoma of the skin.

NRAS mutations, which are present in about 10-30% of melanomas, also induce activation of PI3K/AKT and other survival neural pathways. There is no effective anticancer agent that directly inhibits NRAS mutations. Because melanoma caused by NRAS mutations often utilizes MAPK signaling for growth and survival, methods that inhibit the MAPK sub-pathway of RAS can be used. Since mutant NRAS activates BRAF and CRAF, suppression of MAPK signaling is the most effective, so RAF inhibitors can be used, but RAF inhibitors such as sorafenib have low selectivity and are difficult to inhibit RAF activity in tumor It has little efficacy in melanoma because sufficient doses cannot be administered.

In addition, it has been reported that a mutation in which the function of PTEN that inhibits AKT activation is lost occurs in 10% of melanoma, thereby increasing AKT signaling. Therefore, PI3K/AKT inhibitors can be used for the treatment of melanoma and have shown good anticancer effect in clinical practice, but the effect in vivo is insufficient, which is thought to be that the inhibitors did not completely inhibit AKT or that AKT inhibition was restored by other signals do. Therefore, there is a need to develop a new anticancer drug that can overcome the side effects and resistance of existing melanoma treatments.

Vimentin is a Type III intermediate filament (IF) protein that fixes organelles in the cytoplasm and is also involved in the cytoskeleton and intracellular signaling pathways. In particular, when epithelial to mesenchymal transition (EMT) occurs, expression is increased in mesenchymal cells, which is known to be involved in cancer cell migration and metastasis. In a previous study conducted to find biomarkers related to melanoma metastasis to the lungs, Vimentin was highly expressed in the melanoma group that had metastasized to the lung, and Vimentin was overexpressed in primary cancer or primary melanoma patients with hematoma metastasis. As this has been frequently observed, vimentin expression regulation can be an effective approach as a strategy to inhibit metastasis of melanoma.

Bacterial effectors are proteins secreted by pathogenic bacteria into their host cells and usually use a type III secretion system or a type IV or VI secretion system. In general, effector proteins penetrate host tissues and suppress the immune system or help pathogens survive. One of the models used for the interaction between disease-causing pathogenic bacteria in plants and susceptible plants, Pseudomanas Syringae pv. Tomatoes inject the HopQ effector protein into the host plant through a type III secretion system. HopQ is Pseudomanas Syringae pv. Tomato DC3000 is important in determining the host range causing disease in the host, and is known as an effector that promotes disease in tomatoes. When HopQ is injected into the host, it is phosphorylated by the host's kinase and can bind to the host's 14-3-3 protein. 14-3-3 protein is a well-conserved protein not only in plants but also in animal cells. It binds to various signal transduction proteins such as kinases, dephosphoryases, and transmembrane receptors, and is known to be involved in cancer metastasis in various ways. If HopQ, a tertiary protein, binds to 14-3-3 protein in animal cells, it is involved in various signal transductions in animal cells, and there is a possibility that cancer cell metastasis may also be regulated.

Under this background, the inventors of the present invention investigated the role of HopQ in the treatment of melanoma, and as a result, it was first identified that HopQ interacts with 14-3-3 and is involved in the migration of cancer cells. By regulating the vimentin protein by interacting with HopQ 14-3-3, it was revealed that it inhibits melanoma metastasis, and it was confirmed that it inhibits the migration of cancer cells, thereby inhibiting cancer metastasis and cancer metastasis. By confirming that it can be usefully used as a health food for prevention or improvement, the present invention has been completed.

An object of the present invention is to provide a pharmaceutical composition for inhibiting cancer metastasis comprising HopQ (Hrp outer protein Q) protein as an active ingredient.

Another object of the present invention is to provide a health functional food for preventing or improving cancer metastasis comprising HopQ protein as an active ingredient.

Another object of the present invention is to provide a screening method for a cancer metastasis inhibitor using the interaction between HopQ and 14-3-3.

In order to achieve the above object, the present invention provides a pharmaceutical composition for inhibiting cancer metastasis comprising a HopQ (Hrp outer protein Q) protein as an active ingredient.

In the present invention, the HopQ protein is represented by the peptide sequence of SEQ ID NO: 1.

As used herein, the term “peptide” refers to a linear molecule formed by bonding amino acid residues to each other by peptide bonds.

The cancer is characterized in that it is melanoma.

In addition, the HopQ protein of the present invention is an effector protein of Pseudomonas syringae, a plant phagocytic bacterium. The effector is a protein secreted by pathogenic bacteria into their host cells, and the effector proteins penetrate host tissues to suppress the immune system or help pathogens survive.

The HopQ protein of the present invention inhibits cancer metastasis by inhibiting the expression and stability of Vimentin protein in cancer cells through the interaction of 14-3-3 protein.

In addition, the composition of the present invention is characterized in that it inhibits the movement of cancer cells.

The 14-3-3 protein is a well-conserved protein not only in plants but also in animal cells, and is known to bind to various signal transduction proteins such as phosphorylation enzymes, dephosphorylation enzymes, and transmembrane receptors, and to be involved in cancer metastasis. The vimentin protein is a type III intermediate fiber protein and is known to be involved in the movement and metastasis of cancer cells by increasing expression in mesenchymal cells when EMT (Epithelial to mesenchymal transition) occurs.

As used herein, the term “cancer” refers to a condition in which a problem occurs in the control function of normal division, differentiation, and death of cells, and it proliferates abnormally and infiltrates surrounding tissues and organs to form a mass and destroy or modify the existing structure. means

Also, in the present invention, the term “cancer metastasis” refers to cancer cells moving from a primary organ to another organ and proliferating. The spread of cancer to other parts of the body is largely divided into two categories: the growth of cancer tissue from the primary cancer and directly invading the surrounding organs, and the distant metastasis along the lymphatic vessels to other organs that are far away.

The cancer is divided into a primary cancer existing at the site of occurrence and a metastatic cancer that has spread from the site of occurrence to another site. The metastatic cancer is formed by spreading through blood circulation or lymph circulation, and usually grows as a new tumor after moving to other organs through blood circulation. Cancer cells attached to the teeth move directly to neighboring tissues and are sometimes formed. In the present invention, cancer metastasis includes both the spread of cancer cells by infiltration, where cancer cells directly move and infiltrate into neighboring tissues, and metastasis in which cancer cells move through the bloodstream to form a new tumor in an organ that is not physically adjacent to the primary cancer. do. Meanwhile, in cancer metastasis, cell migration is essential. Therefore, inhibiting the migration of these cancer cells is the primary method for preventing cancer metastasis.

Also, in cancer metastasis, cell migration is involved in several stages. When cancer cells move from the initial primary cancer site to the blood vessel through the extracellular matrix, when they move out of the blood vessel in the second metastatic tissue, from neovascularization to The process is very complex and has various functions, such as being involved in the movement of vascular endothelial cells. Therefore, considering that a general anticancer agent has an effect of simply killing cancer cells or inhibiting the proliferation of cancer cells, an agent for inhibiting cancer metastasis should be developed separately.

The pharmaceutical composition for inhibiting cancer metastasis of the present invention may further include a pharmaceutically acceptable carrier, excipient or diluent.

As used herein, the term “pharmaceutically acceptable” refers to exhibiting non-toxic properties to cells or humans exposed to the composition. The carrier may be used without limitation as long as it is known in the art, such as a buffer, a preservative, an analgesic agent, a solubilizer, an isotonic agent, a stabilizer, a base, an excipient, a lubricating agent, and the like. Examples of the pharmaceutically acceptable carrier excipient diluent that can be used in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythitol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidine, water, methylhydroxybenzoethide, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, which are 1 More than one species can be used.

In addition, the composition may further include an anticancer agent.

Non-limiting examples of the anticancer agent may be DNA alkylating agents, anti-cancer antibiotics, and plant alkaloids, and specifically, the anticancer agent is vemurafenib and dabrafenib. (dabrafenib), taxol (Taxol), celastrol (celastrol), sorafenib, dacarbazine, temozolmomid, keytruda, carmustine, carboplatin, vinblatin, ipilimubab, nivolumam, pembrolizumab, cisplatin, mekinist, trametinib, trametinib dimethylsulfoxide, selumetibib, cobimeninib, dasatinib, imatinib or nilotinib, and the like.

The present invention provides a health functional food for preventing or improving cancer metastasis comprising the HopQ protein as an active ingredient.

Specifically, the HopQ protein according to the present invention may be added to food or beverages for the purpose of inhibiting cancer metastasis, and the type of food is not particularly limited, for example, various foods such as confectionery, bread, noodles, water, and soft drinks. , drinks such as fruit drinks, gum, tea, vitamin complexes, seasonings, and health functional foods.

The health functional food includes various nutrients, vitamins, minerals (electrolytes), synthetic flavors, and flavoring agents such as natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and salts thereof , organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages, and the like. In addition, the health functional food of the present invention may contain fruit for the production of natural fruit juice beverages and vegetable beverages.

The present invention also provides a method for screening a cancer metastasis inhibitor comprising the steps of:

1) Step of treating the test substance in the HopQ protein-expressing cancer cell line

2) analyzing the interaction of 14-3-3 in the cell line; and

3) It provides a cancer metastasis inhibitor screening method comprising the step of monitoring the expression and activity of factors related to the migration and metastasis of cancer cells by using the interaction of 14-3-3 in step 2).

In step 2), the 14-3-3 interaction analysis was performed by western blot. Real time polymerase chain reaction, Immunoprecipitation, Immuno-staining, Immuno-fluorescence, Fluorescence Resonance Energy Transfer (FRET) analysis , CHIP (Chromatin immunoprecipitation), enzyme immunoassay (ELISA), tag-protein pull down analysis, and immunohistochemistry.

As used herein, the term “test material” refers to any one selected from the group consisting of peptides, proteins, antibodies, antibody parts, non-peptidic compounds, active compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and plasma. It is preferred, but not limited thereto.

The present invention relates to a composition for inhibiting cancer metastasis comprising a HopQ (Hrp outer protein Q) protein, wherein the HopQ protein of the present invention interacts with 14-3-3 protein, thereby expressing or stability of vimentin protein By inhibiting cancer metastasis, it effectively inhibits cancer metastasis, so the HopQ of the present invention can be usefully used as a pharmaceutical composition for inhibiting cancer metastasis and a health functional food for preventing or improving cancer metastasis. .

1 is a result of reduced cell mobility of a melanoma cell line (B16F10) by HopQ. 1A-D are graphs showing the results of cell mobility reduction by analyzing photographs, cell migration areas or trajectories. 1E-F are results for cell growth by HopQ.
2 is a result of reduced mobility of human melanoma cells by HopQ. 2A-C are graphs showing the results of cell mobility reduction according to cell lines by analyzing photographs, cell migration areas or trajectories. 2D is the result of cell growth by HopQ.
3 is a result confirming the interaction between HopQ and 14-3-3 protein. Figure 3A is a result confirming that HopQ expressed in a melanoma cell line is strongly bound to 14-3-3 protein, and Figure 3B-C is a confirmation of the interaction site between the 14-3-3 protein and HopQ.
Figure 4 is an analysis of the effect of binding to 14-3-3 on the reduction of melanoma mobility by HopQ. Figure 4A shows the confirmation of the 14-3-3 binding motif to HopQ, Figure 4B-C shows the binding of the mutant (HopQ S51A) and the 14-3-3 protein, Figure 4D-F shows the B16F10 cells of HopQ S51A This is the result of examining the effect on the mobility of
Figure 5 confirms the interaction with the decrease in non-mentin (vimentin) protein expression by HopQ. Figure 5A is the result of observing the expression change of the proteins involved in cell migration by HopQ, Figure 5B is a Western blot (western blot) result confirms that the vimentin expression decreases in proportion to the amount of HopQ, Figure 5C is the result of confirming whether the reduction of vimentin by HopQ occurs at the mRNA level, Figure 5D is the result of confirming the reduction of vimentin protein by HopQ in human melanoma cancer cells, Figures 5E and F are cycloheximide (cycloheximide) It is a result of confirming that the amount of vimentin protein by HopQ decreased compared to the control when the newly synthesized protein was inhibited by treatment by time, and Fig. 5G-I shows whether the decrease in the vimentin protein by HopQ is due to the binding of HopQ and vimentin. This is the confirmed result.
6 is a result confirming the association between the interaction between HopQ and 14-3-3 and the expression of vimentin. Figures 6A-B confirm the vimentin inhibitory effect after overexpressing HopQ S51A, Figure 6C shows that in the case of HopQ S51A, the binding ability with vimentin is significantly lower than that of HopQ WT It was confirmed through immunoprecipitation, Figure 6D is 14-3 It is the result of confirming that the binding of HopQ and vimentin is inhibited when the inhibitor (R18) of -3 is treated, and FIG. 6E shows that when HopQ N90, a domain capable of binding with HopQ 14-3-3, is expressed together with HopQ, vimentin is It is the result of confirming that it is not inhibited, and Figure 6F shows that, in the case of HopQ ΔN, in which the N-term was removed so that it cannot bind to 14-3-3, the effect of vimentin yesterday was small even if overexpressed, and it was confirmed that HopQ N90 also did not inhibit vimentin. It is the result.
7 is a result confirming the degradation mechanism of vimentin by HopQ. Figure 7A shows that the reduction of vimentin was still confirmed by HopQ even when HopQ was overexpressed and treated with a proteasome inhibitor and a caspase inhibitor, and Figure 7B is an autophage inhibitor Bafilomycin A to confirm whether the degradation of vimentin is due to autophagy, another proteolytic mechanism. It was confirmed that vimentin did not decrease even when HopQ was overexpressed when treated with zVAD, and Fig. 7C shows that LC3-II, an autophagy marker, was increased when HopQ was overexpressed, and Fig. 7D is
E confirms that when autophagy was blocked by inhibiting Atg5 and Atg7 with siRNA, vimentin was not reduced even when HopQ was overexpressed, and FIGS. It was confirmed that punctae was increased by HopQ and free GFP was increased through western blot, Figure 7G confirms that red puntae increased by HopQ, Figure 7H shows that co-localization of vimentin and LC3B by HopQ will be observed
8 is a result confirming the selective autophagy of vimentin of HopQ. Figure 8A is the result of confirming that HopQ is overexpressed and ubiquitinated in B16F10 cells, Figures 8B-C shows that p62, HopQ, and vimentin bind together, and Figure 8D-E shows that the binding of HopQ and p62 is in the NH domain of HopQ. It is the result of confirming that it is happening.
Figure 9 confirms the cancer metastasis inhibitory effect of HopQ. 9A is a photograph showing the effect of inhibiting cancer metastasis as a photograph of cancer tissue, and it is a photograph showing that cancer metastasis is significantly inhibited compared to the control group in the lung tumor of the mouse, which is a metastasized cancer tissue, FIG. 9B is It was confirmed that it was also reduced in metastasized lung nodules.

The present invention provides a pharmaceutical composition for inhibiting cancer metastasis comprising HopQ (Hrp outer protein Q) protein as an active ingredient.

The HopQ protein of the present invention inhibits cancer metastasis by inhibiting the expression and stability of Vimentin protein in cancer cells through the interaction of 14-3-3 protein.

The pharmaceutical composition of the present invention may include chemical substances, peptides, peptide mimerics, matrix analogues, aptamers, nucleotides, polynucleotides, polypeptides, antibodies, antisense, siRNA, and natural product extracts as active ingredients.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier, excipient or diluent.

The carrier is sterile and biocompatible, and means that the composition exhibits non-toxic properties to cells or humans to which it is exposed. Buffers, preservatives, pain relievers, solubilizers, isotonic agents, stabilizers, bases, excipients, lubricating agents, etc. may be used without limitation as long as they are known in the art. Examples of pharmaceutically acceptable carriers excipients, diluents available that can be used in the pharmaceutical compositions of the present invention are lactose, text Rose, sucrose, sorbitol, mannitol, jayiritol, Erie styryl sorbitol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, calcium carbonate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidine, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil; One or more of these may be used, and other conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed. In addition, dispersing agents, surfactants, binders and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, and the like, pill, capsule, granule or tablet.

The pharmaceutical formulations of the pharmaceutical composition of the present invention include granules, powders, corrections, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions and sustained-release formulations of the active compound. can be The pharmaceutical composition of the present invention can be administered via conventional intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, transdermal, intranasal, inhalational, topical, rectal, oral, intraocular or intradermal routes. method can be administered. The effective amount of the active ingredient of the pharmaceutical composition of the present invention means an amount required for preventing or treating a disease. Therefore, the type of disease, the severity of the disease, the type and content of the active ingredient and other ingredients contained in the composition, the type of dosage form and the age, weight, general health status, sex and diet of the patient, administration time, route of administration, and minutes of the composition It can be adjusted according to various factors including the ratio, the duration of treatment, and the drugs used at the same time.

The composition of the present invention may further include an anticancer agent.

Non-limiting examples of the anticancer agent may be DNA alkylating agents, anti-cancer antibiotics, and plant alkaloids, and specifically, the anticancer agent is vemurafenib and dabrafenib. (dabrafenib), taxol (Taxol), celastrol (celastrol), sorafenib, dacarbazine, temozolmomid, keytruda, carmustine, carboplatin, vinblatin, ipilimubab, nivolumam, pembrolizumab, cisplatin, mekinist, trametinib, trametinib dimethylsulfoxide, selumetibib, cobimeninib, dasatinib, imatinib or nilotinib, and the like.

The composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers for the prevention or treatment of cancer.

Hereinafter, the present invention will be described in detail by way of Examples and Experimental Examples.

However, the following Examples and Experimental Examples merely illustrate the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

Example 1. Cell Line Culture

B16F10, a mouse melanoma cell, was cultured using RPMI (Welgene) supplemented with 10% fetal bovine serum (FBS, RMBIO) and 1% penicillin-streptomycin (antibiotic-antimycotic) mixed solution (Gibco, Invitrogen) as a culture medium with 5% CO ₂ was cultured in an incubator at 37 ° C.

Example 2. Preparation and transfection of gene expression vectors

In order to clone the HopQ gene into the pBICEP vector, which is a flag-labeled protein expression vector, primers were prepared as shown in Table 1 below.

<Primer for pBICEP vector cloning>

Name Primer sequence ( 5'- 3') Flag-HopQ (full) Forward 5’-GACAAGCTTGCGGCCCATCGTCCTATCACCGCA (NotⅠ) Reverse 5’-ATGCCACCCGGGATCTCAATCTGGGGCTACCGT (BamHI)

Next, after amplifying HopQ using PCR, it was loaded on an agarose gel to check the size, purified from the gel, and adjusted to a concentration of 100 ng/ul by DNA quantification. Next, 1ug of the pBICEP vector was cut using the restriction enzymes NotⅠ and BamHI, and the vector was loaded on an agarose gel, the size was checked, and the size was purified from the gel. 100ng of HopQ prepared as above and the cleaved pBICEP vector were ligated with INFUSION HD enzyme (Clontech Laboratories) to prepare a Flag-labeled HopQ expression system.

To clone each domain of HopQ into the pCMV-Myc-N vector, primers were prepared as shown in Table 2 below.

<Primer for cloning by domain of pCMV-Myc-N vector>

Primer Primer sequence ( 5'- 3') Myc-HopQ (full) Forward 5’-CGGTCGACCGAGATCATGCATCGTCCTATCACCGC (Bgl2) Reverse 5'-TGGATCCCCGCGGCCTCAATCTGGGGCTACCGTCG (Not1) HopQ delNT (ΔN)
N-terminal removal Forward 5’-CGGTCGACCGAGATCCTTTTACCTAAGGATACGTGGTT (Bfl2) Reverse 5'-TGGATCCCCGCGGCCTCAATCTGGGGCTACCGTC (Not1) HopQ delC (ΔC)
C terminus removal Forward 5’-CGGTCGACCGAGATCATGCATCGTCCTATCACCGC (Bgl2) Reverse 5'-TGGATCCCCGCGGCCTCAGGCCAGTAATGTCAGAGG (Not1) HopQ NH (NH)
central part Forward 5'-CGGTCGACCGAGATCCTTTTACCTAAGGATACGTGGTT (Bgl2) Reverse 5'-TGGATCCCCGCGGCCTCAGGCCAGTAATGTCAGAGG (Not1) HopQdelN90 (N90)
up to the N-terminal 90 Forward 5'-CGGTCGACCGAGATCATGCATCGTCCTATCACCGCAG (Bgl2) Reverse 5'-TGGATCCCCGCGGCCTCAGGGCTTGTGATCTCAG (Not1)

100ng of HopQ domains were prepared using the same method as Flag-HopQ, and 50ng of pCMV-Myc-N vector was also prepared in the same manner as pBICEP vector, followed by ligation with INFUSION HD enzyme (Clontech Laboratories). ) to prepare a Myc-labeled HopQ expression system.

In order to transfect the prepared expression vectors, the B16F10 cell line was cultured in a 6-well culture dish based on 8 × 105 cells, and then 2 ml of RPMI medium containing 10% FBS without antibiotics was supplied to the culture dish. Prepared vector is prepared by mixing 1ug of TransIT-X2 Dynamic Delivery System (Mirus, transfection reagent) reagent with 250ul of opti-MEM medium in a 1:3 ratio and reacting at room temperature (24°C) for about 30 minutes, then added to the prepared B16F10 cell line. After addition, the expression amount was checked 24 hours later and used in the experiment.

Example 3. Immuno-staining

After putting a round cover glass in a 24-well culture dish, B16F10 cells were cultured to 1.0 × 10 ⁵ cells, and Myc-HopQ vector was transfected. After 24 hours of transfection, the culture medium was removed, and 1 ml of cold phosphate buffered saline (PBS) was washed three times, followed by the addition of PBS containing 4% paraformaldehyde for 20 minutes at room temperature. After fixation, 0.2% TritonX-100 was added for membrane permeabilization, followed by reaction at room temperature for 15 minutes. After the reaction, wash with cold phosphate buffered saline (PBS) three times and remove the remaining Triton X-100. After removing the antibody remaining around the cells by adding 1 ml each to the culture dish three times, the Alexa Fluorⓡ 488 conjugated Donkey-anti mouse IgG antibody and 14-3-3 After reacting with Alexa Fluorⓡ 555 conjugated Donkey-anti rabbit IgG antibody that recognizes and displays red fluorescence at room temperature for 2 hours, the remaining antibody was washed again with cold phosphate buffered saline (PBS). After the nuclear staining (DAPI) dye was added for 5 minutes to stain the nucleus, and then washed three times with cold phosphate buffered saline (PBS) to remove the remaining DAPI. The prepared immunostaining sample was analyzed for fluorescence images using a confocal microscope, LSM510 (Carl Zeiss), which is a confocal fluorescence microscope.

Example 4. Western blot

After the cells were lysed with a cell lysis buffer containing a proteinase inhibitor, the protein concentration of each cell lysis sample was uniformly adjusted by using the BCA method to quantify the protein. After loading the prepared protein sample on an SDS-PGAE gel, electrophoresis was performed to separate the protein. After electrophoresis of the SDS-PAGE gel is electrically transferred to PVDF membrane filter paper, 5% skim milk and 1% Tween 20 are used to prevent non-specific antibody binding to the stomach. ) containing phosphate buffered saline (PBS) for 1 hour. After washing 3 times once every 5 minutes with phosphate buffered saline (PBS) containing 1% Tween 20, the primary antibody recognizing the target protein was incubated at 4 °C for 12 hours. reacted. The primary antibody against the target protein is used as follows. Anti Myc antibody, anti 14-3-3 (pan) antibody, anti 14-3-3 beta antibody, anti 14-3-3 gamma antibody, anti 14-3-3 epsilon antibody, anti 14-3-3 zeta antibody , anti 14-3-3 eta antibody, anti 14-3-3 theta antibody, anti 14-3-3 tau antibody, anti phospho-ser/Thr antibody, anti vimentin antibody, anti β-actin antibody, anti-LC3B antibody , After the primary antibody reaction, washing 3 times every 5 minutes with phosphate buffered saline (PBS) containing 1% Tween 20 The intensity of fluorescence was measured and analyzed using the EZ Capture Image system (ATTO).

Example 5. Immunoprecipitation

For the immunoprecipitation method, the B16F10 cell line transfected with Myc-labeled HopQ was lysed with a cell lysis buffer containing a protease inhibitor, and the protein was quantified using the BCA method. The antibody was added and reacted in a rotating apparatus at 4 °C for 12 hours. After adding 30ul of magnetic beads, they were reacted at 4°C for 2 hours in a rotating device. Using a magnetic column, proteins not bound to magnetic beads were washed three times with cold cell lysis buffer. After removing the lysis buffer, a sample of the protein bound to the bead was obtained with double Laemmli sample buffer. /Thr antibody and anti-vimentin antibody were used for analysis.

Example 6. Cancer cell migration assay (Woundhealing assay)

After culturing the B16F10 cell line in a ^{6-well culture dish based on 8 × 10 5} cells, when the cells grew to 80-90%, HopQ was transfected. After 24 hours, Mitomycin C was treated at 40 ug/ml for 2 hours and a scratch was made by scraping the culture dish in which the cells were grown from top to bottom with a tip for 200 ul. It was washed twice with phosphate buffered saline (PBS), a culture medium was put, and the results were recorded under a microscope. After 18 hours, a picture of the same area was taken again, and the spatial area of the scratch was calculated using the imageJ program, and the result was recorded as a graph.

Transwell assay was performed by a conventional method in this field.

Example 7. Real-Time PCR: Real-time polymerase chain reaction

After culturing the B16F10 cell line in a ^{12-well culture dish based on 3 × 10 5} cells, when the cells grew to 80-90%, HopQ was transfected. After 24 hours, total RNA was extracted using NucleoZOL (MACHEREY-NAGEL). cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO), and primers were prepared as shown in Table 3 below.

<Primers for real time PCR>

Primer Primer sequence ( 5'- 3') vimentin Forward 5'-AAAGCGTGGCTGCCAAGAA Reverse 5'- ACCTGTCTCCGGTACTCGTTTGA Rps18
(House keeping gene) Forward 5’-TTCTGGCCAACGGTCTAGACAAC Reverse 5'-CCAGTGGTCTTGGTGTGCTGA

RT-PCR was performed using ROTOR-Gene Q (QIAGEN) by mixing the prepared primer, cDNA, and THUNDERBIRD SYBR qPCR Mix (TOYOBO).

Example 8. In vivo assay (In vivo mouse model)

B16F10 cells were transfected with pBICEP vector and pBICEP-HopQ vector, respectively. After 24 hours, cells were removed, 5 × 10 ⁵ cells were dissolved in 100ul PBS, and injected into the tail of 8-week-old C57BL/6 mice (Mouse). After 14 days, the lungs of the mice were removed, photographed, and the results were recorded and confirmed by measuring the number of colonies of metastasized B16F10 cells.

Experimental Example 1. Confirmation of reduced mobility of B16F10 cells by HopQ

In order to confirm the anti-metastatic effect of HopQ on metastatic cancer cells, the overexpression of HopQ in B16F10 cells, a mouse melanoma cell line, showed that the B16F10 cells overexpressed with HopQ significantly decreased the mobility compared to the Control group, which had increased cell mobility. was confirmed (FIGS. 1A-D). It was confirmed that overexpression of HopQ did not affect the growth of B16F10 cells ( FIGS. 1E and F ).

Experimental Example 2. Confirmation of reduced mobility of human melanoma cells by HopQ

In the mouse cell line B16F10 as well as in the human melanoma cell lines SK-MEL-2, SK-MEL-28 and UACC-257, it was confirmed that when HopQ was overexpressed, it effectively reduced cell mobility without affecting cell growth. (FIGS. 2A-C). On the other hand, it was confirmed that the overexpression of HopQ did not affect the growth of SK-MEL-2, SK-MEL-28, and UACC-257 cells ( FIG. 2D ). Through these results, it was confirmed that the induction of HopQ expression in metastatic melanoma cells can reduce the mobility of cancer cells.

Experimental Example 3. Confirmation of binding of HopQ and 14-3-3

In plant cells, it is known that when HopQ effector protein is injected from bacteria, it is phosphorylated by intracellular kinase and binds to 14-3-3 protein. In order to determine whether this phenomenon also occurs in B16F10 cells, it was confirmed that HopQ overexpressed and Immunoprecipitation was performed. As a result, HopQ overexpressed in B16F10 strongly binds to 14-3-3 protein (FIG. 3A). In order to confirm the binding position with 14-3-3 in the structure of the HopQ protein, the domain of the HopQ protein was cloned and the expression was induced in B16F10 cells. It was confirmed that binding to 14-3-3 protein is possible at this location ( FIG. 3b ), and binding to all 14-3-3 isoforms ( FIG. 3c ).

Experimental Example 4. Confirmation of the effect of the binding of HopQ and 14-3-3 on the reduction of melanoma mobility

A 14-3-3 binding motif was confirmed in HopQ (FIG. 4A), and a mutant (HopQ S51A) was constructed to confirm that it did not bind to 14-3-3 protein (FIG. 4B-C). In the case of HopQ S51A, it was confirmed that even when it was overexpressed in B16F10 cells, it had no ability to inhibit cell mobility (Fig. 4D-F>. Through these results, HopQ was compared with 14-3-3 to reduce the mobility of melanoma cells. It was confirmed that binding is important.

Experimental Example 5. Confirmation of decrease in vimentin protein by HopQ

In order to analyze the mechanism of the interaction of HopQ with 14-3-3 on the decrease in the mobility of cancer cells, the expression changes of various proteins involved in cell migration among the intracellular roles of 14-3-3 were analyzed through western blot. Among them, it was confirmed that the expression of vimentin, a type III intermediate filament protein, was decreased by HopQ (FIG. 5A), and it was confirmed that the expression of vimentin decreased in proportion to the amount of HopQ (FIG. 5B), and it was confirmed that the expression of vimentin by HopQ It was confirmed by RT-PCR that the decrease was not due to the decrease in mRNA ( FIG. 5C ).

It was confirmed that the decrease of vimentin protein by HopQ in not only the mouse but also the human melanoma cancer cell line (FIG. 5D).

It was confirmed that the amount of vimentin decreased when HopQ was overexpressed compared to the control group when the newly synthesized protein was inhibited by treatment with cycloheximide, which stops the protein synthesis of cells (Fig. 5E-F). .

As a result of immunoprecipitation to confirm whether the decrease in vimentin protein by HopQ is due to the binding of HopQ and vimentin, it was confirmed that it binds to vimentin through the NH domain of HopQ (FIG. 5G-I).

Experimental Example 6. Analysis of the interaction mechanism of HopQ/14-3-3/vimentin

In order to check how the binding of HopQ and 14-3-3 affects the expression of vimentin, it was found that the ability to inhibit vimentin was reduced compared to HopQ WT as a result of overexpressing HopQ S51A, a mutant that does not bind to 14-3-3. was confirmed (FIGS. 6A-B).

In the case of HopQ S51A, it was confirmed through immunoprecipitation that the binding ability with vimentin was significantly lower than that of HopQ WT (Fig. 6C). It was confirmed that the binding of HopQ and vimentin was inhibited by treatment with the inhibitor (R18) of 14-3-3. (Fig. 6D).

When HopQ N90, a domain capable of binding to 14-3-3, was expressed together with HopQ, it was confirmed that vimentin was not inhibited (FIG. 6E). In the case of HopQ ΔN, in which the N-term was removed so that it could not bind to 14-3-3, the effect of vimentin yesterday was small even when overexpressed, and it was confirmed that HopQ N90 also did not inhibit vimentin (Fig. 6F). This suggests that it is important for HopQ to bind with 14-3-3 to inhibit vimentin.

Experimental Example 7. Confirmation of the degradation mechanism of vimentin by HopQ

The degradation mechanism of vimentin known to date is known as proteasome degradation and caspase cleavage. To investigate the mechanism of degradation of vimentin by HopQ, HopQ was overexpressed and treated with a proteasome inhibitor and a caspase inhibitor. As a result, even after treatment with both inhibitors, a decrease in vimentin was still confirmed by HopQ (FIG. 7A). In order to confirm that the degradation of vimentin is due to autophagy, which is another proteolytic mechanism, it was confirmed that vimentin was not decreased even when HopQ was overexpressed when the autophage inhibitors Bafilomycin A and zVAD were treated (FIG. 7B).

When HopQ was overexpressed, LC3-II, an autophagy marker, was increased ( FIG. 7C ). When autophagy was blocked by inhibiting Atg5 and Atg7, which play an important role in autophagy, with siRNA, it was confirmed that vimentin was not reduced even when HopQ was overexpressed (FIG. 7D). When the GFP-LC3 fusion protein was expressed, it was accumulated in the autophagosome and punctae appeared in the cytoplasm.

The tandem RFP-GFP-LC3 structure showed yellow color in autophagosome but red color in autolysosome by acidic condition. It was confirmed that the red puntae were increased by HopQ (Fig. 7G), which means that the autophagic flux was increased by HopQ. In addition, it was observed that vimentin and LC3B co-localized by HopQ (Fig. 7H). These results suggested that HopQ induces vimentin degradation through the autolysosome.

When a specific protein is selectively removed by autophagy, a specific cargo protein is required. Among them, p62 is known to attach to ubiquitinated proteins and selectively remove only the corresponding protein by autophagy. In actual B16F10 cells, it was confirmed that HopQ was overexpressed and ubiquitinated (Fig. 8A), and it was confirmed that p62, HopQ, and vimentin were combined (Fig. 8B-C), and that this binding of HopQ and p62 occurs in the NH domain of HopQ. was also confirmed (FIGS. 8D-E).

Experimental Example 8. Confirmation of the cancer metastasis inhibitory effect of HopQ

To check whether HopQ is involved in cancer metastasis in vivo , when B16F10, which expresses HopQ, was injected iv into mice, it was confirmed that cancer metastasis was significantly inhibited compared to the control group, and the nodule of metastasized cancer cells was also reduced. (FIG. 9A-B). Through these results, it was confirmed that the induction of HopQ expression in metastatic melanoma B16F10 cells can be used as an effective therapeutic agent capable of suppressing cancer metastasis.

These results show that HopQ protein does not affect the growth of melanoma, and it characteristically reduces the expression or safety of vimentin protein, thereby suppressing the metastasis of cancer cells. It was confirmed that it can be used as a pharmaceutical composition for inhibiting cancer metastasis, which can effectively increase the activity of a drug, and as a health functional food for preventing or improving cancer metastasis.

So far, with respect to the present invention, the preferred examples and experimental examples have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. In this regard, the above-described examples and experimental examples are illustrative in all respects, and should be considered in an illustrative rather than a restrictive point of view.

Claims (12)

A pharmaceutical composition for inhibiting cancer metastasis comprising HopQ (Hrp outer protein Q) protein as an active ingredient.
The pharmaceutical composition for inhibiting cancer metastasis according to claim 1, wherein the protein is represented by the peptide sequence of SEQ ID NO: 1.
The pharmaceutical composition for inhibiting cancer metastasis according to claim 1, wherein the cancer is melanoma.
The pharmaceutical composition for inhibiting cancer metastasis according to claim 1, wherein the protein is an effector protein of Pseudomonas syringae.
The pharmaceutical composition for inhibiting cancer metastasis according to claim 1, wherein the protein inhibits cancer metastasis through the interaction of 14-3-3 protein.
The pharmaceutical composition for inhibiting cancer metastasis according to claim 1, wherein the protein inhibits cancer metastasis by inhibiting the expression and stability of the Vimentin protein in cancer cells.
The pharmaceutical composition for inhibiting cancer metastasis according to claim 1, wherein the composition inhibits the movement of cancer cells.
The pharmaceutical composition for inhibiting cancer metastasis according to claim 1, wherein the composition further comprises a pharmaceutically acceptable carrier, excipient or diluent.
The pharmaceutical composition for inhibiting cancer metastasis according to claim 1, wherein the composition further comprises an anticancer agent.
A health functional food for preventing or improving cancer metastasis containing HopQ (Hrp outer protein Q) protein as an active ingredient.
1) Step of treating the test substance in the HopQ protein-expressing cancer cell line
2) analyzing the interaction of 14-3-3 in the cell line; and
3) Using the interaction of 14-3-3 in step 2), monitoring the expression and activity of factors related to the migration and metastasis of cancer cells; a cancer metastasis inhibitor screening method comprising a.
The method of claim 11, wherein the interaction analysis of 14-3-3 in step 2) is western blot. Real time polymerase chain reaction, Immunoprecipitation, Immuno-staining, Immuno-fluorescence, Fluorescence Resonance Energy Transfer (FRET) analysis , CHIP (Chromatin immunoprecipitation), enzyme immunoassay (ELISA), tag-protein pull down analysis and immunohistochemistry (Immunohistochemistry) cancer metastasis inhibitor screening method, characterized in that the measurement by any one selected from the group consisting of.

Images