KR101975778B1 - Composition comprising PTP4A1 protein or polynucleotide encoding the PTP4A1 for the prevention or treatment of vascular-inflammatory disease - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of vascular diseases, comprising as an active ingredient a PTP4A1 (protein tyrosine phosphatase type IV A1) protein or a polynucleotide encoding the same, wherein specifically the PTP4A1 protein is IL-1β, TNF- LPS inhibited the expression of the cell adhesion proteins ICAM-1 and VCAM-1 in vascular endothelial cells induced by inflammatory responses and inhibited the adhesion of immune cells to the surface of vascular endothelial cells that induced inflammation with IL-1β or TNF-α And that the expression of the cell adhesion proteins ICAM-1 and VCAM-1 in the arterial blood vessels and pulmonary blood vessels caused by TNF-α was markedly suppressed in the mouse (TG) specifically overexpressed in the vascular endothelial cells as compared with the control (WT) , And the expression of inflammatory cytokines and inflammatory cytokines in ApoE-deficient mouse atherosclerotic lesions overexpressing PTP4A1 after high fat diet decreased compared to the control group, The effect of improving the sex was shown. In addition, inhibition of the expression of the cell adhesion molecule suppresses the expression of ICAM-1 and VCAM-1 by inhibiting NF-κB activity by increasing the expression of A20 protein by increasing the expression of TRAF2 and RIP1 protein by PTP4A1 , The PTP4A1 protein of the present invention and the polynucleotide encoding the PTP4A1 protein can be usefully used as a pharmaceutical composition for the prevention or treatment of vascular inflammation diseases.

Description

A composition for preventing or treating vascular inflammation diseases, comprising a PTP4A1 protein or a polynucleotide encoding the PTP4A1 protein as an active ingredient. (Composition PTP4A1 protein or polynucleotide encoding the PTP4A1 for the prevention or treatment of vascular-inflammatory disease)

The present invention relates to a composition for the prevention and treatment of vascular inflammation diseases, including atherosclerosis, which comprises PTP4A1 (protein tyrosine phosphate type IV A1) protein or a nucleotide encoding the same.

Vascular Endothelial Cells (Vascular Endothelial Cells) are the cells of the monolayer that make up the inside of the blood vessels. They produce various vasoactivity regulators that regulate blood vessel relaxation and contraction or react with immune cells in the blood to help them migrate . When inflammation occurs in the body, such as tissue damage or infection with external bacteria, various cytokines such as Tumor necrosis factor alpha (TNF-α) or interleukin 1 beta (IL-1β) activate vascular endothelial cells and cause vascular inflammation do. At this time, the expression of cell adhesion proteins such as ICAM-1, VCAM-1, e-selectin or integrin is increased on the surface of vascular endothelial cells, and the immune cells (leukocytes, monocytes) By inducing migration to the tissue, it helps to eliminate dead cells or infected bacteria. In many acute / chronic inflammatory diseases such as sepsis, pneumonia, viral infection, inflammatory bowel disease, allergies, asthma, arthritis, cardiovascular diseases, Alzheimer's and the like, as well as such local inflammatory reaction, vascular endothelial cells are activated, ≪ / RTI > and lymphocyte to act as the initiator of the inflammatory response.

Recently, inflammation of vascular endothelial cells has been reported to be a major cause of arteriosclerosis and cardiovascular disease (Libby, P. et al. , Inflammation and atherosclerosis. 2002, Circulation, 105, 1135-1143) , And inflammation of the arterial wall caused by inflammation of the blood vessels, endothelial cells, blood cells, platelets, fibrin, etc., react with the vascular endothelial cells to attach to the walls of the arteries, Loses. Atherosclerosis is a disease in which the elasticity of the arteries is decreased and the arteries are narrowed, which causes the blood flow in the tissues to decrease, which causes stroke in the brain, angina in the heart, and myocardial infarction.

The most common vascular diseases caused by arteriosclerosis are cerebrovascular disease and heart disease, which are ranked second and third respectively in 2013. The death rate per 100,000 population is 50.3 (9.6% of the total deaths) and 50.2 9.5% of the causes). Arteriosclerosis progresses slowly, so symptoms do not appear, but symptoms occur when the internal diameter of the artery is blocked by more than 70% to cause blood flow disorder. The treatment of arteriosclerosis includes prophylactic treatment to prevent the progression of vascular stenosis if the stenosis is not severe, and surgical intervention such as angioplasty, stenting, and endarterectomy, arterial bypass surgery, There is a treatment method. Drugs such as nitrate, beta-blocker, aspirin, cholesterol-lowering drugs and antiplatelet agents are used for the treatment of early atherosclerosis. They are effective in slowing the progression of the disease or alleviating the symptoms. It does not. Therefore, the technique of inhibiting immune cell adhesion of vascular endothelial cells will be an important target for prevention and treatment of vascular inflammatory diseases in the future.

PTP4A1 (protein tyrosine phosphatase type IV A1) plays an important role in intracellular signal transduction mediating cell growth, proliferation and migration, and is known to be involved in the progression and metastasis of cancer (Neel, BG et al . Zhang, Z.-Y. 2002, Annu. Rev. Pharmacol. Toxicol. 41, 209-234, Jing D. et al. , 2014, Mol. Med Rep. 10, 1426-1432). Luo Y. et al. Have shown that PTP4A1 enhances the migration and invasion of cancer cells by regulating MMP2, MMP9, Src and ERK1 / 2 (Luo et al., 2009, Biochem, 3, 1838-1846) It has been reported that the PTP4A1 signal is targeted to inhibit the growth and metastasis of colorectal cancer (Zhou C. et al, 2013, PLoS One, 16, e63142). These reports suggest that PTP4A1 plays an important role in cell migration. However, there have been no reports related to vascular endothelial cell activation, inflammation control, or vascular disease of PTP4A1.

Under these circumstances, the present inventors intend to present PTP4A1 protein as a new substance for the prevention and treatment of vascular inflammation diseases through inhibition of cell adhesion protein expression in order to develop a preventive or therapeutic method for vascular inflammation diseases such as arteriosclerosis, Overexpression of PTP4A1 inhibits the expression of cell adhesion proteins such as ICAM-1 and VCAM-1 induced by TNF-α, IL-1β or LPS. PTP4A1 inhibits the expression of NF-κB transcription Inhibition of NF-κB activation by the expression of A20, an inhibitory protein of the factor, was confirmed. PTP4A1 protein inhibited the expression of IL-1β and TNF-α by inhibiting the expression of cell adhesion proteins such as ICAM-1 and VCAM- α-induced immune cell adhesion to vascular endothelial cells. In addition, the expression of ICAM-1 and VCAM-1 induced by mouseTNF-α was markedly inhibited in the vascular inflammatory animal model by the mouse overexpressing PTP4A1 in a blood vessel-specific manner, (C57BL / 6N and Apolipoprotein E (ApoE, hyperlipidemia mouse model) deficient mice overexpressing PTP4A1, and the expression of inflammatory cytokines and inflammatory cytokines in ApoE deficient mouse atherosclerotic lesions overexpressing PTP4A1 after high fat diet , Confirming the effect of enhancing the stability of atherosclerotic lesions, thereby confirming that PTP4A1 protein has an effect of inhibiting the development of vascular diseases based on inflammatory reaction, thereby completing the present invention.

It is an object of the present invention to provide a pharmaceutical composition for the prevention or treatment of vascular inflammatory diseases containing, as an active ingredient, PTP4A1 (protein tyrosine phosphatase type IV A1) protein or a polynucleotide encoding the same.

In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention or treatment of vascular inflammatory diseases containing PTP4A1 (protein tyrosine phosphatase type IV A1) as an active ingredient.

The present invention also provides a pharmaceutical composition for the prevention or treatment of vascular inflammation diseases, which comprises a polynucleotide encoding the PTP4A1 protein as an active ingredient.

The present invention also provides a pharmaceutical composition for the prevention or treatment of vascular inflammatory diseases containing, as an active ingredient, a vector comprising a polynucleotide encoding a PTP4A1 protein.

In addition,

1) measuring the expression level of PTP4A1 in a sample derived from a subject as an experimental group;

2) comparing the expression level of PTP4A1 in step 1) with the expression level of PTP4A1 in the control-derived sample; And

3) determining that the risk of vascular disease is high if the level of expression of PTP4A1 in the step 2) is decreased as compared with that of the control, is provided.

In addition,

1) treating the test substance with the PTP4A1-expressing cell line;

2) measuring the level of expression or activity of the PTP4A1 protein in the treated cell line of step 1); And

3) screening for an agent for treating a vascular inflammation disease therapeutic agent, comprising the step of selecting the test substance whose expression or activity level of the PTP4A1 protein of step 2) is increased compared to the control not treated with the test substance.

The PTP4A1 protein of the present invention further enhances the expression of A20 protein in vascular endothelial cells activated by inflammation inducers such as TNF-α, IL-1β, or LPS, thereby inhibiting the expression of NF-κB transcription factor Inhibits the expression of the cell adhesion proteins ICAM-1 and VCAM-1, and inhibits the adhesion of immune cells to the surface of vascular endothelial cells induced by IL-1β and TNF-α 1 and VCAM-1 were inhibited by PTP4A1-overexpressing vascular endothelial cells. In addition, the expression of C57BL / PTP4A1-overexpressing vascular endothelial cells, 6N and Apolipoprotein E (ApoE, hyperlipidemia mouse model) deficient mice were implanted with ApoE-deficient mouse atherosclerotic lesions overexpressing PTP4A1 after high-fat diets, and inflammatory cell deposition and inflammatory cytokine efflux The inhibitory effect of the PTP4A1 protein or the polynucleotide encoding the PTP4A1 protein was confirmed by confirming the effect of enhancing the stability of atherosclerotic lesion by inhibiting the inflammatory induction of vascular endothelial cells, It can be usefully used as a composition.

FIG. 1 shows the expression of PTP4A1 (protein tyrosine phosphatase type IV A1) protein in vascular endothelial cells using immunofluorescence staining.
FIG. 2 is a graph showing changes in the expression of cell adhesion proteins as a function of PTP4A1 protein expression:
2A, confirmation of inhibition of PTP4A1 expression by shPTP4A1;
FIG. 2b, confirmation of increased expression of ICAM-1 and VCAM-1 induced by IL-1β in the PTP4A1 expression-inhibiting cell line;
FIG. 2c, Confirmation of expression increase of ICAM-1 and VCAM-1 induced by TNF-α in PTP4A1 expression-inhibiting cell line;
2d, confirmation of increased expression of ICAM-1 and VCAM-1 induced by LPS in the PTP4A1 expression inhibitory cell line;
Figure 2E, Confirmation of PTP4A1 overexpression by PTP4A1 overexpression vector;
2f, IL-1? Induced decrease in ICAM-1 and VCAM-1 expression in PTP4A1-expressing cell line;
FIG. 2g, Identification of TNF-α induced decrease in ICAM-1 and VCAM-1 expression in PTP4A1-expressing cell line; And
FIG. 2h, Identification of LPS-induced expression of ICAM-1 and VCAM-1 in the PTP4A1-expressing cell line.
FIG. 3 shows changes in vascular endothelial cell adhesion of immune cells following the modulation of PTP4A1 protein expression:
Fig. 3a, confirmation of increased vascular endothelial cell adhesion of immune cells by shPTP4A1;
FIG. 3b, confirmation of the decrease of vascular endothelial cell adhesion of immune cells by overexpression of PTP4A1,
Figure 3c, a quantification graph of vascular endothelial cell adhesion enhancement of immune cells by shPTP4A1; And
Figure 3d, a quantification graph of the reduction of vascular endothelial cell adhesion of immune cells by overexpression of PTP4A1.
4 is a graph showing the effect of inhibiting cell adhesion protein expression and inflammatory cell deposition by increasing the expression of blood vessel-specific PTP4A1 protein in C57BL / 6N (wild type) and Apolipoprotein E deficient mice (mouse model of hyperlipidemia)
Figure 4a, Gene expression reduction of cell adhesion proteins in C57BL / 6N mouse arterial blood vessels;
Figures 4b and 4c show reduced gene expression of cell adhesion proteins in the C57BL / 6N mouse pulmonary artery;
4d, reduction of inflammatory cytokines and inflammatory cytokine expression by vascular-specific PTP4A1 overexpression in atherosclerotic lesions of Apolipoprotein E deficient mice;
Figure 4e, reduction of necrotic area in atherosclerotic lesions; And
Figure 4f, increased collagen deposition in atherosclerotic lesions.
FIG. 5 is a graph showing the effect of inhibiting the expression of A20 protein and the activity of NF-.kappa.B and higher signal transduction factors with increasing PTP4A1 protein expression.
Figure 5a, A20 expression increased by overexpression of PTP4A1;
Figure 5b, increased TRAF2 and RIP1 degradation by overexpression of PTP4A1;
5c, inhibition of phosphorylation of IKK? /?, I? B ?, NF-? B subunit p65 by overexpression of PTP4A1; And
Figure 5d, Increased ICAM-1 and VCAM-1 expression by A20 siRNA.
6 is a graph showing changes in cell adhesion protein and NF-κB transcription factor activity due to dephosphorylase activity of PTP4A1.
6A, ICAM-1, VCAM-1 increase by phosphorylase activity inhibition (DN-PTP4A1-over) of PTP4A1 and phosphorylation of NF-KB subunit p65; And
Figure 6b is a quantification graph of the increase in ICAM-1, VCAM-1 expression and phosphorylation of NF-kappa B subunit p65 by inhibition of phosphorylase activity (DN-PTP4A1-over) of PTP4A1.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for the prevention or treatment of vascular inflammatory diseases containing PTP4A1 (protein tyrosine phosphatase type IV A1) as an active ingredient.

The present invention also provides a pharmaceutical composition for the prevention or treatment of vascular inflammation diseases, which comprises a polynucleotide encoding the PTP4A1 protein as an active ingredient.

It is preferable that the PTP4A1 protein has any one of the amino acid sequences selected from the amino acid sequences of the following 1) to 3)

1) an amino acid sequence represented by SEQ ID NO: 1 (NCBI Accession number: NM_03463.4);

2) a partial amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1; And

3) an amino acid sequence having 95% or more homology with SEQ ID NO: 1.

The PTP4A1 protein is characterized by inhibiting the expression of ICAM-1 (intercellular adhesion molecule-1) or VCAM-1 (vascular cell adhesion molecule-1).

The PTP4A1 protein is characterized in that it increases the expression of A20, promotes the degradation of TRAF2 or RIP1 protein, or inhibits NF-κB activity.

The vascular inflammatory disease is preferably one selected from the group consisting of arteriosclerosis, rheumatoid arthritis, acute sepsis, aortic aneurysm, and diabetic peripheral vascular disease, but is not limited thereto.

The present invention also provides a pharmaceutical composition for the prevention or treatment of vascular inflammatory diseases containing, as an active ingredient, a vector comprising a polynucleotide encoding a PTP4A1 protein.

It is preferable that the PTP4A1 protein has any one of the amino acid sequences selected from the amino acid sequences of the following 1) to 3)

1) an amino acid sequence represented by SEQ ID NO: 1;

2) a partial amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1; And

3) an amino acid sequence having 95% or more homology with SEQ ID NO: 1.

The vector comprising the PTP4A1 polynucleotide may be a vector comprising a linear DNA, a plasmid vector, a viral expression vector or a recombinant retrovirus vector, a recombinant adenovirus vector, or a recombinant lentivirus vector expressed in a human or animal cell It is preferably a recombinant viral vector comprising a lentivirus vector, more preferably an adeno-associated virus (AAV) vector and a recombinant herpes simplex virus vector, but is not limited thereto .

The vascular inflammatory disease is preferably one selected from the group consisting of arteriosclerosis, rheumatoid arthritis, acute sepsis, aortic aneurysm, and diabetic peripheral vascular disease, but is not limited thereto.

In a specific example of the present invention, we performed immunofluorescence staining to confirm expression of PTP4A1 protein in vascular endothelial cells (see FIG. 1). In addition, in order to confirm the expression of cell adhesion protein according to the expression of PTP4A1 in vascular endothelial cell line, shRNA or overexpression vector was introduced into endothelial cell line, and western blot analysis was performed to determine the expression level of ICAM-1 and VCAM- As a result of comparing the expression levels, ICAM-1 and VCAM-1 proteins were increased when knockdown of PTP4A1 by introduction of shPTP4A1 in vascular endothelial cells induced inflammation with IL-1β, TNF-α or LPS In contrast, when PTP4A1 overexpression was introduced to increase PTP4A1 protein expression, ICAM-1 and VCAM-1 expression increased (Fig. 3C). In contrast, (See Figures 2f-2h), confirming that immune cell attachment was reduced (see Figures 3b and d).

In order to confirm the effect of PTP4A1 on vascular endothelial inflammation control in animal models, the present inventors prepared C57BL / 6N and Apolipoprotein E (ApoE, hyperlipidemia mouse model) deficient mice that specifically overexpress PTP4A1 in vascular endothelial cells, The expression levels of ICAM-1 and VCAM-1 in arterial and pulmonary vessels were significantly reduced compared to the control group by treating mouseTNF-α. The apoE-deficient mouse atherosclerotic lesion overexpressing PTP4A1 after high-fat diet, Inflammatory cytokine expression was reduced compared to the control group, which showed the effect of enhancing the stability of atherosclerotic lesions (see FIG. 4). In addition, we confirmed the expression of A20 protein, which regulates the activity of NF-κB, a transcription factor that controls the expression of cell adhesion proteins, and the proteolytic regulation function of TRAF2 and RIP1, which are intermediate signals of A20 protein and NF-κB signal pathway Western blot analysis showed that PTP4A1 increased the expression of A20 protein and promoted the degradation of TRAF2 and RIP1 proteins, thereby inhibiting the phosphorylation of NF-κB subunit p65 (see FIG. 5).

In addition, siRNAs of A20 gene were introduced into PTP4A1-overexpressing vascular endothelial cells to examine the expression of cell adhesion protein and phosphorylation of p65 after treatment with inflammatory inducer. As a result, the ability of inhibiting ICAM-1 and VCAM-1 expression by PTP4A1 overexpression (Fig. 5D). From these results, it was confirmed that PTP4A1 can inhibit the expression of cell adhesion protein by increasing A20 expression. Furthermore, the inventors of the present invention analyzed the changes in the cell adhesion protein and NF-κB expression by inhibiting the dephosphorylase activity of the PTP4A1 protein by inducing a mutation of amino acid residues in the active site of the dephosphorylation of PTP4A1 (DN-PTP4A1-Over) It was confirmed that the expression of cell adhesion protein, which was reduced by PTP4A1, and the phosphorylation of NF-κB subunit p65 were restored by inhibiting the dephosphorylation activity of PTP4A1 protein (see FIG. 6).

Therefore, when the expression and activity of PTP4A1 gene and protein were increased, it was confirmed that the expression of cell adhesion protein of vascular endothelial cells was inhibited and the adhesion of vascular endothelial wall of immune cells was inhibited. As a result, PTP4A1 protein or poly The nucleotide can be usefully used as an active ingredient of a pharmaceutical composition for the prevention or treatment of vascular inflammation diseases.

The therapeutically effective amount of the composition of the present invention may vary depending on a variety of factors, such as the method of administration, the site of administration, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined in consideration of safety and efficacy. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations in determining the efficacy can be found in, for example, Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

Compositions of the present invention may also include carriers, diluents, excipients, or a combination of two or more thereof commonly used in biological formulations. The pharmaceutically acceptable carrier is not particularly limited as long as the composition is suitable for in vivo delivery, for example, Merck Index, 13th ed., Merck & Inc. A buffered saline solution, a buffer solution, a dextrose solution, a maltodextrin solution, glycerol, ethanol, and one or more of these components may be mixed and used, and if necessary, an antioxidant, a buffer, Conventional additives may be added. In addition, diluents, dispersants, surfactants, binders and lubricants can be additionally added to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Further, it can be suitably formulated according to each disease or ingredient, using the method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990) in a suitable manner in the art.

The composition of the present invention may further contain one or more active ingredients showing the same or similar functions. The composition of the present invention contains 0.0001 to 10% by weight, preferably 0.001 to 1% by weight of the protein, based on the total weight of the composition.

The composition of the present invention may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) orally, and the dose may be appropriately determined depending on the body weight, age, sex, The range varies depending on diet, administration time, method of administration, excretion rate, and severity of the disease. The daily dose of the composition according to the present invention is 0.0001 to 10 mg / ml, preferably 0.0001 to 5 mg / ml, more preferably administered once to several times a day.

The vector containing the polynucleotide encoding the PTP4A1 protein of the present invention preferably contains 0.05 to 500 mg, more preferably 0.1 to 300 mg, and the coding of the PTP4A1 protein is preferably a recombinant vector containing a polynucleotide In the case of viruses, it is preferable to contain 10 ³ to 10 ¹² IU (10 to 10 ¹⁰ PFU), more preferably 10 ⁵ to 10 ¹⁰ IU.

The effective dose of the composition containing the polynucleotide encoding the PTP4A1 protein of the present invention as an active ingredient is 0.05 to 12.5 mg / kg in the case of the vector per 1 kg of body weight, 10 ⁷ to 10 ^{6 in} the case of the recombinant virus, 10 ¹¹ viral particles (10 ⁵ to 10 ⁹ IU) / ㎏, preferably when the vector is 0.1 to 10 ㎎ / ㎏, when the recombinant virus is 10 ⁸ to 10 ¹⁰ particles (10 ⁶ to 10 ⁸ IU) / Kg, and can be administered 2 to 3 times a day. Such composition is not necessarily limited to this, and may vary depending on the condition of the patient and the severity of the disease.

In addition, the present invention provides a protein detection method for providing information on vascular disease diagnosis.

The detection method preferably comprises the following steps:

1) measuring the expression level of PTP4A1 in a sample derived from a subject as an experimental group;

2) comparing the expression level of PTP4A1 in step 1) with the expression level of PTP4A1 in the control-derived sample; And

3) determining that the risk of developing a vascular inflammatory disease is high if the level of PTP4A1 expression in step 2) is reduced compared to the control.

Expression levels of PTP4A1 in step 1) of the detection method can be determined by Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemical staining (IHC), immunoprecipitation immunoprecipitation, and immunofluorescence. However, the present invention is not limited thereto.

The vascular inflammatory disease is preferably one selected from the group consisting of arteriosclerosis, rheumatoid arthritis, acute sepsis, aortic aneurysm, and diabetic peripheral vascular disease, but is not limited thereto.

The present invention also provides a method for screening candidate substances for treating vascular diseases.

Preferably, the screening method of the candidate agent for treating vascular disease comprises the following steps:

1) treating the test substance with the PTP4A1-expressing cell line;

2) measuring the level of expression or activity of the PTP4A1 protein in the treated cell line of step 1); And

3) Selecting the test substance to which the expression or activity level of the PTP4A1 protein of step 2) is increased compared to the control not treated with the test substance.

In the screening method, the test substance of step 1) is selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacteria or fungi metabolites and biosynthetic molecules .

The expression level of the protein in the step 2) is determined by immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemical staining (IHC), RT-PCR, Western blotting and flow cytometry But the present invention is not limited thereto.

The activity level of the protein of step 2) is preferably measured by any one method selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chip, but is not limited thereto.

The vascular inflammatory disease is preferably one selected from the group consisting of arteriosclerosis, rheumatoid arthritis, acute sepsis, aortic aneurysm, and diabetic peripheral vascular disease, but is not limited thereto.

Therefore, it has been confirmed that when the expression and activity of the PTP4A1 gene or protein is increased, the expression of the cell adhesion protein of the vascular endothelial cells is inhibited and the adhesion of the inner wall of the vascular endothelial cells of the immune cells is inhibited. Therefore, the PTP4A1 protein or the polynucleotide Can be usefully used as an active ingredient of a pharmaceutical composition for the prevention or treatment of vascular inflammation diseases and can be used as a protein detection method for providing information on the diagnosis of vascular diseases through the expression and activity analysis of the PTP4A1 gene or protein, And can be used as a screening method for candidate therapeutic agents.

Hereinafter, the present invention will be described in detail with reference to experimental examples.

EXAMPLES The following experimental examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

< Experimental Example  1> Analysis of PTP4A1 Protein in Vascular Endothelial Cells and Changes in Cell Adhesion Protein Expression of Vascular Endothelial Cells by Control of PTP4A1 Expression

<1-1> PTP4A1  Identification of changes in vascular endothelial cells

The present inventors confirmed the expression of cell adhesion protein of vascular endothelial cells by the expression control of PTP4A1 protein.

Specifically, expression of PTP4A1 in vascular endothelial cells was first confirmed by immunofluorescence staining. Immunofluorescent staining was performed by isolating the aorta of the mouse (C57BL / 6N) and fixed in a 4% formaldehyde aqueous solution for 48 hours. After that, blocks were prepared through conventional paraffin embedding and slides were formed to a thickness of 4 μm. For antigen reconstitution, the cells were treated with 10 mM sodium citrate aqueous solution (pH 6.0) at 97 ° C for 20 minutes, washed 3 times with PBS (phosphate buffered saline), and treated with 0.2% trione X-100 solution at room temperature for 20 minutes. The cells were treated with 1% bovine serum albumin (BSA) at room temperature for 1 hour to prevent nonspecific antigen binding. After washing, anti-mouse CD31 (AF3628, R & D systems) and anti-mouse PTP4A1 Lt; 0 &gt; C. Then, the secondary antibody, AlexaFluor 488 (A11001, Life Technologies) and tetramethylrhodamin B siothicyanate (TRITC) conjugated (ab6786, Abcam) were treated at room temperature for 2 hours and then treated with DAPI diluted 1: 1000 for 2 minutes. And then confirmed by using a microscope (Olympus, IX81-ZDC).

As a result, it was confirmed that the PTP4A1 protein was expressed at the same position as the vascular endothelial cell-specific marker CD31 as shown in Fig. 1 (see Fig. 1).

<1-2> PTP4A1  Change of cell adhesion protein of vascular endothelial cells by expression control

The present inventors produced knock-down and overexpressing vascular endothelial cell lines of PTP4A1 to confirm the inflammatory function of PTP4A1 expressed in vascular endothelial cells.

Specifically, a PTP4A1 shRNA vector having the nucleotide sequence shown in SEQ ID NO: 6 was purchased (SHCLNG-NM_003463, sigma Aldrich) and a PLKO.1 vector (SHC001, sigma aldrich) was used as a control. Total mRNA was isolated by using human Umbilical Artery Endothelial cell (HUAEC) and trizol reagent (15596018, Life Technology), and reverse transcriptase (M170B, Promega) and RNase inhibitor (N2518, Promega) were used to construct PTP4A1 overexpression vector , And the PTP4A1 gene (NM_03463.4) was amplified by the PCR method and cloned into the pLVX-EF1α-IRES-Puro vector (631988, Clontech). These vectors were introduced into Lenti-X 293T cell (632180, Clontech) using lentiviral envelope protein making vectors psPAX2 (# 12260, addgene) and pMD2.G (# 12259, addgene) as transfection reagent Lipofectamine 2000 (11668-019, invitrogen) , And the supernatant was collected at 24 and 48 hours. Ultrasonic centrifugation (25,000 rpm, 4 ° C, 2 hr) was performed to obtain concentrated virus and polybrene (sc-134220, santa cruz ) Was adjusted to a final concentration of 5 μg / ml, and then only puromycin (P8833, Sigma Aldrich) was used to select and isolate infected cell lines with a 2 μg / ml culture. The expression of PTP4A1 was then confirmed by RT-PCR (GoTaq Green Master Mix, M7823, Promega) and Realtime-PCR (SsoAdvanced Universal SYBR Green Supermix, 172-5270, BIO-RAD) Respectively. The function of PTP4A1 protein in inflammation was examined by administering IL-1β, TNF-α or LPS, which is an inflammation inducer, to the completed PTP4A1 gene expression-regulating cell line.

order PTP4A1 primer
F: TTG GCC TTT TGA TGA TGG TG (SEQ ID NO: 2) R: TGG AAT CTT TGA AAC GCA GC (SEQ ID NO: 3) GAPDH primer
F: ACA CGT TGG CAG TGG GGA CA (SEQ ID NO: 4) R: TGC CTC CTG CAC CAC CAA CT (SEQ ID NO: 5) PTP4A1 shRNA CCGGATTGTTGATGACTGGTTAAGTCTCGAGACTTAACCAGTCATCAACAATTTTTG (SEQ ID NO: 6)

As a result, it was confirmed that the expression level of PTP4A1 was changed by PTP4A1 shRNA and PTP4A1 overexpressing vector as shown in FIG. 2 (FIGS. 2A and 2E). In addition, the expression of ICAM-1 and VCAM-1 increases in a time-dependent manner when IL-1β, TNF-α or LPS is treated. Inhibition of PTP4A1 expression by shRNA causes IL-1β, TNF-α or LPS ICAM-1 and VCAM-1 were further enhanced (Fig. 2B to Fig. 2D). On the other hand, it was confirmed that the expression of ICAM-1 and VCAM was significantly inhibited by IL-1β, TNF-α or LPS in the PTP4A1 overexpressing cell line (FIGS. 2F to 2H).

< Experimental Example  2> PTP4A1  Changes in immune cell adhesion of vascular endothelial cells following expression control

The present inventors confirmed that the cell adhesion protein was regulated by the expression control of PTP4A1 gene in the <Experimental Example 1>. We then examined the anti - inflammatory activity of PTP4A1 by confirming immune cell adhesion.

Specifically, the PTP4A1 knock-down and over-expressing cell lines prepared in Experimental Example <1-2> were incubated for 2 days at 2 × 10 ⁵ cells / plate on a 35 mm plate (81156, Ibidi), followed by addition of 1% FBS M199 with antibiotics The cells were treated with IL-1β or TNF-α for 6 hours at a final concentration of 10 ng / ml, and U937 cells were treated with Cell-Tracker Green CMFDA (C2925, Invitrogen) Cells were stained for 30 minutes. Was sprinkled on top of each of the cell lines were carried out fast the stained U937 cells to 3 x 10 ⁵ cell / plate. After co-culturing for 2 hours, the cells were washed 4 times with PBS, fixed with 4% formaldehyde at room temperature for 20 minutes, and then divided into 16 sections by fluorescence microscope, and the number of U937 cells stained was calculated.

As a result, as shown in FIG. 3, in the endothelial cell line inhibiting the expression of PTP4A1, immune cell adhesion was significantly increased when IL-1β or TNF-α, which is an inflammation inducer, was treated, compared with the control group that did not inhibit PTP4A1 expression (Mock + IL-1β, Mock + IL-1β, PTP4A1-Over + TNF-α) without overexpression in the endothelial cell line PTP4A1-Over + TNF-a) (Fig. 3B and Fig. 3D).

< Experimental Example  3> Blood vessel specific PTP4A1  In animal models with increased gene expression Cell adhesion protein Confirming the inhibition of vaginal expression

The inventors of the present invention produced a mouse having increased blood vessel-specific PTP4A1 gene expression in an animal disease model in order to examine the inhibitory effect of PTP4A1 on vascular inflammation.

Specifically, an animal model was produced by MARCROGEN (Korea, Daejeon), and the vector used was a vector having a mouse-specific promoter, mouseTie2 promoter. For selection of mice for the experiment, the general C57BL / 6N line was used. Direct vector PCR was used to distinguish only vascular - specific PTP4A1 gene expressing mice from vector - specific primers. For details, cut a portion of the tail of the mouse and immerse it in 100 μl of a 1:25 mixture of proteinase K (10910000, roche) and Direct PCR tail solution (102-T, vivagen) and treat at 57 ° C for 16 hours. After vortexing, centrifugation (14000 rpm, 4 ° C, 10 min) is performed, and only the supernatant is extracted to measure the amount of DNA. Using 200 ng of each DNA, confirm by conventional PCR method. SEQ ID NOS: 7 and 8 of Table 2 were used as primers for confirmation.

In this mouse-induced increase of PTP4A1 gene expression, mouse TNF-α drug was administered at a concentration of 2 μg / 20 g for 8 hours to induce acute inflammation in vascular endothelial cells. (Normal C57BL / 6N mouse, WT) and experimental group (mouse-specific PTP4A1 gene expression-increasing mouse, TG) were included in each group. After each mouse was anesthetized and transcardiac perfusion was performed with a saponin salt solution, the vertebral aorta and lung were removed through a surgical procedure. To obtain cDNA, 800 μl of trizol reagent was added and homogenization was performed 3 times for 20 seconds using a homogenizer (FastPrep-24, Millipore). Then 200 μl of Chloroform (c2432 sigma Aldrich) was added and shaken for 15 seconds. After centrifugation at 14000 rpm at 4 ° C for 15 minutes, 350 ~ 400 μl of transparent supernatant was transferred to a new tube and isopropanol (merck) After shaking for 15 seconds, the sample was allowed to stand at room temperature for 10 minutes and then centrifuged at 14000 rpm at 4 ° C for 10 minutes. The supernatant was discarded and treated with 1 ml of 75% ethanol, followed by centrifugation at 14000 rpm at 4 ° C for 5 min. After discarding the supernatant, dissolve the total mRNA using a suitable amount of DEPC water after drying. To determine the amount of total mRNA using Nanodrop (ND-1000, Thermo scientific) to make cDNA for RT-PCR, 2 μg of total mRNA was diluted in 9 μl of DEPC water and 1 μl of oligo DT (C110A, Promega) are treated together and maintained at 70 ° C for 10 minutes. 4 μl each of reverse transcriptase buffer (M531A, Promega) and DNTP (U151B, Promega) were added to each well and the reverse transcriptase (M170B, Promega) and RNase inhibitor (N2518, Promega) And then treated at 42 ° C for 1 hour. Finally, to inhibit the enzyme activity, the cells were treated at 70 ° C for 10 minutes and stored frozen. RT-PCR (GoTaq Green Master Mix, M7823, Promega) and Realtime-PCR (PCR) were performed using the primers shown in Table 2 below in order to confirm the degree of transcription of specific genes (ICAM-1 and VCAM- SsoAdvanced Universal SYBR Green Supermix, 172-5270, BIO-RAD), and the results were derived using conventional methods.

order mouseTie2 promoter
Forward: CCAAATGCACCCCAGAGAACA (SEQ ID NO: 7) Reverse: GGTCGCATTGGTTGGATTGTG (SEQ ID NO: 8) mICAM-1
F: TGG AGA CGC AGA GGA CCT TA (SEQ ID NO: 9) R: AGG CCT GGC ATT TCA GAG TC (SEQ ID NO: 10) mVCAM-1
F: CTG GGA AGC TGG AAC GAA GT (SEQ ID NO: 11) R: CCT CGC TGG AAC AGG TCA TT (SEQ ID NO: 12) mGAPDH
F: TGA AGT CGC AGG AGA CAA CC (SEQ ID NO: 13) R: CTA CCC CCA ATG TGT CCG TC (SEQ ID NO: 14)

As a result, as shown in Fig. 4, the inflammatory induction responses of the experimental group (TG) and the control group (WT), which are mice with increased PTP4A1 gene expression, were compared. In the control group (WT), ICAM- The degree of transcription of VCAM-1 gene was dramatically increased in the group treated with mouse TNF-α, while that in the experimental group (TG) was significantly decreased in arterial blood vessels (FIG. 4A) and pulmonary arteries (FIGS. 4B and 4C).

In order to examine the effect of vascular-specific PTP4A1 overexpression in chronic diseases such as arteriosclerosis, a high-quality mouse model ApoE-deficient mouse and a vascular-specific PTP4A1-overexpressing mouse were crossed to generate ApoE - / - PTP4A1 mouse Mice were sacrificed to obtain a heart. After fasting to 10% neutral formalin, frozen blocks were prepared and aortic arches were obtained. (aortic sinus) sections were obtained and immunofluorescent staining was performed. For the analysis of inflammatory cell deposition in atherosclerotic lesions, anti-CD45 (550539, BD bioscience) and anti-F4 / 80 (sc-26643-R, Santa Cruz) staining were performed. Anti-TNFalpha (ApoE - / - PTP4A1), which was overexpressed by PTP4A1 (Fig. 4d), as compared with the control (ApoE - / -). Reduced inflammatory responses in atherosclerotic lesions were associated with decreased necrotic area in lesions (Figure 4e). In addition, reduced inflammatory cell deposition in the apoE - / - PTP4A1 mouse atherosclerotic lesion was induced by matrix metalloproteinase-2 (anti-MMP-2; sc-10736, Santa Cruz) -9; sc-6840, Santa Cruz), which increased collagen deposition and increased the stability of atherosclerotic lesions (Fig. 4f).

From the above results, it was confirmed that the treatment and prevention of acute and chronic vascular endothelial inflammation were effective by controlling the expression of PTP4A1 gene in vivo and in vitro.

< Experimental Example  4> PTP4A1  Through regulation of A20 gene expression in proteins NF - κB  Signaling system inhibition and Cell adhesion protein  Confirming expression suppression effect

<4-1> PTP4A1  Over-expression confirmed A20 expression increase

In order to confirm the mechanism by which PTP4A1 protein overexpressed in inflammation-induced vascular endothelial cells inhibits the expression of cell adhesion protein, the inventors of the present invention conducted intracellular administration of the PTP4A1 protein-overexpressing vascular endothelial cells The expression of the A20 protein and the NF-κB signaling pathway, which are responsible for the inhibition of NF-κB activity, and the expression of A20 protein and NF-κB signaling pathway Expression of the intermediate signal transporters TRAF2 and RIP1 and IκBα and IKKα / β phosphorylation were analyzed by western blot.

As a result, as shown in FIG. 5, it was confirmed that the overexpression group of PTP4A1 (PTP4A1-Over) in the endothelial cells induced inflammation with IL-1β increased the expression of A20 protein compared to the control (Mock) , Thereby promoting the degradation of proteins of TRAF2 and RIP1 (FIG. 5b), inhibiting IκBα and IKKα / β phosphorylation, and ultimately inhibiting phosphorylation of NF-κB subunit p65 (FIG. 5c).

<4-2> PTP4A1  A20 inhibition in overexpressing cell lines Cell adhesion protein  Confirmation of expression recovery

The A20 protein is a gene whose expression is induced by an inflammatory inducer and is known to increase the degradation of TRAF2 and RIP1 proteins and to inhibit NF-κB phosphorylation as a negative feedback function (Catrysse, L. et al. et al., A20 in inflammation and autoimmunity, 2014, trends in immunology, vol. 35, No. 1). The present inventors conducted the following experiments to further investigate the relationship between the PTP4A1 gene and the A20 protein.

Specifically, A20 siRNA (sc-37655, santa cruz) was inhibited by the electrophoresis transfection method in the PTP4A1 over-expressing cell line. A20 siRNA per 1 x 10 ⁶ cells / 100 μl was treated to a final concentration of 1 μM and electroporated with Neon (Thermo Fisher scientific) instrument set at 1300 v and 30 ms 1 (pulse number). Thereafter, the cells were cultured in a special culture medium (without antibiotics) for 24 hours and then kept in a normal culture medium. The cell line was treated with an inflammatory inducer and the cell adhesion protein was identified.

As a result, as shown in Fig. 5, the expression of ICAM-1 and VCAM-1 inhibited by the PTP4A1 gene when the inflammation inducer was treated with the PTP4A1 overexpressing cell line and the PTP4A1 overexpression- And the phosphorylation of the subunit p65 of NF-kB regulating the transcription of this cell adhesion protein was also restored (Fig. 5d).

These results indicate that the PTP4A1 gene induces the degradation of TRAF2 and RIP1 protein by inhibiting the activity of NF-κB by increasing the A20 protein expression and consequently inhibiting the protein expression of the cell adhesion proteins ICAM-1 and VCAM-1 it means. From the above results, it was confirmed that the PTP4A1 protein has a function of inhibiting the inflammatory reaction.

< Experimental Example  5> PTP4A1 Dephosphorylation  By enzyme activity control Cell adhesion protein  Confirming expression suppression effect

The present inventors conducted the following experiments in order to examine the activity of PTP4A1 dephosphorylase in the inhibition of cell adhesion protein expression by PTP4A1 protein.

Specifically, the cell line (dominant negative PTP4A1-Over, DN-PTP4A1-Over), which inhibited the dephosphorylation enzyme activity of PTP4A1 protein by inducing mutation of amino acid residues of PTP4A1 active site, was prepared. The dephosphorylated enzyme activity of PTP4A1 was determined by searching PTP4A1 from the International Bioinformatics homepage www.uniport.org, Q93096, and the amino acid sequence showing the activity of this gene was confirmed. Aspartic acid, which is the 72th amino acid, was substituted with alanine and 104 The amino acid cysteine was replaced with serine to completely remove the activity of PTP4A1. For this purpose, PCR was performed using Point mutation PCR, pfu Taq polymerase and mutagenic primer, and the methylated DNA chain was removed by treatment with DPN1 enzyme. The PTP4A1 vector with the mutated amino acid residues was obtained through transformation. The primers used are shown in Table 3 below. The effect of IL-1β on cell adhesion protein and NF-κB expression was analyzed by western blot using PTP4A1 over-expressing cell line (PTP4A1-Over) and PTP4A1 dephosphorylase-overexpressing cell line (DN-PTP4A1-Over).

order Normal (# 72)
F: ATT GCT GTT CAT TGC GTT GCA GGC CTT (SEQ ID NO: 15) R: AAG GCC TGC AAC GCA ATG AAC AGC AAT (SEQ ID NO: 16) Mutation (# 72) primer
F: ATT GCT GTT CAT A GC GTT GCA GGC CTT (SEQ ID NO: 17) R: AAG GCC TGC AAC AGC AAC ATG GC T AAT (SEQ ID NO: 18) Top (No. 104)
F: TGG CCT TTT GAT GAT GGT GCA CCA CCA (SEQ ID NO: 19) R: TGG TGG TGC ACC ATC ATC AAA AGG CCA (SEQ ID NO: 20) Mutation (# 104) primer
F: TGG CCT TTT GAT G C T GGT GCA CCA CCA (SEQ ID NO: 21) R: TGG TGG TGC ACC A G C ATC AAA AGG CCA (SEQ ID NO: 22)

As a result, it was confirmed that the expression of cell adhesion protein and the activity of NF-κB, which were reduced by PTP4A1 overexpression as shown in FIG. 6, were restored by inhibiting PTP4A1 protein dephosphorylation activity (FIG. 6). Therefore, it was confirmed that not only the expression of the PTP4A1 protein but also the activity of the PTP4A1 protein were effective in inhibiting the expression of the cell adhesion protein.

<110> KOREA RESEARCH INSTITUTE OF BIOSCIENCE AND BIOTECHNOLOGY <120> Composition comprising PTP4A1 protein or polynucleotide encoding          the PTP4A1 for the prevention or treatment of          비ascular-inflammatory disease <130> 2016P-03-016 <160> 22 <170> Kopatentin 2.0 <210> 1 <211> 173 <212> PRT <213> Homo sapiens <400> 1 Met Ala Arg Met Met Asn Arg Pro Ala Pro Val Glu Val Thr Tyr Lys Asn   1 5 10 15 Met Arg Phe Leu Ile Thr His Asn Pro Thr Asn Ala Thr Leu Asn Lys              20 25 30 Phe Ile Glu Glu Leu Lys Lys Tyr Gly Val Thr Thr Ile Val Arg Val          35 40 45 Cys Glu Ala Thr Tyr Asp Thr Thr Leu Val Glu Lys Glu Gly Ile His      50 55 60 Val Leu Asp Trp Pro Phe Asp Asp Gly Ala Pro Pro Ser Asn Gln Ile  65 70 75 80 Val Asp Asp Trp Leu Ser Leu Val Lys Ile Lys Phe Arg Glu Glu Pro                  85 90 95 Gly Cys Cys Ile Ala Val His Cys Val Ala Gly Leu Gly Arg Ala Pro             100 105 110 Val Leu Val Ala Leu Ala Leu Ile Glu Gly Gly Met Lys Tyr Glu Asp         115 120 125 Ala Val Gln Phe Ile Arg Gln Lys Arg Arg Gly Ala Phe Asn Ser Lys     130 135 140 Gln Leu Leu Tyr Leu Glu Lys Tyr Arg Pro Lys Met Arg Leu Arg Phe 145 150 155 160 Lys Asp Ser Asn Gly His Arg Asn Asn Cys Cys Ile Gln                 165 170 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PTP4A1 primer F <400> 2 ttggcctttt gatgatggtg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PTP4A1 primer R <400> 3 tggaatcttt gaaacgcagc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH primer F <400> 4 acacgttggc agtggggaca 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH primer R <400> 5 tgcctcctgc accaccaact 20 <210> 6 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> PTP4A1 shRNA <400> 6 ccggattgtt gatgactggt taagtctcga gacttaacca gtcatcaaca attttttg 58 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouseTie2 promoter F <400> 7 ccaaatgcac cccagagaac a 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouseTie2 promoter R <400> 8 ggtcgcattg gttggattgt g 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mICAM-1 F <400> 9 tggagacgca gaggacctta 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mICAM-1 R <400> 10 aggcctggca tttcagagtc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mVCAM-1 F <400> 11 ctgggaagct ggaacgaagt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mVCAM-1 R <400> 12 cctcgctgga acaggtcatt 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mGAPDH F <400> 13 tgaagtcgca ggagacaacc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mGAPDH R <400> 14 ctacccccaa tgtgtccgtc 20 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Normal 72 F <400> 15 attgctgttc attgcgttgc aggcctt 27 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Normal 72 R <400> 16 aaggcctgca acgcaatgaa cagcaat 27 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Mutation 72 F <400> 17 attgctgttc atagcgttgc aggcctt 27 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Mutation 72 R <400> 18 aaggcctgca acgctatgaa cagcaat 27 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Normal 104 F <400> 19 tggccttttg atgatggtgc accacca 27 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Normal 104 R <400> 20 tggtggtgca ccatcatcaa aaggcca 27 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Mutation 104 F <400> 21 tggccttttg atgctggtgc accacca 27 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Mutation 104 R <400> 22 tggtggtgca ccagcatcaa aaggcca 27

Claims (17)

A pharmaceutical composition for the prevention and treatment of vascular inflammatory diseases containing PTP4A1 (protein tyrosine phosphatase type IV A1) as an active ingredient.
2. The pharmaceutical composition according to claim 1, wherein the PTP4A1 protein is an amino acid sequence represented by SEQ ID NO: 1.
The pharmaceutical composition according to claim 1, wherein the PTP4A1 protein inhibits the expression of ICAM-1 (intercellular adhesion molecule-1) or VCAM-1 (vascular cell adhesion molecule-1).
The pharmaceutical composition according to claim 1, wherein the PTP4A1 protein increases the expression of the A20 protein.
The pharmaceutical composition according to claim 1, wherein the PTP4A1 protein promotes degradation of TRAF2 or RIP1 protein, or inhibits NF-κB activity.
A pharmaceutical composition for the prevention or treatment of vascular inflammation diseases, which comprises, as an active ingredient, a vector comprising a polynucleotide encoding a PTP4A1 protein.
7. The pharmaceutical composition according to claim 6, wherein said vector is any one selected from the group consisting of linear DNA plasmid DNA and recombinant viral vector.
The pharmaceutical composition according to claim 7, wherein the recombinant virus is any one selected from the group consisting of retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, and lentivirus.
The pharmaceutical composition according to any one of claims 1 to 6, wherein the vascular inflammatory disease is any one selected from the group consisting of arteriosclerosis, rheumatoid arthritis, acute sepsis, aortic aneurysms, and diabetic peripheral vascular disease.
1) measuring the expression level of PTP4A1 in a sample derived from a subject as an experimental group;
2) comparing the expression level of PTP4A1 in step 1) with the expression level of PTP4A1 in the control-derived sample; And
3) determining that the level of expression of PTP4A1 in step 2) is decreased compared to the control, and that the risk of developing a vascular inflammatory disease is high;
Wherein the method comprises the steps of:
The method according to claim 10, wherein the expression level of PTP4A1 in step 1) is selected from the group consisting of Western blotting, enzyme-linked immunosorbent assay (ELISA), immunohistochemical staining (IHC) wherein the protein is detected by any one method selected from the group consisting of immunoprecipitation and immunofluorescence.
[Claim 11] The method of claim 10, wherein the vascular inflammation disease is any one selected from the group consisting of arteriosclerosis, rheumatoid arthritis, acute sepsis, aortic aneurysm, and diabetic peripheral vascular disease.
1) treating the test substance with the PTP4A1-expressing cell line;
2) measuring the level of expression or activity of the PTP4A1 protein in the treated cell line of step 1); And
3) selecting the test substance whose expression or activity level of the PTP4A1 protein of step 2) is increased compared to the control not treated with the test substance;
A method for screening a candidate substance for treating a vascular inflammation disease.
The method according to claim 13, wherein the test substance in step 1) is selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacteria or fungi metabolites and bioactive molecules And the selected one is selected.
14. The method of claim 13, wherein the level of expression of the protein of step 2) is selected from the group consisting of immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemical staining (IHC) (Western blotting), and flow cytometry (FACS). &Lt; Desc / Clms Page number 19 &gt;
14. The method according to claim 13, wherein the activity level of the protein of step 2) is measured by any one method selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chip Lt; / RTI &gt;
14. The screening method according to claim 13, wherein the vascular inflammation disease is any one selected from the group consisting of arteriosclerosis, rheumatoid arthritis, acute sepsis, aortic aneurysms, and diabetic peripheral vascular disease.

Images