KR20210106349A - Bone graft composition comprising cancellous bone grafts as an active ingredient - Google Patents

Abstract

The present invention provides a bone graft material composition having excellent bone differentiation promoting activity by utilizing bio-silica bone fragments obtained from sponges, and thus, can provide a bone graft material having an excellent effect not only on bone support but also on bone regeneration.

Description

Bone graft composition comprising cancellous bone grafts as an active ingredient

The present invention relates to a bone graft material composition comprising a spongy bone fragment as an active ingredient.

Sponges (Porifera) belong to the lowest phylum among metazoans, and are also called sponge animals. ) is also called These sponges are distributed to the depths of the sea at a depth of 10 to 9,000 meters, and are attached to the shells of sea squirts and shellfish, and there are types that stand upright on the muddy bottom. Also, since sponges live on rocks or the ground without movement, it is easy to think of them as plants at first glance, but they consume food through small and large pores.

Sponges are divided into four rivers: Lime spongy river, Hexagon spongy river, Normal spongy river, and Donggol spongy river according to the characteristics of bone fragments. Lime sponges have red ash ossicles and live in shallow waters. More than 500 species have been discovered around the world, and about 9 species have been identified in Korea. It includes shiitake mushroom sponges, Utenpal sponges, white bugle sponges, and concave sponges. Common sponges have siliceous skeletal fragments, but some types do not, and most of them live in shallow seas or lakes. It contains the most species of sponges, and about 114 species are known in Korea. These include Bath sponges, Bora sponges, freshwater sponges, volcanic sponges, Tapjip sponges, Metnun sponges, and Haero cave sponges. Hexagonal Sponges have siliceous bone fragments and three axes are the basic type, but there are several types ranging from one axis to six axes. In particular, small bone fragments called hexagonal bodies or yangban bodies are attached to bone fragments, and they are further classified into hexagonal subclasses and yangban subclasses depending on which of them is present. All live in the deep sea, and only two species are known from Korea. These include the sea sponge and the tip of the top hair. Donggol spongy neck is composed of two families. The size of the bone fragments is about 10 μm and can be observed through a microscope. The fibrous skeleton of sponges has the ability to absorb due to capillary action, so it is also used for bathing, medical, art, makeup, lithography, and machine cleaning. On the other hand, some sponges are known to contain elements such as iodine, bromine and aluminium, as well as phosphates that can promote metabolism.

The sponge animal may be used for the manufacture of a therapeutic agent in a form in which impurities are removed and dried to be made into a powder or to absorb an active ingredient in a spongy bone fragment. Although the technology in which sponges or spongy bone fragments are applied for the treatment (skin) of a specific disease has been disclosed, a therapeutic composition containing silica bone fragments of sponges and a support for bone regeneration and manufacturing thereof in Korea has not yet been disclosed. do.

KR 10-1762594

An object of the present invention is to provide a bone graft material for bone regeneration and support using cancellous bone fragments, and to provide a method for obtaining a cancellous bone fragment for manufacturing a bone graft material.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to solve the above problems, the present invention provides a bone graft composition comprising cancellous bone fragments as an active ingredient.

In one embodiment of the present invention, the composition may further include a calcium phosphate compound, wherein the calcium phosphate compound is hydroxyapatite, tricalcium phosphate (TCP), monocalcium phosphate, tetracalcium phosphate, dicalcium. It may be phosphate or a combination thereof, preferably tricalcium phosphate, and more preferably beta tricalcium phosphate.

In another embodiment of the present invention, the composition may further include collagen to induce homogeneous mixing of the spongy bone fragments and the calcium phosphate compound, and may further promote bone differentiation.

As another embodiment of the present invention, the sponge may be at least one selected from the group consisting of Agelas sp., Ircinia sp., and Stylissa sp. .

As another embodiment of the present invention, the composition may contain 1.3 to 7 parts by weight of the calcium phosphate compound based on 1 part by weight of the spongy bone fragment, and more preferably, the calcium phosphate compound based on 1 part by weight of the spongy bone fragment. It may include 7 parts by weight.

As another embodiment of the present invention, the composition may contain 10% by weight of spongy bone fragments, 70% by weight of a calcium phosphate compound, and 20% by weight of collagen.

In addition, the present invention provides a method for producing a bone graft material comprising the steps of:

removing organic matter and impurities by immersing the sponges in methanol and dichloromethane solution;

heating the sponge to 600 to 800°C for 5 to 10 hours to obtain purified spongy bone fragments;

washing the obtained spongy bone fragments with distilled water and freeze-drying;

passing the dried spongy bone fragments through a mesh network 1 to 3 times to control the size of the bone fragments;

mixing the spongy bone fragments with collagen and 0.2M acetic acid to prepare a mixture 1;

preparing a mixture 2 by mixing tricalcium phosphate (TCP) with the mixture 1; and

Molding the mixture 2 by pouring it into a mold.

In one embodiment of the present invention, the bone graft material may be used for bone regeneration and support, and the tricalcium phosphate may be mixed in 7 parts by weight based on 1 part by weight of the spongy bone fragments.

In addition, the present invention provides a bone graft material prepared by the above method.

The present invention provides a bone graft material having excellent bone differentiation promoting activity by utilizing bio-silica bone fragments obtained from a sponge, and thus it is possible to provide a bone graft material having excellent effects not only on bone support but also on bone regeneration.

1 is an image of four types of spongy debris dried after organic matter has been removed, an image after their sintering, and an image observed with a scanning electron microscope (SEM).
2 is an image of the surface of a bone graft material having different components and different component ratios observed with a scanning electron microscope. The components of each graft and their proportions are as follows:
A: Bone graft material prepared with 50 mg of β-TCP and 50 mg of collagen,
B: Bone graft material prepared with 50 mg of sponge 001 and 50 mg of collagen,
C: Bone graft material prepared with 80 mg of sponge 003 and 20 mg of collagen
FIG. 3A shows the results of cell viability analysis by MTS analysis 7 days after inoculation of cells into each prepared bone graft material, and FIG. 3B shows the results of alkaline phosphatase activity analysis 7 days later.
4 is a result of comparative analysis of the expression of alkaline phosphatase (ALP), Type I collagenase (Col1), bone sialoprotein (BSP), and osteocalcin (OCN), which are bone differentiation factors that can confirm the degree of promoting bone differentiation in each prepared bone graft material. am.

The present inventors have completed the present invention by intensively researching a material that is implanted into a bone scaffold and promotes excellent cell adhesion and osteocytic differentiation.

In the present invention, the sponge is derived from an invertebrate species of the Spongea phylum, and is also referred to as a sponge. About 5,000 surviving sponge species are classified in the phyla Sponga, which are divided into three different groups: Hexactinellida (free sponges), Demospongia and Calcarea (calcarea sponges). ) is composed of Sponge is composed of soft tissue suspended in a jelly-like protein matrix supported by a hard skeleton composed of acicular structures known as skeletal fragments, and contains calcium carbonate, or silica and collagen as major components.

In the present invention, cancellous bone fragments can be obtained by performing the following steps:

(1) removing organic matter and impurities by immersing the sponges in methanol and dichloromethane solution;

(2) obtaining purified spongy bone fragments by heating the spongy animal to 600 to 800° C. for 5 to 10 hours;

(3) washing the obtained spongy bone fragments with distilled water and freeze-drying; and

(4) passing the dried spongy bone fragments through a mesh network 1 to 3 times to control the size of the bone fragments.

Step (2) may be performed in an electric furnace, and may be to remove organic matter by heating sponges having a moisture content of less than 10%, preferably less than 8%, in an electric furnace. The spongy bone fragments obtained in step (3) after heating may be made of high-purity silica having a high silica content.

The term “bone graft composition” used in the present invention refers to a material that is implanted in a bone defect and fills it, that is, a composition used as a bone defect replacement material. Specifically, in the present invention, the bone graft material composition refers to a synthetic bone graft material (Alloplastic, Synthetic bone graft materials) composition based on a calcium phosphate compound.

The bone graft material composition of the present invention includes cancellous bone fragments as an active ingredient, and may further include a calcium phosphate compound and/or a bone differentiation inducing (or promoting) factor.

In the present invention, the spongy bone fragments may be obtained from Agelas sp., Ircinia sp., and Stylissa sp., but is not limited to the above sponges.

In the present invention, the calcium phosphate compound is a natural bone-like component including phosphoric acid and calcium to induce bone conduction and growth. In a specific experiment of the present invention, calcium phosphate was used as β-tricalcium phosphate (β-TCP, Ca ₃ (PO ₄ ) ₂ ), but is not limited thereto, but is not limited thereto. Tetracalcium phosphate, dicalcium phosphate, and the like can be used.

On the other hand, the present invention prepared a bone graft material by varying the mixing ratio of cancellous bone fragment and β-TCP through a specific experiment and confirmed the adhesion ability and differentiation level of bone cells. It was confirmed that the mixing ratio of TCP is important.

The bone graft material composition of the present invention may contain 1.3 to 7 parts by weight of the calcium phosphate compound, preferably 7 parts by weight of the calcium phosphate compound, based on 1 part by weight of the spongy bone fragments.

In addition, the present invention provides a method for preparing a bone graft material using the composition, the method comprising the following steps:

removing organic matter and impurities by immersing the sponges in methanol and dichloromethane solution;

heating the sponge to 600 to 800° C. for 5 to 10 hours to obtain purified spongy bone fragments;

washing the obtained spongy bone fragments with distilled water and freeze-drying;

passing the dried spongy bone fragments through a mesh network 1 to 3 times to control the size of the bone fragments;

mixing the spongy bone fragments with collagen and 0.2M acetic acid to prepare a mixture 1;

preparing a mixture 2 by mixing tricalcium phosphate (TCP) with the mixture 1; and

Molding the mixture 2 by pouring it into a mold.

Since the bone graft material provided by the method of the present invention has excellent cell adhesion and bone differentiation inducing activity, it may be provided as a bone graft material for bone regeneration and support.

In addition, the present invention provides a bone graft material manufacturing kit comprising cancellous bone fragments and a calcium phosphate compound, and the kit may further include collagen.

The present invention can apply various transformations and can have various embodiments. Hereinafter, specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, and it should be understood to include all modifications, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

[Example]

Example 1. Preparation of silica bone fragments from sponges

Sponges of Agelas sp., Ircinia sp., and Stylissa sp. were prepared, and each of the sponges was treated with a methanol solution and dichloromethane ) was immersed in the solution to remove organic matter and impurities to obtain spongy bone fragments. Then, the obtained spongy bone fragments were heated in an electric furnace at 700° C. for 6 hours to obtain purified pure silica bone fragments. Thereafter, the obtained silica bone fragments were washed with distilled water and then freeze-dried, and silica fragments having a certain size were obtained using a mesh sieve. The components of four types of silica bone fragments purified from each sponge are shown in Table 1 below.

No. Bell Si Atomic % Si Atomic % (Calcinated) Ca Atomic % (Calcinated) P Atomic % (Calcinated) 01 Agelas sp. 0.58 4.69 6.65 2.47 02 Ircinia sp. 0.26 1.24 5.37 9.06 03 Stylissa sp. 1.08 28.77 0.77 0.34 04 Stylissa sp. 0.69 12.99 7.54 3.38

Example 2. Preparation of bone graft material

A bone scaffold was prepared by mixing the silica bone fragments prepared in Example 1 with collagen. For comparison, instead of spongy bone fragments, a bone scaffold was prepared using a matrix in which beta-tricalcium phosphate (bTCP) and collagen were mixed. The components and mixing ratios of each matrix for preparing the bone scaffold are shown in Table 2 below.

Material Matrix A
(bTCP) matrix B
(Sponge 01) matrix C
(Sponge 03) Spicule - 50mg 80mg β-TCP 50mg - - Collagen 50mg 50mg 20mg Total 100mg

More specifically, first, purified and sintered spongy bone fragments, collagen, and 0.2 M acetic acid (Acetric aicd) were mixed and shaken at high speed. The mixture was mixed with beta-tricalcium phosphate, put in a mold (5 mm x 2 mm), and dried naturally for 24 hours. Matrix A put beta TCP in a mold and air-dried for 24 hours.

The SEM image of the prepared bone graft material is shown in FIG. 2 . (Figures 2A-2C).

Example 3. Confirmation of adhesion and differentiation of osteocytes to bone graft material

The bone graft material prepared in Example 2 was immersed in a culture medium for one day, transferred to a new 96-well plate, and 1 × 10 ⁵ cells of preosteoblast MC3T3 E1 cells were inoculated into each well. After culturing in the culture medium for 3 days, the differentiation medium was replaced on the 4th day to induce bone differentiation for 4 days. The culture medium is an alpha-MEM medium containing 10% Fetal bovine serum (FBS) and 1% antibiotics, and the differentiation medium is an alpha-MEM medium additionally containing 10 mM beta-glycerophosphate and 50 M ascorbic acid in the culture medium. . After 7 days of culture, cell proliferation was confirmed by MTS analysis, and alkaline phosphatase (ALP) activity, a marker of bone differentiation, was measured. After one week of culture, the bone graft material made of Matrix C showed the highest cell viability and ALP activity (FIG. 3).

Example 4. Spongy 04 bone fragments and beta-bone differentiation factor expression according to the ratio of tricalcium phosphate

The purpose of this study was to determine the degree of promotion of bone differentiation of bone graft materials according to the mixing ratio of cancellous bone fragments and bTCP. Specific components for preparing the bone graft material and their mixing ratios are shown in Table 3 below.

Material S4:T4 S3:T5 S2:T6 S1:T7 S0:T8 Spicule 40 mg 30 mg 20 mg 10 mg - β-TCP 40 mg 50 mg 60 mg 70 mg 80 mg Collagen 20mg Total 100mg

First, purified and sintered spongy bone fragments, collagen, and 0.2 M acetic acid (Acetric aicd) were mixed and shaken at high speed. Then, the substrate mixed with bTCP in the mixture was placed in a mold (5 mm x 2 mm) and dried naturally for 24 hours to prepare a bone graft material. The prepared bone graft material was immersed in culture medium for one day, transferred to a new 96-well plate, and 1 × 10 ⁵ preosteoblast MC3T3 E1 cells were inoculated into each well. After culturing in the culture medium for 3 days, the differentiation medium was replaced on the 4th day to induce bone differentiation for 4 days. The culture medium is an alpha-MEM medium containing 10% Fetal bovine serum (FBS) and 1% antibiotics, and the differentiation medium is an alpha-MEM medium additionally containing 10 mM beta-glycerophosphate and 50 M ascorbic acid in the culture medium. .

After culturing for 7 days, the expression level of bone differentiation markers in each sample was confirmed by performing RT-qPCR. RNA extraction was performed using a ReliaPrep RNA Cell Miniprep system (Promega), and cDNA synthesis was performed using ReverTra Ace RT Master Mix (Toyobo, Japan) according to the manufacturer's instructions. qPCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (ThermoFisher Scientific Korea, Seoul) in the StepOnePlus real-time PCR system (Applied Biosystems).

Bone differentiation markers confirmed to check the degree of promoting osteodifferentiation were alkaline phosphatase (ALP), Type I collagenase (Col1), bone` sialoprotein (BSP), and osteocalcin (OCN), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was It was used for normalization of marker gene expression. The primer sequences used for qPCR are shown in Table 4 below, and the expression level of the osteodifferentiation marker gene in each sample is expressed as an average multiple of the expression level of cells on the bone scaffold that does not contain cancellous bone fragments on the 7th day. .

Name primer 5’ to 3’ ALP Forward ACCGCTGCCCGAATCC Reverse TCTCCTCGCCCGTGTTGT BSP Forward CCAAGAAGGCTGGAGATGCA Reverse TCCTCGTCGCTTTCCTTCAC COL1 Forward CTTCACCTACAGCACCCTTGTG Reverse TGACTGTCTTGCCCCAAGTTC OCN Forward GTGAGCTTAACCCTGCTTGTGA Reverse TGCGTTTGTAGGCGGTCTTC GAPDH Forward CCTGGCCAAGGTCATCCATG Reverse GCAGGAGACAACCTGGTCCT

When Sponge 04 and β-TCP were mixed in a ratio of 1:7, the expression of osteodifferentiation factors was increased more than twice that of β-TCP alone. When the ratio of cancellous bone fragments to β-TCP was 1:7 to 3:5, it was confirmed that the expression of osteodifferentiation factor was increased overall compared to TCP alone.

From the above results, it was found that the bone graft material prepared with the matrix containing the spongy bone fragments exhibited more active attachment and differentiation of bone cells than the bone graft material containing only β-TCP, and that the content of the cancellous bone fragments contained in the bone graft material is important for bone differentiation. Could know.

As the specific parts of the present invention have been described in detail above, for those of ordinary skill in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (10)

A bone graft material composition comprising cancellous bone fragments as an active ingredient. According to claim 1,
The composition is characterized in that it further comprises a calcium phosphate compound, bone graft composition. According to claim 1,
The calcium phosphate compound is hydroxyapatite, tricalcium phosphate (TCP), monocalcium phosphate, tetracalcium phosphate, dicalcium phosphate or a combination thereof, bone graft composition. 4. The method of claim 3,
The tricalcium phosphate is β-tricalcium phosphate (β-TCP), the bone graft composition. According to claim 1,
The composition is characterized in that it further comprises collagen, a bone graft composition. According to claim 1,
The sponge is at least one selected from the group consisting of Agelas sp., Ircinia sp., and Stylissa sp., Bone graft material composition. 3. The method of claim 2,
The bone graft material composition, characterized in that the calcium phosphate compound is included in an amount of 1.3 to 7 parts by weight based on 1 part by weight of the spongy bone fragments. According to claim 1,
The composition further comprises a calcium phosphate compound and collagen,
The composition is a bone graft material composition, characterized in that it contains 10% by weight of cancellous bone fragments, 70% by weight of a calcium phosphate compound, and 20% by weight of collagen. removing organic matter and impurities by immersing the sponges in methanol and dichloromethane solution;
heating the sponge to 600 to 800° C. for 5 to 10 hours to obtain purified spongy bone fragments;
washing the obtained spongy bone fragments with distilled water and freeze-drying;
passing the dried spongy bone fragments through a mesh network 1 to 3 times to control the size of the bone fragments;
mixing the spongy bone fragments with collagen and 0.2M acetic acid to prepare a mixture 1;
preparing a mixture 2 by mixing tricalcium phosphate (TCP) with the mixture 1; and
A method of manufacturing a graft material for bone regeneration and support, including the step of molding by pouring the mixture 2 into a mold.
10. The method of claim 9,
The tricalcium phosphate is characterized in that the mixing of 7 parts by weight based on 1 part by weight of the spongy bone fragments, the manufacturing method.

Images