KR20210102592A - Composition for preventing skin aging and improving skin wrinkle comprising extract of Cynoglosus semilaevis skin as effective component - Google Patents

Abstract

The present invention relates to a composition for preventing skin aging and mitigating skin wrinkles containing an extract of Cynoglosus semilaevis skin as an active ingredient. More specifically, the present invention relates to a cosmetic composition, a composition for external application for skin, a health functional food composition, and a food additive, which includes an extract of Cynoglosus semilaevis skin as an active ingredient to provide an effect of preventing or mitigating skin wrinkles. The extract of Cynoglosus semilaevis skin mitigates wrinkles through elastase inhibitory activity and matrix metalloproteinases (MMPs) generation inhibitory activity and increase skin elasticity so that an excellent effect of preventing or mitigating wrinkles is provided, thereby replacing existing anti-wrinkle agents. In addition, the extract of Cynoglosus semilaevis skin can be usefully used in products, such as quasi-drugs, health functional foods, and the like as well as cosmetics for wrinkle mitigation and anti-aging.

Description

Composition for preventing skin aging and improving skin wrinkle comprising extract of Cynoglosus semilaevis skin as effective component

The present invention relates to a composition for preventing skin aging and improving wrinkle, comprising an extract of B. Specifically, it relates to a cosmetic composition, a composition for external application to the skin, a health functional food composition and a food composition having an effect of preventing or improving skin aging and wrinkles by including the extract of the sagebrush as an active ingredient.

As the body's primary barrier, the skin protects internal organs from external environmental stimuli such as temperature and humidity changes, UV rays, and pollutants, and plays an important role in maintaining body homeostasis, such as thermoregulation. The skin, like other organs of the human body, ages as it ages, and changes such as loss of skin elasticity, keratinization, wrinkle formation, and skin atrophy are accompanied.

There are two main causes of skin aging, which can be classified into internal factors such as cellular genetic mutations and tissue changes, and external factors such as UV rays and humidity. In particular, the aging phenomenon caused by ultraviolet rays is called photoaging. Proteolytic enzymes (MMP-1, MMP-3, MMP -9, etc.) promotes the synthesis (Fisher GJ etal., Nature, Vol. 379, 335-339), and reduces the elasticity of the dermal layer, thereby causing skin wrinkles.

In particular, elastase present in neutrophil granulocytes in the human body is an enzyme that decomposes elastin, a matrix protein important for maintaining skin elasticity in the dermis, and also has collagen-decomposing activity. When elastase is properly expressed and activated, it is involved in wound healing, etc., but when overexpressed or activated, elastin in the skin is decomposed and the skin's elasticity is lost. Therefore, elastase inhibitors exhibit the action of improving skin wrinkles, and ursolic acid and the like are used as elastase inhibitors.

In addition, matrix metalloproteinase (MMP) is a metalloproteinase having zinc in the active center, and is secreted in the form of a latent proenzyme (zymogen) in vivo. Structural modification occurs to have enzymatic activity, and the amino terminal site is cleaved and activated. The vast majority of cells, including cells and fibroblasts, secrete MMPs. Since MMP activity in the skin is increased even when irradiated with UV light once, and collagen in the skin is significantly degraded, MMP has a decisive effect on the breakdown of collagen in the dermal layer and plays a very important role in photoaging.

Recently, as consumers' interest in skin has increased, various studies have been conducted on physiologically active substances derived from natural products that have anti-aging and anti-wrinkle effects such as elastase inhibitory activity and MMP expression inhibitory activity, but do not show toxicity to the skin. is losing

Under this background, the present inventors found that the extract of B. basil extract exhibits high elastase inhibitory activity and MMPs (MMP-1, MMP-2 and MMP-3) production inhibitory activity, etc. The present invention was completed by finding the fact that

KR 1339423 B

An object to be solved by the present invention is to provide a cosmetic composition for preventing photoaging and improving skin wrinkles, which includes an extract from the bark of the stalk of the present invention as an active ingredient.

Another object of the present invention is to provide a composition for external application for skin for preventing photoaging and improving skin wrinkles, comprising the above-described extract from the bark of the basilica as an active ingredient.

Another object of the present invention is to provide a health functional food composition or food additive for photoaging prevention and skin wrinkle improvement, comprising the above-mentioned gourd bark extract as an active ingredient.

In order to achieve the above object, the present invention provides a cosmetic composition for preventing photoaging and improving skin wrinkles, comprising the extract of Cynoglosus semilaevis bark as an active ingredient.

According to an embodiment of the present invention, the extract may be extracted using one or more solvents selected from water, lower alcohols having 1 to 4 carbon atoms, and mixtures thereof.

According to an embodiment of the present invention, the extract may be extracted by adding a lower alcohol having 1 to 4 carbon atoms in an amount of 2 to 20 times the weight of the thorn bark powder.

According to an embodiment of the present invention, the extract of the squash bark may be included in an amount of 0.001 to 30% by weight based on the total weight of the cosmetic composition.

According to an embodiment of the present invention, the improvement of skin wrinkles is achieved by promoting collagen production, inhibiting elastase activity, inhibiting MMP (matrix metalloproteinase) expression, or promoting TIMP-1 (tissue inhibitor of metalloproteinase-1) expression. can

According to an embodiment of the present invention, the cosmetic composition may have a formulation selected from lotion, emulsion, cream, essence, cosmetic ointment, spray, gel, pack, sunscreen, makeup base, foundation, powder, and makeup remover. .

In addition, the present invention provides a composition for external application for skin for preventing photoaging and improving skin wrinkles, comprising the extract of Cynoglosus semilaevis bark as an active ingredient.

According to an embodiment of the present invention, the external preparation may be in the form of an ointment, patch, gel, cream or spray.

In addition, the present invention provides a health functional food composition for preventing photoaging and improving skin wrinkles, which includes the bark extract of Cynoglosus semilaevis as an active ingredient.

In addition, the present invention provides a food additive for preventing photoaging and improving skin wrinkles, comprising the extract of Cynoglosus semilaevis bark as an active ingredient.

The extract according to the present invention improves wrinkles through elastase inhibitory activity and MMPs production inhibitory activity and improves skin elasticity, thereby preventing or improving wrinkles, and thus can replace existing anti-wrinkle agents. The bark extract may be usefully used in products such as quasi-drugs and health functional foods as well as cosmetics for wrinkle improvement and anti-aging.

1 is a result showing the cytotoxic activity of Bakbae bark extract according to an embodiment of the present invention.
Figure 2 is a result showing the antioxidant activity of the extract of the bark extract according to an embodiment of the present invention.
3 is a graph showing the elastase inhibitory activity of the extract by showing the elastase content after treating the LPS and hydrogen peroxide-treated cells according to an embodiment of the present invention.
4 is a RT showing the efficacy of inhibiting the expression of MMPs (MMP-1, MMP-2, MMP-3 and MMP-9) increased by UV-B treatment of Bak bae bark extract according to an embodiment of the present invention; -PCR electrophoresis picture.
5 is an RT-PCR electrophoresis photograph showing the efficacy of promoting the expression of TIMP-1, which is reduced by UV-B treatment of a B. basil extract according to an embodiment of the present invention.

Hereinafter, the present invention will be described in detail.

According to one embodiment of the present invention, the present invention provides a cosmetic composition for preventing skin aging and improving skin wrinkles, comprising an extract of Cynoglosus semilaevis bark as an active ingredient.

The bag is a white-fleshed fish belonging to the family Chamseodae family of the order Flounder fish, and it is popular in the west coast area including Gunsan.

The extract may be extracted using one or more solvents selected from water, lower alcohols having 1 to 4 carbon atoms, and mixtures thereof.

In one aspect of the present specification, the step of washing and drying the gourd skin extract; Solvent extraction after pulverizing the dry gourd skins; and concentrating and filtering the extracted Bak baek bark extract.

In addition, the extract is preferably extracted at room temperature after adding an extraction solvent, preferably 40% to 60% of an aqueous solution of ethanol in an amount of 2 to 20 times by weight, preferably 5 to 15 times by weight of the dry weight of the thin stalk skin, It is not limited. In addition, the extraction may be performed for 6 to 48 hours, preferably 6 to 24 hours, more preferably 6 to 18 hours, more preferably 10 to 15 hours. In addition, the extraction may be performed using any extraction method such as cold extraction, reflux cooling extraction, or ultrasonic extraction. On the other hand, in the extraction of the present invention, since collagen is a protein easily denatured by heat, it is preferable not to use an extraction method by heat treatment.

In the present specification, the extract of B. basilica may include the crude extract of the basil, as described above, and may also be included as a soluble fraction of an organic solvent obtained by further extracting the crude extract with an organic solvent having low polarity. The organic solvent may be hexane, methylene chloride, ethyl acetate, n-butanol, or the like, but is not limited thereto. The extract extracted by the above method or a soluble fraction of the extract may be used as it is, but it may be used in the form of an extract by concentration after filtration, or in the form of a freeze-dried product after concentration and freeze-drying.

In one embodiment of the present invention, the skin aging and skin wrinkles may be caused by photoaging or natural aging, more preferably by photoaging, and more preferably by photoaging by UV exposure, but is not limited thereto. The skin aging and wrinkles are preferably based on the activity of the MMP enzyme, but is not limited thereto. In general, skin aging is accelerated due to increased expression and activity of MMP, which is an enzyme that decomposes collagen, which is a major component of skin, after UV exposure. In a preferred embodiment of the present invention, it has been found that the extract of B. basil extract inhibits the activity of MMP, a collagen degrading enzyme increased by UV stimulation, and promotes the secretion of collagen whose secretion is reduced by UV, thereby preventing photoaging. confirmed that.

In addition, the bark extract can exhibit the effect of improving wrinkles and enhancing skin elasticity as well as preventing skin aging such as photoaging through elastase inhibitory activity, MMP expression inhibitory activity or TIMP-1 expression promoting activity. .

In a preferred embodiment of the present invention, it was confirmed that the inhibitory effect of the MMP enzyme, which is a photoaging-related biomarker overexpressed by cytotoxicity and UV stimulation, and the promotion of the expression of TIMP-1, an inhibitor of the MMP enzyme, of the B. It was specifically confirmed that the extract of the Bahlia bark extract of the present invention had an excellent anti-photoaging effect.

On the other hand, the inventors of the present invention tested the skin accumulative stimulation of the extract from the sagebrush through a specific experiment and confirmed that it is a harmless substance to the human body. In addition, the extract of the present invention has almost no toxicity and side effects, so it can be safely used even when used for a long period of time.

In the present invention, the meaning of "contained as an active ingredient" is an elastase inhibitory activity, MMP expression inhibitory activity, or TIMP-1 expression promoting activity related to wrinkle-improving effect-related wrinkle-improving effect on the skin as a cosmetic composition. It means to contain an effective amount of a degree that can be shown.

In an exemplary embodiment, the B. serrata bark extract may be present in the composition in any amount desired to provide an effective photoaging prevention and skin wrinkle improvement level. According to one embodiment, the extract of the brinjal bark extract may be 0.0001 to 99.9% by weight, preferably 0.001 to 30% by weight, more preferably 0.005 to 10% by weight, more preferably 0.005 to 5% by weight, more preferably may be included in an amount of 0.005 to 1% by weight. According to another embodiment, the B. serrata bark extract of the present invention may be 1 to 500 mg/mL, preferably 1 to 300 mg/mL, more preferably 1 to 200 mg/mL, more preferably 5 to 200 mg/mL. mg/mL, more preferably 5 to 100 mg/mL.

When the content of the Bak baek bark extract is less than the above range, it is difficult to expect the effect of the Bak baek bark extract. there is a problem that That is, by being included in the composition of the present invention in the above range, it is possible to realize an excellent effect of preventing or improving photoaging and skin wrinkles, having formulation and product stability, and exhibiting excellent effects with an optimal content in terms of economic feasibility. . In particular, the extract of Bak bae bark extract can exert a significant anti-photoaging effect even in a trace amount of 1 to 30 mg/mL, preferably 5 to 10 mg/mL.

According to a preferred aspect of the present invention, the formulation of the cosmetic composition for preventing photoaging and improving skin wrinkles is a lotion, emulsion, cream, essence, cosmetic ointment, spray, gel, pack, sunscreen, makeup base, foundation, powder and makeup remover. It may be selected from the group consisting of.

According to a preferred embodiment of the present invention, the cosmetic composition for preventing photoaging and improving skin wrinkles may additionally include a dermatologically acceptable excipient in addition to the extract of the bald eagle.

The excipient is not limited thereto, but may include, for example, an emollient, a skin penetration enhancer, a colorant, a fragrance, an emulsifier, a thickening agent, and a solvent. In addition, fragrances, dyes, bactericides, antioxidants, preservatives and moisturizing agents may be additionally included, and thickeners, inorganic salts, synthetic polymers, etc. may be included for the purpose of improving physical properties.

According to a preferred embodiment of the present invention, the moisturizing agent is glycerin, butylene glycol, propylene glycol, sorbitol, hexylene glycol, dipropylene glycol, diglycerin, 1,2-hexanediol, panthenol, betaine, squalane, petrolatum, fluid It may be at least one selected from paraffin and hydrolyzed wheat gluten, but is not limited thereto.

The cosmetic composition of the present invention may be used alone or in overlapping application, or may be used in overlapping application with other cosmetic compositions other than the present invention. In addition, the cosmetic composition according to the present invention can be used according to a conventional method of use, and the number of times of use can be varied according to the skin condition or taste of the user.

In addition, the present invention provides a composition for external application for skin wrinkle improvement, comprising the bark extract of Cynoglosus semilaevis as an active ingredient. In the present invention, the term "Baklava bark extract" is the same as described above.

According to an embodiment of the present invention, the external preparation may be in the form of an ointment, patch, gel, cream or spray.

In one aspect of the present invention, the composition for external application for skin may be used for at least one selected from anti-aging, skin wrinkle improvement, and skin elasticity improvement. In one aspect of the present invention, the composition for external application for skin can inhibit photoaging, more specifically, skin aging caused by UV.

When the composition for external application for skin containing the extract of the present invention as an active ingredient is used as an external preparation for skin, additionally, a fatty substance, an organic solvent, a solubilizer, a thickening agent and a gelling agent, an emollient, an antioxidant, a suspending agent, a stabilizer, Foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic or hydrophilic It may contain adjuvants commonly used in the field of dermatology, such as oily active agents, lipid vesicles or any other ingredients commonly used in external preparations for skin. In addition, the ingredients may be introduced in an amount generally used in the field of dermatology.

In addition, the present invention provides a health functional food composition for skin wrinkle improvement containing the extract of Bak bae bark as an active ingredient. In the present invention, the term "Baklava bark extract" is the same as described above.

The health functional food composition may be provided in the form of powder, granule, tablet, capsule, syrup or beverage, and the health functional food composition is used together with other foods or food additives in addition to the active ingredient, and is suitable according to a conventional method. can be used The mixed amount of the active ingredient may be suitably determined according to the purpose of its use, for example, prevention, improvement or therapeutic treatment. According to one embodiment, the B. serrata bark extract may be included in an amount of 0.001 to 30% by weight, preferably 0.01 to 10% by weight, and more preferably 0.01 to 5% by weight.

The effective dose of the active ingredient contained in the health food composition is the type and content of the active ingredient and other ingredients contained in the composition, the type of formulation, the age, weight, general health status, sex and diet, administration time, administration It may be adjusted according to various factors, including route, duration of intake, and concurrently used drugs, but is not limited thereto. In addition, in the case of long-term ingestion for the purpose of preventing, improving or therapeutically controlling skin wrinkles, it may be less than the above range, and since the active ingredient has no problem in terms of safety, it is certain that it can be used in an amount above the above range do.

In addition, the present invention provides a food additive for skin wrinkle improvement containing the extract of the bark of the spearmint as an active ingredient. In the present invention, the term "Baklava bark extract" is the same as described above.

The food additives may be added to meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, etc. can

In addition, the present invention provides a pharmaceutical composition for preventing or treating skin wrinkle containing the extract of Bak baek bark as an active ingredient. In the present invention, the term "Baklava bark extract" is the same as described above.

Through the pharmaceutical composition of the present invention, it is possible to provide the extract of Bak baek bark at a pharmaceutically effective concentration to achieve the object and desired effect of the present invention. /kg, preferably 0.01 to 10 mg/kg, more preferably 0.1 to 5 mg/kg of dosage (or application amount) may be divided once or several times a day (administration or application).

The pharmaceutical composition of the present invention may contain the above-mentioned B. basil extract of the present invention at an effective concentration to achieve the object and desired effect of the present invention. As an example, the B. serrata bark extract of the present invention may be included in an amount of 0.001 to 30% by weight, preferably 0.01 to 10% by weight, more preferably 0.01 to 5% by weight based on the total weight of the pharmaceutical composition, but is not limited thereto. .

The pharmaceutical composition includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers are those commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginic acid, gelatin, calcium silicate, microcrystalline cellulose, poly vinylpyrrolidone, cellulose, purified water, syrup, methyl cellulose, methylhydroxybenzoic acid, propylhydroxybenzoic acid, talc, magnesium stearate, mineral oil, and the like. The pharmaceutical composition of the present invention may further include commonly used additives such as lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, and preservatives in addition to the above components.

The composition according to the present invention may be prepared in conventional pharmaceutical preparations, for example, tablets, granules, capsules, powders, liquid preparations, or syrups; Alternatively, it may be formulated as an ointment, warning agent, pasta agent, cataplasmase, cream, or emulsion, etc.

In addition, the composition according to the present invention may further comprise a pharmaceutically acceptable carrier. Carriers that can be used in the composition of the present invention are conventional in the pharmaceutical field, for example, in the case of formulations for oral administration, there are binders, lubricants, disintegrants, excipients, solubilizers, stabilizers, etc., and for topical administration In the case of formulations, there are bases, excipients, lubricants, preservatives, and the like.

A suitable dosage of the pharmaceutical composition of the present invention may be prescribed variously depending on factors such as formulation method, administration mode, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity of the patient. can

Hereinafter, the present invention will be described in detail with reference to examples, but the present invention is not limited by the following examples.

<Example>

<Materials and Methods>

UV-B in vitro model experiment

By adjusting the UV-B irradiation intensity and time conditions for human fibroblast-derived detroit 551 cells, after establishing conditions that give stimulation by UV-B but do not induce extreme toxicity, An in vitro model was constructed to confirm the effect of preventing photoaging and improving skin wrinkles.

cell culture

RAW264.7 (KCLB 40071), WM-266-4 (KCLB 21616), CCD-986sk (KCLB 21947), and Detroit551 (KCLB 10110) cells were purchased from the Korean Cell Line Bank (KCLB) and Penicillin Streptomycin 100 Using DMEM medium containing unit/mL and 10% Fetal Bovine Serum, subculture was performed once every 3 days in an incubator at _{37°C and 5% CO 2 .}

EXAMPLE: Preparation of B. sagebrush extract

After washing the gourd skin, it was dried naturally, and then finely pulverized to prepare a gourd skin powder. A 10-fold weight of 50% ethanol aqueous solution was added to the sorrel husk powder, extracted at room temperature for 12 hours, and then filtered with Whatman filter paper to prepare a basil extract.

The extract of Bak bae bark extract was powdered using a rotary vacuum concentrator, diluted in DMSO to a concentration of 50 mg/mL, and used in the experiment while stored at -20 °C.

Comparative Example 1: Preparation of hot water extract from the bark

It was carried out in the same manner as in Example, except that water was added instead of the aqueous ethanol solution, and then extracted at 100° C. to prepare a hot water extract from the bark of the spearmint.

Comparative Example 2: Preparation of sea bream skin extract

It was carried out in the same manner as in Example, except that the sea bream (red sea bream) skin was used instead of the thin sea bream skin to prepare a sea bream skin extract.

Comparative Example 3: Preparation of halibut skin extract

It was carried out in the same manner as in Example, but a halibut skin extract was prepared using halibut skins instead of the thin halibut skins.

Comparative Example 4: Preparation of Zopi rockfish (Rockfish) bark extract

It was carried out in the same manner as in the Example, except that the cockle rock extract was prepared by using the cockle cockle shell instead of the taproot shell.

< Experimental example>

Materials and Methods

1) Cell culture

Normal human dermal fibroblasts (neonatal foreskin) were purchased from ATCC (Manassas, VA, USA) and used. The purchased cells were cultured in a fibroblast growth medium (Promo Cell, Heidelberg) at 37° C., 5% CO _{2 in an} incubator and used for the experiment.

2) RNA isolation and RT-PCR (reverse transcription-polymerase chain reaction)

334 μl of trizol solution per 1 × 10 ⁷ human skin fibroblast cells was added and ground, followed by centrifugation at 4° C. and 12,000 × g for 10 minutes. After transferring the supernatant to a new tube, 67 μl of chloroform was added and vortexed. Again, the supernatant was transferred to a new tube, and isopropanol was added so that the ratio of the supernatant to isopropanol was 1:1. After shaking vigorously 10 times, leave at room temperature for 15 minutes, centrifuge at 12,000 × g, 4°C for 10 minutes, remove the supernatant, and add 1 ml of 70% ethanol to the remaining precipitate at 7,500 × g, 4°C. Centrifugation was carried out for 5 minutes. After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using nuclease-free water. Measure the concentration of the RNA sample extracted at 260 nm and 280 nm wavelength using a UV/VIS spectrophotometer (Beckman coulter, DU730), and conduct agarose gel electrophoresis to check that there is no abnormality in the RNA sample (integrity). Confirmed.

cDNA was synthesized by performing reverse transcription on the RNA sample extracted from human skin fibroblasts using oligo dT primer and Superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA).

In each tube, 12.6 μL of D.W, 2 μl of 10×PCR buffer, 2 μL of dNTP, and 0.4 μL of Taq polymerase were added, followed by amplification by adding 1 μL of primer and cDNA each. And the expression of MMP-1, MMP-2, MMP-3, MMP-9 was evaluated by the electrophoresis method. The primer sequences were prepared as shown in Table 1 below, and after adding 10× loading buffer to the amplified product, 5 uL of each was dispensed on a 1% agarose gel and loaded at 75 V for 35 minutes. After loading, the band was quantified using FluorChem.

Primer sequence used for RT-PCR gene Size (bp) Primer sequence (5'→3') Annealing temperature (℃) MMP-1 234 F: ATGCTGAAACCCTGAAGGTG 60.0 R: CTGCTTGACCCTCAGAGACC MMP-2 411 F: ATGACAGCTGCACCACTGAG 60.0 R: AGCTTGTCTGAGAGTGGCTT MMP-3 214 F: GCAGTTTGCTCAGCCTATCC 60.0 R: GAGTGTCGGAGTCCAGCTTC MMP-9 236 F: GAGACCGGTGAGCTGGATAG 60.0 R: TACACGCGAGTGAAGGTGAG Actin 234 F: GGACTTCGAGCAAGAGATGG 60.0 R: AGCACTGTGTTGGCGTACAG

3) Statistical processing

All statistical analyzes were performed using SPSS version 18.0 (IBM, Chicago, IL, USA). The difference (p <0.05) between the experimental groups was determined using one-way ANOVA using Duncan's post-hoc test. Each experimental data was expressed as mean ± standard deviation (SD).

Experimental Example 1: Cytotoxicity evaluation using MTT assay

In order to confirm the cell viability of the RAW 264.7 cell line, an MTT reduction assay was performed. The cell line was aliquoted in a 96-well plate at ^{a concentration of 1 X 10 5} cells/well and cultured at 37° C., 5% CO _{2 in an} incubator for 24 hours, and then 10, 50, 100, 200 , 400 and 600 mg/mL concentrations, and incubated for 24 hours. Then, 10 μL of MTT (5 μg / mL) solution dissolved in PBS buffer was added to each well and reacted for 1 hour again. After confirming the formation of Formazan, the medium was completely removed, and 100 μL of DMSO was added to dissolve the formazan formed at the bottom of the well, and the absorbance was measured at 540 nm using a microplate reader (Thermo Fisher Scientific, Rockford, IL, USA). It was measured and shown in FIG. 1 , and specifically, it was expressed as a relative cell viability when 100% of the control cells cultured without treatment with the B. hull extract.

Referring to FIG. 1 , it can be confirmed that cytotoxicity is not observed in all cells treated with the B. basil extract according to an embodiment of the present invention.

Experimental Example 2: Analysis of amino acid composition

In order to analyze the amino acid composition contained in the extract according to the present invention, it was hydrolyzed using 6N-HCl, derivatized with PITC (Phenyl isothiocyanate), and used as a sample for analysis. The amino acid composition (constituting amino acids) of the sample was analyzed using HPLC (HPLC PICO-TAG system), and the results are shown in Table 2 below.

For reference, collagen, unlike other proteins, contains hydroxylated amino acids hydroxyproline and hydroxylysine. and hydroxyproline are frequently located, and the presence or absence of collagen can be confirmed by the content of glycine, proline, and hydroxyproline.

type of amino acid Concentration (μg/mL) Aspartic acid (Asp) 1217 Threonine (Thr) 447 Serine (Ser) 807 Glutamic acid (Glu) 1980 Glycine (Gly) 3905 Cysteine (Cys) 4537 Alanine (Als) 30 Valine (Val) 582 Methionine (Met) 417 Isoleucine (Ile) 225 Leucine (Leu) 621 Tyrosine (Tyr) 177 Phenylalanine (Phe) 398 Lysine (Lys) 709 Histidine (His) 235 Arginine (Arg) 1562 Proline (Pro) 1432 Total 19,281

Referring to Table 2, the sample according to the embodiment of the present invention contains 3,905 μg/mL of glycine, which can confirm the characteristics of the repetitive Gly-XY amino acid sequence in the region of the triple helix of collagen, and about 20 of the total amino acids. %, and proline accounts for about 7.4% as 1,432 μg/mL.

In addition, the free amino acid composition contained in the sample was analyzed and shown in Table 3 below.

free amino acids Concentration (μg/mL) o-Phosphoserine 4 Taurine 33 o-Phosphoethanolamine One Urea 17 Sarcosine 0 L-2-Aminoadipic Acid 2 L-Citruline 8 DL-2-Aminobutyric 0 LCystathionine 10 β-Alanine 8 DL-3- Aminoisobutyric Acid 7 4-Aminobutyric acid One 2-Aminoethanol 133 DL-plusallo-δ-Hydroxylysine 0 L-Ornithine 3 L-1-Methylhistidine 0 L-3-Methylhistidine 0 L-Anserine 0 L-Carnosine 0 hydroxyl-L-proline 1,554 Total 1,778

Referring to Table 3, it can be seen that the hydroxyl-L-proline content of the sample according to the embodiment of the present invention is remarkably high. Specifically, the hydroxyl-L-proline is 1,554 μg/mL, accounting for more than about 85% of the total free amino acids.

Experimental Example 3: Antioxidant activity (DPPH radical scavenging ability)

DPPH (2,2-diphenyl-1-picrylhydrazyl) assay is a method for measuring antioxidants using the property of DPPH to accept hydrogen atoms using unstable nitrogen atoms in hydra lipids by reacting with antioxidants. The B. basil extract according to the example was diluted in DMSO and adjusted to 10, 50, 100, 200, 400 mg/mL concentrations. Then, 80 μL of 0.4 mM DPPH (Sigma-Aldrich Co, USA.) solution was added to 20 μL of each concentration sample in 95% ethanol solution, and reacted at room temperature for 10 minutes with a microplate reader (Thermo Fisher Scientific, Rockford, IL). , USA) was used to measure the absorbance at 492 nm, and after calculation as shown in the following formula, the results are shown in FIG. 2 . As a positive control, ascorbic acid, a representative antioxidant, was used.

Electron donating capacity (free radical scavenging capacity) (%) = {1- (A-B) / C} × 100

A: sample absorbance 520 nm

B: color control absorbance 520 nm (without DPPH treatment)

C: negative control absorbance 520 nm (without sample treatment)

Referring to FIG. 2 , it can be confirmed that the B. basil extract according to the present invention exhibits antioxidant activity similar to that of vitamin (ascorbic acid), which is a positive control, at a concentration of 10 gm/mL or more.

Experimental Example 4: Confirmation of skin wrinkle improvement effect - Measurement of elastase inhibitory activity

Elastase Concentration Measurement Using Human PMN Elastase Kit

Detroit 551 cells were inoculated in a 24-well plate at ^{a concentration of 1.0×10 5} cells/well, and then _{cultured at 37° C., 5 CO 2} environment for 48 hours. After that, the medium was removed, washed once with phosphate buffered saline (PBS), and then Detroit 551 cells were treated with LPS (1 μg/mL) and hydrogen peroxide. 2 hours later, in a medium without FBS, dilute the extracts of Bak bae bark according to the Examples and Comparative Examples of the present invention with DMSO to give the cells a final concentration of 10, 50, 100, and 200 mg/mL, and then for 18 hours. After additional incubation, the cell culture supernatant was used for enzyme-linked immunosorbent assay (ELISA). The elastase inhibitory ability of the samples according to Examples and Comparative Examples of the present invention was performed according to the ELISA manufacturer's instructions by purchasing a human PMN ELISA kit from Abcam.

First, 400 μL of 1 x wash buffer was added to a 96 well plate coated with antibody, washed for 10 to 15 seconds, and then 1 x wash buffer was carefully removed so that the antibody on the bottom was not scratched. This process was repeated 4 times. Then, the cell culture supernatant diluted 1:100 using the sample diluent reagent was treated in a 96-well plate coated with an antibody, the cover of the plate was closed, and incubated at room temperature (18°C to 25°C) for 1 hour. After incubation for 1 hour, the cell culture supernatant of the 96-well plate was removed, and the washing operation using 1 x wash buffer was repeated 4 times as above. After washing the 96 well plate, 150 μL of 1 x HRP Conjugated Antibody was put into the well and incubated for 1 hour at room temperature (18℃ to 25℃). And once again, the washing operation using 1 x wash buffer was repeated 4 times. After washing the 96 well plate, 200 μL of TMB Substrate Solution was added to the well, and the color change was confirmed by reacting at room temperature (18℃ to 25℃) for 20 minutes. After 20 minutes, the stop solution was added and the reaction was terminated, the absorbance was measured at 450 nm, and the elastase concentration according to the absorbance was quantified using a standard graph, and is shown in FIGS. 3, 3 and 4 below. In Tables 4 and 5 below, the elastase inhibition rate (%) represents the relative effect of the control group on the elastase inhibition rate as a percentage.

division LPS+H ₂ O ₂ treatment Elastase Concentration (ng/mL) Elastase inhibition rate (%) control - 0.23 - control + 1.38 0 Example - 10 mg/mL + 1.06 23.25 Example - 50 mg/mL + 0.94 31.48 Example - 100 mg/mL + 0.80 41.88 Example - 200 mg/mL + 0.77 44.31

Table 4 and Figure 3 show the elastase inhibitory activity according to the concentration of the extract of Bak bae bark extract of Examples. Referring to Table 3 and Figure 3, the elastase inhibitory activity also increased as the concentration increased, and the increase in the effect as the concentration increased was insignificant when the concentration was 100 mg/mL or more. can be checked

Table 5 below shows the comparison of elastase inhibitory activity at a concentration of 100 mg/mL of samples according to Examples and Comparative Examples of the present invention.

Classification (100 mg/mL) LPS+H ₂ O ₂ treatment Elastase Concentration (ng/mL) Elastase inhibition rate (%) control - 0.23 - control + 1.38 0 Example + 0.81 41.88 Comparative Example 1 + 1.02 26.09 Comparative Example 2 + 0.95 31.16 Comparative Example 3 + 1.03 25.36 Comparative Example 4 + 1.10 20.29

Referring to Table 5 above, the experimental group treated with the B. basil extract of Example had an elastase concentration reduced by at least 40% or more compared to the control group, and showed significantly superior elastase inhibitory activity compared to the comparative example, according to the present invention It can be seen that the elastase inhibitory activity of the Bak baek bark extract is very excellent.

Experimental Example 5: Confirmation of skin photoaging prevention effect

5-1. Inhibition of MMP gene expression in UV-B stimulated cells

MMPs are known to have more than 20 types so far, and are metalloproteinases having zinc in the active center, and are classified into collagenase, stromelysin, interstitial, gelatinase, membrane type MMP, etc. according to their structure and function. It is known that the increase in collagenase MMP-1, MMP-2, and stromelysin MMP-3 collapses the collagen of the dermal layer, thereby having a great effect on skin photoaging. Therefore, it was determined that inhibition of MMP-1, MMP-2, MMP-3 and MMP-9 activity would reduce collagen degradation, thereby suppressing photoaging such as wrinkle formation, and maintaining skin elasticity. The mRNA expression of -3 and MMP-9 was investigated.

Specifically, in order to confirm the effect of the extracts according to Examples and Comparative Examples on the MMP enzyme activity of the present invention, fibroblast skin cells ^{were subcultured in a 24-well plate at 5 × 10 5} cells/dish. After one day, the medium was removed, 1 ml of PBS was added, and 100 mJ/cm2 of UV was irradiated, and the extracts according to Examples and Comparative Examples were treated in serum-free DMEM medium at each concentration for 48 hours and cultured. Thereafter, the medium was removed and RT-PCR was performed using the cells to measure the gene expression levels of MMP-1, MMP-2, MMP-3 and MMP-9. Relative gene expression levels were analyzed using Image analysis software, and gene expression levels of MMP-1, MMP-2, MMP-3 and MMP-9 were quantified by beta-actin for quantitative comparison.

4 is a RT showing the MMPs (MMP-1, MMP-2, MMP-3 and MMP-9) expression inhibitory efficacy of the Bak bae bark extract according to an embodiment of the present invention compared to that of the sea bream shell extract of Comparative Example 2; -PCR electrophoresis picture.

Referring to FIG. 4, it can be confirmed that the B. basil extract according to an embodiment of the present invention is effective in preventing photoaging by inhibiting the expression of MMPs genes increased by UV in a concentration-dependent manner. In addition, it was specifically confirmed that the MMP expression inhibitory effect of the sea bream shell extract of the present invention was more excellent than that of the sea bream shell extract of Comparative Example 2.

Table 6 below shows the relative band density (%) of MMP (MMP-1, MMP-2, MMP-3 and MMP-9) expression inhibitory activity at a concentration of 10 mg/mL of samples according to Examples and Comparative Examples of the present invention. control) is compared.

Classification (10 mg/mL) UV-B treatment MMP-1 MMP-2 MMP-3 MMP-9 control - 100 100 100 100 control + 297.3 123.0 131.0 231.3 Example + 112.2 66.8 36.1 48.2 Comparative Example 1 + 164.3 86.6 115.2 136.8 Comparative Example 2 + 117.0 91.4 60.3 71.7 Comparative Example 3 + 155.7 80.8 92.5 101.2 Comparative Example 4 + 135.2 89.3 119.4 96.7

Referring to Table 6, it can be seen that the MMP expression inhibitory activity of the Bak bae bark extract according to an embodiment of the present invention is significantly higher than that of the extracts of Comparative Examples 1 to 4.

5-2. Effect of promoting TIMP-1 mRNA expression in UV-B stimulated cells

In order to confirm the wrinkle improvement effect of the extracts according to the Examples and Comparative Examples of the present invention, to confirm the expression promoting effect on TIMP-1 (tissue inhibitor of metalloproteinase-1), which exhibits inhibitory activity against MMP that decomposes collagen did.

Specifically, according to Experimental Example 5-1, fibroblast skin cells ^{were subcultured in a 24-well plate at 5 × 10 5} cells/dish. After one day, the medium was removed, 1 ml of PBS was added, and 100 mJ/cm 2 of UV was irradiated, and the extracts according to Examples and Comparative Examples were treated and cultured for 48 hours in serum-free DMEM medium. Thereafter, the medium was removed and RT-PCR was performed using the cells to measure the gene expression level of TIMP-1. The relative gene expression level was analyzed using Image analysis software, and the gene expression level of TIMP-1 was quantified by beta-actin for quantitative comparison.

FIG. 5 is an RT-PCR electrophoresis photograph showing the TIMP-1 expression promotion effect of the B. hull extract according to an embodiment of the present invention compared with that of the sea bream skin extract of Comparative Example 2. FIG.

Referring to FIG. 5 , it can be confirmed that the B. basil extract according to an embodiment of the present invention has an effect of preventing photoaging by promoting the expression of the TIMP-1 gene reduced by UV in a concentration-dependent manner. In addition, it was specifically confirmed that the sea bream skin extract of the present invention was more excellent in promoting TIMP-1 expression than the sea bream skin extract of Comparative Example 2.

Table 7 below shows the TIMP-1 expression promoting activity at a concentration of 5 mg/mL of the samples according to Examples and Comparative Examples of the present invention by comparison with relative band density (% control).

Classification (5 mg/mL) UV-B treatment TIMP-1 control + 100 Example + 315.9 Comparative Example 1 + 150.3 Comparative Example 2 + 174.1 Comparative Example 3 + 232.2 Comparative Example 4 + 161.5

Referring to Table 7, it can be seen that the basil extract of the example has significantly higher TIMP-1 expression promoting activity than the comparative example.

From the above results, it can be seen that the B. basil extract of the present invention can exhibit the effect of inhibiting collagen degradation by promoting the expression of TIMP-1, which inhibits the activity of MMP, and thus it can be seen that it will exhibit excellent skin aging prevention and wrinkle improvement effects.

<Result>

As a result of measuring the wrinkle-improving activity of the B. basil extract of the present invention, the wrinkle-improving activity of the B. basil extract of the present invention remarkably inhibited the mRNA expression of matrix metalloproteinase (MMP), promoted the mRNA expression of TIMP-1, and excellent elastomer. showed inhibitory activity. In addition, it was specifically confirmed that the extract of the bark of the present invention is remarkably superior to that of other extracts of fish.

In addition, even in the same extract, there is a difference in the effect depending on the extraction method, and it is seen that the ethanol extract of the gourd bark of the present invention exhibits a significantly superior effect compared to the hot water extract of the gourd bark, in the case of the hot water extract of the gourd bark, due to thermal denaturation It is inferred that a large amount of collagen is destroyed.

The experimental results of this study require additional research, but it is judged to be usable as a candidate material for development as an alternative to the existing anti-wrinkle agent.

<Production Example>

Examples of the preparation for the extract of the present invention are exemplified below.

<Production Example 1> Preparation of cosmetics

<1-1> Softening lotion (skin)

In order to prepare a softening lotion for photoaging prevention and skin wrinkle improvement, including the extract of the present invention, it can be prepared according to a conventional manufacturing method in the cosmetic field by mixing as shown in Table 8 below.

ingredient content (wt%) Example of gourd bark extract 5.0 glycerin 6.0 1,3-butylene glycol 3.0 PG 1500 1.0 allantoin 0.1 DL-Panthenol 0.3 EDTA-2Na 0.02 Benzophenone-9 0.04 Sodium Hyaluronate 5.0 ethanol 10.0 Polysorbate 20 0.2 preservatives, fragrances, colors a very small amount Distilled water remaining amount Sum 100

<1-2> Nutrient lotion (lotion)

In order to prepare a nutrient lotion for photoaging prevention and skin wrinkle improvement, including the extract of the present invention, it can be prepared according to a conventional manufacturing method in the cosmetic field by mixing as described in Table 9 below.

ingredient content (wt%) Example of gourd bark extract 5.0 propylene glycol 6.0 glycerin 4.0 triethanolamine 1.2 Tocopheryl Acetate 3.0 liquid paraffin 5.0 squalane 3.0 Macadamina Nut Oil 2.0 Polysorbate 60 1.5 Sorbitan sesquioleate 1.0 Carboxyvinyl Polymer 1.0 preservatives, fragrances, colors a very small amount Distilled water remaining amount Sum 100

<1-3> Nourishing Cream

In order to prepare a nourishing cream for photoaging prevention and skin wrinkle improvement, including the extract of the squash bark of the present invention, it can be prepared according to a conventional manufacturing method in the cosmetic field by mixing as described in Table 10 below.

ingredient content (wt%) Example of gourd bark extract 5.0 lipophilic monostearate glycerin 1.5 cetearyl alcohol 1.5 stearic acid 1.0 Polysorbate 60 1.5 Sorbitan Stearate 0.6 Isostearylisostearate 5.0 squalane 5.0 mineral oil 35.0 dimethicone 0.5 Hydroxyethyl Cellulose 0.12 glycerin 6.0 triethanolamine 0.7 preservatives, fragrances, colors a very small amount Distilled water remaining amount Sum 100

<1-4> Latex for mask pack

In order to prepare an emulsion for a mask pack for photoaging prevention and skin wrinkle improvement containing the extract of the present invention, it can be prepared according to a conventional manufacturing method in the cosmetic field by mixing as described in Table 11 below.

ingredient content (wt%) Example of gourd bark extract 5.0 polyvinyl alcohol 15.0 Cellulose Gum 0.15 glycerin 3.0 PEG 1500 2.0 cyclodextrin 0.15 DL-Panthenol 0.4 allantoin 0.1 Monoammonium glycyrrhizinate 0.3 nicotinamide 0.5 ethanol 6.0 PEG 40 hydrogenated castor oil 0.3 preservatives, fragrances, colors a very small amount Distilled water remaining amount Sum 100

<Preparation Example 2> Preparation of pharmaceutical formulations

<2-1> Preparation of powder

Bak baek bark extract of the present invention 100mg

lactose 20mg

After mixing the above ingredients, the powder was prepared by filling in an airtight cloth.

<2-2> Preparation of tablets

Bak baek bark extract of the present invention 100mg

corn starch 100mg

lactose 100mg

magnesium stearate 2mg

After mixing the above ingredients, tablets were prepared by tableting according to a conventional method for manufacturing tablets.

<2-3> Preparation of capsules

Bak baek bark extract of the present invention 100mg

crystalline cellulose 3mg

lactose 14.8mg

magnesium stearate 0.2mg

After mixing the above ingredients, the capsules were prepared by filling in gelatin capsules according to a conventional manufacturing method of capsules.

<2-4> Preparation of liquid preparation

Bak baek bark extract of the present invention 500mg

Lee Seonghwadang 10g

mannitol 5g

Purified water appropriate amount

Add each component to purified water to dissolve it according to the usual manufacturing method, add an appropriate amount of lemon flavor, mix the above ingredients, add purified water to adjust the total to 100ml, fill in a brown bottle, and sterilize the solution prepared.

<2-5> Preparation of injection

Bak baek bark extract of the present invention 100 mg/ml

dilute hydrochloric acid BP until pH 7.6

Sodium Chloride BP for Main Use up to 1ml

Dissolve the extract of the present invention in an appropriate volume of sodium chloride BP for main use, adjust the pH of the resulting solution to pH 7.6 using dilute hydrochloric acid BP, adjust the volume using sodium chloride BP for main use, and mix thoroughly did. 5ml type of solution with clear glass?? It was filled in an ampoule, sealed under an upper grid of air by dissolving glass, and autoclaved at 120° C. for 15 minutes or more to prepare an injection solution.

Although the present invention has been described as the above-mentioned preferred embodiment, it is possible to make various modifications and variations without departing from the spirit and scope of the invention. It is also intended that the appended claims cover such modifications and variations as fall within the scope of the present invention.

Claims (10)

A cosmetic composition for preventing photoaging and improving skin wrinkles, comprising the bark extract of Cynoglosus semilaevis as an active ingredient. According to claim 1,
The extract is a cosmetic composition, characterized in that extracted using one or more solvents selected from water, lower alcohols having 1 to 4 carbon atoms, and mixtures thereof. According to claim 1,
The extract is a cosmetic composition, characterized in that the extract is extracted at room temperature by adding 2 to 20 times the weight of lower alcohol having 1 to 4 carbon atoms to the powder of the sagebrush. According to claim 1,
The cosmetic composition, characterized in that the extract is contained in an amount of 0.001 to 30% by weight based on the total weight of the cosmetic composition. According to claim 1,
The skin wrinkle improvement is a cosmetic composition, characterized in that it is achieved by promoting collagen production, inhibiting elastase activity, inhibiting MMP (matrix metalloproteinase) expression, or TIMP-1 (tissue inhibitor of metalloproteinase-1) expression. According to claim 1,
The cosmetic composition is a cosmetic composition, characterized in that the formulation is selected from lotion, emulsion, cream, essence, cosmetic ointment, spray, gel, pack, sunscreen, makeup base, foundation, powder and makeup remover. A composition for external application to the skin for preventing photoaging and improving skin wrinkles, comprising the bark extract of Cynoglosus semilaevis as an active ingredient. 8. The method of claim 7,
The composition for external application for skin is a composition for external application for skin, characterized in that it is a formulation selected from ointments, patches, gels, creams and sprays. A health functional food composition for preventing photoaging and improving skin wrinkles, comprising the bark extract of Cynoglosus semilaevis as an active ingredient. A food additive for preventing photoaging and improving skin wrinkles, which contains Cynoglosus semilaevis bark extract as an active ingredient.

Images