KR20210095828A - Kit for diagnosing liver cancer comprising an agent capable of measuring expression level of miR-4661-5p - Google Patents

Abstract

The present invention relates to an exosome miRNA panel marker composition for early diagnosis of liver cancer for non-invasive in-vitro diagnosis. In order to find a novel serum liver cancer biomarker, microRNA inside exosomes secreted by liver cancer cells was analyzed so as to identify microRNA specifically overexpressed in the liver cancer exosomes. As a result, a novel serum biomarker with high diagnostic accuracy in early-stage liver cancer for which there are currently no reliable biomarkers was discovered. Accordingly, a genome and proteome of cancer cells was checked using the exosomes without histological examination, and therefore, there is a high possibility that the exosomes can be used as a useful diagnostic biomarker in a group of diseases with a high risk from histological examination, such as liver cancer.

Description

Kit for diagnosing liver cancer comprising an agent capable of measuring expression level of miR-4661-5p

The present invention relates to an exosome miRNA panel marker composition for early cancer diagnosis for non-invasive in vitro diagnosis.

Liver cancer is one of the most common cancers in Koreans. In 2015, the incidence rate was 29.5 males and 8.2 females per 100,000, ranking 4th among males and 6th among females. It is a malignant tumor with a poor prognosis, ranking 2nd in women and 3rd in women.

Most liver cancer patients have to bear a significant risk due to the high risk of bleeding during biopsy due to underlying liver cirrhosis. . Biopsy is not invasive and convenient because it can be diagnosed with blood, compared to taking a significant risk. Unlike biopsy, blood can be collected multiple times during the course of treatment, making it suitable for predicting treatment response or residual cancer during treatment.

Exosomes are small nano-vesicles with a size of 30-150 nm that are generated/secreted from most nucleated cells including cancer cells. It is detected in , and the specific genetic information of the parent cell is loaded into the exosomal cargo and delivered to the target cell. Recently, exosomes have been attracting attention as a key material for cell-cell communication, and cancer cell-derived exosomes have been pointed out as a key material for tumor invasion and metastasis. Cancer cell exosomes transfer maternal genetic information to other target cells in the tumor microenvironment to malign normal cells, and it is speculated that they serve as the parental cancer cell avatar.

On the other hand, in the case of alpha-fetoprotein (AFP), which has been previously used as a diagnostic marker for liver cancer, the diagnostic sensitivity for liver cancer is only about 60%. , there is an urgent need to discover next-generation serum liver cancer biomarkers for predicting treatment response.

Korean Patent Registration No. 10-1987358 (Registered on June 3, 2019)

It is an object of the present invention to provide a biomarker composition for diagnosing liver cancer comprising one or more miRNAs selected from miR-4661-5p and miR-4746-5p as an active ingredient.

In addition, another object of the present invention is a composition for diagnosing liver cancer comprising an agent capable of measuring the expression level of any one or more miRNAs selected from miR-4661-5p and miR-4746-5p as an active ingredient, and a kit for diagnosing liver cancer comprising the same is to provide

In addition, another object of the present invention is to provide a method for providing information necessary for diagnosing liver cancer, comprising measuring the expression level of any one or more miRNAs selected from miR-4661-5p and miR-4746-5p.

In order to achieve the above object, the present invention provides a biomarker composition for diagnosing liver cancer comprising at least one miRNA selected from miR-4661-5p and miR-4746-5p as an active ingredient.

In addition, the present invention provides a composition for diagnosing liver cancer comprising, as an active ingredient, an agent capable of measuring the expression level of any one or more miRNAs selected from miR-4661-5p and miR-4746-5p.

In addition, the present invention provides a kit for diagnosing liver cancer comprising the composition.

In addition, the present invention comprises the steps of (1) measuring the expression level of any one or more miRNAs selected from miR-4661-5p and miR-4746-5p from a sample isolated from a patient; (2) comparing the measured expression level of miRNA with a control sample; And (3) when the measured expression level of the miRNA is higher than that of the control sample, it provides a method of providing information necessary for diagnosing liver cancer, comprising the step of determining that it is liver cancer.

The present invention relates to an exosome miRNA panel marker composition for early-stage cancer diagnosis for non-invasive in vitro diagnosis. In order to find a new serum liver cancer biomarker, the microRNA inside the exosome secreted by liver cancer cells is analyzed to be specific in the liver cancer exosome. By identifying microRNAs that are overexpressed with , a new serum biomarker with high diagnostic accuracy was discovered in early liver cancer, where there are currently no reliable biomarkers. As such, by using exosomes to identify the cancer cell genome and proteomic without biopsy, it is highly likely to be utilized as a useful diagnostic biomarker in a disease group with a high risk of biopsy, such as liver cancer in the future.

1 is a schematic diagram for exosome purification and separation.
2 shows the patient cohort configuration used in the present invention.
3 shows the results of identifying miRNAs specifically overexpressed in early liver cancer and advanced liver cancer.
Figure 4 shows the diagnostic power of 6 miRNA liver cancer in test and validation cohorts.
5 is an image according to the mUICC stage.
Figure 6(A) shows the AUC results of liver cancer diagnosis of serum AFP and two combination panels in the entire cohort. 6(B) shows the AUC results of mUICC II or lower early liver cancer diagnosis of serum AFP and two combination panels in the entire cohort. 6(C) shows the AUC results of early liver cancer diagnosis below mUICC I of serum AFP and two combination panels in the entire cohort.

The present invention provides a biomarker composition for diagnosing liver cancer comprising one or more miRNAs selected from miR-4661-5p and miR-4746-5p as an active ingredient.

Specifically, the composition may additionally include any one or more miRNAs selected from miR-25-3p and miR-1269a.

Preferably, the miRNA may be derived from an exosome, but is not limited thereto.

"miR-4661-5p" of the present invention is miRBase accession no. It may be MIMAT0019729, and the specific sequence is described as SEQ ID NO: 1 (AACUAGCUCUGUGUGGAUCCUGAC).

"miR-4746-5p" of the present invention is miRBase accession no. It may be MIMAT0019880, and the specific sequence is described as SEQ ID NO: 2 (CCGGUCCCAGGAGAACCUGCAGA).

"miR-25-3p" of the present invention is miRBase accession no. It may be MIMAT000081, and the specific sequence is described as SEQ ID NO: 3 (CAUUGCACUUGUCUCGGUCUGA).

"miR-1269a" of the present invention is miRBase accession no. It may be MIMAT0005923, and the specific sequence is described as SEQ ID NO: 4 (CUGGACUGAGCCGUGCUACUGG).

As used herein, the term "diagnosis" refers to determining a subject's susceptibility to a particular disease or condition, determining whether a subject currently has a particular disease or disorder, or having a particular disease or disorder. Determining a subject's prognosis, or therametrics (eg, monitoring a subject's condition to provide information about treatment efficacy).

In addition, the present invention provides a composition for diagnosing liver cancer comprising, as an active ingredient, an agent capable of measuring the expression level of any one or more miRNAs selected from miR-4661-5p and miR-4746-5p.

Specifically, the composition may further include an agent capable of measuring the expression level of any one or more miRNAs selected from miR-25-3p and miR-1269a.

Specifically, the agent capable of measuring the expression level of the miRNA may be a primer or a probe that specifically binds to the miRNA, but is not limited thereto.

Preferably, the liver cancer may be early liver cancer, but is not limited thereto.

In addition, the present invention provides a kit for diagnosing liver cancer comprising the composition.

As used herein, the term "primer" refers to a nucleic acid sequence having a short free 3' hydroxyl group, capable of base pairing with a complementary template and serving as a starting point for template strand copying. nucleic acid sequence. The primer is capable of initiating DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. PCR conditions and lengths of sense and antisense primers may be appropriately selected according to techniques known in the art.

As used herein, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases in length that can be specifically bound to mRNA, and is labeled to determine the presence or absence of a specific mRNA, expression quantity can be checked. The probe may be manufactured in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, or the like. Suitable probe selection and hybridization conditions can be appropriately selected according to techniques known in the art.

In addition, the present invention comprises the steps of (1) measuring the expression level of any one or more miRNAs selected from miR-4661-5p and miR-4746-5p from a sample isolated from a patient; (2) comparing the measured expression level of miRNA with a control sample; And (3) when the measured expression level of the miRNA is higher than that of the control sample, it provides a method of providing information necessary for diagnosing liver cancer, comprising the step of determining that it is liver cancer.

Specifically, step (1) may further include measuring the expression level of any one or more miRNAs selected from miR-25-3p and miR-1269a.

Preferably, the liver cancer may be early liver cancer, but is not limited thereto.

Specifically, the method for measuring the expression level of the miRNA is RT-PCR, competitive RT-PCR (Competitive RT-PCR), real-time RT-PCR (Real-time RT-PCR), RNase protection assay (RPA; RNase protection) assay), Northern blotting, DNA chip, Western blot, ELISA (enzyme linked immunosorbent asay), Radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion method , Rocket immunoelectrophoresis, tissue immunostaining, Immunoprecipitation assay, Complement Fixation Assay, FACS or protein chip may be used, but are not limited thereto.

As used herein, the term "sample isolated from a patient" refers to a tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine that is different from the control group in the expression level of the miRNA, which is a biomarker for diagnosing liver cancer in a patient. The same sample includes, but is not limited to. In the present invention, preferably, the sample may be blood, and more preferably, the sample may be a blood-derived exosome.

Hereinafter, the present invention will be described in detail according to non-limiting examples. Of course, the following examples of the present invention are not intended to limit or limit the scope of the present invention only to embody the present invention. Accordingly, what can be easily inferred by an expert in the technical field to which the present invention pertains from the detailed description and examples of the present invention is construed as belonging to the scope of the present invention.

<Experimental example>

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

One. exosomes Separation and verification

(1) Purification/isolation of each exosome from liver cancer cells, normal hepatocytes, and hepatic stellate cell cultures

Isolation of exosomes using ultracentrifugation: Each liver cancer cell line culture medium was centrifuged at 300 g for 10 minutes to remove cell debris, and centrifuged at 3000 g for 20 minutes to remove apoptotic bodies. . The exosome fraction was separated by ultracentrifugation at 100,000 g for 70 minutes. Exosomes suspended in D-PBS medium through ultrafiltration using a 0.2 μm pore filter were concentrated to 250 μl.

Purification of exosomes using Optiprep density gradient centrifugation: A sucrose gradient was performed to further purify the exosomes obtained above. Dilute sucrose buffer and 60% Optiprep gradient media (Sigma-Aldrich) to prepare 40%, 20%, 10%, and 5% solutions, layered in a centrifuge tube sequentially, and extract the exosomes from the above by ultracentrifugation. loaded. After ultracentrifugation at 100,000 g for 18 hours, exosomes located between 40% and 20% were collected (Fig. 1).

(2) Exosome isolation and RNA extraction from patient serum

Normal and liver cancer patient sera were extracted with 300ul using Exosome RNA isolation kit (SeraMir™ Exosome RNA Amplification (Cat #RA806A-1)).

After putting 72ul of ExoQuick™ in 300ul of patient serum and mixing (Vortex), it was stored at 4℃ for about one day, and then the sample placed ExoQuick™ in 300ul of patient serum was centrifuged at 13,000rpm, 4℃, for 2 minutes.

After removing all of the supernatant except for the generated pellet, 100ul of PBS (1×) (Hyclone™) was dissolved in the pellet, 300ul of Lysis buffer and 200ul of 100% EtOH were added, followed by mixing (Vortex) for 10 seconds.

Prepare the Spin Column and Collection Tube, transfer the entire amount of sample (600ul) to the column, centrifuge at 13,000rpm, 4℃, for 1 minute, remove the solution that came down to the Collection Tube, and then put 400ul of Wash Buffer, 13,000rpm, After centrifugation at 4° C. for 1 minute, and after removing the solution that came down to the Collection Tube, the process was repeated and centrifuged at 13,000 rpm, 4° C. for 2 minutes, followed by final drying.

Elution buffer 30ul was added and centrifuged at 2,000 rpm, 4°C, 2 minutes, followed by final centrifugation at 13,000 rpm, 4°C, 1 minute. The concentration of the obtained solution was measured by Nano Drop.

2. Liver disease stage miRNome From the data, liver cancer specific miRNA marker screening

Based on the fact that all carcinomas become cancers only through various precancerous lesion stages as a result of the accumulation of dysregulation of various genes for years or decades, a total of 88 patients with normal liver, chronic hepatitis, cirrhosis, early-stage cancer, and liver cancer Tissues were collected from the patient and sequencing was performed. Genes whose expression was not significantly different in hepatitis and cirrhosis compared to the normal control group, but whose expression was specifically increased only in early liver cancer and advanced liver cancer were selected. When common miRNAs were selected by merging with the GSE76903 data, one of the public omics data, about 71 miRNAs were selected, and compared with the TCGA liver cancer cohort, AUC in the liver cancer group compared to the non-liver cancer group was found to be 0.7 or higher. miRNAs were selected.

3. Public omics Validated using data exosomes microRNA Candidate selection

The association of microRNA overexpressed in liver cancer exosomes with the expression level and prognosis of liver cancer samples was analyzed from the TCGA data set, and microRNAs that were significantly overexpressed in liver cancer samples and showed correlation with prognosis were selected and verified in the actual liver disease patient cohort. did.

4. Liver disease for verification cohort Blood and clinical information collection

After passing the IRB review at Ajou University Hospital, the study was conducted by receiving the serum and clinical information of 178 liver disease cohorts (28 normal, 27 chronic hepatitis, 33 cirrhosis, 99 liver cancer) through the Human Resources Bank. .

5. qPCR Liver disease through analysis cohort patient serum in exosomes microRNA Expression level measurement

To measure miRNA expression, 300ul of patient serum was used, and an Exosome RNA isolation kit (SeraMir™ Exosome RNA Amplification (Cat #RA806A-1)) (SBI, System Biosciences) was used. cDNA synthesis was performed using the miScript RT II kit (Cat #218161) (QIAGEN).

Combine Exosome RNA and RNA Free Water (RFW) to 12ul, add miScript RT Ⅱ Buffer to 8ul (5× miScript Hiflex buffer 4ul, 10× miScript Nucleics Mix 2ul, miScript Reverse TranScriptase Mix 2ul) to synthesize cDNA with a total of 20ul proceeded. The synthesized cDNA was diluted 1/20 and used.

cDNA conditions were set as follows.

A. Stage 1: 37℃, 60 minutes

B. Stage 2: 95℃, 10℃ after 5 minutes, -ing

Gene Accession No. mature sequence Primer sequence hsa - miR -25-3p MIMAT00000081 5'-CAUUGCACUUGUCUCCGGUCUGA-3' 5'-CATTGCACTTGTCTCGGTCTGA-3' hsa - miR -140-3p MIMAT0004597 5'-UACCACAGGGUAGAACCACGG-3' 5'-TACCACAGGGTAGAACCACGG-3' hsa - miR -423-3p MIMAT0001340 5'-AGCUCGGUCUGAGGCCCCCUCAGU-3' 5'-AGCTCGGTCTGAGGCCCCTCAGT-3' hsa - miR -1269a MIMAT0005923 5'-CUGGACUGAGCCGUGCUACUGG-3' 5'-CTGGACTGAGCCGTGCTACTGG-3' hsa - miR -4661-5p MIMAT0019729 5'-AACUAGCUCUGUGGAUCCUGAC-3' 5'-AACTAGCTCTGTGGATCCTGAC-3' hsa - miR -4746-5p MIMAT0019880 5'-CCGGUCCCAGGAGAACCUGCAGA-3' 5'-CCGGTCCCAGGAGAACCTGCAGA-3' hsa - miR -1228-3p MIMAT0005583 5'-UCACACCUGCCUCGCCCCCC-3' 5'-TCACACCTGCCTCGCCCCCC-3'

PCR was performed using the primers having the sequence of Table 1. In this case, the necessary primers were purchased from M.biotech (Hanam, Korea) and used. qPCR MasterMix (2X, High ROX) (Gendepot, Cat #Q5602) was used for qRT-PCR with a total of 10ul using 5ul.

qRT-PCR conditions were set as follows.

A. Stage 1: 2 minutes at 95℃

B. Stage 2: 15 seconds at 95°C, 34 seconds at 58-60°C (different by miRNA), 30 seconds at 72°C

C. Repeat Stage 2 for 40 cycles

6. exosomes microRNA Statistical analysis of results

After calculating the relative concentration of serum using Microsoft Office Excel program, statistical analysis was performed using MedCalc statistical software and SPSS v22 analysis program.

< Example 1> Serum exosomes early liver cancer miRNA marker patient for sympathy cohort Selection

A total of 250 patients were used in the present invention. First, GSE76903 and TCGA LIHC, which are public omics data, were used together to derive a candidate liver cancer exo-miRNA marker, and final candidates were selected through ROC analysis. Cohort 1 used in the present invention to identify candidate substances was performed with NGS RNA-seq by obtaining 108 samples from 86 patients. 15 NL, 20 CH, 10 LC, 18 eHCC (High grade dysplastic nodules and Edmoson grade TG1) ), 45 avHCC (Edmoson grade TG2 and TG3). A total of 6 liver cancer driver miRNAs were selected from this, and they were tested by qRT-PCR in a blood cohort of 24 patients at Ajou University Hospital. For blood samples, liver cancer staging was applied based on the modified UICC. qRT-PCR was performed in a validation cohort of 144 people for the last 4 miRNAs selected for the test (FIG. 2).

< Example 2> Early liver cancer detection serum exo - miRNA Integrated genomic analysis for screening

After expression profiling was performed from tissue sequencing data consisting of 108 samples of cohort 1, an HCC-specific gene signature was derived. After extracting it once more through ROC analysis, it was finally selected through TCGA survival analysis.

Compared to the normal group, statistically significantly overexpressed miRNAs (Up-regulated DEGs: welch's t-test p<0.05 & >=1.3 fold) in each liver disease stage were selected and presented as a Venn diagram. We found a total of 140 miRNAs overexpressed in early-stage cancer (eHCC) and advanced liver cancer (avHCC), excluding hepatitis (CH) and cirrhosis (LC).

Cohort 1 Catholic LIHC and Tsinghua University RNA-seq data (Tsinghua LIHC, GSE76903) were integrated and compared with 305 miRNA (welch's t-test p<0.05 & >=1.5 fold) overexpressed in liver cancer specific from Tsinghua LIHC data. A total of 71 miRNAs were identified.

When 71 commonly overexpressed miRNAs were shown as heatmaps in 3 liver cancer cohorts (Catholic LIHC, Tsinghua LIHC, TCGA LIHC), it was confirmed that they were clearly overexpressed in liver cancer.

ROC analysis was performed to evaluate whether the selected miRNAs can accurately discriminate between non-liver cancer and liver cancer, and miRNAs with an AUC of 0.7 or higher were finally selected. 62 miRNAs were selected from Catholic LIHC, 67 miRNAs from Tsinghua LIHC, and 32 miRNAs from TCGA LIHC. Among them, the final six miRNAs that were significantly expressed in early-stage cancer and were associated with the survival of liver cancer patients were selected (FIG. 3).

< Example 3> 6 candidates exo - miRNA Testing and Validation in the cohort diagnostic power evaluation

To determine whether six candidate microRNAs were overexpressed in actual patients, normal liver (n=4), chronic hepatitis (n=4), cirrhosis (n=4), mUICC I/II (n=6), mUICC III miRNA expression was confirmed by quantitative real-time PCR in exosomes from /IV (n=6) patient serum. The expression of 4 miRNAs (miR-25-3p, miR-1269a, miR-4661-5p, miR-4746-5p) in the serum exosomes of liver cancer patients was significantly higher than that of non-liver cancer (NL, CH, LC). It was confirmed that increased (Welch's t-test, **P<0.01, ***P<0.001).

When the AUC of 6 exo-miRNA candidate liver cancer diagnosis was confirmed, 4 miRNAs (miR-25-3p, miR-1269a, miR-4661-5p, miR-4746-5p) showed good results of AUC 0.8 or higher. Therefore, it was decided to proceed with validation in a validation cohort of 140 people for a total of 4 microRNAs.

The expression levels of serum exosome microRNA candidates discovered in a total of 140 cohorts were verified (Welch's t-test, *P<0.05, **P<0.01, ***P<0.001).

For liver cancer diagnosis, serum exosome miR-25-3p had an AUC of 0.758 (95% CI: 0.679-0.827), miR-1269a had an AUC of 0.844 (95% CI: 0.773-0.900), miR-4661- 5p is AUC=0.918 (95% CI: 0.860-0.958), miR-4746-5p is AUC=0.687 (95% CI: 0.542-0.707), so miR-4661-5p has the highest AUC among the four serum exosomal miRNAs. was shown (Fig. 4).

< Example 4> exosomes microRNA panel of early liver cancer as a marker Verification result

The composition of the entire cohort is shown in Table 2 below.

Candidate microRNAs in the validation cohort were validated for clinical significance. AUC was measured by dividing the mUICC stage to determine whether early liver cancer was discriminated in a cohort of a total of 168 patients (FIG. 5).

Through the panel combination of serum AFP and exosome miRNA for liver cancer diagnosis, AUC for each panel combination was measured to find a panel of markers that can complement or improve AFP, the existing liver cancer serum marker (Table 3).

　 N,CHB,LC vs HCC AUC 95% CI AFP 0.704 0.625-0.782 AFP+miR-25 0.790 0.723-0.857 AFP+miR-1269a 0.872 0.820-0.924 AFP+miR-4661 0.921 0.883-0.959 AFP+miR-4746 0.741 0.665-0.817 miR-25+miR-1269a 0.850 0.793-0.907 miR-25+miR-4661 0.919 0.880-0.957 miR-25+miR-4746 0.790 0.720-0.860 miR-1269a+miR-4661 0.918 0.879-0.956 miR-1269a+miR-4746 0.874 0.821-0.927 miR-4661+miR-4746 0.942 0.908-0.975

For the diagnosis of liver cancer in the entire liver cancer cohort, the best combination with AFP had the best AUC of AFP+miR-4661-5p of 0.921. 0.942 was found to be the best.

Therefore, early liver cancer discrimination analysis was performed for the two combinations. When ROC analysis was performed with a combination of miR-4661-5p and miR-4746-5p among those constituting the panel, it was confirmed that excellent diagnostic power of 0.9 or more was shown in all cases ( FIG. 6 ).

In conclusion, the present invention relates to the diagnostic power of liver cancer using microRNA overexpressed in liver cancer exosomes, which shows very good sensitivity and specificity with only a small amount of blood, enabling accurate diagnosis of early liver cancer, accuracy, simplicity, and economy of diagnosis can be said to be effective for

The present invention discovered microRNAs overexpressed in exosomes of liver cancer cells, first verified them in public omics data, selected candidates, and verified the clinical effectiveness of the selected candidates in an independent liver disease cohort, thereby providing excellent diagnostic accuracy was confirmed.

In a situation in which the detection rate of early liver cancer using ultrasound is 60-80%, which does not meet expectations, and AFP, also known as a serum biomarker, plays an insignificant role in early liver cancer, the present invention shows surprising liver cancer diagnosis accuracy using a small amount of blood. Therefore, it is expected that the present invention will play an innovative role in screening for high-risk groups of liver cancer in the future.

<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Kit for diagnosing liver cancer comprising an agent capable of measuring expression level of miR-4661-5p <130> ADP-2021-0408 <160> 4 <170> KopatentIn 2.0 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 aacuagcucu guggauccug ac 22 <210> 2 <211> 23 <212> RNA <213> Homo sapiens <400> 2 ccggucccag gagaaccugc aga 23 <210> 3 <211> 22 <212> RNA <213> Homo sapiens <400> 3 cauugcacuu gucucggucu ga 22 <210> 4 <211> 22 <212> RNA <213> Homo sapiens <400> 4 cuggacugag ccgugcuacu gg 22

Claims (4)

A kit for diagnosing liver cancer comprising a formulation capable of measuring the expression level of miR-4661-5p as an active ingredient. The method of claim 1, wherein the kit further comprises an agent capable of measuring the expression level of any one or more miRNAs selected from the group consisting of miR-4746-5p, miR-25-3p and miR-1269a. Liver cancer diagnostic kit. The kit for diagnosing liver cancer according to claim 1 or 2, wherein the agent capable of measuring the expression level of miRNA is a primer or probe that specifically binds to the miRNA. The kit for diagnosing liver cancer according to claim 1 or 2, wherein the liver cancer is early liver cancer.

Images