KR20210090147A - Markers for diagnosing prognosis of patient of clear cell renal cell carcinoma - Google Patents

Abstract

The present invention relates to a marker for prognostic diagnosis of kidney cancer patients. In kidney cancer patients, since the mutation of the gene of the present invention and the survival rate of the patient, or the mutation of the gene of the present invention and the recurrence rate of kidney cancer are respectively correlated, variants of the genes of the present invention can be used as markers to predict the prognosis of kidney cancer patients.

Description

Markers for diagnosing prognosis of patient of clear cell renal cell carcinoma

The present invention relates to a marker for prognostic diagnosis of a renal cancer patient, a kit for diagnosing the prognosis of a renal cancer patient comprising the same, and a method for providing information necessary for prognostic diagnosis of renal cancer using the marker for prognostic diagnosis of a renal cancer patient.

The kidney is an important urinary organ having a role of excreting wastes in the living body to the outside of the body by filtering blood and producing urine. It is also an important endocrine organ that produces hormones such as angiotensin, which controls blood pressure, and erythropoietin, a red blood cell hematopoietic factor.

There are renal cell carcinoma that occurs in adults, Wilms' tumor that occurs in children, and sarcoma as a rare tumor, among the tumors occurring in the kidney, but renal cell carcinoma, which is a malignant tumor with the highest incidence, is called renal cancer. The incidence of kidney cancer in Japan is about 2.5 per 100,000 population, and the male to female ratio is 2 to 3:1, which tends to be high in males. Among urological malignancies, prostate cancer and bladder cancer are the most common tumors. Kidney cancer refers to renal cell cancer that occurs mostly in the parenchyma of the kidney (the part of the kidney that makes urine, which is composed of the medulla and the cortex).

Kidney cancer accounts for about 3% of adult cancers in the United States, and about 32,000 new patients occur annually. In addition, it is estimated that about 12,000 people die from kidney cancer, and the incidence is increasing worldwide every year. According to the central cancer registration data in 2002, 1,578 patients were newly registered, accounting for 1.6% of the total cancer incidence in Korea. Kidney cancer is most common in people in their 40s and 60s, and when looking at the incidence by age (Central Cancer Registry in 2002), it is most common in those in their 60s (479 patients, 30.2%), 50s (412 patients, 26.0%), and 40s (268 cases, 16.9%) occur most frequently.

Although genetic factors are also known as risk factors for kidney cancer, in general, smoking and excessive fat intake are included. It is also known that the incidence rate of the above tumor is high in patients undergoing dialysis for a long time.

In kidney cancer, when the maximum diameter of the tumor is less than 5 cm, it is rare to have any subjective symptoms, and it is often detected by CT scan during examination. Larger tumors include hematuria, abdominal tumors, and pain. In addition, as a systemic symptom, fever, weight loss, anemia, etc. may occur, and in rare cases, polycythemia, hypertension, and hypercalcemia may occur due to endocrine factors. On the other hand, progress in the inferior vena cava of renal cancer may cause venous longevity and venous varices in the abdominal body surface. About 20% of kidney cancers are found from lung or bone metastases. In kidney cancer, the tumor tends to spread in veins, and metastasis to other organs is likely to occur.

Kidney cancer has almost no symptoms when the size of the tumor is small, and symptoms appear only when the tumor grows to a certain extent and pushes the organs away. Therefore, the diagnosis is often delayed, and when first diagnosed, about 30% of patients appear to have already metastasized. The most common symptom is hematuria, but this also occurs in only 60% of patients. Rather, symptoms such as shortness of breath, cough, and headache appear depending on the metastasized site, and the diagnosis of kidney cancer due to these metastases is up to 30% of all patients. Because kidney cancer can cause high blood pressure, hypercalcemia, and liver function abnormalities, especially due to certain hormones produced by cancer cells, tumors are sometimes discovered while examining these other symptoms. However, recently, there are many cases where it is discovered incidentally on an imaging test while undergoing a medical examination without any symptoms, and the treatment results are relatively good because these cases are mainly detected at an early stage. Therefore, early diagnosis of kidney cancer as described above is very important.

Transglutaminase 2 (Patent Document 1) is disclosed as a marker used for detection or diagnosis of human kidney cancer. Although markers for diagnosing cancer, including kidney cancer, have been developed, studies on markers capable of measuring the prognosis of kidney cancer patients have not been made yet.

In order to diagnose kidney cancer or discover a therapeutic agent for kidney cancer patients and design a therapeutic strategy, the present inventors focus on the need for development of markers capable of diagnosing the prognosis of kidney cancer patients. The association between genetic variation and patient survival and mortality was studied.

Korean Patent No. 1267580

In order to apply a suitable therapeutic strategy for renal cancer patients, it is necessary to develop markers that can predict the prognosis of renal cancer patients. An object of the present invention is to provide a marker capable of diagnosing the prognosis of a renal cancer patient.

In order to achieve the above object, one aspect of the present invention is BAZ2B, CDCA2, CFP, CHSY3, CLCN2, DHX37, EGFR, FAM178A (SLF2), FAM54B (MTFR1L), FCRL4, GALNT7, GRIK2, IL16, LIMK2, LONP2, MYO1G, OBSCN, OGT, OR10AG1, PRKAG2, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SPTBN1, SYNE1, TINAGL1, USP18 and ZNF33A of kidney cancer capable of detecting a mutation in at least one gene selected from the group consisting of A kit for prognostic diagnosis is provided.

Another aspect of the present invention comprises the steps of preparing a sample DNA from a sample of a renal cancer patient; amplifying the sample DNA using a kit for prognostic diagnosis of kidney cancer; and confirming the presence or absence of a mutation from the amplification result; provides a method for providing information necessary for prognostic diagnosis of kidney cancer, including.

In renal cancer patients, the genes discovered in the present invention BAZ2B, CDCA2, CFP, CHSY3, CLCN2, DHX37, EGFR, FAM178A(SLF2), FAM54B(MTFR1L), FCRL4, GALNT7, GRIK2, IL16, LIMK2, LONP2, MYO1G, OBSCN , OGT, OR10AG1, PRKAG2, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SPTBN1, SYNE1, TINAGL1, USP18 and ZNF33A at least one gene selected from the group consisting of a mutation and patient survival rate, or a mutation and Since the recurrence rate of kidney cancer is correlated with each other, the mutant of the genes of the present invention can be used as a marker to predict the prognosis of a kidney cancer patient.

However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned will be clearly understood by those skilled in the art from the following description.

Figures 1-30 show BAZ2B, CDCA2, CFP, CHSY3, CLCN2, DHX37, EGFR, FAM178A (SLF2), FAM54B (MTFR1L), FCRL4, GALNT7, GRIK2, IL16, LIMK2, LONP2, MYO1G, OR10CN, OGT For each of the genes PRKAG2, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SPTBN1, SYNE1, TINAGL1, USP18, and ZNF33A, renal cancer patients with a mutation in the corresponding gene (red) and kidney cancer patients without the corresponding gene ( Blue) is a graph comparing the total survival rate or disease-free survival rate.

In this specification, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are those well known and commonly used in the art.

Hereinafter, the present invention will be described in detail.

1. Survival-specific mutated genes in renal cancer patients, and primer sets capable of detecting these mutated genes

One aspect of the present invention is BAZ2B (Gene bank accession number: NM_013450.3), CDCA2 (Gene bank accession number: NM_152562.3), CFP (Gene bank accession number: NM_002621.2), CHSY3 (Gene bank accession number: NM_175856) .4), CLCN2 (Gene bank accession number: NM_004366.5), DHX37 (Gene bank accession number: NM_032656.3), EGFR (Gene bank accession number: NM_005228.4), FAM178A (SLF2) (Gene bank accession number: NM_018121.3), FAM54B(MTFR1L)(Gene bank accession number: NM_001099627.1), FCRL4(Gene bank accession number: NM_031282.2), GALNT7(Gene bank accession number: NM_017423.2), GRIK2(Gene bank accession number) : NM_021956.4), IL16 (Gene bank accession number: NM_172217.3), LIMK2 (Gene bank accession number: NM_016733.2), LONP2 (Gene bank accession number: NM_031490.4), MYO1G (Gene bank accession number: NM_033054) .2), OBSCN (Gene bank accession number: NM_001271223.2), OGT (Gene bank accession number: NM_181672.2), OR10AG1 (Gene bank accession number: NM_001005491.1), PRKAG2 (Gene bank accession number: NM_016203.3) ), PRO X1 (Gene bank accession number: NM_001270616), PTPRU (Gene bank accession number: NM_005704.4), RGS9 (Gene bank accession number: NM_003835.3), RTN3 (Gene bank accession number: NM_001265589.1), SECISBP2L (Gene bank accession number: NM_001193489.1), SPTBN1 (Gene bank accession number: NM_003128.2), SYNE1 (Gene bank accession number: NM_182961.3), TINAGL1 (Gene bank accession number: NM_022164.2), USP18 (Gene bank accession number) : NM_017414.3) and ZNF33A (Gene bank accession number: NM_006954.1) provides a kit for prognostic diagnosis of kidney cancer capable of detecting a mutation in at least one gene selected from the group consisting of: NM_017414.3) and ZNF33A (Gene bank accession number: NM_006954.1).

In one embodiment of the present invention, there is provided a kit for prognostic diagnosis of renal cancer capable of detecting a mutation of at least one gene selected from mutations of the following genes:

Mutation of the gene encoding BAZ2B represented by the amino acid sequence of SEQ ID NO: 1, mutation of the gene encoding CDCA2 represented by the amino acid sequence of SEQ ID NO: 2, mutation of the gene encoding CFP represented by the amino acid sequence of SEQ ID NO: 3, SEQ ID NO: Mutation of the gene encoding CHSY3 represented by the amino acid sequence of 4, mutation of the gene encoding CLCN2 represented by the amino acid sequence of SEQ ID NO: 5, mutation of the gene encoding DHX37 represented by the amino acid sequence of SEQ ID NO: 7 Mutation of the gene encoding EGFR represented by the amino acid sequence, mutation of the gene encoding FAM178A (SLF2) represented by the amino acid sequence of SEQ ID NO: 8, FAM54B (MTFR1L) represented by the amino acid sequence of SEQ ID NO: 9 mutation of the gene, Mutation of the gene encoding FCRL4 represented by the amino acid sequence of SEQ ID NO: 10, mutation of the gene encoding GALNT7 represented by the amino acid sequence of SEQ ID NO: 11, mutation of the gene encoding GRIK2 represented by the amino acid sequence of SEQ ID NO: 12, SEQ ID NO: Mutation of the gene encoding IL16 represented by the amino acid sequence of SEQ ID NO: 13, mutation of the gene encoding LIMK2 represented by the amino acid sequence of SEQ ID NO: 14, mutation of the gene encoding LONP2 represented by the amino acid sequence of SEQ ID NO: 15, SEQ ID NO: 16 Mutation of the gene encoding MYO1G represented by the amino acid sequence, mutation of the gene encoding OBSCN represented by the amino acid sequence of SEQ ID NO: 17, mutation of the gene encoding OGT represented by the amino acid sequence of SEQ ID NO: 18, amino acid sequence of SEQ ID NO: 19 Mutation of the gene encoding OR10AG1 represented by , mutation of the gene encoding PRKAG2 represented by the amino acid sequence of SEQ ID NO: 20, mutation of the gene encoding PROX1 represented by the amino acid sequence of SEQ ID NO: 21, SEQ ID NO: 22 Mutation of the gene encoding PTPRU represented by the amino acid sequence of SEQ ID NO: 23, mutation of the gene encoding RGS9 represented by the amino acid sequence of SEQ ID NO: 23, mutation of the gene encoding RTN3 represented by the amino acid sequence of SEQ ID NO: 24, amino acid of SEQ ID NO: 25 Mutation of the gene encoding SECISBP2L represented by the sequence, mutation of the gene encoding SPTBN1 represented by the amino acid sequence of SEQ ID NO: 26, mutation of the gene encoding SYNE1 represented by the amino acid sequence of SEQ ID NO: 27, amino acid sequence of SEQ ID NO: 28 A mutation of the gene encoding TINAGL1 represented by a mutation, a mutation of a gene encoding USP18 represented by the amino acid sequence of SEQ ID NO: 29 and a mutation of a gene encoding ZNF33A represented by the amino acid sequence of SEQ ID NO: 30.

As used herein, the term 'diagnosis' refers to confirming the presence or characteristics of a pathological condition, and for the purpose of the present invention, not only confirming whether or not cancer occurs, but also relapse, metastasis, drug reactivity, It means judging whether such things as tolerance, etc. Preferably, when using the mutation of the gene of the present invention, it is possible to predict whether or not the subject will develop cancer, as well as whether the prognosis of the subject will be good in the future by checking whether the mutation is present from the subject's sample.

In the present invention, the term 'prognosis' refers to the progress and cure of neoplastic diseases such as cancer, such as the possibility of cancer-caused death or progression, including recurrence, metastatic spread, and drug resistance, for example. For the purpose of the present invention, it may be to predict the prognosis of kidney cancer, preferably to predict the disease-free survival rate or survival rate of renal cancer patients.

As used herein, the term 'cancer' includes any member of a class of diseases characterized by the uncontrolled growth of abnormal cells. The term includes all known cancers and neoplastic conditions, whether characterized as malignant, benign, soft tissue or solid, and cancers of all stages and grades, including cancers before and after metastasis.

In the present invention, the term 'gene' and its variants include DNA fragments involved in polypeptide chain generation; It includes regions before and after the coding region, eg promoters and 3'-untranslated regions, respectively, as well as intervening sequences (introns) between individual coding fragments (exons).

The mutation of the gene may include any one or more mutations, for example, a truncating mutation, a missense mutation (or a missense mutation), a nonsense mutation, a frame shift. ) mutation, in-frame mutation (or in-frame mutation), splice mutation, and splice_region mutation may have at least one mutation selected from the group consisting of mutations. The frame shift mutation may be at least one of a frame shift insert (FS ins) mutation and a frame shift delete mutation (FS del). The in-frame mutation may be at least one of an in-frame insertion (IF ins) mutation and an in-frame delete (IF del) mutation.

The term "X#Y" with respect to a mutation in a polypeptide sequence is self-recognized in the art, where "#" indicates the mutation site with respect to the amino acid number of the polypeptide, and "X" is that of the wild-type amino acid sequence. indicates the amino acid found at that position, and "Y" indicates the mutant amino acid at that position. For example, the designation "G1717V" in the context of a BAZ2B polypeptide indicates that glycine is present at amino acid number 1717 of the wild-type BAZ2B sequence and that glycine has been replaced by valine in the mutant BAZ2B sequence. The mutations in these genes are as follows:

In the amino acid sequence of BAZ2B shown in SEQ ID NO: 1, a nonsense mutation that is E1830*, G1717V, R1565G, W1246C, S1226G, I1153K, E1064Q, R1021H, Q854K, E616D, S561N, H560Q, Q321H, H295Q and S241T selected from the group consisting of It is at least one missense mutation, and in the nonsense mutation, * indicates that the amino acid synthesis at the corresponding amino acid position is terminated (the description is omitted below);

In the amino acid sequence of CDCA2 shown in SEQ ID NO: 2, at least one missense mutation selected from the group consisting of S210Y, I246V, G742V and A876V;

In the amino acid sequence of CFP represented by SEQ ID NO: 3, at least one missense mutation selected from the group consisting of E323Gfs*34, a frame shift insert (FS ins) mutation, R359Q, T151I, P144L, E135K and S27L, and , frameshift mutations are represented by the amino acid type (amino acid position), amino acid type fs* (the number of nucleotides from the amino acid position to the stop codon in the downstream direction) (frameshift insertion mutations and frameshift deletion mutations both have the same notation method, description will be omitted below);

In the amino acid sequence of CHSY3 shown in SEQ ID NO: 4, at least one missense mutation selected from the group consisting of K299N, K619N, H622N and I628M;

In the amino acid sequence of CLCN2 shown in SEQ ID NO: 5, a missense mutation that is at least one of R881H and L724P, a frame shift delete (FS del) mutation that is at least one of E871Gfs*35 and G498Afs*14, in- which is R646dup It is an in-frame insertion (IF ins) mutation, and dup in the notation of in-frame insertion mutation indicates that the corresponding amino acid is copied at the corresponding amino acid sequence position. That is, the R646dup in-frame insertional mutation indicates that arginine is copied at the 646th amino acid sequence;

In the amino acid sequence of DHX37 shown in SEQ ID NO: 6, at least one missense mutation selected from the group consisting of K990N, S831G, A669T, L388P, R249W, M214V, and K129T, a splice mutation that is X957_splice (C is at chromosome position 125435351) T), a splice site (splice_region) mutation in which the base G is substituted with A at chromosome position 125449470, a frame shift deletion mutation with E26Sfs*15;

In the amino acid sequence of EGFR shown in SEQ ID NO: 7, at least one missense mutation selected from the group consisting of G225C, E330K, H805R, R832H, L838M, L838P and S1042N, a frame shift insertion mutation that is L267Tfs*32;

In the amino acid sequence of FAM178A (SLF2) shown in SEQ ID NO: 8, at least one missense mutation selected from the group consisting of G118R, H126R, K235N, S515C, L1048F and D1142E, a frame shift deletion mutation that is K235Nfs*6;

In the amino acid sequence of FAM54B (MTFR1L) shown in SEQ ID NO: 9, a splice mutation that is X80_splice (base G is replaced with T at chromosome position 26152903), a missense mutation that is P94H;

in the amino acid sequence of FCRL4 shown in SEQ ID NO: 10, a frame shift deletion mutation of L346Pfs*28, a missense mutation that is at least one selected from the group consisting of P295L, K185R, I168V and A18T;

In the amino acid sequence of GALNT7 shown in SEQ ID NO: 11, a frame shift insertion mutation that is R10Nfs*13, a missense mutation that is at least one selected from the group consisting of H253R, L361I, K363R and G390R;

In the amino acid sequence of GRIK2 shown in SEQ ID NO: 12, at least one missense mutation selected from the group consisting of T425K, R748Q, K797R and N802S, a nonsense mutation that is W613*, a frame shift insertion mutation that is N849Kfs*11;

a missense mutation that is at least one selected from the group consisting of R134M, L450I, G464V, G749E and A1291V in the amino acid sequence of IL16 represented by SEQ ID NO: 13; a missense mutation that is at least one of L232P and P403L in the amino acid sequence of LIMK2 shown in SEQ ID NO: 14;

a missense mutation that is at least one selected from the group consisting of Q112H, L440V, I627M and K786E in the amino acid sequence of LONP2 shown in SEQ ID NO: 15;

In the amino acid sequence of MYO1G shown in SEQ ID NO: 16, at least one missense mutation selected from the group consisting of T698S, K418M, P225S and M166V, or a nonsense mutation that is K418*;

In the amino acid sequence of OBSCN represented by SEQ ID NO: 17, at least one missense mutation selected from the group consisting of E268K, A3942V, C5529F, R6172C, E6502G, W8453R, V8800F and R8898Q, a nonsense mutation that is Q1913*;

a missense mutation that is at least one selected from the group consisting of G35V, R348S, S399F and V843I in the amino acid sequence of OGT represented by SEQ ID NO: 18;

a missense mutation that is at least one of L204F and L156F in the amino acid sequence of OR10AG1 represented by SEQ ID NO: 19;

In the amino acid sequence of PRKAG2 shown in SEQ ID NO: 20, at least one missense mutation selected from the group consisting of V463G, F149S and A44V, I391_G393delinsM in-frame delete (IF del) mutation;

In the amino acid sequence of PROX1 shown in SEQ ID NO: 21, at least one missense mutation selected from the group consisting of M85I, R156H, I172L, V225D and K240N, a frame shift insertion mutation that is E139Rfs*15;

a missense mutation that is at least one selected from the group consisting of R771L, R835L and R974G in the amino acid sequence of PTPRU represented by SEQ ID NO: 22;

In the amino acid sequence of RGS9 shown in SEQ ID NO: 23, at least one missense mutation selected from the group consisting of N38K 3D, V60F 3D and R515W, R549Pfs*27 is a frame shift insertion mutation, and the "3D" is a three-dimensional structure ( three dimensional structure);

In the amino acid sequence of RTN3 shown in SEQ ID NO: 24, at least one missense mutation selected from the group consisting of E260D, S312N and E622K;

In the amino acid sequence of SECISBP2L represented by SEQ ID NO: 25, at least one missense mutation selected from the group consisting of E990D, G962S, V869E, F700L, S654I and P652R, a frame shift insertion mutation that is V789Sfs*2, a nonsense mutation that is C275*, a frameshift deletion mutation that is N193Kfs*2;

In the amino acid sequence of SPTBN1 shown in SEQ ID NO: 26, at least one missense mutation selected from the group consisting of I45F, F855V, H1316P, A1875V 3D, N2205K 3D and G2343S, a frame shift deletion mutation that is K1354Nfs*39, E2007* 3D is nonsense mutation;

In the amino acid sequence of SYNE1 shown in SEQ ID NO: 27, E8769V, Q8752H, R8468H, R8468S, L6746V, Q6554R, K5499T, R5087W, A4515G, Q4029H, Q2734K, L2692M, K2554N, E1651K, A1393V, K919N, G688W consisting of T229I a missense mutation that is at least one selected from the group, a frame shift deletion mutation that is V8096Hfs*15, a nonsense mutation that is at least one selected from the group consisting of Q7230*, E7207* and Q846*, a splice mutation that is X6733_splice (at chromosome position 152557951) C is replaced by T);

In the amino acid sequence of TINAGL1 shown in SEQ ID NO: 28, a missense mutation of C226F or a frame shift deletion mutation of C309Vfs*2;

In the amino acid sequence of USP18 shown in SEQ ID NO: 29, at least one missense mutation selected from the group consisting of R44S, P45S, T80N and N325S, a splice mutation that is X134_splice (base G is substituted with C at chromosome position 18650021); and

In the amino acid sequence of ZNF33A represented by SEQ ID NO: 30, a frame shift deletion mutation that is at least one of Y162* and S291Lfs*8, a missense mutation that is at least one selected from the group consisting of K166M, D272E and Y275H; selected from the group consisting of; at least one mutation.

RT-PCR, direct nucleic acid sequencing, and microarray can be used as an analysis method for diagnosing the prognosis of kidney cancer using the mutation of the gene, and the presence of the mutation can be confirmed using the mutation of the gene of the present invention. Any method can be applied without limitation. In one embodiment, the presence of a mutation is determined using an anti-(mutant of each gene) antibody or nucleic acid probe that hybridizes under stringent conditions to the polynucleotide of the mutation of each gene. In another embodiment, the antibody or nucleic acid probe is detectably labeled. In another embodiment, the label is selected from the group consisting of an immunofluorescent label, a chemiluminescent label, a phosphorescent label, an enzymatic label, a radioactive label, avidin/biotin, colloidal gold particles, colored particles, and magnetic particles. In another embodiment, the presence of the mutation is determined by a radioimmunoassay, a western blot assay, an immunofluorescence assay, an enzymatic immunoassay, an immunoprecipitation assay, a chemiluminescence assay, an immunohistochemical assay, a dot blot assay, a slot blot assay, or flow cytometry. determined by the assay. In another embodiment, the presence of the mutation is determined by RT-PCR. In another embodiment, the presence of a mutation is determined by nucleic acid sequencing.

As used herein, the term 'polynucleotide' generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for example, polynucleotides as defined herein include, but are not limited to, single- and double-stranded DNA, DNA comprising single- and double-stranded regions, single- and double-stranded RNA, and single- and double-stranded DNA. - RNA comprising a region, single-stranded or more typically double-stranded, or hybrid molecule comprising DNA and RNA, which may comprise single- and double-stranded regions. Thus, DNA or RNA having a backbone that has been modified for stability or other reasons is a 'polynucleotide' as the term is intended herein. Also included in the term 'polynucleotide' as defined herein is DNA or RNA comprising an unconventional base such as inosine or a modified base such as a tritiated base. In general, the term 'polynucleotide' includes all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides. Polynucleotides can be prepared by a variety of methods, including in vitro recombinant DNA-mediated techniques, and by expression of DNA in cells and organisms.

A primer set capable of detecting the mutation, that is, for prognostic diagnosis of renal cancer, is as follows:

SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36, SEQ ID NO: 37 and SEQ ID NO: 38, SEQ ID NO: 39 and SEQ ID NO: 40, SEQ ID NO: 41 and SEQ ID NO: for mutation detection of BAZ2B SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44, SEQ ID NO: 45 and SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48, SEQ ID NO: 49 and SEQ ID NO: 50, SEQ ID NO: 51 and SEQ ID NO: 52, SEQ ID NO: 53 and SEQ ID NO: 54, at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 55 and SEQ ID NO: 56, and SEQ ID NO: 57 and SEQ ID NO: 58;

SEQ ID NO: 59 and SEQ ID NO: 60, SEQ ID NO: 61 and SEQ ID NO: 62 for detection of mutations in CDCA2; at least one primer set selected from the group consisting of a base sequence pair represented by SEQ ID NO: 63 and SEQ ID NO: 64, and SEQ ID NO: 65 and SEQ ID NO: 66;

Base sequences represented by SEQ ID NO: 67 and SEQ ID NO: 68, SEQ ID NO: 69 and SEQ ID NO: 70, SEQ ID NO: 71 and SEQ ID NO: 72, SEQ ID NO: 73 and SEQ ID NO: 74, and SEQ ID NO: 75 and SEQ ID NO: 76 for mutation detection of CFP at least one primer set selected from the group consisting of pairs;

at least one primer set selected from the nucleotide sequence pair shown in SEQ ID NO: 77 and SEQ ID NO: 78, and SEQ ID NO: 79 and SEQ ID NO: 80 for detecting CHSY3 mutation;

At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 81 and SEQ ID NO: 82, SEQ ID NO: 83 and SEQ ID NO: 84, SEQ ID NO: 85 and SEQ ID NO: 86, and SEQ ID NO: 87 and SEQ ID NO: 88 for mutation detection of CLCN2 of primer sets;

SEQ ID NO: 89 and SEQ ID NO: 90, SEQ ID NO: 91 and SEQ ID NO: 92 for mutation detection of DHX37; SEQ ID NO: 93 and SEQ ID NO: 94, SEQ ID NO: 95 and SEQ ID NO: 96, SEQ ID NO: 97 and SEQ ID NO: 98, SEQ ID NO: 99 and SEQ ID NO: 100, SEQ ID NO: 101 and SEQ ID NO: 102, SEQ ID NO: 103 and SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106, and a base sequence pair represented by SEQ ID NO: 107 and SEQ ID NO: 108 selected from the group consisting of at least one primer set;

SEQ ID NO: 109 and SEQ ID NO: 110, SEQ ID NO: 111 and SEQ ID NO: 112, SEQ ID NO: 113 and SEQ ID NO: 114, SEQ ID NO: 115 and SEQ ID NO: 116, SEQ ID NO: 117 and SEQ ID NO: 118, and SEQ ID NO: 119 for mutation detection of EGFR and at least one primer set selected from the group consisting of a nucleotide sequence pair represented by SEQ ID NO: 120;

At least one selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 121 and SEQ ID NO: 122, SEQ ID NO: 123 and SEQ ID NO: 124, SEQ ID NO: 125 and SEQ ID NO: 126, and SEQ ID NO: 127 and SEQ ID NO: 128 for mutation detection of FCRL4 of primer sets;

At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 129 and SEQ ID NO: 130, SEQ ID NO: 131 and SEQ ID NO: 132, SEQ ID NO: 133 and SEQ ID NO: 134, and SEQ ID NO: 135 and SEQ ID NO: 136 for mutation detection of GALNT7 of primer sets;

SEQ ID NO: 137 and SEQ ID NO: 138, SEQ ID NO: 139 and SEQ ID NO: 140, SEQ ID NO: 141 and SEQ ID NO: 142, SEQ ID NO: 143 and SEQ ID NO: 144, and SEQ ID NO: 145 and SEQ ID NO: 146 for mutation detection of GRIK2 at least one primer set selected from the group consisting of pairs;

At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 147 and SEQ ID NO: 148, SEQ ID NO: 149 and SEQ ID NO: 150, SEQ ID NO: 151 and SEQ ID NO: 152, and SEQ ID NO: 153 and SEQ ID NO: 154 for IL16 mutation detection of primer sets;

at least one primer set selected from the nucleotide sequence pair shown in SEQ ID NO: 155 and SEQ ID NO: 156, and SEQ ID NO: 157 and SEQ ID NO: 158 for detecting LIMK2 mutation;

At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 159 and SEQ ID NO: 160, SEQ ID NO: 161 and SEQ ID NO: 162, SEQ ID NO: 163 and SEQ ID NO: 164, and SEQ ID NO: 165 and SEQ ID NO: 166 for mutation detection of LONP2 of primer sets;

at least one primer set selected from the nucleotide sequence pair shown in SEQ ID NO: 167 and SEQ ID NO: 168, and SEQ ID NO: 169 and SEQ ID NO: 170 for detecting mutations in MTFR1L;

At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 171 and SEQ ID NO: 172, SEQ ID NO: 173 and SEQ ID NO: 174, SEQ ID NO: 175 and SEQ ID NO: 176, and SEQ ID NO: 177 and SEQ ID NO: 178 for MYO1G mutation detection of primer sets;

SEQ ID NO: 179 and SEQ ID NO: 180, SEQ ID NO: 181 and SEQ ID NO: 182, SEQ ID NO: 183 and SEQ ID NO: 184, SEQ ID NO: 185 and SEQ ID NO: 186, SEQ ID NO: 187 and SEQ ID NO: 188, SEQ ID NO: 189 and at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 190, SEQ ID NO: 191 and SEQ ID NO: 192, SEQ ID NO: 193 and SEQ ID NO: 194, and SEQ ID NO: 195 and SEQ ID NO: 196;

At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 197 and SEQ ID NO: 198, SEQ ID NO: 199 and SEQ ID NO: 200, SEQ ID NO: 201 and SEQ ID NO: 202, and SEQ ID NO: 203 and SEQ ID NO: 204 for mutation detection of OGT of primer sets;

a primer set of at least one of the nucleotide sequence pairs shown in SEQ ID NO: 205 and SEQ ID NO: 206, and SEQ ID NO: 207 and SEQ ID NO: 208 for detecting a mutation of OR10AG1;

At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 209 and SEQ ID NO: 210, SEQ ID NO: 211 and SEQ ID NO: 212, SEQ ID NO: 213 and SEQ ID NO: 214, and SEQ ID NO: 215 and SEQ ID NO: 216 for mutation detection of PRKAG2 of primer sets;

SEQ ID NO: 217 and SEQ ID NO: 218, SEQ ID NO: 219 and SEQ ID NO: 220, SEQ ID NO: 221 and SEQ ID NO: 222, SEQ ID NO: 223 and SEQ ID NO: 224, and SEQ ID NO: 225 and SEQ ID NO: 226 for mutation detection of PROX1 at least one primer set selected from the group consisting of pairs;

at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 227 and SEQ ID NO: 228, SEQ ID NO: 229 and SEQ ID NO: 230, and SEQ ID NO: 231 and SEQ ID NO: 232 for detecting mutations in PTPRU;

At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 233 and SEQ ID NO: 234, SEQ ID NO: 235 and SEQ ID NO: 236, SEQ ID NO: 237 and SEQ ID NO: 238, and SEQ ID NO: 239 and SEQ ID NO: 240 for mutation detection of RGS9 of primer sets;

at least one primer set selected from the group consisting of a base sequence pair represented by SEQ ID NO: 241 and SEQ ID NO: 242, SEQ ID NO: 243 and SEQ ID NO: 244, and SEQ ID NO: 245 and SEQ ID NO: 246 for detecting mutations in RTN3;

SEQ ID NO: 247 and SEQ ID NO: 248, SEQ ID NO: 249 and SEQ ID NO: 250, SEQ ID NO: 251 and SEQ ID NO: 252, SEQ ID NO: 253 and SEQ ID NO: 254, SEQ ID NO: 255 and SEQ ID NO: 256, SEQ ID NO: 257 and SEQ ID NO: 257 for mutation detection of SECISBP2L at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 258, SEQ ID NO: 259 and SEQ ID NO: 260, and SEQ ID NO: 261 and SEQ ID NO: 262;

SEQ ID NO: 263 and SEQ ID NO: 264, SEQ ID NO: 265 and SEQ ID NO: 266, SEQ ID NO: 267 and SEQ ID NO: 268, SEQ ID NO: 269 and SEQ ID NO: 270, and SEQ ID NO: 271 and SEQ ID NO: 272 for mutation detection of SLF2 at least one primer set selected from the group consisting of pairs;

SEQ ID NO: 273 and SEQ ID NO: 274, SEQ ID NO: 275 and SEQ ID NO: 276, SEQ ID NO: 277 and SEQ ID NO: 278, SEQ ID NO: 279 and SEQ ID NO: 280, SEQ ID NO: 281 and SEQ ID NO: 282, SEQ ID NO: 283 and at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 284, SEQ ID NO: 285 and SEQ ID NO: 286, and SEQ ID NO: 287 and SEQ ID NO: 288;

SEQ ID NO: 289 and SEQ ID NO: 290, SEQ ID NO: 291 and SEQ ID NO: 292, SEQ ID NO: 293 and SEQ ID NO: 294, SEQ ID NO: 295 and SEQ ID NO: 296, SEQ ID NO: 297 and SEQ ID NO: 298, SEQ ID NO: 299 for mutation detection of SYNE1 SEQ ID NO: 300, SEQ ID NO: 301 and SEQ ID NO: 302, SEQ ID NO: 303 and SEQ ID NO: 304, SEQ ID NO: 305 and SEQ ID NO: 306, SEQ ID NO: 307 and SEQ ID NO: 308, SEQ ID NO: 309 and SEQ ID NO: 310, SEQ ID NO: 311 and SEQ ID NO: 312, SEQ ID NO: 313 and SEQ ID NO: 314, SEQ ID NO: 315 and SEQ ID NO: 316, SEQ ID NO: 317 and SEQ ID NO: 318, SEQ ID NO: 319 and SEQ ID NO: 320, SEQ ID NO: 321 and SEQ ID NO: 322, SEQ ID NO: 323 and SEQ ID NO: 324, SEQ ID NO: 325 and SEQ ID NO: 326, SEQ ID NO: 327 and SEQ ID NO: 328, SEQ ID NO: 329 and SEQ ID NO: 330, SEQ ID NO: 331 and SEQ ID NO: 332, and a base sequence pair represented by SEQ ID NO: 333 and SEQ ID NO: 334 selected from the group consisting of at least one primer set;

a primer set of at least one of SEQ ID NO: 335 and SEQ ID NO: 336, and a base sequence pair represented by SEQ ID NO: 337 and SEQ ID NO: 338 for detecting TINAGL1 mutation;

At least one selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 339 and SEQ ID NO: 340, SEQ ID NO: 341 and SEQ ID NO: 342, SEQ ID NO: 343 and SEQ ID NO: 344, and SEQ ID NO: 345 and SEQ ID NO: 346 for mutation detection of USP18 of primer sets; and

A primer set of at least one of the base sequence pair shown in SEQ ID NO: 347 and SEQ ID NO: 348, and SEQ ID NO: 349 and SEQ ID NO: 350 for detecting ZNF33A mutation.

The kit of the present invention prepared as described above is very economical because it saves time and money compared to the conventional general gene mutation search method. Using existing gene mutation detection methods such as Single Strand Conformational Polymorphism (SSCP), Protein Truncation Test (PTT), cloning, and direct sequencing, it takes several days on average to test all one gene. It takes several months. In addition, although next generation sequencing (NGS) can detect gene mutations, there is a problem in that the cost is high. In the case of testing mutations by existing analysis methods such as SSCP, cloning, direct sequencing, and RFLP (Restriction Fragment Length Polymorphism), it takes about a month to complete the test, whereas using the kit of the present invention, the sample DNA is prepared If it is done, results can be obtained within about 10 to 11 hours, and since a primer set capable of detecting mutations is integrated in one chip, not only time but also cost can be reduced compared to the conventional method. Compared to the existing method, the average cost of reagents is less than half per experiment, so even greater cost savings can be expected when considering the researcher's labor costs.

2. Method of providing information necessary for prognostic diagnosis of kidney cancer using survival-specific mutant gene

Another aspect of the present invention comprises the steps of preparing a sample DNA from a sample of a renal cancer patient; amplifying the sample DNA using the kit for prognostic diagnosis of renal cancer of claim 1; and confirming the presence or absence of a mutation from the amplification result; provides a method for providing information necessary for prognostic diagnosis of kidney cancer, including.

The description of the 'Kit for Prognostic Diagnosis of Kidney Cancer' is the same as described in ' 1. Survival-specific mutated genes in kidney cancer patients and primer sets capable of detecting these mutated genes ', and thus detailed descriptions will be omitted.

As used herein, the term 'sample' includes any biological sample obtained from a patient. Samples include whole blood, plasma, serum, red blood cells, white blood cells (eg peripheral blood monocytes), ductal fluid, ascites, pleural efflux, nipple aspirate, lymphatic fluid (eg, disseminated tumors of lymph nodes). cells), bone marrow aspirate, saliva, urine, feces (i.e. feces), sputum, bronchial lavage fluid, tears, microneedle aspirate (e.g. harvested by random mammary microneedle aspiration), any other bodily fluid, tissue A sample (eg tumor tissue) such as a tumor biopsy (eg puncture biopsy) or lymph node (eg sentinel lymph node biopsy), a tissue sample (eg tumor tissue), eg surgical resection of a tumor , and cell extracts thereof. In some embodiments, the sample is whole blood or some component thereof, such as plasma, serum or cell pellet. In another embodiment, the sample is obtained by isolating circulating cells of a solid tumor from whole blood or a cell fraction thereof using any technique known in the art. In another embodiment, the sample is a formalin-fixed paraffin-embedded (FFPE) tumor tissue sample from a solid tumor, eg, colorectal cancer.

In certain embodiments, the sample is a tumor lysate or extract prepared from frozen tissue obtained from a subject with colorectal cancer.

The term 'patient' usually includes humans as well as other animals, such as other primates, rodents, dogs, cats, horses, sheep, pigs, and the like.

The method can predict the overall survival or disease-free survival of renal cancer patients.

As used herein, the term 'overall survival' includes a clinical endpoint describing a patient who is alive for a finite time after being diagnosed with or treated for a disease, such as cancer, and the survival rate with or without cancer recurrence. means possibility.

In the present invention, the term 'disease-free survival (DFS)' includes the survival period of a patient whose disease recurs after treatment for a specific disease (eg, cancer).

In the present invention, by analyzing the presence of a mutation in a gene of the present invention in a sample of a kidney cancer patient, it is possible to determine what prognosis an individual having the target sample has for cancer. This method can also be achieved by comparing the total survival or disease-free survival of subjects in a control group that does not have a mutation known to have a good prognosis. In the present invention, an individual known to have a good prognosis means an individual without a history of metastasis, recurrence, death, etc. after cancer has developed.

A sample of an individual suspected of having cancer refers to a sample of an individual or tissue in which cancer or tumor has already occurred or is expected to occur, and is a target sample for diagnosing the prognosis.

DHX37, FAM178A, FCRL4, GALNT7, GRIK2, PRKAG2, USP18, BAZ2B, CDCA2, CFP, CHSY3, CLCN2, IL16, OBSCN, OR10AG1, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SPTB33A, MYO1G, and SPTBN When a mutation is identified in at least one gene selected from the gene group consisting of, determining that the survival rate of the subject is not good; may further include.

In one embodiment of the present invention, DHX37, FAM178A, FCRL4, GALNT7, GRIK2, PRKAG2, USP18, at least one gene selected from the group consisting of BAZ2B, CDCA2, CFP, CHSY3, CLCN2, IL16, OBSCN, OR10AG1, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SYNE1, ZNF33A, MYO1G, OGT and SPTBN1 is mutated In renal cancer patients, the survival rate was lower than in renal cancer patients in which the gene was not mutated (see Tables 1 and 2).

TINAGL1, FAM178A (SLF2), FCRL4, PRKAG2, USP18, BAZ2B, CDCA2, CFP, CHSY3, CLCN2, IL16, OBSCN, OR10AG1, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SYNE1, ZNF33A, EGFR, FAM54B (MTFR1L) , when a mutation is identified in at least one gene selected from the gene group consisting of LIMK2 and LONP2, determining that the subject has a high recurrence rate of kidney cancer; may further include.

In one embodiment of the present invention, TINAGL1, FAM178A(SLF2), FCRL4, PRKAG2, USP18, BAZ2B, CDCA2, CFP, CHSY3, CLCN2, IL16, OBSCN, OR10AG1, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SYNE1, Renal cancer patients with a mutation in at least one gene selected from the gene group consisting of ZNF33A, EGFR, FAM54B (MTFR1L), LIMK2 and LONP2 have a higher rate of recurrence of kidney cancer compared to patients with kidney cancer in which the gene is not mutated. high (see Table 1 and Table 2).

As such, the mutants of the genes of the present invention, BAZ2B, CDCA2, CFP, CHSY3, CLCN2, DHX37, EGFR, FAM178A (SLF2), FAM54B (MTFR1L), FCRL4, GALNT7, GRIK2, IL16, LIMK2, LONP2, MYO1G, OBSCN, OGT, OR10AG1, PRKAG2, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SPTBN1, SYNE1, TINAGL1, USP18 and ZNF33A using a mutation of at least one gene selected from the gene group consisting of It has yet to be revealed as to what can be diagnosed. In addition, it has not been reported that the total survival rate or disease-free survival rate may be different for each gene. The present inventors have identified for the first time that mutants of the above genes can be used as diagnostic markers for diagnosing the prognosis of renal cancer patients.

The method of providing information necessary for prognostic diagnosis of renal cancer of the present invention may be used to increase the survival rate or decrease the recurrence rate of renal cancer patients. Through the method for prognostic diagnosis of renal cancer of the present invention, the survival rate or recurrence rate of renal cancer patients can be predicted, so it is possible to provide information in not only discovering a therapeutic agent suitable for each patient but also in selecting a treatment method, Therapeutic strategies can be designed effectively.

Hereinafter, the present invention will be described in detail by way of Examples and Experimental Examples.

However, the following Examples and Experimental Examples are only for illustrating the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

Securing genetic and clinical information

First, the genes of the present invention (BAZ2B, CDCA2, CFP, CHSY3, CLCN2, DHX37, EGFR, FAM178A(SLF2), FAM54B(MTFR1L), FCRL4, GALNT7, GRIK2, IL16, LIMK2, LONP2, MYO1G, OBSCN, OGT To determine whether OR10AG1, PRKAG2, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SPTBN1, SYNE1, TINAGL1, USP18 and ZNF33A) can be utilized as renal cancer markers, genetic information and clinical information from The Cancer Genome Atlas (TCGA) Data from 417 kidney cancer patients for whom all information was secured were obtained and used for analysis.

Tables 1 and 2 below show the number of mutations in each gene, mutation rate, mutation type, cytoband, metastasis stage (M0: no distant metastasis, M1: with distant metastasis), metastasis rate, and P-value of total survival (mutagenesis) and survival rate), and the P-value of disease-free survival (the association between mutation and disease-free survival). In addition, the mutated positions of each gene are shown in Tables 3 to 9. The overall survival kaplan-meier estimate and the disease-free survival kaplan-meier estimate were obtained by the Kaplan Meier survival assay (Spss 21) as in Example 2 below. In the total survival period, the event was defined as death, and in the disease-free survival period, the event was defined as the recurrence of renal cancer. In order to determine whether the occurrence of mutations in each of the genes is correlated with death or recurrence of kidney cancer, based on the event time of each group obtained in the Kaplan Meier survival assay, the occurrence of mutations and The association of total survival and the association of mutagenesis and disease-free survival were confirmed by log rank test. A P-value of less than 0.05 was considered statistically significant.

gene number of mutations Mutation (%) Mutation type Cyto band transition transition(%) total survival
(p-value) disease-free survival
(p-value) cut Miss Sense (P) missense (D) in-frame MO M1 ANKRD55 3 0.72 0 2 0 One 5q11.2 2 One 33.3 0.0517 0.556 ARID1A 21 5.04 17 4 0 0 1p36.11 20 One 4.8 0.281 0.302 ASPH null 8q12.3 null BAP1 37 8.89 25 8 3 One 3p21.1 26 11 29.7 0.0657 0.0773 BAZ2B 10 2.4 One 9 0 0 2q24.2 7 3 42.9 0.00147 0.00228 BCL9 4 0.96 2 2 0 0 1q21.2 3 One 25 0.145 0.156 CDCA2 4 0.96 0 4 0 0 8p21.2 3 One 25 1.86E-07 0.00373 CFP 4 0.96 One 3 0 0 Xp11.23 3 One 25 2.29E-04 2.92E-04 CHSY3 3 0.72 0 3 0 0 5q23.3 0 3 100 0.00319 2.66E-04 CLCN2 5 1.2 One 2 0 2 3q27.1 2 3 60 1.45E-04 1.79E-10 DHX37 9 2.16 2 6 0 One 12q24.31 7 2 22.2 0.00918 0.578 DSP 4 0.96 0 4 0 0 6p24.3 2 2 50 0.587 0.947 EGFR 8 1.92 One 3 4 0 7p11.2 6 2 25 0.155 0.0267 FAM178A
(SLF2) 4 0.96 One 3 0 0 10q24.31 3 One 25 8.53E-08 5.27E-05 FAM54B
(MTFR1L) 2
0.48
One
One
0
0
1p36.11
One
One
50
0.607
0.00261
FCRL4 4 0.96 0 4 0 0 1q23.1 2 2 50 1.05E-06 3.01E-07 GALNT7 5 1.2 One 4 0 0 4q34.1 3 2 40 3.80E-04 0.638 GRIK2 4 0.96 0 4 0 0 6q16.3 2 2 50 0.0227 0.331 IL16 4 0.96 0 4 0 0 15q25.1 2 2 50 0.00158 1.11E-16 LIMK2 2 0.48 0 2 0 0 22q12.2 2 0 0 0.151 0.00322 LONP2 3 0.72 0 3 0 0 16q12.1 One 2 66.7 0.0709 0.00873 MARS2 3 0.72 0 3 0 0 2q33.1 2 One 33.3 0.0576 0.497 MYO1G 3 0.72 0 3 0 0 7p13 2 One 33.3 0.0135 NULL OBSCN 4 0.96 0 4 0 0 1q42.13 4 0 0 0.00406 0.00103

gene number of mutations Mutation (%) Mutation type Cyto band transition transition(%) total survival
(p-value) disease-free survival
(p-value) cut missense
(P) missense
(D) in-frame MO M1 OGT 4 0.96 0 4 0 0 Xq13.1 4 0 0 2.71E-04 0.0624 OR10AG1 2 0.48 0 2 0 0 11q12.1 One One 50 0.0155 0.00842 PRKAG2 4 0.96 0 3 0 One 7q36.1 2 2 50 4.10E-05 8.35E-12 PROX1 8 1.92 3 5 0 0 1q32.3 7 One 12.5 2.50E-04 0.0285 PTPRU 3 0.72 0 3 0 0 1p35.3 2 One 33.3 0.00606 0.0211 RGS9 3 0.72 0 3 0 0 17q24.1 2 One 33.3 0.00162 7.01E-04 RTN3 3 0.72 0 3 0 0 11q13.1 2 One 33.3 0.00154 0.0114 SECISBP2L 7 1.68 2 5 0 0 15q21.1 5 2 28.6 0.0281 0.0018 SPTBN1 5 1.2 2 3 0 0 2p16.2 4 One 20 0.00613 0.163 SYNE1 15 3.6 3 10 2 0 6q25.2 9 6 40 2.77E-04 4.06E-07 TINAGL1 2 0.48 0 2 0 0 1p35.2 One One 50 0.132 0.0245 TP53 11 2.64 5 One 5 0 17p13.1 10 One 9.1 0.183 0.584 USP18 4 0.96 0 4 0 0 22q11.21 2 2 50 2.55E-05 0.00113 ZNF33A 4 0.96 2 2 0 0 10p11.1 3 One 25 0.0239 0.00102

Gene (Accession) AA change Type Copy # COSMIC Mutation Assessor
Prediction Score Chromosome Start Pos End Pos Reference variant USP18 (NM_017414.3) R44S Missense Diploid 2 Neutral chr22 18640560 18640560 C A USP18 P45S Missense ShallowDel 2 Neutral chr22 18640563 18640563 C T USP18 T80N Missense Diploid One Low chr22 18643020 18643020 C A USP18 X134_splice Splice NA chr22 18650021 18650021 G C USP18 N325S Missense Diploid 2 Low chr22 18655999 18655999 A G CDCA2 (NM_152562.3) S210Y Missense Diploid One Low chr8 25325823 25325823 C A CDCA2 I246V Missense Diploid One Neutral chr8 25327412 25327412 A G CDCA2 G742V Missense Diploid One Neutral chr8 25364407 25364407 G T CDCA2 A876V Missense Diploid One Low chr8 25364809 25364809 C T FAM54B (MTFR1L) (NM_001099627.1) X80_splice Splice Diploid chr1 26152903 26152903 G T FAM54B (MTFR1L) P94H Missense ShallowDel Low chr1 26153147 26153147 C A PTPRU(NM_005704.4) R771L Missense Diploid One Low chr1 29611375 29611375 G T PTPRU R835L Missense ShallowDel 2 Medium chr1 29618536 29618536 G T PTPRU R974G Missense Diploid One High chr1 29638000 29638000 C G LIMK2 (NM_016733.2) L232P Missense Diploid Medium chr22 31658681 31658681 T C LIMK2 P403L Missense Diploid Medium chr22 31664140 31664140 C T TINAGL1 (NM_022164.2) C226F Missense ShallowDel One High chr1 32050373 32050373 G T TINAGL1 C309Vfs*2 FS del ShallowDel chr1 32050813 32050813 C - ZNF33A(NM_006954.1) Y162* FS del Diploid chr10 38343536 38343539 TATT - ZNF33A K166M Missense Diploid Low chr10 38343549 38343549 A T ZNF33A D272E Missense Diploid Neutral chr10 38343868 38343868 C A ZNF33A Y275H Missense NA Medium chr10 38343875 38343875 T C ZNF33A S291Lfs*8 FS del Diploid chr10 38343924 38343924 C - MYO1G (NM_033054.2) T698S Missense Diploid One Medium chr7 45005737 45005737 T A MYO1G K418M Missense Diploid One Medium chr7 45009718 45009718 T A MYO1G K418* Nonsense NA One chr7 45009719 45009719 T A MYO1G P225S Missense Gain One Medium chr7 45011770 45011770 G A MYO1G M166V Missense NA One Low chr7 45015151 45015151 T C

Gene(Accession) AA change Type Copy # COSMIC "Mutation Assesor Prediction Score Chromosome Start Pos End Pos Reference variant CFP (NM_002621.2) R359Q Missense Diploid One Low chrX 47485783 47485783 C T CFP E323Gfs*34 FS ins Gain One chrX 47485891 47485892 - C CFP T151I Missense NA One High chrX 47486992 47486992 G A CFP P144L Missense NA 2 Medium chrX 47487013 47487013 G A CFP E135K Missense Diploid One Low chrX 47487501 47487501 C T CFP S27L Missense Diploid 2 Medium chrX 47489070 47489070 G A LONP2 (NM_031490.4) Q112H Missense Diploid One Low chr16 48286144 48286144 G C LONP2 L440V Missense Gain One Medium chr16 48311325 48311325 C G LONP2 I627M Missense NA One Neutral chr16 48368212 48368212 T G LONP2 K786E Missense Diploid One High chr16 48385510 48385510 A G SECISBP2L(NM_001193489.1) E990D Missense ShallowDel Low chr15 49284777 49284777 T A SECISBP2L G962S Missense Diploid Low chr15 49284863 49284863 C T SECISBP2L V869E Missense Diploid Low chr15 49288581 49288581 A T SECISBP2L V789Sfs*2 FS ins Diploid chr15 49292068 49292069 - T SECISBP2L F700L Missense Diploid Medium chr15 49293222 49293222 G T SECISBP2L S654I Missense Diploid Low chr15 49301479 49301479 C A SECISBP2L P652R Missense Diploid Medium chr15 49301485 49301485 G C SECISBP2L C275* Nonsense Gain One chr15 49320719 49320719 G T SECISBP2L N193Kfs*2 FS del NA One chr15 49325247 49325247 A - SPTBN1 (NM_003128.2) I45F Missense Diploid One Medium chr2 54753688 54753688 A T SPTBN1 F855V Missense NA One Medium chr2 54856834 54856834 T G SPTBN1 H1316P Missense NA One High chr2 54870208 54870208 A C SPTBN1 K1354Nfs*39 FS del Diploid chr2 54871514 54871514 A - SPTBN1 A1875V3D Missense Diploid One Medium chr2 54880792 54880792 C T SPTBN1 E2007*3D Nonsense Diploid One chr2 54883108 54883108 G T SPTBN1 N2205K3D Missense Diploid One Low chr2 54891784 54891784 T A SPTBN1 G2343S Missense Diploid One Low chr2 54895638 54895638 G A

Gene(Accession) AA change Type Copy # COSMIC "Mutation Assesor Prediction Score Chromosome Start Pos End Pos Reference variant EGFR(NM_005228.4) G225C Missense NA One Medium chr7 55220283 55220283 G T EGFR L267Tfs*32 FS ins Diploid chr7 55221747 55221748 - C EGFR E330K Missense Diploid One Low chr7 55223621 55223621 G A EGFR H805R Missense Gain One Low chr7 55249116 55249116 A G EGFR R832H Missense Diploid 4 Low chr7 55259437 55259437 G A EGFR L838M Missense Diploid 7 High chr7 55259454 55259454 C A EGFR L838M Missense Diploid 7 High chr7 55259454 55259454 C A EGFR L838P Missense Gain 7 High chr7 55259455 55259455 T C EGFR S1042N Missense Gain One Medium chr7 55269438 55269438 G A OR10AG1(NM_001005491.1) L204F Missense Diploid 2 Low chr11 55735328 55735328 C A OR10AG1 L156F Missense Diploid 2 Neutral chr11 55735474 55735474 G A RGS9 (NM_003835.3) N38K3D Missense Diploid One Low chr17 63149596 63149596 C A RGS9 V60F3D Missense Diploid One Neutral chr17 63154436 63154436 G T RGS9 R515W Missense ShallowDel 4 Low chr17 63221255 63221255 C T RGS9 R549Pfs*27 FS ins Diploid chr17 63221351 63221352 - C RTN3 (NM_001265589.1) E260D Missense Diploid Low chr11 63486754 63486754 A C RTN3 S312N Missense Diploid Neutral chr11 63486909 63486909 G A RTN3 E622K Missense Diploid Low chr11 63487838 63487838 G A OGT(NM_181672.2) G35V Missense Diploid Low chrX 70756094 70756094 G T OGT R348S Missense Diploid Low chrX 70775921 70775921 C A OGT S399F Missense Diploid Neutral chrX 70776831 70776831 C T OGT V843I Missense Diploid Low chrX 70784541 70784541 G A IL16 (NM_172217.3) R134M Missense Diploid One Medium chr15 81552201 81552201 G T IL16 L450I Missense NA Medium chr15 81582809 81582809 C A IL16 G464V Missense Diploid One Medium chr15 81582852 81582852 G T IL16 G749E Missense Diploid Low chr15 81591913 81591913 G A IL16 A1291V Missense Diploid Low chr15 81601012 81601012 C T

Gene (Accession) AA change Type Copy # COSMIC "Mutation Assesor Prediction Score Chromosome Start Pos End Pos Reference variant GRIK2 (NM_021956.4) T425K Missense Diploid One Medium chr6 102266315 102266315 C A GRIK2 W613* Nonsense NA One chr6 102372566 102372566 G A GRIK2 R748Q Missense Diploid 2 Neutral chr6 102483373 102483373 G A GRIK2 K797R Missense Diploid One Low chr6 102503283 102503283 A G GRIK2 N802S Missense ShallowDel One Neutral chr6 102503298 102503298 A G GRIK2 N849Kfs*11 FS ins Diploid chr6 102503431 102503432 - A FAM178A
(SLF2)(NM_018121.3) G118R Missense Diploid Low chr10 102676494 102676494 G C FAM178A
(SLF2) H126R Missense Diploid Neutral chr10 102676519 102676519 A G FAM178A
(SLF2) K235Nfs*6 FS del Diploid chr10 102676845 102676845 A - FAM178A
(SLF2) K235N Missense Diploid Neutral chr10 102676847 102676847 A T FAM178A
(SLF2) S515C Missense Diploid Neutral chr10 102684302 102684302 C G FAM178A
(SLF2) L1048F Missense ShallowDel Medium chr10 102709854 102709854 C T FAM178A
(SLF2) D1142E Missense ShallowDel Medium chr10 102719193 102719193 C A DHX37 (NM_032656.3) K990N Missense Diploid One Medium chr12 125435249 125435249 C G DHX37 X957_splice Splice Gain chr12 125435351 125435351 C T DHX37 S831G Missense Diploid One Neutral chr12 125438720 125438720 T C DHX37 A669T Missense Gain One Medium chr12 125448980 125448980 C T DHX37 MUTATED splice_region Gain chr12 125449470 125449470 G A DHX37 L388P Missense Gain One High chr12 125455876 125455876 A G DHX37 R249W Missense Diploid 3 Low chr12 125462030 125462030 G A DHX37 M214V Missense Gain One Neutral chr12 125465134 125465134 T C DHX37 M214V Missense Gain One Neutral chr12 125465134 125465134 T C DHX37 K129T Missense Diploid One Low chr12 125467060 125467060 T G DHX37 E26Sfs*15 FS del Gain chr12 125473494 125473494 G - CHSY3 (NM_175856.4) K299N Missense NA One Medium chr5 129243864 129243864 G C CHSY3 K619N Missense Gain 2 Medium chr5 129520692 129520692 G C CHSY3 H622N Missense Gain One Neutral chr5 129520699 129520699 C A CHSY3 I628M Missense AMP One Neutral chr5 129520719 129520719 C G

Gene
(Accession) AA change Type Copy # COSMIC "Mutation Assesor Prediction Score Chromosome Start Pos End Pos Reference variant PRKAG2 (NM_016203.3) V463G Missense Gain One High chr7 151262817 151262817 A C PRKAG2 I391_G393delinsM IF del Diploid chr7 151265857 151265862 CCACTG - PRKAG2 F149S Missense Diploid 2 Low chr7 151478258 151478258 A G PRKAG2 A44V Missense Gain One Low chr7 151483611 151483611 G A SYNE1 (NM_182961.3) E8769V Missense ShallowDel One Medium chr6 152443659 152443659 T A SYNE1 Q8752H Missense NA One Low chr6 152443709 152443709 C A SYNE1 R8468H Missense NA 14 Low chr6 152461140 152461140 C T SYNE1 R8468S Missense Diploid 14 Low chr6 152461141 152461141 G T SYNE1 V8096Hfs*15 FS del Diploid chr6 152473119 152473120 AC - SYNE1 Q7230* Nonsense Diploid One chr6 152542150 152542150 G A SYNE1 E7207* Nonsense NA chr6 152542598 152542598 C A SYNE1 L6746V Missense Diploid One Medium chr6 152557402 152557402 A C SYNE1 X6733_splice Splice ShallowDel chr6 152557951 152557951 C T SYNE1 Q6554R Missense Diploid One Medium chr6 152565703 152565703 T C SYNE1 K5499T Missense Diploid 4 Low chr6 152639292 152639292 T G SYNE1 R5087W Missense Diploid 3 Neutral chr6 152647465 152647465 G A SYNE1 A4515G Missense NA One Low chr6 152652276 152652276 G C SYNE1 Q4029H Missense Diploid One Low chr6 152665354 152665354 C A SYNE1 Q2734K Missense ShallowDel One Medium chr6 152708494 152708494 G T SYNE1 L2692M Missense Diploid One Low chr6 152711518 152711518 A T SYNE1 K2554N Missense Diploid One Medium chr6 152716701 152716701 T G SYNE1 E1651K Missense ShallowDel One Medium chr6 152749365 152749365 C T SYNE1 A1393V Missense Diploid One Low chr6 152757208 152757208 G A SYNE1 K919N Missense Diploid One Low chr6 152776696 152776696 C A SYNE1 Q846* Nonsense ShallowDel One chr6 152779924 152779924 G A SYNE1 G688W Missense ShallowDel One Medium chr6 152784523 152784523 C A SYNE1 M339T Missense Diploid One Low chr6 152809562 152809562 A G SYNE1 T229I Missense NA One Low chr6 152826428 152826428 G A

Gene
(Accession) AA change Type Copy # COSMIC "Mutation Assesor Prediction Score Chromosome Start Pos End Pos Reference variant FCRL4
(NM_031282.2) L346Pfs*28 FS del NA chr1 157556056 157556056 A - FCRL4 P295L Missense Diploid One Medium chr1 157556209 157556209 G A FCRL4 K185R Missense Diploid One Low chr1 157557663 157557663 T C FCRL4 I168V Missense Diploid One Low chr1 157557715 157557715 T C FCRL4 A18T Missense Diploid One Medium chr1 157566118 157566118 C T BAZ2B
(NM_013450.3) E1830* Nonsense Gain One chr2 160194250 160194250 C A BAZ2B G1717V Missense Diploid One Medium chr2 160205332 160205332 C A BAZ2B R1565G Missense Diploid One Medium chr2 160206389 160206389 G C BAZ2B W1246C Missense Diploid One Medium chr2 160240140 160240140 C A BAZ2B S1226G Missense NA One Low chr2 160241676 160241676 T C BAZ2B I1153K Missense Diploid One Neutral chr2 160242877 160242877 A T BAZ2B E1064Q Missense Gain One Medium chr2 160245882 160245882 C G BAZ2B R1021H Missense NA One Low chr2 160252293 160252293 C T BAZ2B Q854K Missense Diploid One Neutral chr2 160268963 160268963 G T BAZ2B E616D Missense Diploid One Neutral chr2 160289320 160289320 T G BAZ2B S561N Missense Diploid One Low chr2 160289486 160289486 C T BAZ2B H560Q Missense Diploid 2 Low chr2 160289488 160289488 A T BAZ2B Q321H Missense Diploid One Low chr2 160295144 160295144 C A BAZ2B H295Q Missense Diploid One Low chr2 160295535 160295535 A T BAZ2B S241T Missense NA One Low chr2 160295698 160295698 C G

Gene
(Accession) AA change Type Copy # COSMIC "Mutation Assesor Prediction Score Chromosome Start Pos End Pos Reference variant GALNT7
(NM_017423.2) R10Nfs*13 FS ins ShallowDel chr4 174090012 174090013 - AA GALNT7 H253R Missense Diploid One Medium chr4 174216550 174216550 A G GALNT7 L361I Missense ShallowDel One Low chr4 174219381 174219381 C A GALNT7 K363R Missense Diploid One Low chr4 174219388 174219388 A G GALNT7 G390R Missense Diploid 2 High chr4 174223217 174223217 G C CLCN2
(NM_004366.5) R881H Missense Gain One Neutral chr3 184064449 184064449 C T CLCN2 E871Gfs*35 FS del Diploid chr3 184064478 184064479 CT - CLCN2 L724P Missense Diploid One Medium chr3 184070571 184070571 A G CLCN2 R646dup IF ins Gain chr3 184071131 184071132 - CGG CLCN2 G498Afs*14 FS del NA chr3 184072353 184072353 C - PROX1
(NM_001270616) M85I Missense Diploid One Low chr1 214170133 214170133 G A PROX1 E139Rfs*15 FS ins Diploid chr1 214170285 214170286 - C PROX1 R156H Missense ShallowDel 3 Low chr1 214170345 214170345 G A PROX1 I172L Missense Diploid One Medium chr1 214170392 214170392 A T PROX1 V225D Missense Diploid 2 Low chr1 214170552 214170552 T A PROX1 K240N Missense Diploid One Medium chr1 214170598 214170598 A T OBSCN
(NM_001271223.2) E268K Missense Diploid One Neutral chr1 228400286 228400286 G A OBSCN Q1913* Nonsense Diploid chr1 228459673 228459673 C T OBSCN A3942V Missense Diploid Low chr1 228479797 228479797 C T OBSCN C5529F Missense Diploid Medium chr1 228505318 228505318 G T OBSCN R6172C Missense Diploid Medium chr1 228511298 228511298 C T OBSCN E6502G Missense NA Low chr1 228524801 228524801 A G OBSCN W8453R Missense NA High chr1 228562116 228562116 T C OBSCN V8800F Missense NA Low chr1 228565661 228565661 G T OBSCN R8898Q Missense NA Low chr1 228566417 228566417 G A

As a result, when a mutation occurred in the gene of the present invention, the P-value was less than 0.05, which was confirmed to be correlated with the total survival rate or disease-free survival rate. On the other hand, ANKRD55, ARID1A, BAP1, BCL9, DSP, MARS2, and TP53 are genes that have mutations in kidney cancer patients. As such, even if a gene is specifically mutated in kidney cancer patients, depending on the gene, the correlation between the mutation of the gene and the total survival time, or the mutation of the gene and the disease-free survival period It was found that the correlation was different. Example 2 shows the results of survival analysis of the genes of the present invention, which had a very significant correlation between mutation and total survival/disease-free survival.

Confirmation of feasibility as a survival-specific marker

The 417 target patients secured in Example 1 were classified into surviving patients (271 patients) and deceased patients (146 patients), and comparative analysis was performed. Among the 417 patients with kidney cancer, 146 patients died, accounting for 35% of the total. Total survival period or disease-free survival period was calculated by Kaplan Meier survival analysis method based on the clinical information (event (death or recurrence), observation time) obtained in Example 1. The experimental group was defined as the case with alterations in query gene, and the control group was the case without alterations in query gene. The results of the survival analysis for each gene are shown in FIGS. 1 to 30 . The median months survival means a value located at the center when the survival periods of patients in the corresponding group are listed. The slope in the survival curve by the Kaplan Meier survival assay is determined by the duration of survival.

As a result, when the genes of the present invention have mutations, the median survival period is about 27 months, and when the genes of the present invention do not have mutations, the median survival period is about 90 months. It was found that the median survival time was significantly lower when there were mutations in the genes.

As can be seen from (A) of FIG. 1, BAZ2B survived more than 50% of kidney cancer patients for which the mutation in the BAZ2B gene did not occur for more than 80 months (blue), whereas the mutation in the BAZ2B gene occurred As more than 50% of renal cancer patients died before 30 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 1, in the case of kidney cancer patients in which the mutation in the BAZ2B gene did not occur, more than 50% of the patients had no recurrence for more than 100 months (blue), but if there was a mutation in the BAZ2B gene, it was less than 20 months, so the kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the BAZ2B gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation of the BAZ2B gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from FIG. 2 , CDCA2 was significantly shorter in both total survival and disease-free survival in the mutated patients. Therefore, it can be seen that the mutation of the CDCA2 gene is significant as a predictive marker for the survival rate of renal cancer patients or recurrence of renal cancer.

As can be seen from (A) of FIG. 3 , CFP in the case of kidney cancer patients in which the mutation in the CFP gene did not occur, 50% or more survived for more than 80 months (blue), whereas the mutation in the CFP gene occurred As more than 50% of kidney cancer patients died at 20 months, it was confirmed that the survival rate of kidney cancer patients was lower than that of kidney cancer patients without mutation (red). According to (B) of FIG. 3 , in the case of kidney cancer patients in which the CFP gene mutation did not occur, more than 50% of the patients had no recurrence for more than 100 months (blue), but if there was a mutation in the CFP gene, the kidney cancer patients were less than 20 months old. Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the CFP gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation of the CFP gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (A) of FIG. 4, in the case of kidney cancer patients in which the CHSY3 gene is not mutated, more than 50% of CHSY3 survived for more than 80 months (blue), whereas the CHSY3 gene is mutated. As more than 50% of kidney cancer patients died before the age of 40 months, it was confirmed that the survival rate was lower than that of kidney cancer patients without mutation (red). According to (B) of Figure 4, in the case of kidney cancer patients in which the mutation in the CHSY3 gene did not occur, more than 50% did not recur for more than 100 months (blue), but if there was a mutation in the CHSY3 gene, it was less than 20 months, so the kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the CHSY3 gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation of the CHSY3 gene is significant as a survival rate of kidney cancer patients or a predictive marker of kidney cancer recurrence.

As can be seen from (A) of FIG. 5, in the case of kidney cancer patients in which the CLCN2 gene is not mutated, CLCN2 survives for more than 80 months (blue), whereas the CLCN2 gene is mutated. As more than 50% of renal cancer patients died before the age of 20 months, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 5, in the case of kidney cancer patients in which the mutation in the CLCN2 gene did not occur, more than 50% had no recurrence for more than 100 months (blue), but if there was a mutation in the CLCN2 gene, it was less than 20 months. Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the CLCN2 gene, the probability of death or recurrence due to kidney cancer increases. Therefore, it can be seen that the mutation of the CLCN2 gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (A) of FIG. 6 , DHX37 survived more than 80 months in kidney cancer patients in which the DHX37 gene was not mutated (blue), whereas the DHX37 gene was mutated. As more than 50% of kidney cancer patients died before the age of 60 months, it was confirmed that the survival rate was lower than that of kidney cancer patients without mutation (red). Therefore, when there is a mutation in the DHX37 gene, the probability of death due to kidney cancer increases, so it can be seen that the mutation of the DHX37 gene is significant as a marker for predicting the survival rate of patients with kidney cancer.

According to (B) of FIG. 7 , in the case of renal cancer patients in which the mutation in the EGFR gene did not occur, more than 50% of the patients with EGFR had no recurrence for more than 100 months (blue), but if there was a mutation in the EGFR gene, the kidney was not in 30 months. Renal cancer recurred in more than 50% of cancer patients, and survival was difficult to follow in 3 patients (red). Therefore, when there is a mutation in the EGFR gene, the probability of recurrence due to kidney cancer increases, so it can be seen that the mutation of the EGFR gene is significant as a predictive marker for recurrence of kidney cancer.

As can be seen from (A) of FIG. 8, in the case of kidney cancer patients in which the FAM178A gene is not mutated, 50% or more survived more than 80 months (blue), whereas the FAM178A gene was mutated. Since more than 50% of renal cancer patients died before 10 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 8, in the case of renal cancer patients in which the mutation in the FAM178A gene did not occur, 50% or more did not recur for more than 100 months (blue), but if there was a mutation in the FAM178A gene, it was less than 10 months. Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the FAM178A gene, since the probability of death or recurrence due to kidney cancer increases, it can be seen that the mutation of the FAM178A gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (B) of FIG. 9 , in the case of renal cancer patients in which the FAM54B gene mutation did not occur, more than 50% of the patients with FAM54B had no recurrence for more than 100 months (blue), but if there was a mutation in the FAM54B gene, 10 In less than a month, the kidney cancer appeared to recur (red). Therefore, when there is a mutation in the FAM54B gene, the probability of recurrence due to kidney cancer increases, so it can be seen that the mutation in the FAM54B gene is significant as a predictive marker for recurrence of kidney cancer.

As can be seen from (A) of FIG. 10 , in the case of kidney cancer patients in which the FCRL4 gene is not mutated, more than 50% of the FCRL4 survived more than 90 months (blue), whereas the mutation in the FCRL4 gene occurred. Since more than 50% of renal cancer patients died before 10 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 10, in the case of kidney cancer patients in which the mutation in the FCRL4 gene did not occur, more than 50% of the patients had no recurrence for more than 100 months (blue), but if there was a mutation in the FCRL4 gene, it was less than 10 months in the kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the FCRL4 gene, the probability of death or recurrence due to kidney cancer increases. Therefore, it can be seen that the mutation in the FCRL4 gene is significant as a survival rate of kidney cancer patients or a predictive marker of kidney cancer recurrence.

As can be seen from (A) of FIG. 11 , in the case of kidney cancer patients in which the GALNT7 gene mutation did not occur, more than 50% of GALNT7 survived for more than 80 months (blue), whereas the GALNT7 gene mutation occurred Since more than 50% of renal cancer patients died before 10 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). Therefore, when there is a mutation in the GALNT7 gene, the probability of death due to kidney cancer increases, so it can be seen that the mutation in the GALNT7 gene is significant as a predictive marker for the survival rate of patients with kidney cancer.

As can be seen from (A) of FIG. 12 , in the case of kidney cancer patients in which the GRIK2 gene is not mutated, GRIK2 survives for more than 80 months (blue), whereas the GRIK2 gene is mutated. As more than 50% of kidney cancer patients died before the age of 60 months, it was confirmed that the survival rate was lower than that of kidney cancer patients without mutation (red). Therefore, when there is a mutation in the GRIK2 gene, the probability of death due to kidney cancer increases, so it can be seen that the mutation in the GRIK2 gene is significant as a marker for predicting the survival rate of patients with kidney cancer.

As can be seen from (A) of FIG. 13 , in the case of renal cancer patients in which the IL16 gene is not mutated, 50% or more survived more than 90 months (blue), whereas the IL16 gene was mutated. As more than 50% of renal cancer patients died before 30 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of FIG. 13 , in the case of kidney cancer patients in which the mutation in the IL16 gene did not occur, more than 50% of the patients had no recurrence for more than 100 months (blue), but if there was a mutation in the IL16 gene, it was less than 10 months in the kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the IL16 gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation of the IL16 gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (B) of FIG. 14, LIMK2 did not recur more than 40% of patients with kidney cancer in which the mutation in the LIMK2 gene did not occur for more than 140 months (blue), but if there is a mutation in the LIMK2 gene, 10 In less than a month, the kidney cancer appeared to recur (red). Therefore, when there is a mutation in the LIMK2 gene, the probability of recurrence due to kidney cancer increases, so it can be seen that the mutation in the LIMK2 gene is significant as a predictor of recurrence of kidney cancer.

As can be seen from (B) of FIG. 15 , LONP2 had no recurrence for more than 120 months (blue) in more than 40% of renal cancer patients in which the LONP2 gene mutation did not occur, but 10 if the LONP2 gene mutation was present. In less than a month, the kidney cancer appeared to recur (red). Therefore, when there is a mutation in the LONP2 gene, the probability of recurrence due to kidney cancer increases, so it can be seen that the mutation in the LONP2 gene is significant as a marker for predicting recurrence of kidney cancer.

As can be seen in FIG. 16, MYO1G is more than 50% of kidney cancer patients with no mutation in the MYO1G gene survived more than 90 months (blue), whereas kidney cancer patients with mutation in the MYO1G gene survived more than 90 months (blue). Since more than 50% of renal cancer patients died before 30 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). Therefore, when there is a mutation in the MYO1G gene, the probability of death due to kidney cancer increases. Therefore, it can be seen that the mutation in the MYO1G gene is significant as a marker for predicting the survival rate of patients with kidney cancer.

As can be seen from (A) of FIG. 17, in the case of kidney cancer patients with no mutation in the OBSCN gene, OBSCN survived more than 90 months (blue), whereas the mutation in the OBSCN gene occurred. As more than 50% of renal cancer patients died before 30 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 17, in the case of kidney cancer patients in which the mutation in the OBSCN gene did not occur, more than 50% did not recur for more than 100 months (blue), but if there was a mutation in the OBSCN gene, it was less than 10 months in the kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the OBSCN gene, since the probability of death or recurrence due to kidney cancer increases, it can be seen that the mutation of the OBSCN gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (A) of FIG. 18, in the case of kidney cancer patients in which the mutation in the OGT gene did not occur, 50% or more of the OGT survived more than 90 months (blue), whereas the mutation in the OGT gene occurred. As more than 50% of renal cancer patients died before 30 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). Therefore, when there is a mutation in the OGT gene, the probability of death due to kidney cancer increases, so it can be seen that the mutation of the OGT gene is significant as a marker for predicting the survival rate of kidney cancer patients.

As can be seen from (A) of FIG. 19, OR10AG1 survived more than 50% of kidney cancer patients for which the OR10AG1 gene was not mutated for more than 90 months (blue), whereas the OR10AG1 gene was mutated. As more than 50% of renal cancer patients died before the age of 20 months, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 19, in the case of kidney cancer patients in which the mutation in the OR10AG1 gene did not occur, more than 50% of the patients had no recurrence for more than 100 months (blue), but if there was a mutation in the OR10AG1 gene, the kidney cancer patients were less than 20 months old. Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the OR10AG1 gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation in the OR10AG1 gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (A) of FIG. 20 , in the case of renal cancer patients in which the PRKAG2 gene is not mutated, 50% or more survived more than 80 months (blue), whereas the PRKAG2 gene was mutated. As more than 50% of renal cancer patients died before 30 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 20, in the case of kidney cancer patients in which the mutation in the PRKAG2 gene did not occur, more than 50% of the patients had no recurrence for more than 100 months (blue), but if there was a mutation in the PRKAG2 gene, it was less than 10 months. Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the PRKAG2 gene, the probability of death or recurrence due to kidney cancer increases. Therefore, it can be seen that the mutation of the PRKAG2 gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (A) of FIG. 21 , in the case of kidney cancer patients in which the PROX1 gene is not mutated, more than 50% survived more than 90 months (blue), whereas the PROX1 gene was mutated. As more than 50% of renal cancer patients died before the age of 20 months, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 21, in the case of kidney cancer patients in which the mutation in the PROX1 gene did not occur, 50% or more did not recur for more than 100 months (blue), but if there is a mutation in the PROX1 gene, it is less than 20 months, so kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the PROX1 gene, the probability of death or recurrence due to kidney cancer increases. Therefore, it can be seen that the mutation of the PROX1 gene is significant as a survival rate of kidney cancer patients or a predictive marker of kidney cancer recurrence.

As can be seen from (A) of FIG. 22 , PTPRU survived more than 50% of kidney cancer patients for which the PTPRU gene did not occur for more than 90 months (blue), whereas the PTPRU gene was mutated. As more than 50% of renal cancer patients died before 30 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 22, in the case of kidney cancer patients in which the mutation in the PTPRU gene did not occur, more than 50% had no recurrence for more than 110 months (blue), but if there was a mutation in the PTPRU gene, it was less than 20 months, so kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the PTPRU gene, since the probability of death or recurrence due to kidney cancer increases, it can be seen that the mutation in the PTPRU gene is significant as a survival rate of kidney cancer patients or a predictive marker of kidney cancer recurrence.

As can be seen from (A) of FIG. 23 , RGS9 survives more than 50% of kidney cancer patients for which the RGS9 gene is not mutated for more than 90 months (blue), whereas the RGS9 gene is mutated. As more than 50% of kidney cancer patients died before the age of 40 months, it was confirmed that the survival rate was lower than that of kidney cancer patients without mutation (red). According to (B) of Figure 23, in the case of kidney cancer patients in which the mutation in the RGS9 gene did not occur, more than 50% did not recur for more than 100 months (blue), but if there was a mutation in the RGS9 gene, it was less than 10 months in the case of kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the RGS9 gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation in the RGS9 gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (A) of FIG. 24 , in the case of kidney cancer patients in which the RTN3 gene is not mutated, 50% or more of the RTN3 survived more than 90 months (blue), whereas the RTN3 gene was mutated. As more than 50% of renal cancer patients died before 30 months of age, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 24, in the case of renal cancer patients in which the mutation in the RTN3 gene did not occur, 50% or more did not recur for more than 100 months (blue), but if there was a mutation in the RTN3 gene, it was less than 10 months in the case of kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the RTN3 gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation in the RTN3 gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

SECISBP2L, as can be seen in FIG. 25 (A), in the case of kidney cancer patients in which the mutation in the SECISBP2L gene does not occur, 50% or more survives for more than 90 months (blue), whereas the mutation in the SECISBP2L gene occurs As more than 50% of renal cancer patients died before the age of 50 months, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 25, in the case of kidney cancer patients in which the mutation in the SECISBP2L gene did not occur, more than 50% had no recurrence for more than 120 months (blue), but if there was a mutation in the SECISBP2L gene, it was less than 30 months, so kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the SECISBP2L gene, the probability of death or recurrence due to kidney cancer increases. Therefore, it can be seen that the mutation in the SECISBP2L gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (A) of FIG. 26, SPTBN1 survives more than 50% of kidney cancer patients for which the SPTBN1 gene is not mutated for more than 90 months (blue), whereas the SPTBN1 gene is mutated. As more than 50% of kidney cancer patients died before the age of 60 months, it was confirmed that the survival rate was lower than that of kidney cancer patients without mutation (red). Therefore, when there is a mutation in the SPTBN1 gene, the probability of death due to kidney cancer increases, so it can be seen that the mutation in the SPTBN1 gene is significant as a survival rate predictive marker of renal cancer patients.

As can be seen from (A) of FIG. 27, SYNE1 survived more than 50% of kidney cancer patients for which the SYNE1 gene was not mutated (blue), whereas the SYNE1 gene was mutated. As more than 50% of kidney cancer patients died before the age of 40 months, it was confirmed that the survival rate was lower than that of kidney cancer patients without mutation (red). According to (B) of Figure 27, in the case of kidney cancer patients in which the mutation in the SYNE1 gene did not occur, more than 50% of the patients had no recurrence for more than 120 months (blue), but if there was a mutation in the SYNE1 gene, the kidney cancer patients were less than 20 months old. Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the SYNE1 gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation of the SYNE1 gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (B) of FIG. 28, in the case of kidney cancer patients in which the TINAGL1 gene mutation did not occur, 40% or more of TINAGL1 had no recurrence for more than 120 months (blue), but if there was a mutation in the TINAGL1 gene, 10 In less than a month, the kidney cancer appeared to recur (red). Therefore, when there is a mutation in the TINAGL1 gene, the probability of recurrence due to kidney cancer increases, so it can be seen that the mutation in the TINAGL1 gene is significant as a marker for predicting recurrence of kidney cancer.

As can be seen from (A) of FIG. 29, USP18 is more than 50% of patients with renal cancer in which the mutation in the USP18 gene does not occur for more than 80 months (blue), whereas the mutation in the USP18 gene occurs. As more than 50% of renal cancer patients died before the age of 20 months, it was confirmed that the survival rate was lower than that of renal cancer patients without mutation (red). According to (B) of Figure 29, in the case of renal cancer patients in which the mutation in the USP18 gene did not occur, 50% or more did not recur for more than 100 months (blue), but if there was a mutation in the USP18 gene, it was less than 40 months in the case of kidney cancer patients Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the USP18 gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation of the USP18 gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

As can be seen from (A) of FIG. 30 , in the case of kidney cancer patients in which the ZNF33A gene is not mutated, 50% or more survived more than 80 months (blue), whereas the ZNF33A gene was mutated. As more than 50% of kidney cancer patients died before the age of 40 months, it was confirmed that the survival rate was lower than that of kidney cancer patients without mutation (red). According to (B) of Figure 30, in the case of kidney cancer patients in which the mutation in the ZNF33A gene did not occur, more than 50% had no recurrence for more than 120 months (blue), but if there was a mutation in the ZNF33A gene, it was less than 10 months. Renal cancer was found to recur in more than 50% of patients (red). Therefore, when there is a mutation in the ZNF33A gene, the probability of death or recurrence due to kidney cancer increases, so it can be seen that the mutation of the ZNF33A gene is significant as a predictive marker for the survival rate of kidney cancer patients or recurrence of kidney cancer.

Through the above results, if there is a mutation in the genes of the present invention among kidney cancer patients, it can be seen that the survival rate is significantly lowered or the recurrence rate is increased, so the prognosis of kidney cancer through whether there is a mutation in the genes of the present invention , in particular, it can be seen that survival or recurrence can be predicted.

Preparation of a chip capable of detecting the mutation of the gene of Example 2

A primer set for mutation detection of the gene of Example 2 was prepared with Thermo fisher's Ion AmpliSeq™ Custom and Community Panels with reference to https://tools.thermofisher.com/content/sfs/manuals/MAN0006735_AmpliSeq_DNA_RNA_LibPrep_UG.pdf. In order to easily detect the mutation, the chip type was selected and the depth was increased. Specifically, information about the panel to be produced was input to Ampliseq.com, and after receiving feedback on the input information, related matters were discussed and a panel loaded with a primer set capable of detecting mutations was produced. Tables 10 to 14 show primer sets capable of detecting mutations in genes of the present invention.

384Well_PlateID Lineitem_Name SEQ ID NO: Ion_AmpliSeq_Fwd_Primer* SEQ ID NO: Ion_AmpliSeq_Rev_Primer* Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop IAD121945_1_A BAZ2B 31 TGCTTTCGTCTTCGCCAGTAAA 32 CACCCACCTAGCATTTTAAGAGGAAA 160194166 160194188 160194313 160194339 IAD121945_1_A BAZ2B 33 ACTTAGATGGTGGCTGAGACTGA 34 CCAGGGAAGTTCTACAGTCCTCT 160206302 160206325 160206453 160206476 IAD121945_1_A BAZ2B 35 TGTGCTAGTCTGTAACTTTCCAATTTTCT 36 TCCAGCACAGAAAGCTTCAGTC 160241560 160241589 160241712 160241734 IAD121945_1_A BAZ2B 37 CAATAGCAGCTCTGGCAAAGAAAT 38 GCGTAAACTAGAGCAGCGAAGA 160245769 160245793 160245921 160245943 IAD121945_1_A BAZ2B 39 CATCTGCGTTATCTAGGAATTCAGCA 40 CAGTGGTGTCTTTTGAAAGAAGAGG 160268876 160268902 160269025 160269050 IAD121945_1_A BAZ2B 41 AAGATTTTGCAGGATGGGAGTGAT 42 CCTCACCTGTAAATCTGAGTACAAGTG 160289409 160289433 160289546 160289573 IAD121945_1_A BAZ2B 43 CTACAGACTTTGAGAGTCAAGATAAACCA 44 GTGAAGATGATGATTCTGATTCAGAGAGT 160295437 160295466 160295546 160295575 IAD121945_2_A BAZ2B 45 TTGTTTTTGTAATGCCTTTTCTCTTATTCCTC 46 CTTTTTATTTCCATGGTGTCATTTCCTATTCA 160205241 160205273 160205383 160205415 IAD121945_2_A BAZ2B 47 TATCTTTGCAATTCATATGCTTTACTGGGA 48 TTCTTGCATTGGCAGTGAAATCG 160240037 160240067 160240183 160240206 IAD121945_2_A BAZ2B 49 GCTATCTACCAATGCACTGACAGT 50 GTTCTTCAAGAGGGATTGCTAAATATAGGG 160242803 160242827 160242947 160242977 IAD121945_2_A BAZ2B 51 ATTTAGAAGAGCCAATGCTTTAGGAAAAA 52 TGAGTTATTTTCCACATTTTATCTGGGCCTA 160252207 160252236 160252349 160252379 IAD121945_2_A BAZ2B 53 TGAAAATAACCTGATTGGCTGTCATCA 54 CAGATTCAGACATTCCCAGTAGTAAAGATT 160289258 160289285 160289357 160289387 IAD121945_2_A BAZ2B 55 ATAAATGGAAGCTGCTGTGACAAAAC 56 CTAGGTGCTATTACATGGTATTTCAGACC 160295037 160295063 160295181 160295210 IAD121945_2_A BAZ2B 57 TCTTCTTCTAGATCATCTGAATCACTGCT 58 TGAATGTTTTCCAAAAATAAAGTCTTGCCA 160295608 160295637 160295743 160295773 IAD121945_1_A CDCA2 59 TATGCCTGTGTCGTTTTGTTTTTATTTTGT 60 GGAGACCAATTACTTTTCCTTCAGCA 25325695 25325725 25325841 25325867 IAD121945_1_A CDCA2 61 TGAAGAACGTGTGGCATCAGAT 62 AGAAGTCATCCTTTCTTTCACACTTTATGT 25364336 25364358 25364460 25364490 IAD121945_2_A CDCA2 63 CAGGCAATCCATAATGTTTACTCAAATCT 64 TTTGAAGTCTCTGTGAGCTCTGAAAG 25327320 25327349 25327468 25327494 IAD121945_2_A CDCA2 65 TGTGGGCAGCTCTGTAGAAATT 66 AAGACCTTCGTTTTCTAAATCCTTCTGTAG 25364747 25364769 25364867 25364897 IAD121945_1_A CFP
67 GCTGTAGCAGTGCCGGATAT 68 ACATGAAGTCCATCAGCTGTCAAG 47485743 47485763 47485843 47485867 IAD121945_1_A CFP
69 CTTGGGAGCAGGGTGATTACAG 70 GAAGCAAAGAGCCCTGAATGAC 47486937 47486959 47487080 47487102 IAD121945_1_A CFP
71 GGCAAAGGCAGTGTTGAGAC 72 GTGTCCAGGCCCACCACAT 47488961 47488981 47489116 47489135 IAD121945_2_A CFP
73 CCGGGATTTCTTGACAGCTGAT 74 TGATTCCCTGCTTTGGTCCAATC 47485835 47485857 47485940 47485963 IAD121945_2_A CFP
75 CCCACTCTGAGGACCTCTGTA 76 GAATGGGCAGTGCTCTGGAA 47487417 47487438 47487563 47487583

384Well_PlateID Lineitem_Name SEQ ID NO: Ion_AmpliSeq_Fwd_Primer* SEQ ID NO: Ion_AmpliSeq_Rev_Primer* Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop IAD121945_1_A CHSY3 77 AAGAGTTTCTTAGATCGCTAAACAGCA 78 CACCATCCTCCTGAGAACTTCTC 129243782 129243809 129243922 129243945 IAD121945_2_A CHSY3 79 ATTAACAGTGAAACTCAGTCATTCTCCTTT 80 CATGTTTTCAAAGTTCTCCATGAATCTCA 129520594 129520624 129520738 129520767 IAD121945_1_A CLCN2 81 GGCTCATTGGCATTTGTCGT 82 TCACAGCACAGGGTGTGAAAG 184064391 184064411 184064542 184064563 IAD121945_1_A CLCN2 83 GGGACCCTCCTGATCAGATAGT 84 GTCCAGAGTCCATGATTCTGCT 184071068 184071090 184071194 184071216 IAD121945_2_A CLCN2 85 GGTTAATGACGTGGTCTCAGCAT 86 GGGCCTTATGTTTGGGAACACA 184070448 184070471 184070599 184070621 IAD121945_2_A CLCN2 87 ATCTGAGGGAAGCCTGGTTTC 88 CCCAGATGGAATTCATACGGACA 184072226 184072247 184072377 184072400 IAD121945_1_A DHX37 89 CCTCGGCACCTTTCATGTACAT 90 ACATCACTCTCCATTCTCTGCAGA 125435227 125435249 125435349 125435373 IAD121945_1_A DHX37 91 GTCGCCGAGCTTCAGAGAAG 92 CCCAGCCCAGACAGTATGTAT 125438649 125438669 125438769 125438790 IAD121945_1_A DHX37 93 GGGATGCTGATCAAACAGCA 94 GCTCCCGCTGTACTCTCTG 125449367 125449387 125449499 125449518 IAD121945_1_A DHX37 95 TGAAGCCTGCTTCATAGAGAAACTG 96 TCCCTAAGTGCTGACTTCCTCT 125461892 125461917 125462044 125462066 IAD121945_1_A DHX37 97 CCACCATAAAGGTATTTTCTCAAATGTTCC 98 GAGACTCTTTTATACACTTCCAAGCT 125466942 125466972 125467089 125467116 IAD121945_2_A DHX37 99 ACGATTTCCTGGTAGACCACAAAC 100 AATCAGATTCTTCTCCTGGGTTGAAAG 125435262 125435286 125435409 125435436 IAD121945_2_A DHX37 101 TCCCTTGTTCCTCAGTGGCTAT 102 GTCACTGGCGTATCCTCCTT 125448872 125448894 125449020 125449040 IAD121945_2_A DHX37 103 GAAGCCCAAGCCTCTGACA 104 CTGCGGTACAAGGTGGTGAT 125455775 125455794 125455929 125455949 IAD121945_2_A DHX37 105 CTGGAGGAGGAGGAACAGTCA 106 GGAGGAGGAGGAGTCGGAATC 125465113 125465134 125465261 125465282 IAD121945_2_A DHX37 107 GCCCTGGGAAATCTCCGAAA 108 GGCGCTACAACATCAAGGG 125473416 125473436 125473533 125473552 IAD121945_1_A EGFR 109 GGGAAATGATCCTACCCTCACTCT 110 CCTGCAGCACACTGGTTGT 55220183 55220207 55220307 55220326 IAD121945_1_A EGFR 111 CCGACAGCTATGAGATGGAGGAA 112 GAAGAGGAAGATTGTGTTCCTTTGGA 55223571 55223594 55223706 55223731 IAD121945_1_A EGFR 113 TGAATTCGGATGCAGAGGCTTCT 114 GCCAGCCCAAAATCTGTGATCT 55259345 55259367 55259496 55259518 IAD121945_2_A EGFR 115 GTGTCCTCTCTCCTCCATAGGT 116 GGTGGCACCAAAGCTGTATTTTG 55221684 55221706 55221804 55221826 IAD121945_2_A EGFR 117 CTCCAGGAAGCCTACGTGATG 118 CAGTTGAGCAGGTACTGGGAG 55248980 55249001 55249131 55249152 IAD121945_2_A EGFR 119 CAGGAAAAGTGGATGAGATGTGGT 120 TCCATGTAAAATAGAGCCATAGTGGAGA 55269365 55269389 55269511 55269539 IAD121945_1_A FCRL4 121 GGTGCCAGGAGAATGTGGTATC 122 CCCACCTGTGGTCTCATTTTCA 157556120 157556142 157556250 157556272 IAD121945_1_A FCRL4 123 CAACAGGGACTCTTGTAAGTATTTGAGA 124 GGCTCTCAGGGTGAATAGTTCG 157566031 157566059 157566183 157566205 IAD121945_2_A FCRL4 125 TCACAGTGACATTCAGCACCAT 126 CTCCTGGCACCGAGAGGACAT 15755961 157555983 157556109 157556130 IAD121945_2_A FCRL4 127 GCTCAGTTTCCTATCCCTGTCATT 128 AGCTGGGATCTTCTTATCCCACA 157557598 157557622 157557749 157557772 IAD121945_1_A GALNT7 129 CGGAGGAAGATGAGGCTGAAGA 130 CGGGTCACTCACCCTCAT 174089978 174090000 174090106 174090124 IAD121945_1_A GALNT7 131 GGGTGGTGATGAAGATGGGTATG 132 GTGATTACCGATACGGTTCAGTTTTTG 174219332 174219355 174219429 174219456 IAD121945_2_A GALNT7 133 CCAATGCACCTGTATTCTTGTTTCC 134 CCTTCCCTTCTTTCATTTCGAAATAC 174216454 174216479 174216601 174216628 IAD121945_2_A GALNT7 135 CAGGCTGTATTCTACAAGGCTTCT 136 ATCTGGAGACCTGGATCATAGAGAC 174223108 174223132 174223256 174223281

384Well_PlateID Lineitem_Name SEQ ID NO: Ion_AmpliSeq_Fwd_Primer* SEQ ID NO: Ion_AmpliSeq_Rev_Primer* Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop IAD121945_1_A GRIK2 137 TGCCTGATGGACAATTTACAAAGTACA 138 TGGAAAAGCAAATACTTACCAAAATGGTG 102266203 102266230 102266348 102266377 IAD121945_1_A GRIK2 139 AGCGAGTCCTCACCTCTGATTA 140 CAAAGAGCTGACATATAACCTACCCAT 102483307 102483329 10483437 102483464 IAD121945_1_A GRIK2 141 GGTTCAGAATATTGGTGGGCATCT 142 ACAAGTAACATTTACCTTTTCCAATTGAGC 102503340 102503364 102503440 102503470 IAD121945_2_A GRIK2 143 TGTCAATTACCACAGGTTTAGTCCTTATG 144 GGACATGGTGCCCAAAGGAAATA 102372461 102372490 102372612 102372635 IAD121945_2_A GRIK2 145 AGGTTCTCCATATCGAGACAAAATTACC 146 TGCCAGAACAATGAAGATGCCA 102503203 102503231 102503355 102503377 IAD121945_1_A IL16 147 CCACAGCTTCCTCTCGAGAAAA 148 CAATAGTCCTGCTATCCAGGAACA 81552120 81552142 81552262 81552286 IAD121945_1_A IL16 149 TTTCTGACTGCATCAAAAACTTATTTAGCC 150 TCTGCTGACTTGTAAACTTTGGGA 81591817 81591847 81591967 81591991 IAD121945_2_A IL16 151 CCTGATGCAGGAGCTTCTACTG 152 CACCATTTGTCTTACCTTCCAGACT 81582741 81582763 81582871 81582896 IAD121945_2_A IL16 153 GGAACCCATTACCTTCTCCCTCAT 154 GATGACAATCGTGACAGGTCCAT 81600917 81600941 81601065 81601088 IAD121945_1_A LIMK2 155 GCAGCCTGTGGGAGCTTTATA 156 GTGTCCGGCATTCTGCATG 31658544 31658565 31658690 31658709 IAD121945_2_A LIMK2 157 GCTTCACTGGGAGACCACATTG 158 TTTGTTGGTGGGACTCACCATT 31664039 31664061 31664182 31664204 IAD121945_1_A LONP2 159 GTTCAGGTTGTGGGGCAGTAACT 160 CCTCATTTTACAGGTGTTGGGAAAC 48286064 48286086 48286203 48286228 IAD121945_1_A LONP2 161 TTTTTCTTTTAGGTTGCAGAGAACACA 162 AGAATGAATCACCTCCATTTCATACATCG 48368115 48368142 48368252 48368281 IAD121945_2_A LONP2 163 CTTTCTCTAGGCGCACCTATGT 164 ACAGGGAATTTTCCAAATCTTACCTCA 48311239 48311261 48311386 48311413 IAD121945_2_A LONP2 165 AAAGAAAGCTGGGTCAGGGTTT 166 CTGGGATTCCCTCAAGGTCTTT 48385417 48385439 48385569 48385591 IAD121945_1_A MTFR1L 167 CATAGACCCTGCCCAACATCTC 168 CCTCTTCTGGGAAGTTCTCCATTC 26152788 26152810 26152931 26152955 IAD121945_2_A MTFR1L 169 TTTCCCTGGTCCAGGAGTGATA 170 CAGCTCAGTAGTGCGGCTTA 26153092 26153114 26153239 26153259 IAD121945_1_A MYO1G 171 CTGCTCCATGTGTGACCAGT 172 TACAAGATGACCTGTGAATACACATGG 45005717 45005736 45005851 45005878 IAD121945_1_A MYO1G 173 ACTCACACTGTGCACAGGTCATG 174 CCTGTGTCCTCTTAGTTGCTGAGA 45011708 45011730 45011815 45011838 IAD121945_2_A MYO1G 175 CGTACTCTTCCTGTTCCTGCTT 176 CCCATTACCATGCACTCCACAA 45009665 45009687 45009792 45009814 IAD121945_2_A MYO1G 177 GCCCACCTTCTCCAGTAGGTAG 178 AAGGACGTGCTGCTCAAGT 45015077 45015099 45015225 45015244 IAD121945_1_A OBSCN 179 CACCTGCACGGTGACTGAA 180 GATCTTGAGCACGAAGTTCTCCT 228400219 228400238 228400355 228400378 IAD121945_1_A OBSCN 181 GCCCGAGAACCTCAGGATG 182 ACAAGGCCACACATGATCTTTTACC 228479711 228479731 228479861 228479885 IAD121945_1_A OBSCN 183 GAGGAGGATGATCACTACATGATTAATGAA 184 CAAACCAGACGCAGGTACTCACA 228511154 228511184 228511306 228511328 IAD121945_1_A OBSCN 185 GAGCTCTCAGATGAGACTGTGG 186 GATGGCCACTCACCCGATT 228562032 228562054 228562160 228562179 IAD121945_1_A OBSCN 187 CCACGTGCTGAGCCTATGTC 188 CTCGCGATTGCGCACGAAGA 228566291 228566311 228566425 228566445 IAD121945_2_A OBSCN 189 GTATCTTTGACCTCGTATGTCCTTCC 190 CATAACCTCCGTCTGGGCTT 228459586 228459612 228459739 228459759 IAD121945_2_A OBSCN 191 CAGCTCCCATGAGTGATGGAG 192 CTGCCACACGGAAGCGGTA 228505234 228505255 228505376 228505395 IAD121945_2_A OBSCN 193 CACCTGAGCAGAGCGTTTTGTA 194 CTGCGTGATCTTGGCCGATA 228524677 228524698 228524806 228524826 IAD121945_2_A OBSCN 195 ACCTGGGACCACTCACTCAT 196 CCAGACAGGTTGGAGGACTCA 228565560 228565580 228565708 228565729

384Well_PlateID Lineitem_Name SEQ ID NO: Ion_AmpliSeq_Fwd_Primer* SEQ ID NO: Ion_AmpliSeq_Rev_Primer* Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop IAD121945_1_A OGT 197 GTTATAATACAGCTCTCCGTCTGGTGT 198 CTGCTTTCCCCTCTACTATCATGCTAAA 70775823 70775849 70775970 70775997 IAD121945_1_A OGT 199 AACAATAAGGCTGCAACTGGAGA 200 GTCTCTAACATACTTGCATACTCACGTT 70784454 70784477 70784600 70784628 IAD121945_2_A OGT 201 CCAGAACCAACGAAACGTATGC 202 CGACACTGGAAGTGTATAGATGAAAGTAAT 70756024 70756046 70756166 70756196 IAD121945_2_A OGT 203 TGTATTGGAGAAATAAAACCTTTGGCTTCT 204 ATTAATTTGGATGGCACCGGTATAAC 70776765 70776795 70776884 70776910 IAD121945_1_A OR10AG1 205 GGTGGAGAAGGCTTTAGCCTTTC 206 CTCAAGCTTGCTTGTGGAAACATATTT 55735247 55735270 55735387 55735414 IAD121945_2_A OR10AG1 207 AAATATGTTTCCACAAGCAAGCTTGAG 208 GATGAACCACAAAGTCTGCATTCAG 55735388 55735415 55735537 55735562 IAD121945_1_A PRKAG2
209 GTGCCAGGTCATCTTACAATAATTGC 210 ACAACATTGCCTTCATACATCCAGA 151262731 151262757 151262879 151262904 IAD121945_1_A PRKAG2
211 CCAGCACCCACCTGAAACAATA 212 GCATGAGCTTCAGTGGGATCTTC 151478201 151478223 151478322 151478345 IAD121945_2_A PRKAG2
213 CGCTAAAAACTACTTACAAAAAGCTGGA 214 CAGCCTCTTCGATGCTGTATACTC 151265785 151265813 151265907 151265931 IAD121945_2_A PRKAG2
215 ACTTCTGGAAAGGAGGTCTTACCT 216 GACACCCACGTAGAGTTCCATG 151483534 151483558 151483683 151483705 IAD121945_1_A PROX1
217 CTCTCTAGTACAGGCTCCGAAGTA 218 AAGCGATCCATATCAAACTGGCT 214170224 214170248 214170325 214170348 IAD121945_1_A PROX1
219 GGGCAATGAAAATGAAAGAGAGATG 220 GCTCCTCTCGCTTCTGTTCTTT 214170433 214170458 214170562 214170584 IAD121945_2_A PROX1
221 CTGAGCAGGATGTTGAGTATTCAGT 222 CCGTGCCACCATTTTTGTTCAT 214170027 214170052 214170178 214170200 IAD121945_2_A PROX1
223 CCCTTTTGGCAGGCCTACTATG 224 GCCATCTCTCTTTCATTTTCATTGCC 214170304 214170326 214170433 214170459 IAD121945_2_A PROX1
225 CTGGTTTCAGCCCGAAAAGAAC 226 ATCAGTGCTGTCATAGATTTGGTAGAAC 214170548 214170570 214170645 214170673 IAD121945_1_A PTPRU
227 GCTTGCTGTCCTCATCCTTCTC 228 CAGCTCTTAGCCACTATTCCTTCG 29611328 29611350 29611441 29611465 IAD121945_1_A PTPRU
229 TGGAGACCTTGTCTCAGGGAC 230 CCTCGACCAGCTTGGTGATC 29637922 29637943 29638037 29638057 IAD121945_2_A PTPRU
231 GTGGACCGCAGCTTCCACA 232 GGGACCCTATTGTCTCAGGT 29618448 29618466 29618586 29618606 IAD121945_1_A RGS9
233 GTCAGTCGGCTTTTTCCTGTTC 234 GGGTCTATTCCAGGCCAAGACTA 63149508 63149530 63149654 63149677 IAD121945_1_A RGS9
235 CCCATCTGACCGTGTACACC 236 CTCTCCAAGGCCACTCTGATG 63221145 63221165 63221286 63221307 IAD121945_2_A RGS9
237 GGGATGTGTCAGGAGGCTATGA 238 CATGGTGCTGTACACAAAGCTG 63154361 63154383 63154496 63154518 IAD121945_2_A RGS9
239 CATCGGGCTTGGAGCAGAA 240 CAGAAACCTGCTGAAGGACAGA 63221310 63221329 63221448 63221470 IAD121945_1_A RTN3

241 ATCCAAAGTTTCAGGAGATGATGTTATTGA 242 TGAAATGTCTTCGGATGATTCTTTATCAGT 63486664 63486694 63486808 63486838 IAD121945_1_A RTN3

243 GATACGAATGTCTCCTTAGAAGATGTGA 244 GTTTAACATTTTTCCCATGTAATGACTCCA 63487733 63487761 63487877 63487907 IAD121945_2_A RTN3

245 GACATTTCAGAGACTAATGACAAGCTTTTT 246 GATCCAAGTCAGTATTTCGTTAGTAAAGT 63486830 63486860 63486974 63487004 IAD121945_1_A SECISBP2L 247 GTCTCTGAGACCCAAGACTCAATT 248 GCAGTTGCCGAGATCTTTTGAA 49284676 49284700 49284828 49284850 IAD121945_1_A SECISBP2L 249 ACCAAATTTCGAGCAACATTTGAATAATCA 250 TTCTGCAGTGTTATTTCTGAACCGA 49288444 49288474 49288590 49288615 IAD121945_1_A SECISBP2L 251 ACCCATAACGAGTCGTCTCCTT 252 TAGGATGGAGTTACCCATTTTGGTTTTT 49293159 49293181 49293302 49293330 IAD121945_1_A SECISBP2L 253 AGAAATCAAGACGATGTCACATACATTCA 254 CATCCCACCCTACTGCTGAATC 49320626 49320655 49320773 49320795 IAD121945_2_A SECISBP2L 255 TTCTTCAAGCATGCCAGGTACA 256 TACAAGTGCTGGGAAATCCACAG 49284777 49284799 49284928 49284951 IAD121945_2_A SECISBP2L 257 GGAGAGCAAGAGTGTGTGTCTTC 258 ACGGGAACAAGAAATTCCTTTTTGG 49291996 49292019 49292119 49292144 IAD121945_2_A SECISBP2L 259 CTCTCTAAATCTTTTGCTGTGGATTTTGG 260 AGTGATACTTCACTCTCTCCAGCAA 49301412 49301441 49301530 49301555 IAD121945_2_A SECISBP2L 261 CCAGAAGCACAATTTTTGATCGACT 262 AATGTTCAGTACATTGAATAGTTGTGTGTTTTTT 49325183 49325208 49325324 49325357 IAD121945_1_A SLF2
263 TTTGAAAGGAAACTATCCTCACCAAAAGA 264 TTCCTTTGGCTAAATATTTGAGGGCTA 102676407 102676436 102676554 102676581 IAD121945_1_A SLF2
265 CAAGTGCTGGTTCCTCTCTAGT 266 CCTGAAGATACATTAGAATCGGCCTTA 102684197 102684219 102684344 102684371 IAD121945_1_A SLF2
267 GCCTGTTGCAGCTGTCAGATAT 268 AGTAGGCCGACAGTTCTGGATTA 102719088 102719110 102719227 102719250 IAD121945_2_A SLF2
269 CTGACATCTTCAATAACAGCTCCAGAA 270 CGGAGTTGATTCTCTGCTCCATT 102676759 102676786 102676909 102676932 IAD121945_2_A SLF2
271 GGACAAAATGAAAGAGTACACACTGGA 272 CAGCCTTTTTCTTCAAGACCATTTTCT 102709737 102709764 102709884 102709911

384Well_PlateID Lineitem_Name SEQ ID NO: Ion_AmpliSeq_Fwd_Primer* SEQ ID NO: Ion_AmpliSeq_Rev_Primer* Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop IAD121945_1_A SPTBN1 273 CAACATTGAGATCCAGCAGCAGTA 274 GGGCATCCTGATTTTAGGCATC 54753585 54753609 54753735 54753757 IAD121945_1_A SPTBN1 275 GTCTCTCTGGATCAATGAGAAGATGC 276 CCATGGCCACATCAAATGTTTTAACT 54870122 54870148 54870269 54870295 IAD121945_1_A SPTBN1 277 GTATGAGCAGAACAGAATAGGGCTT 278 CGTTCTCGCGCTTCTGGATATC 54880660 54880685 54880808 54880830 IAD121945_1_A SPTBN1 279 CGACCTCTGATCGTAAAGCCAA 280 GCTGTTACCTGCTTGAGGCTTT 54891678 54891700 54891814 54891836 IAD121945_2_A SPTBN1 281 GCATCGAGGAGCGGTATAAGGA 282 GCTTCTCTGGGATCTGCATGTT 54856748 54856770 54856890 54856912 IAD121945_2_A SPTBN1 283 TTTACAACCATGTTGGTTTTGTTTTCCA 284 GGCCTTGTTTGCATCAAAGAGC 54871431 54871459 54871578 54871600 IAD121945_2_A SPTBN1 285 GGGATCCTCTTTTTCATACAGATCAAGG 286 GCATGTTTTCCATTGATACCAAAAGAG 54883030 54883058 54883159 54883187 IAD121945_2_A SPTBN1 287 TCTTCCGCCATCTCCTCTGATA 288 AACCGCTTCTCTTTGTCTTTCTCT 54895518 54895540 54895657 54895681 IAD121945_1_A SYNE1
289 ACAGCTGTAGTCTTCCTCTGACA 290 CTCCGATTCCTCCCTTTCTGAG 152443643 152443666 152443774 152443796 IAD121945_1_A SYNE1
291 TCACTGAGACTGTGTCTCAAGACT 292 TGTAGCCTCAAACAGATGGTTCAC 152473008 152473032 152473156 152473180 IAD121945_1_A SYNE1
293 CATACTCCATACCTCATGTTGACTTCTT 294 AAAACAGGAAAGGAGCTTACAGAAATTTG 152542549 152542577 152542645 152542674 IAD121945_1_A SYNE1
295 AATAATTGATCACAAGTTTGTTTACATTCTGTT 296 GTGGAAAGCAGCATCCCAAGC 152557869 152557902 152558008 152558029 IAD121945_1_A SYNE1
297 GATTGAGCTTGGAGAGCCGATT 298 AGAGGAATTAGATGGCTGTAATTCAAAGTT 152639218 152639240 152639360 152639390 IAD121945_1_A SYNE1
299 TCATAGACACTCTGCAATTCCTGAAG 300 CAGATGATGTGAGCAAAACAAGTCAA 152652189 152652215 152652338 152652363 IAD121945_1_A SYNE1
301 TTTTTGATCCACTGATTCCATCCACT 302 TGTGATTGGTTTTCAGTAGAGATGTCAAAA 152708429 152708455 152708552 152708582 IAD121945_1_A SYNE1
303 AGGTAAAGGACCTGTTCCATTTCTG 304 ACAGAAAACTGAACTTATGGATCCATGAAA 152716618 152716643 152716762 152716792 IAD121945_1_A SYNE1
305 GCTGTTGAAGCAGCTGCTTATT 306 TGCACTTTATTTGAGGGCAGAGATAAATAA 152757131 152757153 152757275 152757305 IAD121945_1_A SYNE1
307 CCTGGTCTTGTTACACATGCTTTAG 308 GGAGGAATTAGAAAAGCAGATGACGT 152779835 152779860 152779983 152780009 IAD121945_1_A SYNE1
309 AGCTTTTGAAAAATTCAAAAATCTTCTCCA 310 CTCATTTCCAGAGAGAAGACAGAGTAATTT 152809493 152809523 152809619 152809649 IAD121945_2_A SYNE1
311 TGCTTATGACCCGATCCTCCTT 312 TGCCTGCCTTGTACCAATGTC 152443512 152443534 152443661 152443682 IAD121945_2_A SYNE1
313 GGGCAGCTACCTTGAGCTTTTT 314 CAGTTTAACTCAGACTTGAACAGCATC 152461075 152461097 152461186 152461213 IAD121945_2_A SYNE1
315 CTTCAACAGCTCATTGGTTCGATC 316 CTGCTCATGAGTGTTGGTTATTATTTCC 152542037 152542061 152542183 152542211 IAD121945_2_A SYNE1
317 CAGCTGATGGATATCAGAAGTCGT 318 GGGAACATTGTAGGTACAGAGAATTAT 152557353 152557377 152557498 152557527 IAD121945_2_A SYNE1
319 CCCTGCAGCTGAATACTACTGG 320 GAAGATGGACTCAAAGAATTTGATGCAG 152565637 152565659 152565748 152565776 IAD121945_2_A SYNE1
321 CATTCGTGTATTACTACTTTCAGTTGGA 322 GCAAAGAAGACCTAGAACAGAAAGTG 152647358 152647387 152647498 152647524 IAD121945_2_A SYNE1
323 CCTACTAAGAGGTGGTTGAGGACT 324 GGTAGAAAGCAGTTCTCATAATCTCAGC 152665234 152665258 152665380 152665408 IAD121945_2_A SYNE1
325 CTCATGATGTCAGCCCCACACTT 326 AGTATTCTTTCTTCCTTCCCAGGATATTCT 152711436 152711458 152711579 152711609 IAD121945_2_A SYNE1
327 CCAGAATTTCCTATTTAGTAGTGCAGCAA 328 GAACAGAGATTCCTGTGTTCAGGA 152749289 152749318 152749432 152749456 IAD121945_2_A SYNE1
329 CAATCCGCAGTACCTTCTCCAA 330 CAAAATGATCCTTTCAGTAATGAGAAAGCA 152776617 152776639 152776756 152776786 IAD121945_2_A SYNE1
331 ACATTTGTAACACATACACGTTGAGGT 332 CATGAACGATGCTGGCAATTTTCTAA 152784438 152784465 152784582 152784608 IAD121945_2_A SYNE1
333 CCAGTTCTTGTTTCGGCGATAGT 334 AGTAAAAGATTTTGGGAAGAGTTGGAGAAG 152826363 152826385 152826487 152826517 IAD121945_1_A TINAGL1 335 GGCCATGATGCACTGAGTCTT 336 GCTCGGCTGTGCATCATACA 32050699 32050720 32050818 32050838 IAD121945_2_A TINAGL1 337 TGATTCATGAGCCTCTTGACCAAG 338 GAATGGATTGAGACACGATCGGAT 32050343 32050367 32050493 32050517 IAD121945_1_A USP18
339 GGCAAATCTGTCAGTCCATCCT 340 CATGCAGTCAAGAAGAGGAAAACG 18640456 18640478 18640603 18640627 IAD121945_1_A USP18
341 ATAGAGTGTTCATGTGTGTCTAAGTACC 342 TCTTACCAAGTGCACATCAGTGATC 18649934 18649961 18650082 18650107 IAD121945_2_A USP18
343 CCCTTATAGGCCTGGTTGGTTT 344 AGAAATAATACAAATGCTCATCAGCCTGAA 18642930 18642952 18643047 18643077 IAD121945_2_A USP18
345 CTGGAGGGCAGTATGAGCTTTT 346 GCAGGAGGCAATTGTGGATGAT 18655918 18655940 18656057 18656079 IAD121945_1_A ZNF33A 347 TTAATGTGGATGTAAGTTCTTTTCCTTCCA 348 GTAACAATTTCCCACAGGCATTAAATTCA 38343429 38343459 38343555 38343584 IAD121945_2_A ZNF33A 349 CCTCTTGTTCCATCAGATATCTCCGT 350 ACTTTCACCACAATCATAGTGTTTCATAGA 38343835 38343861 38343940 38343970

In order to confirm whether the mutation detection is possible with the prepared primer set, the gene mutations identified in Example 2 and samples derived from wild-type kidney cancer cells were used as samples, and each of the gene mutations was used as a sample, After amplification with the primer set, the reaction-completed chip was scanned using a scanner and an application program, and analyzed using quantitative analysis software. As a result, the mutation of the gene of Example 2 could be detected with the primer set prepared in Example 3. On the other hand, no mutations were detected in samples derived from kidney cancer cells as a control. As such, using the primer pairs of Tables 10 to 14, BAZ2B, CDCA2, CFP, CHSY3, CLCN2, DHX37, EGFR, FAM178A (SLF2), FAM54B (MTFR1L), FCRL4, GALNT7, GRIK2, IL16, LIMK2, LONP2, MYO1G , OBSCN, OGT, OR10AG1, PRKAG2, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SPTBN1, SYNE1, TINAGL1, USP18 and ZNF33A. It is possible to predict the total survival period and disease-free survival period of renal cancer patients, and accordingly, a treatment strategy can be efficiently designed.

In the above, preferred embodiments of the present invention have been exemplarily described, but the scope of the present invention is not limited only to the specific embodiments as described above, and those of ordinary skill in the art are provided with the scope of the claims of the present invention. It can be appropriately changed within.

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRYACADEMIC COOPERATION FOUNDATION <120> Markers for diagnosing prognosis of patient of clear cell renal cell carcinoma <130> 2021-DPA-4312D <150> KR 2017-102357 <151> 2017-08-11 <160> 350 <170> KoPatentIn 3.0 <210> 1 <211> 2168 <212> PRT <213> Homo sapiens <400> 1 Met Glu Ser Gly Glu Arg Leu Pro Ser Ser Ala Ala Ser Ser Thr Thr 1 5 10 15 Pro Thr Ser Ser Ser Thr Pro Ser Val Ala Ser Val Val Ser Lys Gly 20 25 30 Gly Leu Ser Thr Gly Val Ala Ser Leu Ser Ser Thr Ile Asn Pro Cys 35 40 45 Gly His Leu Phe Arg Thr Ala Gly Asp Gln Pro Phe Asn Leu Ser Thr 50 55 60 Val Ser Ser Ala Phe Pro Met Val Ser His Pro Val Phe Gly Leu His 65 70 75 80 Ser Ala Ser Ser Gly His Ser Glu Phe Gly Gly Leu Gly Thr Leu Gly 85 90 95 Thr Pro Thr Ala Leu Ala Ala His Pro Gln Leu Ala Ser Phe Pro Gly 100 105 110 Ala Glu Trp Trp Arg Thr Thr Asp Ala His Thr Arg Thr Gly Ala Thr 115 120 125 Phe Phe Pro Pro Leu Leu Gly Ile Pro Pro Leu Phe Ala Pro Pro Ala 130 135 140 Gln Asn His Asp Ser Ser Ser Phe His Ser Arg Thr Ser Gly Lys Ser 145 150 155 160 Asn Arg Asn Gly Pro Glu Lys Gly Val Asn Gly Ser Ile Asn Gly Ser 165 170 175 Asn Thr Ser Ser Val Ile Gly Ile Asn Thr Ser Val Leu Ser Thr Thr 180 185 190 Ala Ser Ser Ser Met Gly Gln Thr Lys Ser Thr Ser Ser Gly Gly Gly 195 200 205 Asn Arg Lys Cys Asn Gln Glu Gln Ser Lys Asn Gln Pro Leu Asp Ala 210 215 220 Arg Val Asp Lys Ile Lys Asp Lys Lys Pro Arg Lys Lys Ala Met Glu 225 230 235 240 Ser Ser Ser Asn Ser Asp Ser Asp Ser Gly Thr Ser Ser Asp Thr Ser 245 250 255 Ser Glu Gly Ile Ser Ser Ser Asp Ser Asp Asp Leu Glu Glu Asp Glu 260 265 270 Glu Glu Glu Asp Gln Ser Ile Glu Glu Ser Glu Asp Asp Asp Ser Asp 275 280 285 Ser Glu Ser Glu Ala Gln His Lys Ser Asn Asn Gln Val Leu Leu His 290 295 300 Gly Ile Ser Asp Pro Lys Ala Asp Gly Gln Lys Ala Thr Glu Lys Ala 305 310 315 320 Gln Glu Lys Arg Ile His Gln Pro Leu Pro Leu Ala Ser Glu Ser Gln 325 330 335 Thr His Ser Phe Gln Ser Gln Gln Lys Gln Pro Gln Val Leu Ser Gln 340 345 350 Gln Leu Pro Phe Ile Phe Gln Ser Ser Gln Ala Lys Glu Glu Ser Val 355 360 365 Asn Lys His Thr Ser Val Ile Gln Ser Thr Gly Leu Val Ser Asn Val 370 375 380 Lys Pro Leu Ser Leu Val Asn Gln Ala Lys Lys Glu Thr Tyr Met Lys 385 390 395 400 Leu Ile Val Pro Ser Pro Asp Val Leu Lys Ala Gly Asn Lys Asn Thr 405 410 415 Ser Glu Glu Ser Ser Leu Leu Thr Ser Glu Leu Arg Ser Lys Arg Glu 420 425 430 Gln Tyr Lys Gln Ala Phe Pro Ser Gln Leu Lys Lys Gln Glu Ser Ser 435 440 445 Lys Ser Leu Lys Lys Val Ile Ala Ala Leu Ser Asn Pro Lys Ala Thr 450 455 460 Ser Ser Ser Pro Ala His Pro Lys Gln Thr Leu Glu Asn Asn His Pro 465 470 475 480 Asn Pro Phe Leu Thr Asn Ala Leu Leu Gly Asn His Gln Pro Asn Gly 485 490 495 Val Ile Gln Ser Val Ile Gln Glu Ala Pro Leu Ala Leu Thr Thr Lys 500 505 510 Thr Lys Met Gln Ser Lys Ile Asn Glu Asn Ile Ala Ala Ala Ser Ser 515 520 525 Thr Pro Phe Ser Ser Pro Val Asn Leu Ser Thr Ser Gly Arg Arg Thr 530 535 540 Pro Gly Asn Gln Thr Pro Val Met Pro Ser Ala Ser Pro Ile Leu His 545 550 555 560 Ser Gln Gly Lys Glu Lys Ala Val Ser Asn Asn Val Asn Pro Val Lys 565 570 575 Thr Gln His His Ser His Pro Ala Lys Ser Leu Val Glu Gln Phe Arg 580 585 590 Gly Thr Asp Ser Asp Ile Pro Ser Ser Lys Asp Ser Glu Asp Ser Asn 595 600 605 Glu Asp Glu Glu Glu Asp Asp Glu Glu Glu Asp Glu Glu Asp Asp Glu 610 615 620 Asp Asp Glu Ser Asp Asp Ser Gln Ser Glu Ser Asp Ser Asn Ser Glu 625 630 635 640 Ser Asp Thr Glu Gly Ser Glu Glu Glu Asp Asp Asp Asp Lys Asp Gln 645 650 655 Asp Glu Ser Asp Ser Asp Thr Glu Gly Glu Lys Thr Ser Met Lys Leu 660 665 670 Asn Lys Thr Thr Ser Ser Val Lys Ser Pro Ser Met Ser Leu Thr Gly 675 680 685 His Ser Thr Pro Arg Asn Leu His Ile Ala Lys Ala Pro Gly Ser Ala 690 695 700 Pro Ala Ala Leu Cys Ser Glu Ser Gln Ser Pro Ala Phe Leu Gly Thr 705 710 715 720 Ser Ser Ser Thr Leu Thr Ser Ser Pro His Ser Gly Thr Ser Lys Arg 725 730 735 Arg Arg Val Thr Asp Glu Arg Glu Leu Arg Ile Pro Leu Glu Tyr Gly 740 745 750 Trp Gln Arg Glu Thr Arg Ile Arg Asn Phe Gly Gly Arg Leu Gln Gly 755 760 765 Glu Val Ala Tyr Tyr Ala Pro Cys Gly Lys Lys Leu Arg Gln Tyr Pro 770 775 780 Glu Val Ile Lys Tyr Leu Ser Arg Asn Gly Ile Met Asp Ile Ser Arg 785 790 795 800 Asp Asn Phe Ser Phe Ser Ala Lys Ile Arg Val Gly Asp Phe Tyr Glu 805 810 815 Ala Arg Asp Gly Pro Gln Gly Met Gln Trp Cys Leu Leu Lys Glu Glu 820 825 830 Asp Val Ile Pro Arg Ile Arg Ala Met Glu Gly Arg Arg Gly Arg Pro 835 840 845 Pro Asn Pro Asp Arg Gln Arg Ala Arg Glu Glu Ser Arg Met Arg Arg 850 855 860 Arg Lys Gly Arg Pro Pro Asn Val Gly Asn Ala Glu Phe Leu Asp Asn 865 870 875 880 Ala Asp Ala Lys Leu Leu Arg Lys Leu Gln Ala Gln Glu Ile Ala Arg 885 890 895 Gln Ala Ala Gln Ile Lys Leu Leu Arg Lys Leu Gln Lys Gln Glu Gln 900 905 910 Ala Arg Val Ala Lys Glu Ala Lys Lys Gln Gln Ala Ile Met Ala Ala 915 920 925 Glu Glu Lys Arg Lys Gln Lys Glu Gln Ile Lys Ile Met Lys Gln Gln 930 935 940 Glu Lys Ile Lys Arg Ile Gln Gln Ile Arg Met Glu Lys Glu Leu Arg 945 950 955 960 Ala Gln Gln Ile Leu Glu Ala Lys Lys Lys Lys Lys Glu Glu Ala Ala 965 970 975 Asn Ala Lys Leu Leu Glu Ala Glu Lys Arg Ile Lys Glu Lys Glu Met 980 985 990 Arg Arg Gln Gln Ala Val Leu Leu Lys His Gln Glu Arg Glu Arg Arg 995 1000 1005 Arg Gln His Met Met Leu Met Lys Ala Met Glu Ala Arg Lys Lys Ala 1010 1015 1020 Glu Glu Lys Glu Arg Leu Lys Gln Glu Lys Arg Asp Glu Lys Arg Leu 1025 1030 1035 1040 Asn Lys Glu Arg Lys Leu Glu Gln Arg Arg Leu Glu Leu Glu Met Ala 1045 1050 1055 Lys Glu Leu Lys Lys Pro Asn Glu Asp Met Cys Leu Ala Asp Gln Lys 1060 1065 1070 Pro Leu Pro Glu Leu Pro Arg Ile Pro Gly Leu Val Leu Ser Gly Ser 1075 1080 1085 Thr Phe Ser Asp Cys Leu Met Val Val Gln Phe Leu Arg Asn Phe Gly 1090 1095 1100 Lys Val Leu Gly Phe Asp Val Asn Ile Asp Val Pro Asn Leu Ser Val 1105 1110 1115 1120 Leu Gln Glu Gly Leu Leu Asn Ile Gly Asp Ser Met Gly Glu Val Gln 1125 1130 1135 Asp Leu Leu Val Arg Leu Leu Ser Ala Ala Val Cys Asp Pro Gly Leu 1140 1145 1150 Ile Thr Gly Tyr Lys Ala Lys Thr Ala Leu Gly Glu His Leu Leu Asn 1155 1160 1165 Val Gly Val Asn Arg Asp Asn Val Ser Glu Ile Leu Gln Ile Phe Met 1170 1175 1180 Glu Ala His Cys Gly Gln Thr Glu Leu Thr Glu Ser Leu Lys Thr Lys 1185 1190 1195 1200 Ala Phe Gln Ala His Thr Pro Ala Gln Lys Ala Ser Val Leu Ala Phe 1205 1210 1215 Leu Ile Asn Glu Leu Ala Cys Ser Lys Ser Val Val Ser Glu Ile Asp 1220 1225 1230 Lys Asn Ile Asp Tyr Met Ser Asn Leu Arg Arg Asp Lys Trp Val Val 1235 1240 1245 Glu Gly Lys Leu Arg Lys Leu Arg Ile Ile His Ala Lys Lys Thr Gly 1250 1255 1260 Lys Arg Asp Thr Ser Gly Gly Ile Asp Leu Gly Glu Glu Gln His Pro 1265 1270 1275 1280 Leu Gly Thr Pro Thr Pro Gly Arg Lys Arg Arg Arg Lys Gly Gly Asp 1285 1290 1295 Ser Asp Tyr Asp Asp Asp Asp Asp Asp Asp Ser Asp Asp Gln Gly Asp 1300 1305 1310 Glu Asp Asp Glu Asp Glu Glu Asp Lys Glu Asp Lys Lys Gly Lys Lys 1315 1320 1325 Thr Asp Ile Cys Glu Asp Glu Asp Glu Gly Asp Gln Ala Ala Ser Val 1330 1335 1340 Glu Glu Leu Glu Lys Gln Ile Glu Lys Leu Ser Lys Gln Gln Ser Gln 1345 1350 1355 1360 Tyr Arg Arg Lys Leu Phe Asp Ala Ser His Ser Leu Arg Ser Val Met 1365 1370 1375 Phe Gly Gln Asp Arg Tyr Arg Arg Arg Tyr Trp Ile Leu Pro Gln Cys 1380 1385 1390 Gly Gly Ile Phe Val Glu Gly Met Glu Ser Gly Glu Gly Leu Glu Glu 1395 1400 1405 Ile Ala Lys Glu Arg Glu Lys Leu Lys Lys Ala Glu Ser Val Gln Ile 1410 1415 1420 Lys Glu Glu Met Phe Glu Thr Ser Gly Asp Ser Leu Asn Cys Ser Asn 1425 1430 1435 1440 Thr Asp His Cys Glu Gln Lys Glu Asp Leu Lys Glu Lys Asp Asn Thr 1445 1450 1455 Asn Leu Phe Leu Gln Lys Pro Gly Ser Phe Ser Lys Leu Ser Lys Leu 1460 1465 1470 Leu Glu Val Ala Lys Met Pro Pro Glu Ser Glu Val Met Thr Pro Lys 1475 1480 1485 Pro Asn Ala Gly Ala Asn Gly Cys Thr Leu Ser Tyr Gln Asn Ser Gly 1490 1495 1500 Lys His Ser Leu Gly Ser Val Gln Ser Thr Ala Thr Gln Ser Asn Val 1505 1510 1515 1520 Glu Lys Ala Asp Ser Asn Asn Leu Phe Asn Thr Gly Ser Ser Gly Pro 1525 1530 1535 Gly Lys Phe Tyr Ser Pro Leu Pro Asn Asp Gln Leu Leu Lys Thr Leu 1540 1545 1550 Thr Glu Lys Asn Arg Gln Trp Phe Ser Leu Leu Pro Arg Thr Pro Cys 1555 1560 1565 Asp Asp Thr Ser Leu Thr His Ala Asp Met Ser Thr Ala Ser Leu Val 1570 1575 1580 Thr Pro Gln Ser Gln Pro Pro Ser Lys Ser Pro Ser Pro Thr Pro Ala 1585 1590 1595 1600 Pro Leu Gly Ser Ser Ala Gln Asn Pro Val Gly Leu Asn Pro Phe Ala 1605 1610 1615 Leu Ser Pro Leu Gln Val Lys Gly Gly Val Ser Met Met Gly Leu Gln 1620 1625 1630 Phe Cys Gly Trp Pro Thr Gly Val Val Thr Ser Asn Ile Pro Phe Thr 1635 1640 1645 Ser Ser Val Pro Ser Leu Gly Ser Gly Leu Gly Leu Ser Glu Gly Asn 1650 1655 1660 Gly Asn Ser Phe Leu Thr Ser Asn Val Ala Ser Ser Lys Ser Glu Ser 1665 1670 1675 1680 Pro Val Pro Gln Asn Glu Lys Ala Thr Ser Ala Gln Pro Ala Ala Val 1685 1690 1695 Glu Val Ala Lys Pro Val Asp Phe Pro Ser Pro Lys Pro Ile Pro Glu 1700 1705 1710 Glu Met Gln Phe Gly Trp Trp Arg Ile Ile Asp Pro Glu Asp Leu Lys 1715 1720 1725 Ala Leu Leu Lys Val Leu His Leu Arg Gly Ile Arg Glu Lys Ala Leu 1730 1735 1740 Gln Lys Gln Ile Gln Lys His Leu Asp Tyr Ile Thr Gln Ala Cys Leu 1745 1750 1755 1760 Lys Asn Lys Asp Val Ala Ile Ile Glu Leu Asn Glu Asn Glu Glu Asn 1765 1770 1775 Gln Val Thr Arg Asp Ile Val Glu Asn Trp Ser Val Glu Glu Gln Ala 1780 1785 1790 Met Glu Met Asp Leu Ser Val Leu Gln Gln Val Glu Asp Leu Glu Arg 1795 1800 1805 Arg Val Ala Ser Ala Ser Leu Gln Val Lys Gly Trp Met Cys Pro Glu 1810 1815 1820 Pro Ala Ser Glu Arg Glu Asp Leu Val Tyr Phe Glu His Lys Ser Phe 1825 1830 1835 1840 Thr Lys Leu Cys Lys Glu His Asp Gly Glu Phe Thr Gly Glu Asp Glu 1845 1850 1855 Ser Ser Ala His Ala Leu Glu Arg Lys Ser Asp Asn Pro Leu Asp Ile 1860 1865 1870 Ala Val Thr Arg Leu Ala Asp Leu Glu Arg Asn Ile Glu Arg Arg Ile 1875 1880 1885 Glu Glu Asp Ile Ala Pro Gly Leu Arg Val Trp Arg Arg Ala Leu Ser 1890 1895 1900 Glu Ala Arg Ser Ala Ala Gln Val Ala Leu Cys Ile Gln Gln Leu Gln 1905 1910 1915 1920 Lys Ser Ile Ala Trp Glu Lys Ser Ile Met Lys Val Tyr Cys Gln Ile 1925 1930 1935 Cys Arg Lys Gly Asp Asn Glu Glu Leu Leu Leu Leu Cys Asp Gly Cys 1940 1945 1950 Asp Lys Gly Cys His Thr Tyr Cys His Arg Pro Lys Ile Thr Thr Ile 1955 1960 1965 Pro Asp Gly Asp Trp Phe Cys Pro Ala Cys Ile Ala Lys Ala Ser Gly 1970 1975 1980 Gln Thr Leu Lys Ile Lys Lys Leu His Val Lys Gly Lys Lys Thr Asn 1985 1990 1995 2000 Glu Ser Lys Lys Gly Lys Lys Val Thr Leu Thr Gly Asp Thr Glu Asp 2005 2010 2015 Glu Asp Ser Ala Ser Thr Ser Ser Ser Leu Lys Arg Gly Asn Lys Asp 2020 2025 2030 Leu Lys Lys Arg Lys Met Glu Glu Asn Thr Ser Ile Asn Leu Ser Lys 2035 2040 2045 Gln Glu Ser Phe Thr Ser Val Lys Lys Pro Lys Arg Asp Asp Ser Lys 2050 2055 2060 Asp Leu Ala Leu Cys Ser Met Ile Leu Thr Glu Met Glu Thr His Glu 2065 2070 2075 2080 Asp Ala Trp Pro Phe Leu Leu Pro Val Asn Leu Lys Leu Val Pro Gly 2085 2090 2095 Tyr Lys Lys Val Ile Lys Lys Pro Met Asp Phe Ser Thr Ile Arg Glu 2100 2105 2110 Lys Leu Ser Ser Gly Gln Tyr Pro Asn Leu Glu Thr Phe Ala Leu Asp 2115 2120 2125 Val Arg Leu Val Phe Asp Asn Cys Glu Thr Phe Asn Glu Asp Asp Ser 2130 2135 2140 Asp Ile Gly Arg Ala Gly His Asn Met Arg Lys Tyr Phe Glu Lys Lys 2145 2150 2155 2160 Trp Thr Asp Thr Phe Lys Val Ser 2165 <210> 2 <211> 1023 <212> PRT <213> Homo sapiens <400> 2 Met Asp Ala Asn Ser Lys Asp Lys Pro Pro Glu Thr Lys Glu Ser Ala 1 5 10 15 Met Asn Asn Ala Gly Asn Ala Ser Phe Ile Leu Gly Thr Gly Lys Ile 20 25 30 Val Thr Pro Gln Lys His Ala Glu Leu Pro Pro Asn Pro Cys Thr Pro 35 40 45 Asp Thr Phe Lys Ser Pro Leu Asn Phe Ser Thr Val Thr Val Glu Gln 50 55 60 Leu Gly Ile Thr Pro Glu Ser Phe Val Arg Asn Ser Ala Gly Lys Ser 65 70 75 80 Ser Ser Tyr Leu Lys Lys Cys Arg Arg Arg Ser Ala Val Gly Ala Arg 85 90 95 Gly Ser Pro Glu Thr Asn His Leu Ile Arg Phe Ile Ala Arg Gln Gln 100 105 110 Asn Ile Lys Asn Ala Arg Lys Ser Pro Leu Ala Gln Asp Ser Pro Ser 115 120 125 Gln Gly Ser Pro Ala Leu Tyr Arg Asn Val Asn Thr Leu Arg Glu Arg 130 135 140 Ile Ser Ala Phe Gln Ser Ala Phe His Ser Ile Lys Glu Asn Glu Lys 145 150 155 160 Met Thr Gly Cys Leu Glu Phe Ser Glu Ala Gly Lys Glu Ser Glu Met 165 170 175 Thr Asp Leu Thr Arg Lys Glu Gly Leu Ser Ala Cys Gln Gln Ser Gly 180 185 190 Phe Pro Ala Val Leu Ser Ser Lys Arg Arg Arg Ile Ser Tyr Gln Arg 195 200 205 Asp Ser Asp Glu Asn Leu Thr Asp Ala Glu Gly Lys Val Ile Gly Leu 210 215 220 Gln Ile Phe Asn Ile Asp Thr Asp Arg Ala Cys Ala Val Glu Thr Ser 225 230 235 240 Val Asp Leu Ser Glu Ile Ser Ser Lys Leu Gly Ser Thr Gln Ser Gly 245 250 255 Phe Leu Val Glu Glu Ser Leu Pro Leu Ser Glu Leu Thr Glu Thr Ser 260 265 270 Asn Ala Leu Lys Val Ala Asp Cys Val Val Gly Lys Gly Ser Ser Asp 275 280 285 Ala Val Ser Pro Asp Thr Phe Thr Ala Glu Val Ser Ser Asp Ala Val 290 295 300 Pro Asp Val Arg Ser Pro Ala Thr Pro Ala Cys Arg Arg Asp Leu Pro 305 310 315 320 Thr Pro Lys Thr Phe Val Leu Arg Ser Val Leu Lys Lys Pro Ser Val 325 330 335 Lys Met Cys Leu Glu Ser Leu Gln Glu His Cys Asn Asn Leu Tyr Asp 340 345 350 Asp Asp Gly Thr His Pro Ser Leu Ile Ser Asn Leu Pro Asn Cys Cys 355 360 365 Lys Glu Lys Glu Ala Glu Asp Glu Glu Asn Phe Glu Ala Pro Ala Phe 370 375 380 Leu Asn Met Arg Lys Arg Lys Arg Val Thr Phe Gly Glu Asp Leu Ser 385 390 395 400 Pro Glu Val Phe Asp Glu Ser Leu Pro Ala Asn Thr Pro Leu Arg Lys 405 410 415 Gly Gly Thr Pro Val Cys Lys Lys Asp Phe Ser Gly Leu Ser Ser Leu 420 425 430 Leu Leu Glu Gln Ser Pro Val Pro Glu Pro Leu Pro Gln Pro Asp Phe 435 440 445 Asp Asp Lys Gly Glu Asn Leu Glu Asn Ile Glu Pro Leu Gln Val Ser 450 455 460 Phe Ala Val Leu Ser Ser Pro Asn Lys Ser Ser Ile Ser Glu Thr Leu 465 470 475 480 Ser Gly Thr Asp Thr Phe Ser Ser Ser Asn Asn His Glu Lys Ile Ser 485 490 495 Ser Pro Lys Val Gly Arg Ile Thr Arg Thr Ser Asn Arg Arg Asn Gln 500 505 510 Leu Val Ser Val Val Glu Glu Ser Val Cys Asn Leu Leu Asn Thr Glu 515 520 525 Val Gln Pro Cys Lys Glu Lys Lys Ile Asn Arg Arg Lys Ser Gln Glu 530 535 540 Thr Lys Cys Thr Lys Arg Ala Leu Pro Lys Lys Ser Gln Val Leu Lys 545 550 555 560 Ser Cys Arg Lys Lys Lys Lys Gly Lys Gly Lys Lys Ser Val Gln Lys Ser 565 570 575 Leu Tyr Gly Glu Arg Asp Ile Ala Ser Lys Lys Pro Leu Leu Ser Pro 580 585 590 Ile Pro Glu Leu Pro Glu Val Pro Glu Met Thr Pro Ser Ile Pro Ser 595 600 605 Ile Arg Arg Leu Gly Ser Gly Tyr Phe Ser Ser Asn Gly Lys Leu Glu 610 615 620 Glu Val Lys Thr Pro Lys Asn Pro Val Lys Arg Lys Asp Leu Leu Arg 625 630 635 640 His Asp Pro Asp Leu His Met His Gln Gly Tyr Asp Lys Tyr Asp Val 645 650 655 Ser Glu Phe Cys Ser Tyr Ile Lys Ser Ser Ser Ser Leu Gly Asn Ala 660 665 670 Thr Ser Asp Glu Asp Pro Asn Thr Asn Ile Met Asn Ile Asn Glu Asn 675 680 685 Lys Asn Ile Pro Lys Ala Lys Asn Lys Ser Glu Ser Glu Asn Glu Pro 690 695 700 Lys Ala Gly Thr Asp Ser Pro Val Ser Cys Ala Ser Val Thr Glu Glu 705 710 715 720 Arg Val Ala Ser Asp Ser Pro Lys Pro Ala Leu Thr Leu Gln Gln Gly 725 730 735 Gln Glu Phe Ser Ala Gly Gly Gln Asn Ala Glu Asn Leu Cys Gln Phe 740 745 750 Phe Lys Ile Ser Pro Asp Leu Asn Ile Lys Cys Glu Arg Lys Asp Asp 755 760 765 Phe Leu Gly Ala Ala Glu Gly Lys Leu Gln Cys Asn Arg Leu Met Pro 770 775 780 Asn Ser Gln Lys Asp Cys His Cys Leu Gly Asp Val Leu Ile Glu Asn 785 790 795 800 Thr Lys Glu Ser Lys Ser Gln Ser Glu Asp Leu Gly Arg Lys Pro Met 805 810 815 Glu Ser Ser Ser Val Val Ser Cys Arg Asp Arg Lys Asp Arg Arg Arg 820 825 830 Ser Met Cys Tyr Ser Asp Gly Arg Ser Leu His Leu Glu Lys Asn Gly 835 840 845 Asn His Thr Pro Ser Ser Ser Val Gly Ser Ser Val Glu Ile Ser Leu 850 855 860 Glu Asn Ser Glu Leu Phe Lys Asp Leu Ser Asp Ala Ile Glu Gln Thr 865 870 875 880 Phe Gln Arg Arg Asn Ser Glu Thr Lys Val Arg Arg Ser Thr Arg Leu 885 890 895 Gln Lys Asp Leu Glu Asn Glu Gly Leu Val Trp Ile Ser Leu Pro Leu 900 905 910 Pro Ser Thr Ser Gln Lys Ala Lys Arg Arg Thr Ile Cys Thr Phe Asp 915 920 925 Ser Ser Gly Phe Glu Ser Met Ser Pro Ile Lys Glu Thr Val Ser Ser 930 935 940 Arg Gln Lys Pro Gln Met Ala Pro Val Ser Asp Pro Glu Asn Ser 945 950 955 960 Gln Gly Pro Ala Ala Gly Ser Ser Asp Glu Pro Gly Lys Arg Arg Lys 965 970 975 Ser Phe Cys Ile Ser Thr Leu Ala Asn Thr Lys Ala Thr Ser Gln Phe 980 985 990 Lys Gly Tyr Arg Arg Arg Ser Ser Leu Asn Gly Lys Gly Glu Ser Ser 995 1000 1005 Leu Thr Ala Leu Glu Arg Ile Glu His Asn Gly Glu Arg Lys Gln 1010 1015 1020 <210> 3 <211> 469 <212> PRT <213> Homo sapiens <400> 3 Met Ile Thr Glu Gly Ala Gln Ala Pro Arg Leu Leu Leu Pro Pro Leu 1 5 10 15 Leu Leu Leu Leu Thr Leu Pro Ala Thr Gly Ser Asp Pro Val Leu Cys 20 25 30 Phe Thr Gln Tyr Glu Glu Ser Ser Gly Lys Cys Lys Gly Leu Leu Gly 35 40 45 Gly Gly Val Ser Val Glu Asp Cys Cys Leu Asn Thr Ala Phe Ala Tyr 50 55 60 Gln Lys Arg Ser Gly Gly Leu Cys Gln Pro Cys Arg Ser Pro Arg Trp 65 70 75 80 Ser Leu Trp Ser Thr Trp Ala Pro Cys Ser Val Thr Cys Ser Glu Gly 85 90 95 Ser Gln Leu Arg Tyr Arg Arg Cys Val Gly Trp Asn Gly Gln Cys Ser 100 105 110 Gly Lys Val Ala Pro Gly Thr Leu Glu Trp Gln Leu Gln Ala Cys Glu 115 120 125 Asp Gln Gln Cys Cys Pro Glu Met Gly Gly Trp Ser Gly Trp Gly Pro 130 135 140 Trp Glu Pro Cys Ser Val Thr Cys Ser Lys Gly Thr Arg Thr Arg Arg 145 150 155 160 Arg Ala Cys Asn His Pro Ala Pro Lys Cys Gly Gly His Cys Pro Gly 165 170 175 Gln Ala Gln Glu Ser Glu Ala Cys Asp Thr Gln Gln Val Cys Pro Thr 180 185 190 His Gly Ala Trp Ala Thr Trp Gly Pro Trp Thr Pro Cys Ser Ala Ser 195 200 205 Cys His Gly Gly Pro His Glu Pro Lys Glu Thr Arg Ser Arg Lys Cys 210 215 220 Ser Ala Pro Glu Pro Ser Gln Lys Pro Pro Gly Lys Pro Cys Pro Gly 225 230 235 240 Leu Ala Tyr Glu Gln Arg Arg Cys Thr Gly Leu Pro Pro Cys Pro Val 245 250 255 Ala Gly Gly Trp Gly Pro Trp Gly Pro Val Ser Pro Cys Pro Val Thr 260 265 270 Cys Gly Leu Gly Gln Thr Met Glu Gln Arg Thr Cys Asn His Pro Val 275 280 285 Pro Gln His Gly Gly Pro Phe Cys Ala Gly Asp Ala Thr Arg Thr His 290 295 300 Ile Cys Asn Thr Ala Val Pro Cys Pro Val Asp Gly Glu Trp Asp Ser 305 310 315 320 Trp Gly Glu Trp Ser Pro Cys Ile Arg Arg Asn Met Lys Ser Ile Ser 325 330 335 Cys Gln Glu Ile Pro Gly Gln Gln Ser Arg Gly Arg Thr Cys Arg Gly 340 345 350 Arg Lys Phe Asp Gly His Arg Cys Ala Gly Gln Gln Gln Asp Ile Arg 355 360 365 His Cys Tyr Ser Ile Gln His Cys Pro Leu Lys Gly Ser Trp Ser Glu 370 375 380 Trp Ser Thr Trp Gly Leu Cys Met Pro Pro Cys Gly Pro Asn Pro Thr 385 390 395 400 Arg Ala Arg Gln Arg Leu Cys Thr Pro Leu Leu Pro Lys Tyr Pro Pro 405 410 415 Thr Val Ser Met Val Glu Gly Gin Gly Glu Lys Asn Val Thr Phe Trp 420 425 430 Gly Arg Pro Leu Pro Arg Cys Glu Glu Leu Gln Gly Gln Lys Leu Val 435 440 445 Val Glu Glu Lys Arg Pro Cys Leu His Val Pro Ala Cys Lys Asp Pro 450 455 460 Glu Glu Glu Glu Leu 465 <210> 4 <211> 882 <212> PRT <213> Homo sapiens <400> 4 Met Ala Val Arg Ser Arg Arg Pro Trp Met Ser Val Ala Leu Gly Leu 1 5 10 15 Val Leu Gly Phe Thr Ala Ala Ser Trp Leu Ile Ala Pro Arg Val Ala 20 25 30 Glu Leu Ser Glu Arg Lys Arg Arg Gly Ser Ser Leu Cys Ser Tyr Tyr 35 40 45 Gly Arg Ser Ala Ala Gly Pro Arg Ala Gly Ala Gln Gln Pro Leu Pro 50 55 60 Gln Pro Gln Ser Arg Pro Arg Gln Glu Gln Ser Pro Pro Pro Ala Arg 65 70 75 80 Gln Asp Leu Gln Gly Pro Pro Leu Pro Glu Ala Ala Pro Gly Ile Thr 85 90 95 Ser Phe Arg Ser Ser Pro Trp Gln Gln Pro Pro Leu Gln Gln Arg 100 105 110 Arg Arg Gly Arg Glu Pro Glu Gly Ala Thr Gly Leu Pro Gly Ala Pro 115 120 125 Ala Ala Glu Gly Glu Pro Glu Glu Glu Asp Gly Gly Ala Ala Gly Gln 130 135 140 Arg Arg Asp Gly Arg Pro Gly Ser Ser His Asn Gly Ser Gly Asp Gly 145 150 155 160 Gly Ala Ala Ala Pro Ser Ala Arg Pro Arg Asp Phe Leu Tyr Val Gly 165 170 175 Val Met Thr Ala Gln Lys Tyr Leu Gly Ser Arg Ala Leu Ala Ala Gln 180 185 190 Arg Thr Trp Ala Arg Phe Ile Pro Gly Arg Val Glu Phe Phe Ser Ser Ser 195 200 205 Gln Gln Pro Pro Asn Ala Gly Gln Pro Pro Pro Leu Pro Val Ile 210 215 220 Ala Leu Pro Gly Val Asp Asp Ser Tyr Pro Pro Gln Lys Lys Ser Phe 225 230 235 240 Met Met Ile Lys Tyr Met His Asp His Tyr Leu Asp Lys Tyr Glu Trp 245 250 255 Phe Met Arg Ala Asp Asp Asp Val Tyr Ile Lys Gly Asp Lys Leu Glu 260 265 270 Glu Phe Leu Arg Ser Leu Asn Ser Ser Lys Pro Leu Tyr Leu Gly Gln 275 280 285 Thr Gly Leu Gly Asn Ile Glu Glu Leu Gly Lys Leu Gly Leu Glu Pro 290 295 300 Gly Glu Asn Phe Cys Met Gly Gly Pro Gly Met Ile Phe Ser Arg Glu 305 310 315 320 Val Leu Arg Arg Met Val Pro His Ile Gly Glu Cys Leu Arg Glu Met 325 330 335 Tyr Thr Thr His Glu Asp Val Glu Val Gly Arg Cys Val Arg Arg Phe 340 345 350 Gly Gly Thr Gln Cys Val Trp Ser Tyr Glu Met Gln Gln Leu Phe His 355 360 365 Glu Asn Tyr Glu His Asn Arg Lys Gly Tyr Ile Gln Asp Leu His Asn 370 375 380 Ser Lys Ile His Ala Ala Ile Thr Leu His Pro Asn Lys Arg Pro Ala 385 390 395 400 Tyr Gln Tyr Arg Leu His Asn Tyr Met Leu Ser Arg Lys Ile Ser Glu 405 410 415 Leu Arg Tyr Arg Thr Ile Gln Leu His Arg Glu Ser Ala Leu Met Ser 420 425 430 Lys Leu Ser Asn Thr Glu Val Ser Lys Glu Asp Gln Gln Leu Gly Val 435 440 445 Ile Pro Ser Phe Asn His Phe Gln Pro Arg Glu Arg Asn Glu Val Ile 450 455 460 Glu Trp Glu Phe Leu Thr Gly Lys Leu Leu Tyr Ser Ala Ala Glu Asn 465 470 475 480 Gln Pro Pro Arg Gln Ser Leu Ser Ser Ile Leu Arg Thr Ala Leu Asp 485 490 495 Asp Thr Val Leu Gln Val Met Glu Met Ile Asn Glu Asn Ala Lys Ser 500 505 510 Arg Gly Arg Leu Ile Asp Phe Lys Glu Ile Gln Tyr Gly Tyr Arg Arg 515 520 525 Val Asn Pro Met His Gly Val Glu Tyr Ile Leu Asp Leu Leu Leu Leu Leu 530 535 540 Tyr Lys Arg His Lys Gly Arg Lys Leu Thr Val Pro Val Arg Arg His 545 550 555 560 Ala Tyr Leu Gln Gln Leu Phe Ser Lys Pro Phe Phe Arg Glu Thr Glu 565 570 575 Glu Leu Asp Val Asn Ser Leu Val Glu Ser Ile Asn Ser Glu Thr Gln 580 585 590 Ser Phe Ser Phe Ile Ser Asn Ser Leu Lys Ile Leu Ser Ser Phe Gln 595 600 605 Gly Ala Lys Glu Met Gly Gly His Asn Glu Lys Lys Val His Ile Leu 610 615 620 Val Pro Leu Ile Gly Arg Tyr Asp Ile Phe Leu Arg Phe Met Glu Asn 625 630 635 640 Phe Glu Asn Met Cys Leu Ile Pro Lys Gln Asn Val Lys Leu Val Ile 645 650 655 Ile Leu Phe Ser Arg Asp Ser Gly Gln Asp Ser Ser Lys His Ile Glu 660 665 670 Leu Ile Lys Gly Tyr Gln Asn Lys Tyr Pro Lys Ala Glu Met Thr Leu 675 680 685 Ile Pro Met Lys Gly Glu Phe Ser Arg Gly Leu Gly Leu Glu Met Ala 690 695 700 Ser Ala Gln Phe Asp Asn Asp Thr Leu Leu Leu Phe Cys Asp Val Asp 705 710 715 720 Leu Ile Phe Arg Glu Asp Phe Leu Gln Arg Cys Arg Asp Asn Thr Ile 725 730 735 Gln Gly Gln Gln Val Tyr Tyr Pro Ile Ile Phe Ser Gln Tyr Asp Pro 740 745 750 Lys Val Thr Asn Gly Gly Asn Pro Pro Thr Asp Asp Tyr Phe Ile Phe 755 760 765 Ser Lys Lys Thr Gly Phe Trp Arg Asp Tyr Gly Tyr Gly Ile Thr Cys 770 775 780 Ile Tyr Lys Ser Asp Leu Leu Gly Ala Gly Gly Phe Asp Thr Ser Ile 785 790 795 800 Gln Gly Trp Gly Leu Glu Asp Val Asp Leu Tyr Asn Lys Val Ile Leu 805 810 815 Ser Gly Leu Arg Pro Phe Arg Ser Gln Glu Val Gly Val Val His Ile 820 825 830 Phe His Pro Val His Cys Asp Pro Asn Leu Asp Pro Lys Gln Tyr Lys 835 840 845 Met Cys Leu Gly Ser Lys Ala Ser Thr Phe Ala Ser Thr Met Gln Leu 850 855 860 Ala Glu Leu Trp Leu Glu Lys His Leu Gly Val Arg Tyr Asn Arg Thr 865 870 875 880 Leu Ser <210> 5 <211> 898 <212> PRT <213> Homo sapiens <400> 5 Met Ala Ala Ala Ala Ala Glu Glu Gly Met Glu Pro Arg Ala Leu Gln 1 5 10 15 Tyr Glu Gln Thr Leu Met Tyr Gly Arg Tyr Thr Gln Asp Leu Gly Ala 20 25 30 Phe Ala Lys Glu Glu Ala Ala Arg Ile Arg Leu Gly Gly Pro Glu Pro 35 40 45 Trp Lys Gly Pro Pro Ser Ser Arg Ala Ala Pro Glu Leu Leu Glu Tyr 50 55 60 Gly Arg Ser Arg Cys Ala Arg Cys Arg Val Cys Ser Val Arg Cys His 65 70 75 80 Lys Phe Leu Val Ser Arg Val Gly Glu Asp Trp Ile Phe Leu Val Leu 85 90 95 Leu Gly Leu Leu Met Ala Leu Val Ser Trp Val Met Asp Tyr Ala Ile 100 105 110 Ala Ala Cys Leu Gln Ala Gln Gln Trp Met Ser Arg Gly Leu Asn Thr 115 120 125 Ser Ile Leu Leu Gln Tyr Leu Ala Trp Val Thr Tyr Pro Val Val Leu 130 135 140 Ile Thr Phe Ser Ala Gly Phe Thr Gln Ile Leu Ala Pro Gln Ala Val 145 150 155 160 Gly Ser Gly Ile Pro Glu Met Lys Thr Ile Leu Arg Gly Val Val Leu 165 170 175 Lys Glu Tyr Leu Thr Leu Lys Thr Phe Ile Ala Lys Val Ile Gly Leu 180 185 190 Thr Cys Ala Leu Gly Ser Gly Met Pro Leu Gly Lys Glu Gly Pro Phe 195 200 205 Val His Ile Ala Ser Met Cys Ala Ala Leu Leu Ser Lys Phe Leu Ser 210 215 220 Leu Phe Gly Gly Ile Tyr Glu Asn Glu Ser Arg Asn Thr Glu Met Leu 225 230 235 240 Ala Ala Ala Cys Ala Val Gly Val Gly Cys Cys Phe Ala Ala Pro Ile 245 250 255 Gly Gly Val Leu Phe Ser Ile Glu Val Thr Ser Thr Phe Phe Ala Val 260 265 270 Arg Asn Tyr Trp Arg Gly Phe Phe Ala Ala Thr Phe Ser Ala Phe Ile 275 280 285 Phe Arg Val Leu Ala Val Trp Asn Arg Asp Glu Glu Thr Ile Thr Ala 290 295 300 Leu Phe Lys Thr Arg Phe Arg Leu Asp Phe Pro Phe Asp Leu Gln Glu 305 310 315 320 Leu Pro Ala Phe Ala Val Ile Gly Ile Ala Ser Gly Phe Gly Gly Ala 325 330 335 Leu Phe Val Tyr Leu Asn Arg Lys Ile Val Gln Val Met Arg Lys Gln 340 345 350 Lys Thr Ile Asn Arg Phe Leu Met Arg Lys Arg Leu Leu Phe Pro Ala 355 360 365 Leu Val Thr Leu Leu Ile Ser Thr Leu Thr Phe Pro Pro Gly Phe Gly 370 375 380 Gln Phe Met Ala Gly Gln Leu Ser Gln Lys Glu Thr Leu Val Thr Leu 385 390 395 400 Phe Asp Asn Arg Thr Trp Val Arg Gln Gly Leu Val Glu Glu Leu Glu 405 410 415 Pro Pro Ser Thr Ser Gln Ala Trp Asn Pro Pro Arg Ala Asn Val Phe 420 425 430 Leu Thr Leu Val Ile Phe Ile Leu Met Lys Phe Trp Met Ser Ala Leu 435 440 445 Ala Thr Thr Ile Pro Val Pro Cys Gly Ala Phe Met Pro Val Phe Val 450 455 460 Ile Gly Ala Ala Phe Gly Arg Leu Val Gly Glu Ser Met Ala Ala Trp 465 470 475 480 Phe Pro Asp Gly Ile His Thr Asp Ser Ser Thr Tyr Arg Ile Val Pro 485 490 495 Gly Gly Tyr Ala Val Val Gly Ala Ala Ala Ala Leu Ala Gly Ala Val Thr 500 505 510 His Thr Val Ser Thr Ala Val Ile Val Phe Glu Leu Thr Gly Gln Ile 515 520 525 Ala His Ile Leu Pro Val Met Ile Ala Val Ile Leu Ala Asn Ala Val 530 535 540 Ala Gln Ser Leu Gln Pro Ser Leu Tyr Asp Ser Ile Ile Arg Ile Lys 545 550 555 560 Lys Leu Pro Tyr Leu Pro Glu Leu Gly Trp Gly Arg His Gln Gln Tyr 565 570 575 Arg Val Arg Val Glu Asp Ile Met Val Arg Asp Val Pro His Val Ala 580 585 590 Leu Ser Cys Thr Phe Arg Asp Leu Arg Leu Ala Leu His Arg Thr Lys 595 600 605 Gly Arg Met Leu Ala Leu Val Glu Ser Pro Glu Ser Met Ile Leu Leu 610 615 620 Gly Ser Ile Glu Arg Ser Gln Val Val Ala Leu Leu Gly Ala Gln Leu 625 630 635 640 Ser Pro Ala Arg Arg Arg Gln His Met Gln Glu Arg Arg Ala Thr Gln 645 650 655 Thr Ser Pro Leu Ser Asp Gln Glu Gly Pro Pro Thr Pro Glu Ala Ser 660 665 670 Val Cys Phe Gln Val Asn Thr Glu Asp Ser Ala Phe Pro Ala Ala Arg 675 680 685 Gly Glu Thr His Lys Pro Leu Lys Pro Ala Leu Lys Arg Gly Pro Ser 690 695 700 Val Thr Arg Asn Leu Gly Glu Ser Pro Thr Gly Ser Ala Glu Ser Ala 705 710 715 720 Gly Ile Ala Leu Arg Ser Leu Phe Cys Gly Ser Pro Pro Pro Glu Ala 725 730 735 Ala Ser Glu Lys Leu Glu Ser Cys Glu Lys Arg Lys Leu Lys Arg Val 740 745 750 Arg Ile Ser Leu Ala Ser Asp Ala Asp Leu Glu Gly Glu Met Ser Pro 755 760 765 Glu Glu Ile Leu Glu Trp Glu Glu Gln Gln Leu Asp Glu Pro Val Asn 770 775 780 Phe Ser Asp Cys Lys Ile Asp Pro Ala Pro Phe Gln Leu Val Glu Arg 785 790 795 800 Thr Ser Leu His Lys Thr His Thr Ile Phe Ser Leu Leu Gly Val Asp 805 810 815 His Ala Tyr Val Thr Ser Ile Gly Arg Leu Ile Gly Ile Val Thr Leu 820 825 830 Lys Glu Leu Arg Lys Ala Ile Glu Gly Ser Val Thr Ala Gln Gly Val 835 840 845 Lys Val Arg Pro Leu Ala Ser Phe Arg Asp Ser Ala Thr Ser Ser 850 855 860 Ser Asp Thr Glu Thr Thr Glu Val His Ala Leu Trp Gly Pro His Ser 865 870 875 880 Arg His Gly Leu Pro Arg Glu Gly Ser Pro Ser Asp Ser Asp Asp Lys 885 890 895 Cys Gln <210> 6 <211> 1157 <212> PRT <213> Homo sapiens <400> 6 Met Gly Lys Leu Arg Arg Arg Tyr Asn Ile Lys Gly Arg Gln Gln Ala 1 5 10 15 Gly Pro Gly Pro Ser Lys Gly Pro Pro Glu Pro Pro Val Gln Leu 20 25 30 Glu Leu Glu Asp Lys Asp Thr Leu Lys Gly Val Asp Ala Ser Asn Ala 35 40 45 Leu Val Leu Pro Gly Lys Lys Lys Lys Lys Lys Thr Lys Ala Pro Leu 50 55 60 Ser Lys Lys Glu Lys Lys Pro Leu Thr Lys Lys Glu Lys Lys Val Leu 65 70 75 80 Gln Lys Ile Leu Glu Gln Lys Glu Lys Lys Ser Gln Arg Ala Glu Met 85 90 95 Leu Gln Lys Leu Ser Glu Val Gln Ala Ser Glu Ala Glu Met Arg Leu 100 105 110 Phe Tyr Thr Thr Ser Lys Leu Gly Thr Gly Asn Arg Met Tyr His Thr 115 120 125 Lys Glu Lys Ala Asp Glu Val Val Ala Pro Gly Gln Glu Lys Ile Ser 130 135 140 Ser Leu Ser Gly Ala His Arg Lys Arg Arg Arg Trp Pro Ser Ala Glu 145 150 155 160 Glu Glu Glu Glu Glu Glu Glu Glu Glu Ser Glu Ser Glu Leu Glu Glu Glu 165 170 175 Ser Glu Leu Asp Glu Asp Pro Ala Ala Glu Pro Ala Glu Ala Gly Val 180 185 190 Gly Thr Thr Val Ala Pro Leu Pro Pro Ala Pro Ala Pro Ser Ser Gln 195 200 205 Pro Val Pro Ala Gly Met Thr Val Pro Pro Pro Ala Ala Ala Pro 210 215 220 Pro Leu Pro Arg Ala Leu Ala Lys Pro Ala Val Phe Ile Pro Val Asn 225 230 235 240 Arg Ser Pro Glu Met Gln Glu Glu Arg Leu Lys Leu Pro Ile Leu Ser 245 250 255 Glu Glu Gln Val Ile Met Glu Ala Val Ala Glu His Pro Ile Val Ile 260 265 270 Val Cys Gly Glu Thr Gly Ser Gly Lys Thr Thr Gln Val Pro Gln Phe 275 280 285 Leu Tyr Glu Ala Gly Phe Ser Ser Glu Asp Ser Ile Ile Gly Val Thr 290 295 300 Glu Pro Arg Arg Val Ala Ala Val Ala Met Ser Gln Arg Val Ala Lys 305 310 315 320 Glu Met Asn Leu Ser Gln Arg Val Val Ser Tyr Gln Ile Arg Tyr Glu 325 330 335 Gly Asn Val Thr Glu Glu Thr Arg Ile Lys Phe Met Thr Asp Gly Val 340 345 350 Leu Leu Lys Glu Ile Gln Lys Asp Phe Leu Leu Leu Arg Tyr Lys Val 355 360 365 Val Ile Ile Asp Glu Ala His Glu Arg Ser Val Tyr Thr Asp Ile Leu 370 375 380 Ile Gly Leu Leu Ser Arg Ile Val Thr Leu Arg Ala Lys Arg Asn Leu 385 390 395 400 Pro Leu Lys Leu Leu Ile Met Ser Ala Thr Leu Arg Val Glu Asp Phe 405 410 415 Thr Gln Asn Pro Arg Leu Phe Ala Lys Pro Pro Pro Val Ile Lys Val 420 425 430 Glu Ser Arg Gln Phe Pro Val Thr Val His Phe Asn Lys Arg Thr Pro 435 440 445 Leu Glu Asp Tyr Ser Gly Glu Cys Phe Arg Lys Val Cys Lys Ile His 450 455 460 Arg Met Leu Pro Ala Gly Gly Ile Leu Val Phe Leu Thr Gly Gln Ala 465 470 475 480 Glu Val His Ala Leu Cys Arg Arg Leu Arg Lys Ala Phe Pro Ser 485 490 495 Arg Ala Arg Pro Gln Glu Lys Asp Asp Asp Gln Lys Asp Ser Val Glu 500 505 510 Glu Met Arg Lys Phe Lys Lys Ser Arg Ala Arg Ala Lys Lys Ala Arg 515 520 525 Ala Glu Val Leu Pro Gln Ile Asn Leu Asp His Tyr Ser Val Leu Pro 530 535 540 Ala Gly Glu Gly Asp Glu Asp Arg Glu Ala Glu Val Asp Glu Glu Glu 545 550 555 560 Gly Ala Leu Asp Ser Asp Leu Asp Leu Asp Leu Gly Asp Gly Gly Gln 565 570 575 Asp Gly Gly Glu Gln Pro Asp Ala Ser Leu Pro Leu His Val Leu Pro 580 585 590 Leu Tyr Ser Leu Leu Ala Pro Glu Lys Gln Ala Gln Val Phe Lys Pro 595 600 605 Pro Pro Glu Gly Thr Arg Leu Cys Val Val Ala Thr Asn Val Ala Glu 610 615 620 Thr Ser Leu Thr Ile Pro Gly Ile Lys Tyr Val Val Asp Cys Gly Lys 625 630 635 640 Val Lys Lys Arg Tyr Tyr Asp Arg Val Thr Gly Val Ser Ser Phe Arg 645 650 655 Val Thr Trp Val Ser Gln Ala Ser Ala Asp Gln Arg Ala Gly Arg Ala 660 665 670 Gly Arg Thr Glu Pro Gly His Cys Tyr Arg Leu Tyr Ser Ser Ala Val 675 680 685 Phe Gly Asp Phe Glu Gln Phe Pro Pro Glu Ile Thr Arg Arg Pro 690 695 700 Val Glu Asp Leu Ile Leu Gln Met Lys Ala Leu Asn Val Glu Lys Val 705 710 715 720 Ile Asn Phe Pro Phe Pro Thr Pro Pro Ser Val Glu Ala Leu Leu Ala 725 730 735 Ala Glu Glu Leu Leu Ile Ala Leu Gly Ala Leu Gln Pro Pro Gln Lys 740 745 750 Ala Glu Arg Val Lys Gln Leu Gln Glu Asn Arg Leu Ser Cys Pro Ile 755 760 765 Thr Ala Leu Gly Arg Thr Met Ala Thr Phe Pro Val Ala Pro Arg Tyr 770 775 780 Ala Lys Met Leu Ala Leu Ser Arg Gln His Gly Cys Leu Pro Tyr Ala 785 790 795 800 Ile Thr Ile Val Ala Ser Met Thr Val Arg Glu Leu Phe Glu Glu Leu 805 810 815 Asp Arg Pro Ala Ala Ser Asp Glu Glu Leu Thr Arg Leu Lys Ser Lys 820 825 830 Arg Ala Arg Val Ala Gln Met Lys Arg Thr Trp Ala Gly Gln Gly Ala 835 840 845 Ser Leu Lys Leu Gly Asp Leu Met Val Leu Leu Gly Ala Val Gly Ala 850 855 860 Cys Glu Tyr Ala Ser Cys Thr Pro Gln Phe Cys Glu Ala Asn Gly Leu 865 870 875 880 Arg Tyr Lys Ala Met Met Glu Ile Arg Arg Leu Arg Gly Gln Leu Thr 885 890 895 Thr Ala Val Asn Ala Val Cys Pro Glu Ala Glu Leu Phe Val Asp Pro 900 905 910 Lys Met Gln Pro Pro Thr Glu Ser Gln Val Thr Tyr Leu Arg Gln Ile 915 920 925 Val Thr Ala Gly Leu Gly Asp His Leu Ala Arg Arg Val Gln Ser Glu 930 935 940 Glu Met Leu Glu Asp Lys Trp Arg Asn Ala Tyr Lys Thr Pro Leu Leu 945 950 955 960 Asp Asp Pro Val Phe Ile His Pro Ser Ser Val Leu Phe Lys Glu Leu 965 970 975 Pro Glu Phe Val Val Tyr Gln Glu Ile Val Glu Thr Thr Lys Met Tyr 980 985 990 Met Lys Gly Val Ser Ser Val Glu Val Gln Trp Ile Pro Ala Leu Leu 995 1000 1005 Pro Ser Tyr Cys Gln Phe Asp Lys Pro Leu Glu Glu Pro Ala Pro Thr 1010 1015 1020 Tyr Cys Pro Glu Arg Gly Arg Val Leu Cys His Arg Ala Ser Val Phe 1025 1030 1035 1040 Tyr Arg Val Gly Trp Pro Leu Pro Ala Ile Glu Val Asp Phe Pro Glu 1045 1050 1055 Gly Ile Asp Arg Tyr Lys His Phe Ala Arg Phe Leu Leu Glu Gly Gln 1060 1065 1070 Val Phe Arg Lys Leu Ala Ser Tyr Arg Ser Cys Leu Leu Ser Ser Pro 1075 1080 1085 Gly Thr Met Leu Lys Thr Trp Ala Arg Leu Gln Pro Arg Thr Glu Ser 1090 1095 1100 Leu Leu Arg Ala Leu Val Ala Glu Lys Ala Asp Cys His Glu Ala Leu 1105 1110 1115 1120 Leu Ala Ala Trp Lys Lys Asn Pro Lys Tyr Leu Leu Ala Glu Tyr Cys 1125 1130 1135 Glu Trp Leu Pro Gln Ala Met His Pro Asp Ile Glu Lys Ala Trp Pro 1140 1145 1150 Pro Thr Thr Val His 1155 <210> 7 <211> 1210 <212> PRT <213> Homo sapiens <400> 7 Met Arg Pro Ser Gly Thr Ala Gly Ala Ala Leu Leu Ala Leu Leu Ala 1 5 10 15 Ala Leu Cys Pro Ala Ser Arg Ala Leu Glu Glu Lys Lys Val Cys Gln 20 25 30 Gly Thr Ser Asn Lys Leu Thr Gln Leu Gly Thr Phe Glu Asp His Phe 35 40 45 Leu Ser Leu Gln Arg Met Phe Asn Asn Cys Glu Val Val Leu Gly Asn 50 55 60 Leu Glu Ile Thr Tyr Val Gln Arg Asn Tyr Asp Leu Ser Phe Leu Lys 65 70 75 80 Thr Ile Gln Glu Val Ala Gly Tyr Val Leu Ile Ala Leu Asn Thr Val 85 90 95 Glu Arg Ile Pro Leu Glu Asn Leu Gln Ile Ile Arg Gly Asn Met Tyr 100 105 110 Tyr Glu Asn Ser Tyr Ala Leu Ala Val Leu Ser Asn Tyr Asp Ala Asn 115 120 125 Lys Thr Gly Leu Lys Glu Leu Pro Met Arg Asn Leu Gln Glu Ile Leu 130 135 140 His Gly Ala Val Arg Phe Ser Asn Asn Pro Ala Leu Cys Asn Val Glu 145 150 155 160 Ser Ile Gln Trp Arg Asp Ile Val Ser Ser Asp Phe Leu Ser Asn Met 165 170 175 Ser Met Asp Phe Gln Asn His Leu Gly Ser Cys Gln Lys Cys Asp Pro 180 185 190 Ser Cys Pro Asn Gly Ser Cys Trp Gly Ala Gly Glu Glu Asn Cys Gln 195 200 205 Lys Leu Thr Lys Ile Ile Cys Ala Gln Gln Cys Ser Gly Arg Cys Arg 210 215 220 Gly Lys Ser Pro Ser Asp Cys Cys His Asn Gln Cys Ala Ala Gly Cys 225 230 235 240 Thr Gly Pro Arg Glu Ser Asp Cys Leu Val Cys Arg Lys Phe Arg Asp 245 250 255 Glu Ala Thr Cys Lys Asp Thr Cys Pro Pro Leu Met Leu Tyr Asn Pro 260 265 270 Thr Thr Tyr Gln Met Asp Val Asn Pro Glu Gly Lys Tyr Ser Phe Gly 275 280 285 Ala Thr Cys Val Lys Lys Cys Pro Arg Asn Tyr Val Val Thr Asp His 290 295 300 Gly Ser Cys Val Arg Ala Cys Gly Ala Asp Ser Tyr Glu Met Glu Glu 305 310 315 320 Asp Gly Val Arg Lys Cys Lys Lys Cys Glu Gly Pro Cys Arg Lys Val 325 330 335 Cys Asn Gly Ile Gly Ile Gly Glu Phe Lys Asp Ser Leu Ser Ile Asn 340 345 350 Ala Thr Asn Ile Lys His Phe Lys Asn Cys Thr Ser Ile Ser Gly Asp 355 360 365 Leu His Ile Leu Pro Val Ala Phe Arg Gly Asp Ser Phe Thr His Thr 370 375 380 Pro Pro Leu Asp Pro Gln Glu Leu Asp Ile Leu Lys Thr Val Lys Glu 385 390 395 400 Ile Thr Gly Phe Leu Leu Ile Gln Ala Trp Pro Glu Asn Arg Thr Asp 405 410 415 Leu His Ala Phe Glu Asn Leu Glu Ile Ile Arg Gly Arg Thr Lys Gln 420 425 430 His Gly Gln Phe Ser Leu Ala Val Val Ser Leu Asn Ile Thr Ser Leu 435 440 445 Gly Leu Arg Ser Leu Lys Glu Ile Ser Asp Gly Asp Val Ile Ile Ser 450 455 460 Gly Asn Lys Asn Leu Cys Tyr Ala Asn Thr Ile Asn Trp Lys Lys Leu 465 470 475 480 Phe Gly Thr Ser Gly Gln Lys Thr Lys Ile Ile Ser Asn Arg Gly Glu 485 490 495 Asn Ser Cys Lys Ala Thr Gly Gln Val Cys His Ala Leu Cys Ser Pro 500 505 510 Glu Gly Cys Trp Gly Pro Glu Pro Arg Asp Cys Val Ser Cys Arg Asn 515 520 525 Val Ser Arg Gly Arg Glu Cys Val Asp Lys Cys Asn Leu Leu Glu Gly 530 535 540 Glu Pro Arg Glu Phe Val Glu Asn Ser Glu Cys Ile Gln Cys His Pro 545 550 555 560 Glu Cys Leu Pro Gln Ala Met Asn Ile Thr Cys Thr Gly Arg Gly Pro 565 570 575 Asp Asn Cys Ile Gln Cys Ala His Tyr Ile Asp Gly Pro His Cys Val 580 585 590 Lys Thr Cys Pro Ala Gly Val Met Gly Glu Asn Asn Thr Leu Val Trp 595 600 605 Lys Tyr Ala Asp Ala Gly His Val Cys His Leu Cys His Pro Asn Cys 610 615 620 Thr Tyr Gly Cys Thr Gly Pro Gly Leu Glu Gly Cys Pro Thr Asn Gly 625 630 635 640 Pro Lys Ile Pro Ser Ile Ala Thr Gly Met Val Gly Ala Leu Leu Leu 645 650 655 Leu Leu Val Val Ala Leu Gly Ile Gly Leu Phe Met Arg Arg Arg His 660 665 670 Ile Val Arg Lys Arg Thr Leu Arg Arg Leu Leu Gln Glu Arg Glu Leu 675 680 685 Val Glu Pro Leu Thr Pro Ser Gly Glu Ala Pro Asn Gln Ala Leu Leu 690 695 700 Arg Ile Leu Lys Glu Thr Glu Phe Lys Lys Ile Lys Val Leu Gly Ser 705 710 715 720 Gly Ala Phe Gly Thr Val Tyr Lys Gly Leu Trp Ile Pro Glu Gly Glu 725 730 735 Lys Val Lys Ile Pro Val Ala Ile Lys Glu Leu Arg Glu Ala Thr Ser 740 745 750 Pro Lys Ala Asn Lys Glu Ile Leu Asp Glu Ala Tyr Val Met Ala Ser 755 760 765 Val Asp Asn Pro His Val Cys Arg Leu Leu Gly Ile Cys Leu Thr Ser 770 775 780 Thr Val Gln Leu Ile Thr Gln Leu Met Pro Phe Gly Cys Leu Leu Asp 785 790 795 800 Tyr Val Arg Glu His Lys Asp Asn Ile Gly Ser Gln Tyr Leu Leu Asn 805 810 815 Trp Cys Val Gln Ile Ala Lys Gly Met Asn Tyr Leu Glu Asp Arg Arg 820 825 830 Leu Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Thr Pro 835 840 845 Gln His Val Lys Ile Thr Asp Phe Gly Leu Ala Lys Leu Leu Gly Ala 850 855 860 Glu Glu Lys Glu Tyr His Ala Glu Gly Gly Lys Val Pro Ile Lys Trp 865 870 875 880 Met Ala Leu Glu Ser Ile Leu His Arg Ile Tyr Thr His Gln Ser Asp 885 890 895 Val Trp Ser Tyr Gly Val Thr Val Trp Glu Leu Met Thr Phe Gly Ser 900 905 910 Lys Pro Tyr Asp Gly Ile Pro Ala Ser Glu Ile Ser Ser Ile Leu Glu 915 920 925 Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile Cys Thr Ile Asp Val Tyr 930 935 940 Met Ile Met Val Lys Cys Trp Met Ile Asp Ala Asp Ser Arg Pro Lys 945 950 955 960 Phe Arg Glu Leu Ile Ile Ile Glu Phe Ser Lys Met Ala Arg Asp Pro Gln 965 970 975 Arg Tyr Leu Val Ile Gln Gly Asp Glu Arg Met His Leu Pro Ser Pro 980 985 990 Thr Asp Ser Asn Phe Tyr Arg Ala Leu Met Asp Glu Glu Asp Met Asp 995 1000 1005 Asp Val Val Asp Ala Asp Glu Tyr Leu Ile Pro Gln Gln Gly Phe Phe 1010 1015 1020 Ser Ser Pro Ser Thr Ser Arg Thr Pro Leu Leu Ser Ser Leu Ser Ala 1025 1030 1035 1040 Thr Ser Asn Asn Ser Thr Val Ala Cys Ile Asp Arg Asn Gly Leu Gln 1045 1050 1055 Ser Cys Pro Ile Lys Glu Asp Ser Phe Leu Gln Arg Tyr Ser Ser Asp 1060 1065 1070 Pro Thr Gly Ala Leu Thr Glu Asp Ser Ile Asp Asp Thr Phe Leu Pro 1075 1080 1085 Val Pro Glu Tyr Ile Asn Gln Ser Val Pro Lys Arg Pro Ala Gly Ser 1090 1095 1100 Val Gln Asn Pro Val Tyr His Asn Gln Pro Leu Asn Pro Ala Pro Ser 1105 1110 1115 1120 Arg Asp Pro His Tyr Gln Asp Pro His Ser Thr Ala Val Gly Asn Pro 1125 1130 1135 Glu Tyr Leu Asn Thr Val Gln Pro Thr Cys Val Asn Ser Thr Phe Asp 1140 1145 1150 Ser Pro Ala His Trp Ala Gln Lys Gly Ser His Gln Ile Ser Leu Asp 1155 1160 1165 Asn Pro Asp Tyr Gln Gln Asp Phe Phe Pro Lys Glu Ala Lys Pro Asn 1170 1175 1180 Gly Ile Phe Lys Gly Ser Thr Ala Glu Asn Ala Glu Tyr Leu Arg Val 1185 1190 1195 1200 Ala Pro Gln Ser Ser Glu Phe Ile Gly Ala 1205 1210 <210> 8 <211> 1173 <212> PRT <213> Homo sapiens <400> 8 Met Thr Arg Arg Cys Met Pro Ala Arg Pro Gly Phe Pro Ser Ser Pro 1 5 10 15 Ala Pro Gly Ser Ser Pro Pro Arg Cys His Leu Arg Pro Gly Ser Thr 20 25 30 Ala His Ala Ala Ala Gly Lys Arg Thr Glu Ser Pro Gly Asp Arg Lys 35 40 45 Gln Ser Ile Ile Asp Phe Phe Lys Pro Ala Ser Lys Gln Asp Arg His 50 55 60 Met Leu Asp Ser Pro Gln Lys Ser Asn Ile Lys Tyr Gly Gly Ser Arg 65 70 75 80 Leu Ser Ile Thr Gly Thr Glu Gln Phe Glu Arg Lys Leu Ser Ser Pro 85 90 95 Lys Glu Ser Lys Pro Lys Arg Val Pro Pro Glu Lys Ser Pro Ile Ile 100 105 110 Glu Ala Phe Met Lys Gly Val Lys Glu His His Glu Asp His Gly Ile 115 120 125 His Glu Ser Arg Arg Pro Cys Leu Ser Leu Ala Ser Lys Tyr Leu Ala 130 135 140 Lys Gly Thr Asn Ile Tyr Val Pro Ser Ser Tyr His Leu Pro Lys Glu 145 150 155 160 Met Lys Ser Leu Lys Lys Lys His Arg Ser Pro Glu Arg Arg Lys Ser 165 170 175 Leu Phe Ile His Glu Asn Asn Glu Lys Asn Asp Arg Asp Arg Gly Lys 180 185 190 Thr Asn Ala Asp Ser Lys Lys Gln Thr Thr Val Ala Glu Ala Asp Ile 195 200 205 Phe Asn Asn Ser Ser Arg Ser Leu Ser Ser Arg Ser Ser Leu Ser Arg 210 215 220 His His Pro Glu Glu Ser Pro Leu Gly Ala Lys Phe Gln Leu Ser Leu 225 230 235 240 Ala Ser Tyr Cys Arg Glu Arg Glu Leu Lys Arg Leu Arg Lys Glu Gln 245 250 255 Met Glu Gln Arg Ile Asn Ser Glu Asn Ser Phe Ser Glu Ala Ser Ser 260 265 270 Leu Ser Leu Lys Ser Ser Ile Glu Arg Lys Tyr Lys Pro Arg Gln Glu 275 280 285 Gln Arg Lys Gln Asn Asp Ile Ile Pro Gly Lys Asn Asn Leu Ser Asn 290 295 300 Val Glu Asn Gly His Leu Ser Arg Lys Arg Ser Ser Ser Asp Ser Trp 305 310 315 320 Glu Pro Thr Ser Ala Gly Ser Lys Gln Asn Lys Phe Pro Glu Lys Arg 325 330 335 Lys Arg Asn Ser Val Asp Ser Asp Leu Lys Ser Thr Arg Glu Ser Met 340 345 350 Ile Pro Lys Ala Arg Glu Ser Phe Leu Glu Lys Arg Pro Asp Gly Pro 355 360 365 His Gln Lys Glu Lys Phe Ile Lys His Ile Ala Leu Lys Thr Pro Gly 370 375 380 Asp Val Leu Arg Leu Glu Asp Ile Ser Lys Glu Pro Ser Asp Glu Thr 385 390 395 400 Asp Gly Ser Ser Ala Gly Leu Ala Pro Ser Asn Ser Gly Asn Ser Gly 405 410 415 His His Ser Thr Arg Asn Ser Asp Gln Ile Gln Val Ala Gly Thr Lys 420 425 430 Glu Thr Lys Met Gln Lys Pro His Leu Pro Leu Ser Gln Glu Lys Ser 435 440 445 Ala Ile Lys Lys Ala Ser Asn Leu Gln Lys Asn Lys Thr Ala Ser Ser 450 455 460 Thr Thr Lys Glu Lys Glu Thr Lys Leu Pro Leu Leu Ser Arg Val Pro 465 470 475 480 Ser Ala Gly Ser Ser Leu Val Pro Leu Asn Ala Lys Asn Cys Ala Leu 485 490 495 Pro Val Ser Lys Lys Asp Lys Glu Arg Ser Ser Ser Lys Glu Cys Ser 500 505 510 Gly His Ser Thr Glu Ser Thr Lys His Lys Glu His Lys Ala Lys Thr 515 520 525 Asn Lys Ala Asp Ser Asn Val Ser Ser Gly Lys Ile Ser Gly Gly Pro 530 535 540 Leu Arg Ser Glu Tyr Gly Thr Pro Thr Lys Ser Pro Pro Ala Ala Leu 545 550 555 560 Glu Val Val Pro Cys Ile Pro Ser Pro Ala Ala Pro Ser Asp Lys Ala 565 570 575 Pro Ser Glu Gly Glu Ser Ser Gly Asn Ser Asn Ala Gly Ser Ser Ala 580 585 590 Leu Lys Arg Lys Leu Arg Gly Asp Phe Asp Ser Asp Glu Glu Ser Leu 595 600 605 Gly Tyr Asn Leu Asp Ser Asp Glu Glu Glu Glu Thr Leu Lys Ser Leu 610 615 620 Glu Glu Ile Met Ala Leu Asn Phe Asn Gln Thr Pro Ala Ala Thr Gly 625 630 635 640 Lys Pro Pro Ala Leu Ser Lys Gly Leu Arg Ser Gln Ser Ser Asp Tyr 645 650 655 Thr Gly His Val His Pro Gly Thr Tyr Thr Asn Thr Leu Glu Arg Leu 660 665 670 Val Lys Glu Met Glu Asp Thr Gln Arg Leu Asp Glu Leu Gln Lys Gln 675 680 685 Leu Gln Glu Asp Ile Arg Gln Gly Arg Gly Ile Lys Ser Pro Ile Arg 690 695 700 Ile Gly Glu Glu Asp Ser Thr Asp Asp Glu Asp Gly Leu Leu Glu Glu 705 710 715 720 His Lys Glu Phe Leu Lys Lys Phe Ser Val Thr Ile Asp Ala Ile Pro 725 730 735 Asp His His Pro Gly Glu Glu Ile Phe Asn Phe Leu Asn Ser Gly Lys 740 745 750 Ile Phe Asn Gln Tyr Thr Leu Asp Leu Arg Asp Ser Gly Phe Ile Gly 755 760 765 Gln Ser Ala Val Glu Lys Leu Ile Leu Lys Ser Gly Lys Thr Asp Gln 770 775 780 Ile Phe Leu Thr Thr Gln Gly Phe Leu Thr Ser Ala Tyr His Tyr Val 785 790 795 800 Gln Cys Pro Val Pro Val Leu Lys Trp Leu Phe Arg Met Met Ser Val 805 810 815 His Thr Asp Cys Ile Val Ser Val Gln Ile Leu Ser Thr Leu Met Glu 820 825 830 Ile Thr Ile Arg Asn Asp Thr Phe Ser Asp Ser Pro Val Trp Pro Trp 835 840 845 Ile Pro Ser Leu Ser Asp Val Ala Ala Val Phe Phe Asn Met Gly Ile 850 855 860 Asp Phe Arg Ser Leu Phe Pro Leu Glu Asn Leu Gln Pro Asp Phe Asn 865 870 875 880 Glu Asp Tyr Leu Val Ser Glu Thr Gln Thr Thr Ser Arg Gly Lys Glu 885 890 895 Ser Glu Asp Ser Ser Tyr Lys Pro Ile Phe Ser Thr Leu Pro Glu Thr 900 905 910 Asn Ile Leu Asn Val Val Lys Phe Leu Gly Leu Cys Thr Ser Ile His 915 920 925 Pro Glu Gly Tyr Gln Asp Arg Glu Ile Met Leu Leu Ile Leu Met Leu 930 935 940 Phe Lys Met Ser Leu Glu Lys Gln Leu Lys Gln Ile Pro Leu Val Asp 945 950 955 960 Phe Gln Ser Leu Leu Ile Asn Leu Met Lys Asn Ile Arg Asp Trp Asn 965 970 975 Thr Lys Val Pro Glu Leu Cys Leu Gly Ile Asn Glu Leu Ser Ser His 980 985 990 Pro His Asn Leu Leu Trp Leu Val Gln Leu Val Pro Asn Trp Thr Ser 995 1000 1005 Arg Gly Arg Gln Leu Arg Gln Cys Leu Ser Leu Val Ile Ile Ser Lys 1010 1015 1020 Leu Leu Asp Glu Lys His Glu Asp Val Pro Asn Ala Ser Asn Leu Gln 1025 1030 1035 1040 Val Ser Val Leu His Arg Tyr Leu Val Gln Met Lys Pro Ser Asp Leu 1045 1050 1055 Leu Lys Lys Met Val Leu Lys Lys Lys Ala Glu Gln Pro Asp Gly Ile 1060 1065 1070 Ile Asp Asp Ser Leu His Leu Glu Leu Glu Lys Gln Ala Tyr Tyr Leu 1075 1080 1085 Thr Tyr Ile Leu Leu His Leu Val Gly Glu Val Ser Cys Ser His Ser 1090 1095 1100 Phe Ser Ser Gly Gln Arg Lys His Phe Val Leu Leu Cys Gly Ala Leu 1105 1110 1115 1120 Glu Lys His Val Lys Cys Asp Ile Arg Glu Asp Ala Arg Leu Phe Tyr 1125 1130 1135 Arg Thr Lys Val Lys Asp Leu Val Ala Arg Ile His Gly Lys Trp Gln 1140 1145 1150 Glu Ile Ile Gln Asn Cys Arg Pro Thr Gln Gly Gln Leu His Asp Phe 1155 1160 1165 Trp Val Pro Asp Ser 1170 <210> 9 <211> 205 <212> PRT <213> Homo sapiens <400> 9 Met Ser Gly Met Glu Ala Thr Val Thr Ile Pro Ile Trp Gln Asn Lys 1 5 10 15 Pro His Gly Ala Ala Arg Ser Val Val Arg Arg Ile Gly Thr Asn Leu 20 25 30 Pro Leu Lys Pro Cys Ala Arg Ala Ser Phe Glu Thr Leu Pro Asn Ile 35 40 45 Ser Asp Leu Cys Leu Arg Asp Val Pro Val Pro Thr Leu Ala Asp 50 55 60 Ile Ala Trp Ile Ala Ala Asp Glu Glu Glu Thr Tyr Ala Arg Val Arg 65 70 75 80 Ser Asp Thr Arg Pro Leu Arg His Thr Trp Lys Pro Ser Pro Leu Ile 85 90 95 Val Met Gln Arg Asn Ala Ser Val Pro Asn Leu Arg Gly Ser Glu Glu 100 105 110 Arg Leu Leu Ala Leu Lys Lys Pro Ala Leu Pro Ala Leu Ser Arg Thr 115 120 125 Thr Glu Leu Gln Asp Glu Leu Ser His Leu Arg Ser Gln Ile Ala Lys 130 135 140 Ile Val Ala Ala Asp Ala Val Thr Ser Pro Arg Arg Gln Arg Trp Arg 145 150 155 160 Ser Leu Ser Phe His Gln Ser Pro Cys Phe Val Leu Pro Ala Leu Asn 165 170 175 Val Ala Asn Gln Asn Thr Lys Leu Pro Ala Val Arg Leu Lys Arg Met 180 185 190 Thr Ala Ser Leu Cys Pro Arg Pro Ala Ala Leu Gln Thr 195 200 205 <210> 10 <211> 515 <212> PRT <213> Homo sapiens <400> 10 Met Leu Leu Trp Ala Ser Leu Leu Ala Phe Ala Pro Val Cys Gly Gln 1 5 10 15 Ser Ala Ala Ala His Lys Pro Val Ile Ser Val His Pro Pro Trp Thr 20 25 30 Thr Phe Phe Lys Gly Glu Arg Val Thr Leu Thr Cys Asn Gly Phe Gln 35 40 45 Phe Tyr Ala Thr Glu Lys Thr Thr Trp Tyr His Arg His Tyr Trp Gly 50 55 60 Glu Lys Leu Thr Leu Thr Pro Gly Asn Thr Leu Glu Val Arg Glu Ser 65 70 75 80 Gly Leu Tyr Arg Cys Gln Ala Arg Gly Ser Pro Arg Ser Asn Pro Val 85 90 95 Arg Leu Leu Phe Ser Ser Ser Asp Ser Leu Ile Leu Gln Ala Pro Tyr Ser 100 105 110 Val Phe Glu Gly Asp Thr Leu Val Leu Arg Cys His Arg Arg Arg Lys 115 120 125 Glu Lys Leu Thr Ala Val Lys Tyr Thr Trp Asn Gly Asn Ile Leu Ser 130 135 140 Ile Ser Asn Lys Ser Trp Asp Leu Leu Ile Pro Gln Ala Ser Ser Asn 145 150 155 160 Asn Asn Gly Asn Tyr Arg Cys Ile Gly Tyr Gly Asp Glu Asn Asp Val 165 170 175 Phe Arg Ser Asn Phe Lys Ile Ile Lys Ile Gln Glu Leu Phe Pro His 180 185 190 Pro Glu Leu Lys Ala Thr Asp Ser Gln Pro Thr Glu Gly Asn Ser Val 195 200 205 Asn Leu Ser Cys Glu Thr Gln Leu Pro Pro Glu Arg Ser Asp Thr Pro 210 215 220 Leu His Phe Asn Phe Phe Arg Asp Gly Glu Val Ile Leu Ser Asp Trp 225 230 235 240 Ser Thr Tyr Pro Glu Leu Gln Leu Pro Thr Val Trp Arg Glu Asn Ser 245 250 255 Gly Ser Tyr Trp Cys Gly Ala Glu Thr Val Arg Gly Asn Ile His Lys 260 265 270 His Ser Pro Ser Leu Gln Ile His Val Gln Arg Ile Pro Val Ser Gly 275 280 285 Val Leu Leu Glu Thr Gln Pro Ser Gly Gly Gln Ala Val Glu Gly Glu 290 295 300 Met Leu Val Leu Val Cys Ser Val Ala Glu Gly Thr Gly Asp Thr Thr 305 310 315 320 Phe Ser Trp His Arg Glu Asp Met Gin Glu Ser Leu Gly Arg Lys Thr 325 330 335 Gln Arg Ser Leu Arg Ala Glu Leu Glu Leu Pro Ala Ile Arg Gln Ser 340 345 350 His Ala Gly Gly Tyr Tyr Cys Thr Ala Asp Asn Ser Tyr Gly Pro Val 355 360 365 Gln Ser Met Val Leu Asn Val Thr Val Arg Glu Thr Pro Gly Asn Arg 370 375 380 Asp Gly Leu Val Ala Ala Gly Ala Thr Gly Gly Leu Leu Ser Ala Leu 385 390 395 400 Leu Leu Ala Val Ala Leu Leu Phe His Cys Trp Arg Arg Arg Lys Ser 405 410 415 Gly Val Gly Phe Leu Gly Asp Glu Thr Arg Leu Pro Pro Ala Pro Gly 420 425 430 Pro Gly Glu Ser Ser His Ser Ile Cys Pro Ala Gln Val Glu Leu Gln 435 440 445 Ser Leu Tyr Val Asp Val His Pro Lys Lys Gly Asp Leu Val Tyr Ser 450 455 460 Glu Ile Gln Thr Thr Gln Leu Gly Glu Glu Glu Glu Ala Asn Thr Ser 465 470 475 480 Arg Thr Leu Leu Glu Asp Lys Asp Val Ser Val Val Tyr Ser Glu Val 485 490 495 Lys Thr Gln His Pro Asp Asn Ser Ala Gly Lys Ile Ser Ser Lys Asp 500 505 510 Glu Glu Ser 515 <210> 11 <211> 657 <212> PRT <213> Homo sapiens <400> 11 Met Arg Leu Lys Ile Gly Phe Ile Leu Arg Ser Leu Leu Val Val Gly 1 5 10 15 Ser Phe Leu Gly Leu Val Val Leu Trp Ser Ser Leu Thr Pro Arg Pro 20 25 30 Asp Asp Pro Ser Pro Leu Ser Arg Met Arg Glu Asp Arg Asp Val Asn 35 40 45 Asp Pro Met Pro Asn Arg Gly Gly Asn Gly Leu Ala Pro Gly Glu Asp 50 55 60 Arg Phe Lys Pro Val Val Pro Trp Pro His Val Glu Gly Val Glu Val 65 70 75 80 Asp Leu Glu Ser Ile Arg Arg Ile Asn Lys Ala Lys Asn Glu Gln Glu 85 90 95 His His Ala Gly Gly Asp Ser Gln Lys Asp Ile Met Gln Arg Gln Tyr 100 105 110 Leu Thr Phe Lys Pro Gln Thr Phe Thr Tyr His Asp Pro Val Leu Arg 115 120 125 Pro Gly Ile Leu Gly Asn Phe Glu Pro Lys Glu Pro Glu Pro Pro Gly 130 135 140 Val Val Gly Gly Pro Gly Glu Lys Ala Lys Pro Leu Val Leu Gly Pro 145 150 155 160 Glu Phe Lys Gln Ala Ile Gln Ala Ser Ile Lys Glu Phe Gly Phe Asn 165 170 175 Met Val Ala Ser Asp Met Ile Ser Leu Asp Arg Ser Val Asn Asp Leu 180 185 190 Arg Gln Glu Glu Cys Lys Tyr Trp His Tyr Asp Glu Asn Leu Leu Thr 195 200 205 Ser Ser Val Val Ile Val Phe His Asn Glu Gly Trp Ser Thr Leu Met 210 215 220 Arg Thr Val His Ser Val Ile Lys Arg Thr Pro Arg Lys Tyr Leu Ala 225 230 235 240 Glu Ile Val Leu Ile Asp Asp Phe Ser Asn Lys Glu His Leu Lys Glu 245 250 255 Lys Leu Asp Glu Tyr Ile Lys Leu Trp Asn Gly Leu Val Lys Val Phe 260 265 270 Arg Asn Glu Arg Arg Glu Gly Leu Ile Gln Ala Arg Ser Ile Gly Ala 275 280 285 Gln Lys Ala Lys Leu Gly Gln Val Leu Ile Tyr Leu Asp Ala His Cys 290 295 300 Glu Val Ala Val Asn Trp Tyr Ala Pro Leu Val Ala Pro Ile Ser Lys 305 310 315 320 Asp Arg Thr Ile Cys Thr Val Pro Leu Ile Asp Val Ile Asn Gly Asn 325 330 335 Thr Tyr Glu Ile Ile Pro Gln Gly Gly Gly Asp Glu Asp Gly Tyr Ala 340 345 350 Arg Gly Ala Trp Asp Trp Ser Met Leu Trp Lys Arg Val Pro Leu Thr 355 360 365 Pro Gln Glu Lys Arg Leu Arg Lys Thr Lys Thr Glu Pro Tyr Arg Ser 370 375 380 Pro Ala Met Ala Gly Gly Leu Phe Ala Ile Glu Arg Glu Phe Phe Phe 385 390 395 400 Glu Leu Gly Leu Tyr Asp Pro Gly Leu Gln Ile Trp Gly Gly Glu Asn 405 410 415 Phe Glu Ile Ser Tyr Lys Ile Trp Gln Cys Gly Gly Lys Leu Leu Phe 420 425 430 Val Pro Cys Ser Arg Val Gly His Ile Tyr Arg Leu Glu Gly Trp Gln 435 440 445 Gly Asn Pro Pro Pro Ile Tyr Val Gly Ser Ser Pro Thr Leu Lys Asn 450 455 460 Tyr Val Arg Val Val Glu Val Trp Trp Asp Glu Tyr Lys Asp Tyr Phe 465 470 475 480 Tyr Ala Ser Arg Pro Glu Ser Gln Ala Leu Pro Tyr Gly Asp Ile Ser 485 490 495 Glu Leu Lys Lys Phe Arg Glu Asp His Asn Cys Lys Ser Phe Lys Trp 500 505 510 Phe Met Glu Glu Ile Ala Tyr Asp Ile Thr Ser His Tyr Pro Leu Pro 515 520 525 Pro Lys Asn Val Asp Trp Gly Glu Ile Arg Gly Phe Glu Thr Ala Tyr 530 535 540 Cys Ile Asp Ser Met Gly Lys Thr Asn Gly Gly Phe Val Glu Leu Gly 545 550 555 560 Pro Cys His Arg Met Gly Gly Asn Gln Leu Phe Arg Ile Asn Glu Ala 565 570 575 Asn Gln Leu Met Gln Tyr Asp Gln Cys Leu Thr Lys Gly Ala Asp Gly 580 585 590 Ser Lys Val Met Ile Thr His Cys Asn Leu Asn Glu Phe Lys Glu Trp 595 600 605 Gln Tyr Phe Lys Asn Leu His Arg Phe Thr His Ile Pro Ser Gly Lys 610 615 620 Cys Leu Asp Arg Ser Glu Val Leu His Gln Val Phe Ile Ser Asn Cys 625 630 635 640 Asp Ser Ser Lys Thr Thr Gln Lys Trp Glu Met Asn Asn Ile His Ser 645 650 655 Val <210> 12 <211> 908 <212> PRT <213> Homo sapiens <400> 12 Met Lys Ile Ile Phe Pro Ile Leu Ser Asn Pro Val Phe Arg Arg Thr 1 5 10 15 Val Lys Leu Leu Leu Cys Leu Leu Trp Ile Gly Tyr Ser Gln Gly Thr 20 25 30 Thr His Val Leu Arg Phe Gly Gly Ile Phe Glu Tyr Val Glu Ser Gly 35 40 45 Pro Met Gly Ala Glu Glu Leu Ala Phe Arg Phe Ala Val Asn Thr Ile 50 55 60 Asn Arg Asn Arg Thr Leu Leu Pro Asn Thr Thr Leu Thr Tyr Asp Thr 65 70 75 80 Gln Lys Ile Asn Leu Tyr Asp Ser Phe Glu Ala Ser Lys Lys Ala Cys 85 90 95 Asp Gln Leu Ser Leu Gly Val Ala Ala Ile Phe Gly Pro Ser His Ser 100 105 110 Ser Ser Ala Asn Ala Val Gln Ser Ile Cys Asn Ala Leu Gly Val Pro 115 120 125 His Ile Gln Thr Arg Trp Lys His Gln Val Ser Asp Asn Lys Asp Ser 130 135 140 Phe Tyr Val Ser Leu Tyr Pro Asp Phe Ser Ser Leu Ser Arg Ala Ile 145 150 155 160 Leu Asp Leu Val Gln Phe Phe Lys Trp Lys Thr Val Thr Val Val Tyr 165 170 175 Asp Asp Ser Thr Gly Leu Ile Arg Leu Gln Glu Leu Ile Lys Ala Pro 180 185 190 Ser Arg Tyr Asn Leu Arg Leu Lys Ile Arg Gln Leu Pro Ala Asp Thr 195 200 205 Lys Asp Ala Lys Pro Leu Leu Lys Glu Met Lys Arg Gly Lys Glu Phe 210 215 220 His Val Ile Phe Asp Cys Ser His Glu Met Ala Ala Gly Ile Leu Lys 225 230 235 240 Gln Ala Leu Ala Met Gly Met Met Thr Glu Tyr Tyr His Tyr Ile Phe 245 250 255 Thr Thr Leu Asp Leu Phe Ala Leu Asp Val Glu Pro Tyr Arg Tyr Ser 260 265 270 Gly Val Asn Met Thr Gly Phe Arg Ile Leu Asn Thr Glu Asn Thr Gln 275 280 285 Val Ser Ser Ile Ile Glu Lys Trp Ser Met Glu Arg Leu Gln Ala Pro 290 295 300 Pro Lys Pro Asp Ser Gly Leu Leu Asp Gly Phe Met Thr Thr Asp Ala 305 310 315 320 Ala Leu Met Tyr Asp Ala Val His Val Val Ser Val Ala Val Gln Gln 325 330 335 Phe Pro Gln Met Thr Val Ser Ser Leu Gln Cys Asn Arg His Lys Pro 340 345 350 Trp Arg Phe Gly Thr Arg Phe Met Ser Leu Ile Lys Glu Ala His Trp 355 360 365 Glu Gly Leu Thr Gly Arg Ile Thr Phe Asn Lys Thr Asn Gly Leu Arg 370 375 380 Thr Asp Phe Asp Leu Asp Val Ile Ser Leu Lys Glu Glu Gly Leu Glu 385 390 395 400 Lys Ile Gly Thr Trp Asp Pro Ala Ser Gly Leu Asn Met Thr Glu Ser 405 410 415 Gln Lys Gly Lys Pro Ala Asn Ile Thr Asp Ser Leu Ser Asn Arg Ser 420 425 430 Leu Ile Val Thr Thr Ile Leu Glu Glu Pro Tyr Val Leu Phe Lys Lys 435 440 445 Ser Asp Lys Pro Leu Tyr Gly Asn Asp Arg Phe Glu Gly Tyr Cys Ile 450 455 460 Asp Leu Leu Arg Glu Leu Ser Thr Ile Leu Gly Phe Thr Tyr Glu Ile 465 470 475 480 Arg Leu Val Glu Asp Gly Lys Tyr Gly Ala Gln Asp Asp Ala Asn Gly 485 490 495 Gln Trp Asn Gly Met Val Arg Glu Leu Ile Asp His Lys Ala Asp Leu 500 505 510 Ala Val Ala Pro Leu Ala Ile Thr Tyr Val Arg Glu Lys Val Ile Asp 515 520 525 Phe Ser Lys Pro Phe Met Thr Leu Gly Ile Ser Ile Leu Tyr Arg Lys 530 535 540 Pro Asn Gly Thr Asn Pro Gly Val Phe Ser Phe Leu Asn Pro Leu Ser 545 550 555 560 Pro Asp Ile Trp Met Tyr Ile Leu Leu Ala Tyr Leu Gly Val Ser Cys 565 570 575 Val Leu Phe Val Ile Ala Arg Phe Ser Pro Tyr Glu Trp Tyr Asn Pro 580 585 590 His Pro Cys Asn Pro Asp Ser Asp Val Val Glu Asn Asn Phe Thr Leu 595 600 605 Leu Asn Ser Phe Trp Phe Gly Val Gly Ala Leu Met Gln Gln Gly Ser 610 615 620 Glu Leu Met Pro Lys Ala Leu Ser Thr Arg Ile Val Gly Gly Ile Trp 625 630 635 640 Trp Phe Phe Thr Leu Ile Ile Ile Ser Ser Tyr Thr Ala Asn Leu Ala 645 650 655 Ala Phe Leu Thr Val Glu Arg Met Glu Ser Pro Ile Asp Ser Ala Asp 660 665 670 Asp Leu Ala Lys Gln Thr Lys Ile Glu Tyr Gly Ala Val Glu Asp Gly 675 680 685 Ala Thr Met Thr Phe Phe Lys Lys Ser Lys Ile Ser Thr Tyr Asp Lys 690 695 700 Met Trp Ala Phe Met Ser Ser Arg Arg Gln Ser Val Leu Val Lys Ser 705 710 715 720 Asn Glu Glu Gly Ile Gln Arg Val Leu Thr Ser Asp Tyr Ala Phe Leu 725 730 735 Met Glu Ser Thr Thr Ile Glu Phe Val Thr Gln Arg Asn Cys Asn Leu 740 745 750 Thr Gln Ile Gly Gly Leu Ile Asp Ser Lys Gly Tyr Gly Val Gly Thr 755 760 765 Pro Met Gly Ser Pro Tyr Arg Asp Lys Ile Thr Ile Ala Ile Leu Gln 770 775 780 Leu Gln Glu Glu Gly Lys Leu His Met Met Lys Glu Lys Trp Trp Arg 785 790 795 800 Gly Asn Gly Cys Pro Glu Glu Glu Ser Lys Glu Ala Ser Ala Leu Gly 805 810 815 Val Gln Asn Ile Gly Gly Ile Phe Ile Val Leu Ala Ala Gly Leu Val 820 825 830 Leu Ser Val Phe Val Ala Val Gly Glu Phe Leu Tyr Lys Ser Lys Lys 835 840 845 Asn Ala Gln Leu Glu Lys Arg Ser Phe Cys Ser Ala Met Val Glu Glu 850 855 860 Leu Arg Met Ser Leu Lys Cys Gln Arg Arg Leu Lys His Lys Pro Gln 865 870 875 880 Ala Pro Val Ile Val Lys Thr Glu Glu Val Ile Asn Met His Thr Phe 885 890 895 Asn Asp Arg Arg Leu Pro Gly Lys Glu Thr Met Ala 900 905 <210> 13 <211> 1332 <212> PRT <213> Homo sapiens <400> 13 Met Glu Ser His Ser Arg Ala Gly Lys Ser Arg Lys Ser Ala Lys Phe 1 5 10 15 Arg Ser Ile Ser Arg Ser Leu Met Leu Cys Asn Ala Lys Thr Ser Asp 20 25 30 Asp Gly Ser Ser Pro Asp Glu Lys Tyr Pro Asp Pro Phe Glu Ile Ser 35 40 45 Leu Ala Gln Gly Lys Glu Gly Ile Phe His Ser Ser Val Gln Leu Ala 50 55 60 Asp Thr Ser Glu Ala Gly Pro Ser Ser Val Pro Asp Leu Ala Leu Ala 65 70 75 80 Ser Glu Ala Ala Gln Leu Gln Ala Ala Gly Asn Asp Arg Gly Lys Thr 85 90 95 Cys Arg Arg Ile Phe Phe Met Lys Glu Ser Ser Thr Ala Ser Ser Arg 100 105 110 Glu Lys Pro Gly Lys Leu Glu Ala Gln Ser Ser Asn Phe Leu Phe Pro 115 120 125 Lys Ala Cys His Gln Arg Ala Arg Ser Asn Ser Thr Ser Val Asn Pro 130 135 140 Tyr Cys Thr Arg Glu Ile Asp Phe Pro Met Thr Lys Lys Ser Ala Ala 145 150 155 160 Pro Thr Asp Arg Gln Pro Tyr Ser Leu Cys Ser Asn Arg Lys Ser Leu 165 170 175 Ser Gln Gln Leu Asp Cys Pro Ala Gly Lys Ala Ala Gly Thr Ser Arg 180 185 190 Pro Thr Arg Ser Leu Ser Thr Ala Gln Leu Val Gln Pro Ser Gly Gly 195 200 205 Leu Gln Ala Ser Val Ile Ser Asn Ile Val Leu Met Lys Gly Gln Ala 210 215 220 Lys Gly Leu Gly Phe Ser Ile Val Gly Gly Lys Asp Ser Ile Tyr Gly 225 230 235 240 Pro Ile Gly Ile Tyr Val Lys Thr Ile Phe Ala Gly Gly Ala Ala Ala 245 250 255 Ala Asp Gly Arg Leu Gln Glu Gly Asp Glu Ile Leu Glu Leu Asn Gly 260 265 270 Glu Ser Met Ala Gly Leu Thr His Gln Asp Ala Leu Gln Lys Phe Lys 275 280 285 Gln Ala Lys Lys Gly Leu Leu Thr Leu Thr Val Arg Thr Arg Leu Thr 290 295 300 Ala Pro Pro Ser Leu Cys Ser His Leu Ser Pro Pro Leu Cys Arg Ser 305 310 315 320 Leu Ser Ser Ser Thr Cys Ile Thr Lys Asp Ser Ser Ser Phe Ala Leu 325 330 335 Glu Ser Pro Ser Ala Pro Ile Ser Thr Ala Lys Pro Asn Tyr Arg Ile 340 345 350 Met Val Glu Val Ser Leu Gln Lys Glu Ala Gly Val Gly Leu Gly Ile 355 360 365 Gly Leu Cys Ser Val Pro Tyr Phe Gln Cys Ile Ser Gly Ile Phe Val 370 375 380 His Thr Leu Ser Pro Gly Ser Val Ala His Leu Asp Gly Arg Leu Arg 385 390 395 400 Cys Gly Asp Glu Ile Val Glu Ile Ser Asp Ser Pro Val His Cys Leu 405 410 415 Thr Leu Asn Glu Val Tyr Thr Ile Leu Ser His Cys Asp Pro Gly Pro 420 425 430 Val Pro Ile Ile Val Ser Arg His Pro Asp Pro Gln Val Ser Glu Gln 435 440 445 Gln Leu Lys Glu Ala Val Ala Gln Ala Val Glu Asn Thr Lys Phe Gly 450 455 460 Lys Glu Arg His Gln Trp Ser Leu Glu Gly Val Lys Arg Leu Glu Ser 465 470 475 480 Ser Trp His Gly Arg Pro Thr Leu Glu Lys Glu Arg Glu Lys Asn Ser 485 490 495 Ala Pro Pro His Arg Arg Ala Gln Lys Val Met Ile Arg Ser Ser Ser Ser 500 505 510 Asp Ser Ser Tyr Met Ser Gly Ser Pro Gly Gly Ser Pro Gly Ser Gly 515 520 525 Ser Ala Glu Lys Pro Ser Ser Asp Val Asp Ile Ser Thr His Ser Pro 530 535 540 Ser Leu Pro Leu Ala Arg Glu Pro Val Val Leu Ser Ile Ala Ser Ser 545 550 555 560 Arg Leu Pro Gln Glu Ser Pro Pro Leu Pro Glu Ser Arg Asp Ser His 565 570 575 Pro Pro Leu Arg Leu Lys Lys Ser Phe Glu Ile Leu Val Arg Lys Pro 580 585 590 Met Ser Ser Lys Pro Lys Pro Pro Pro Arg Lys Tyr Phe Lys Ser Asp 595 600 605 Ser Asp Pro Gln Lys Ser Leu Glu Glu Arg Glu Asn Ser Ser Cys Ser 610 615 620 Ser Gly His Thr Pro Pro Thr Cys Gly Gin Glu Ala Arg Glu Leu Leu 625 630 635 640 Pro Leu Leu Leu Pro Gln Glu Asp Thr Ala Gly Arg Ser Pro Ser Ala 645 650 655 Ser Ala Gly Cys Pro Gly Pro Gly Ile Gly Pro Gln Thr Lys Ser Ser 660 665 670 Thr Glu Gly Glu Pro Gly Trp Arg Arg Ala Ser Pro Val Thr Gln Thr 675 680 685 Ser Pro Ile Lys His Pro Leu Leu Lys Arg Gln Ala Arg Met Asp Tyr 690 695 700 Ser Phe Asp Thr Thr Ala Glu Asp Pro Trp Val Arg Ile Ser Asp Cys 705 710 715 720 Ile Lys Asn Leu Phe Ser Pro Ile Met Ser Glu Asn His Gly His Met 725 730 735 Pro Leu Gln Pro Asn Ala Ser Leu Asn Glu Glu Glu Gly Thr Gln Gly 740 745 750 His Pro Asp Gly Thr Pro Lys Leu Asp Thr Ala Asn Gly Thr Pro 755 760 765 Lys Val Tyr Lys Ser Ala Asp Ser Ser Thr Val Lys Lys Gly Pro Pro 770 775 780 Val Ala Pro Lys Pro Ala Trp Phe Arg Gln Ser Leu Lys Gly Leu Arg 785 790 795 800 Asn Arg Ala Ser Asp Pro Arg Gly Leu Pro Asp Pro Ala Leu Ser Thr 805 810 815 Gln Pro Ala Pro Ala Ser Arg Glu His Leu Gly Ser His Ile Arg Ala 820 825 830 Ser Ser Ser Ser Ser Ser Ile Arg Gln Arg Ile Ser Ser Phe Glu Thr 835 840 845 Phe Gly Ser Ser Gln Leu Pro Asp Lys Gly Ala Gln Arg Leu Ser Leu 850 855 860 Gln Pro Ser Ser Gly Glu Ala Ala Lys Pro Leu Gly Lys His Glu Glu 865 870 875 880 Gly Arg Phe Ser Gly Leu Leu Gly Arg Gly Ala Ala Pro Thr Leu Val 885 890 895 Pro Gln Gln Pro Glu Gln Val Leu Ser Ser Gly Ser Pro Ala Ala Ser 900 905 910 Glu Ala Arg Asp Pro Gly Val Ser Glu Ser Pro Pro Pro Gly Arg Gln 915 920 925 Pro Asn Gln Lys Thr Leu Pro Pro Gly Pro Asp Pro Leu Leu Arg Leu 930 935 940 Leu Ser Thr Gln Ala Glu Glu Ser Gln Gly Pro Val Leu Lys Met Pro 945 950 955 960 Ser Gln Arg Ala Arg Ser Phe Pro Leu Thr Arg Ser Gln Ser Cys Glu 965 970 975 Thr Lys Leu Leu Asp Glu Lys Thr Ser Lys Leu Tyr Ser Ile Ser Ser 980 985 990 Gln Val Ser Ser Ala Val Met Lys Ser Leu Leu Cys Leu Pro Ser Ser 995 1000 1005 Ile Ser Cys Ala Gln Thr Pro Cys Ile Pro Lys Glu Gly Ala Ser Pro 1010 1015 1020 Thr Ser Ser Ser Asn Glu Asp Ser Ala Ala Asn Gly Ser Ala Glu Thr 1025 1030 1035 1040 Ser Ala Leu Asp Thr Gly Phe Ser Leu Asn Leu Ser Glu Leu Arg Glu 1045 1050 1055 Tyr Thr Glu Gly Leu Thr Glu Ala Lys Glu Asp Asp Asp Gly Asp His 1060 1065 1070 Ser Ser Leu Gln Ser Gly Gln Ser Val Ile Ser Leu Leu Ser Ser Ser Glu 1075 1080 1085 Glu Leu Lys Lys Leu Ile Glu Glu Val Lys Val Leu Asp Glu Ala Thr 1090 1095 1100 Leu Lys Gln Leu Asp Gly Ile His Val Thr Ile Leu His Lys Glu Glu 1105 1110 1115 1120 Gly Ala Gly Leu Gly Phe Ser Leu Ala Gly Gly Ala Asp Leu Glu Asn 1125 1130 1135 Lys Val Ile Thr Val His Arg Val Phe Pro Asn Gly Leu Ala Ser Gln 1140 1145 1150 Glu Gly Thr Ile Gln Lys Gly Asn Glu Val Leu Ser Ile Asn Gly Lys 1155 1160 1165 Ser Leu Lys Gly Thr Thr His His Asp Ala Leu Ala Ile Leu Arg Gln 1170 1175 1180 Ala Arg Glu Pro Arg Gln Ala Val Ile Val Thr Arg Lys Leu Thr Pro 1185 1190 1195 1200 Glu Ala Met Pro Asp Leu Asn Ser Ser Thr Asp Ser Ala Ala Ser Ala 1205 1210 1215 Ser Ala Ala Ser Asp Val Ser Val Glu Ser Thr Ala Glu Ala Thr Val 1220 1225 1230 Cys Thr Val Thr Leu Glu Lys Met Ser Ala Gly Leu Gly Phe Ser Leu 1235 1240 1245 Glu Gly Gly Lys Gly Ser Leu His Gly Asp Lys Pro Leu Thr Ile Asn 1250 1255 1260 Arg Ile Phe Lys Gly Ala Ala Ser Glu Gln Ser Glu Thr Val Gln Pro 1265 1270 1275 1280 Gly Asp Glu Ile Leu Gln Leu Gly Gly Thr Ala Met Gln Gly Leu Thr 1285 1290 1295 Arg Phe Glu Ala Trp Asn Ile Ile Lys Ala Leu Pro Asp Gly Pro Val 1300 1305 1310 Thr Ile Val Ile Arg Arg Lys Ser Leu Gln Ser Lys Glu Thr Thr Ala 1315 1320 1325 Ala Gly Asp Ser 1330 <210> 14 <211> 617 <212> PRT <213> Homo sapiens <400> 14 Met Gly Ser Tyr Leu Ser Val Pro Ala Tyr Phe Thr Ser Arg Asp Leu 1 5 10 15 Phe Arg Cys Ser Glu Cys Gln Asp Ser Leu Thr Asn Trp Tyr Tyr Glu 20 25 30 Lys Asp Gly Lys Leu Tyr Cys Pro Lys Asp Tyr Trp Gly Lys Phe Gly 35 40 45 Glu Phe Cys His Gly Cys Ser Leu Leu Met Thr Gly Pro Phe Met Val 50 55 60 Ala Gly Glu Phe Lys Tyr His Pro Glu Cys Phe Ala Cys Met Ser Cys 65 70 75 80 Lys Val Ile Ile Glu Asp Gly Asp Ala Tyr Ala Leu Val Gln His Ala 85 90 95 Thr Leu Tyr Cys Gly Lys Cys His Asn Glu Val Val Leu Ala Pro Met 100 105 110 Phe Glu Arg Leu Ser Thr Glu Ser Val Gln Glu Gln Leu Pro Tyr Ser 115 120 125 Val Thr Leu Ile Ser Met Pro Ala Thr Glu Gly Arg Arg Gly Phe 130 135 140 Ser Val Ser Val Glu Ser Ala Cys Ser Asn Tyr Ala Thr Thr Val Gln 145 150 155 160 Val Lys Glu Val Asn Arg Met His Ile Ser Pro Asn Asn Arg Asn Ala 165 170 175 Ile His Pro Gly Asp Arg Ile Leu Glu Ile Asn Gly Thr Pro Val Arg 180 185 190 Thr Leu Arg Val Glu Glu Val Glu Asp Ala Ile Ser Gln Thr Ser Gln 195 200 205 Thr Leu Gln Leu Leu Ile Glu His Asp Pro Val Ser Gln Arg Leu Asp 210 215 220 Gln Leu Arg Leu Glu Ala Arg Leu Ala Pro His Met Gln Asn Ala Gly 225 230 235 240 His Pro His Ala Leu Ser Thr Leu Asp Thr Lys Glu Asn Leu Glu Gly 245 250 255 Thr Leu Arg Arg Arg Ser Leu Arg Arg Ser Asn Ser Ile Ser Lys Ser 260 265 270 Pro Gly Pro Ser Ser Pro Lys Glu Pro Leu Leu Phe Ser Arg Asp Ile 275 280 285 Ser Arg Ser Glu Ser Leu Arg Cys Ser Ser Ser Tyr Ser Gln Gln Ile 290 295 300 Phe Arg Pro Cys Asp Leu Ile His Gly Glu Val Leu Gly Lys Gly Phe 305 310 315 320 Phe Gly Gln Ala Ile Lys Val Thr His Lys Ala Thr Gly Lys Val Met 325 330 335 Val Met Lys Glu Leu Ile Arg Cys Asp Glu Glu Thr Gln Lys Thr Phe 340 345 350 Leu Thr Glu Val Lys Val Met Arg Ser Leu Asp His Pro Asn Val Leu 355 360 365 Lys Phe Ile Gly Val Leu Tyr Lys Asp Lys Lys Leu Asn Leu Leu Thr 370 375 380 Glu Tyr Ile Glu Gly Gly Thr Leu Lys Asp Phe Leu Arg Ser Met Asp 385 390 395 400 Pro Phe Pro Trp Gln Gln Lys Val Arg Phe Ala Lys Gly Ile Ala Ser 405 410 415 Gly Met Ala Tyr Leu His Ser Met Cys Ile Ile His Arg Asp Leu Asn 420 425 430 Ser His Asn Cys Leu Ile Lys Leu Asp Lys Thr Val Val Val Ala Asp 435 440 445 Phe Gly Leu Ser Arg Leu Ile Val Glu Glu Arg Lys Arg Ala Pro Met 450 455 460 Glu Lys Ala Thr Thr Lys Lys Arg Thr Leu Arg Lys Asn Asp Arg Lys 465 470 475 480 Lys Arg Tyr Thr Val Val Gly Asn Pro Tyr Trp Met Ala Pro Glu Met 485 490 495 Leu Asn Gly Lys Ser Tyr Asp Glu Thr Val Asp Ile Phe Ser Phe Gly 500 505 510 Ile Val Leu Cys Glu Ile Ile Gly Gln Val Tyr Ala Asp Pro Asp Cys 515 520 525 Leu Pro Arg Thr Leu Asp Phe Gly Leu Asn Val Lys Leu Phe Trp Glu 530 535 540 Lys Phe Val Pro Thr Asp Cys Pro Pro Ala Phe Phe Pro Leu Ala Ala 545 550 555 560 Ile Cys Cys Arg Leu Glu Pro Glu Ser Arg Pro Ala Phe Ser Lys Leu 565 570 575 Glu Asp Ser Phe Glu Ala Leu Ser Leu Tyr Leu Gly Glu Leu Gly Ile 580 585 590 Pro Leu Pro Ala Glu Leu Glu Glu Leu Asp His Thr Val Ser Met Gln 595 600 605 Tyr Gly Leu Thr Arg Asp Ser Pro Pro 610 615 <210> 15 <211> 852 <212> PRT <213> Homo sapiens <400> 15 Met Ser Ser Val Ser Pro Ile Gln Ile Pro Ser Arg Leu Pro Leu Leu 1 5 10 15 Leu Thr His Glu Gly Val Leu Leu Pro Gly Ser Thr Met Arg Thr Ser 20 25 30 Val Asp Ser Ala Arg Asn Leu Gln Leu Val Arg Ser Arg Leu Leu Lys 35 40 45 Gly Thr Ser Leu Gln Ser Thr Ile Leu Gly Val Ile Pro Asn Thr Pro 50 55 60 Asp Pro Ala Ser Asp Ala Gln Asp Leu Pro Pro Leu His Arg Ile Gly 65 70 75 80 Thr Ala Ala Leu Ala Val Gln Val Val Gly Ser Asn Trp Pro Lys Pro 85 90 95 His Tyr Thr Leu Leu Ile Thr Gly Leu Cys Arg Phe Gln Ile Val Gln 100 105 110 Val Leu Lys Glu Lys Pro Tyr Pro Ile Ala Glu Val Glu Gln Leu Asp 115 120 125 Arg Leu Glu Glu Phe Pro Asn Thr Cys Lys Met Arg Glu Glu Leu Gly 130 135 140 Glu Leu Ser Glu Gln Phe Tyr Lys Tyr Ala Val Gln Leu Val Glu Met 145 150 155 160 Leu Asp Met Ser Val Pro Ala Val Ala Lys Leu Arg Arg Leu Leu Asp 165 170 175 Ser Leu Pro Arg Glu Ala Leu Pro Asp Ile Leu Thr Ser Ile Ile Arg 180 185 190 Thr Ser Asn Lys Glu Lys Leu Gln Ile Leu Asp Ala Val Ser Leu Glu 195 200 205 Glu Arg Phe Lys Met Thr Ile Pro Leu Leu Val Arg Gln Ile Glu Gly 210 215 220 Leu Lys Leu Leu Gln Lys Thr Arg Lys Pro Lys Gln Asp Asp Asp Lys 225 230 235 240 Arg Val Ile Ala Ile Arg Pro Ile Arg Arg Ile Thr His Ile Ser Gly 245 250 255 Thr Leu Glu Asp Glu Asp Glu Asp Glu Asp Asn Asp Asp Ile Val Met 260 265 270 Leu Glu Lys Lys Ile Arg Thr Ser Ser Met Pro Glu Gln Ala His Lys 275 280 285 Val Cys Val Lys Glu Ile Lys Arg Leu Lys Lys Met Pro Gln Ser Met 290 295 300 Pro Glu Tyr Ala Leu Thr Arg Asn Tyr Leu Glu Leu Met Val Glu Leu 305 310 315 320 Pro Trp Asn Lys Ser Thr Thr Asp Arg Leu Asp Ile Arg Ala Ala Arg 325 330 335 Ile Leu Leu Asp Asn Asp His Tyr Ala Met Glu Lys Leu Lys Lys Arg 340 345 350 Val Leu Glu Tyr Leu Ala Val Arg Gln Leu Lys Asn Asn Leu Lys Gly 355 360 365 Pro Ile Leu Cys Phe Val Gly Pro Pro Gly Val Gly Lys Thr Ser Val 370 375 380 Gly Arg Ser Val Ala Lys Thr Leu Gly Arg Glu Phe His Arg Ile Ala 385 390 395 400 Leu Gly Gly Val Cys Asp Gln Ser Asp Ile Arg Gly His Arg Arg Thr 405 410 415 Tyr Val Gly Ser Met Pro Gly Arg Ile Ile Asn Gly Leu Lys Thr Val 420 425 430 Gly Val Asn Asn Pro Val Phe Leu Leu Asp Glu Val Asp Lys Leu Gly 435 440 445 Lys Ser Leu Gln Gly Asp Pro Ala Ala Ala Leu Leu Glu Val Leu Asp 450 455 460 Pro Glu Gln Asn His Asn Phe Thr Asp His Tyr Leu Asn Val Ala Phe 465 470 475 480 Asp Leu Ser Gln Val Leu Phe Ile Ala Thr Ala Asn Thr Thr Ala Thr 485 490 495 Ile Pro Ala Ala Leu Leu Asp Arg Met Glu Ile Ile Gln Val Pro Gly 500 505 510 Tyr Thr Gln Glu Glu Lys Ile Glu Ile Ala His Arg His Leu Ile Pro 515 520 525 Lys Gln Leu Glu Gln His Gly Leu Thr Pro Gln Gln Ile Gln Ile Pro 530 535 540 Gln Val Thr Thr Leu Asp Ile Ile Thr Arg Tyr Thr Arg Glu Ala Gly 545 550 555 560 Val Arg Ser Leu Asp Arg Lys Leu Gly Ala Ile Cys Arg Ala Val Ala 565 570 575 Val Lys Val Ala Glu Gly Gln His Lys Glu Ala Lys Leu Asp Arg Ser 580 585 590 Asp Val Thr Glu Arg Glu Gly Cys Arg Glu His Ile Leu Glu Asp Glu 595 600 605 Lys Pro Glu Ser Ile Ser Asp Thr Thr Asp Leu Ala Leu Pro Glu 610 615 620 Met Pro Ile Leu Ile Asp Phe His Ala Leu Lys Asp Ile Leu Gly Pro 625 630 635 640 Pro Met Tyr Glu Met Glu Val Ser Gln Arg Leu Ser Gln Pro Gly Val 645 650 655 Ala Ile Gly Leu Ala Trp Thr Pro Leu Gly Gly Glu Ile Met Phe Val 660 665 670 Glu Ala Ser Arg Met Asp Gly Glu Gly Gln Leu Thr Leu Thr Gly Gln 675 680 685 Leu Gly Asp Val Met Lys Glu Ser Ala His Leu Ala Ile Ser Trp Leu 690 695 700 Arg Ser Asn Ala Lys Lys Tyr Gln Leu Thr Asn Ala Phe Gly Ser Phe 705 710 715 720 Asp Leu Leu Asp Asn Thr Asp Ile His Leu His Phe Pro Ala Gly Ala 725 730 735 Val Thr Lys Asp Gly Pro Ser Ala Gly Val Thr Ile Val Thr Cys Leu 740 745 750 Ala Ser Leu Phe Ser Gly Arg Leu Val Arg Ser Asp Val Ala Met Thr 755 760 765 Gly Glu Ile Thr Leu Arg Gly Leu Val Leu Pro Val Gly Gly Ile Lys 770 775 780 Asp Lys Val Leu Ala Ala His Arg Ala Gly Leu Lys Gln Val Ile Ile 785 790 795 800 Pro Arg Arg Asn Glu Lys Asp Leu Glu Gly Ile Pro Gly Asn Val Arg 805 810 815 Gln Asp Leu Ser Phe Val Thr Ala Ser Cys Leu Asp Glu Val Leu Asn 820 825 830 Ala Ala Phe Asp Gly Gly Phe Thr Val Lys Thr Arg Pro Gly Leu Leu 835 840 845 Asn Ser Lys Leu 850 <210> 16 <211> 1018 <212> PRT <213> Homo sapiens <400> 16 Met Glu Asp Glu Glu Gly Pro Glu Tyr Gly Lys Pro Asp Phe Val Leu 1 5 10 15 Leu Asp Gln Val Thr Met Glu Asp Phe Met Arg Asn Leu Gln Leu Arg 20 25 30 Phe Glu Lys Gly Arg Ile Tyr Thr Tyr Ile Gly Glu Val Leu Val Ser 35 40 45 Val Asn Pro Tyr Gln Glu Leu Pro Leu Tyr Gly Pro Glu Ala Ile Ala 50 55 60 Arg Tyr Gln Gly Arg Glu Leu Tyr Glu Arg Pro Pro His Leu Tyr Ala 65 70 75 80 Val Ala Asn Ala Ala Tyr Lys Ala Met Lys His Arg Ser Arg Asp Thr 85 90 95 Cys Ile Val Ile Ser Gly Glu Ser Gly Ala Gly Lys Thr Glu Ala Ser 100 105 110 Lys His Ile Met Gln Tyr Ile Ala Ala Val Thr Asn Pro Ser Gln Arg 115 120 125 Ala Glu Val Glu Arg Val Lys Asp Val Leu Leu Lys Ser Thr Cys Val 130 135 140 Leu Glu Ala Phe Gly Asn Ala Arg Thr Asn Arg Asn His Asn Ser Ser 145 150 155 160 Arg Phe Gly Lys Tyr Met Asp Ile Asn Phe Asp Phe Lys Gly Asp Pro 165 170 175 Ile Gly Gly His Ile His Ser Tyr Leu Leu Glu Lys Ser Arg Val Leu 180 185 190 Lys Gln His Val Gly Glu Arg Asn Phe His Ala Phe Tyr Gln Leu Leu 195 200 205 Arg Gly Ser Glu Asp Lys Gln Leu His Glu Leu His Leu Glu Arg Asn 210 215 220 Pro Ala Val Tyr Asn Phe Thr His Gin Gly Ala Gly Leu Asn Met Thr 225 230 235 240 Val His Ser Ala Leu Asp Ser Asp Glu Gln Ser His Gln Ala Val Thr 245 250 255 Glu Ala Met Arg Val Ile Gly Phe Ser Pro Glu Glu Val Glu Ser Val 260 265 270 His Arg Ile Leu Ala Ala Ile Leu His Leu Gly Asn Ile Glu Phe Val 275 280 285 Glu Thr Glu Glu Gly Gly Leu Gln Lys Glu Gly Leu Ala Val Ala Glu 290 295 300 Glu Ala Leu Val Asp His Val Ala Glu Leu Thr Ala Thr Pro Arg Asp 305 310 315 320 Leu Val Leu Arg Ser Leu Leu Ala Arg Thr Val Ala Ser Gly Gly Arg 325 330 335 Glu Leu Ile Glu Lys Gly His Thr Ala Ala Glu Ala Ser Tyr Ala Arg 340 345 350 Asp Ala Cys Ala Lys Ala Val Tyr Gln Arg Leu Phe Glu Trp Val Val 355 360 365 Asn Arg Ile Asn Ser Val Met Glu Pro Arg Gly Arg Asp Pro Arg Arg 370 375 380 Asp Gly Lys Asp Thr Val Ile Gly Val Leu Asp Ile Tyr Gly Phe Glu 385 390 395 400 Val Phe Pro Val Asn Ser Phe Glu Gln Phe Cys Ile Asn Tyr Cys Asn 405 410 415 Glu Lys Leu Gln Gln Leu Phe Ile Gln Leu Ile Leu Lys Gln Glu Gln 420 425 430 Glu Glu Tyr Glu Arg Glu Gly Ile Thr Trp Gln Ser Val Glu Tyr Phe 435 440 445 Asn Asn Ala Thr Ile Val Asp Leu Val Glu Arg Pro His Arg Gly Ile 450 455 460 Leu Ala Val Leu Asp Glu Ala Cys Ser Ser Ala Gly Thr Ile Thr Asp 465 470 475 480 Arg Ile Phe Leu Gln Thr Leu Asp Met His His Arg His His Leu His 485 490 495 Tyr Thr Ser Arg Gln Leu Cys Pro Thr Asp Lys Thr Met Glu Phe Gly 500 505 510 Arg Asp Phe Arg Ile Lys His Tyr Ala Gly Asp Val Thr Tyr Ser Val 515 520 525 Glu Gly Phe Ile Asp Lys Asn Arg Asp Phe Leu Phe Gln Asp Phe Lys 530 535 540 Arg Leu Leu Tyr Asn Ser Thr Asp Pro Thr Leu Arg Ala Met Trp Pro 545 550 555 560 Asp Gly Gln Gln Asp Ile Thr Glu Val Thr Lys Arg Pro Leu Thr Ala 565 570 575 Gly Thr Leu Phe Lys Asn Ser Met Val Ala Leu Val Glu Asn Leu Ala 580 585 590 Ser Lys Glu Pro Phe Tyr Val Arg Cys Ile Lys Pro Asn Glu Asp Lys 595 600 605 Val Ala Gly Lys Leu Asp Glu Asn His Cys Arg His Gln Val Ala Tyr 610 615 620 Leu Gly Leu Leu Glu Asn Val Arg Val Arg Arg Ala Gly Phe Ala Ser 625 630 635 640 Arg Gln Pro Tyr Ser Arg Phe Leu Leu Arg Tyr Lys Met Thr Cys Glu 645 650 655 Tyr Thr Trp Pro Asn His Leu Leu Gly Ser Asp Lys Ala Ala Val Ser 660 665 670 Ala Leu Leu Glu Gln His Gly Leu Gln Gly Asp Val Ala Phe Gly His 675 680 685 Ser Lys Leu Phe Ile Arg Ser Pro Arg Thr Leu Val Thr Leu Glu Gln 690 695 700 Ser Arg Ala Arg Leu Ile Pro Ile Ile Val Leu Leu Leu Gln Lys Ala 705 710 715 720 Trp Arg Gly Thr Leu Ala Arg Trp Arg Cys Arg Arg Leu Arg Ala Ile 725 730 735 Tyr Thr Ile Met Arg Trp Phe Arg Arg His Lys Val Arg Ala His Leu 740 745 750 Ala Glu Leu Gln Arg Arg Phe Gln Ala Ala Arg Gln Pro Leu Tyr 755 760 765 Gly Arg Asp Leu Val Trp Pro Leu Pro Pro Ala Val Leu Gln Pro Phe 770 775 780 Gln Asp Thr Cys His Ala Leu Phe Cys Arg Trp Arg Ala Arg Gln Leu 785 790 795 800 Val Lys Asn Ile Pro Pro Ser Asp Met Pro Gln Ile Lys Ala Lys Val 805 810 815 Ala Ala Met Gly Ala Leu Gln Gly Leu Arg Gln Asp Trp Gly Cys Arg 820 825 830 Arg Ala Trp Ala Arg Asp Tyr Leu Ser Ser Ala Thr Asp Asn Pro Thr 835 840 845 Ala Ser Ser Leu Phe Ala Gln Arg Leu Lys Thr Leu Gln Asp Lys Asp 850 855 860 Gly Phe Gly Ala Val Leu Phe Ser Ser His Val Arg Lys Val Asn Arg 865 870 875 880 Phe His Lys Ile Arg Asn Arg Ala Leu Leu Leu Thr Asp Gln His Leu 885 890 895 Tyr Lys Leu Asp Pro Asp Arg Gln Tyr Arg Val Met Arg Ala Val Pro 900 905 910 Leu Glu Ala Val Thr Gly Leu Ser Val Thr Ser Gly Gly Asp Gln Leu 915 920 925 Val Val Leu His Ala Arg Gly Gln Asp Asp Leu Val Val Cys Leu His 930 935 940 Arg Ser Arg Pro Pro Leu Asp Asn Arg Val Gly Glu Leu Val Gly Val 945 950 955 960 Leu Ala Ala His Cys Gin Gly Glu Gly Arg Thr Leu Glu Val Arg Val 965 970 975 Ser Asp Cys Ile Pro Leu Ser His Arg Gly Val Arg Arg Leu Ile Ser 980 985 990 Val Glu Pro Arg Pro Glu Gln Pro Glu Pro Asp Phe Arg Cys Ala Arg 995 1000 1005 Gly Ser Phe Thr Leu Leu Trp Pro Ser Arg 1010 1015 <210> 17 <211> 8923 <212> PRT <213> Homo sapiens <400> 17 Met Asp Gln Pro Gln Phe Ser Gly Ala Pro Arg Phe Leu Thr Arg Pro 1 5 10 15 Lys Ala Phe Val Val Ser Val Gly Lys Asp Ala Thr Leu Ser Cys Gln 20 25 30 Ile Val Gly Asn Pro Thr Pro Gln Val Ser Trp Glu Lys Asp Gln Gln 35 40 45 Pro Val Ala Ala Gly Ala Arg Phe Arg Leu Ala Gln Asp Gly Asp Leu 50 55 60 Tyr Arg Leu Thr Ile Leu Asp Leu Ala Leu Gly Asp Ser Gly Gln Tyr 65 70 75 80 Val Cys Arg Ala Arg Asn Ala Ile Gly Glu Ala Phe Ala Ala Val Gly 85 90 95 Leu Gln Val Asp Ala Glu Ala Ala Cys Ala Glu Gln Ala Pro His Phe 100 105 110 Leu Leu Arg Pro Thr Ser Ile Arg Val Arg Glu Gly Ser Glu Ala Thr 115 120 125 Phe Arg Cys Arg Val Gly Gly Ser Pro Arg Pro Ala Val Ser Trp Ser 130 135 140 Lys Asp Gly Arg Arg Leu Gly Glu Pro Asp Gly Pro Arg Val Arg Val 145 150 155 160 Glu Glu Leu Gly Glu Ala Ser Ala Leu Arg Ile Arg Ala Ala Arg Pro 165 170 175 Arg Asp Gly Gly Thr Tyr Glu Val Arg Ala Glu Asn Pro Leu Gly Ala 180 185 190 Ala Ser Ala Ala Ala Ala Leu Val Val Asp Ser Asp Ala Ala Asp Thr 195 200 205 Ala Ser Arg Pro Gly Thr Ser Thr Ala Ala Leu Leu Ala His Leu Gln 210 215 220 Arg Arg Arg Glu Ala Met Arg Ala Glu Gly Ala Pro Ala Ser Pro Pro 225 230 235 240 Ser Thr Gly Thr Arg Thr Cys Thr Val Thr Glu Gly Lys His Ala Arg 245 250 255 Leu Ser Cys Tyr Val Thr Gly Glu Pro Lys Pro Glu Thr Val Trp Lys 260 265 270 Lys Asp Gly Gln Leu Val Thr Glu Gly Arg Arg His Val Val Tyr Glu 275 280 285 Asp Ala Gln Glu Asn Phe Val Leu Lys Ile Leu Phe Cys Lys Gln Ser 290 295 300 Asp Arg Gly Leu Tyr Thr Cys Thr Ala Ser Asn Leu Val Gly Gln Thr 305 310 315 320 Tyr Ser Ser Val Leu Val Val Val Arg Glu Pro Ala Val Pro Phe Lys 325 330 335 Lys Arg Leu Gln Asp Leu Glu Val Arg Glu Lys Glu Ser Ala Thr Phe 340 345 350 Leu Cys Glu Val Pro Gln Pro Ser Thr Glu Ala Ala Trp Phe Lys Glu 355 360 365 Glu Thr Arg Leu Trp Ala Ser Ala Lys Tyr Gly Ile Glu Glu Glu Gly 370 375 380 Thr Glu Arg Arg Leu Thr Val Arg Asn Val Ser Ala Asp Asp Asp Ala 385 390 395 400 Val Tyr Ile Cys Glu Thr Pro Glu Gly Ser Arg Thr Val Ala Glu Leu 405 410 415 Ala Val Gln Gly Asn Leu Leu Arg Lys Leu Pro Arg Lys Thr Ala Val 420 425 430 Arg Val Gly Asp Thr Ala Met Phe Cys Val Glu Leu Ala Val Pro Val 435 440 445 Gly Pro Val His Trp Leu Arg Asn Gln Glu Glu Val Val Ala Gly Gly 450 455 460 Arg Val Ala Ile Ser Ala Glu Gly Thr Arg His Thr Leu Thr Ile Ser 465 470 475 480 Gln Cys Cys Leu Glu Asp Val Gly Gln Val Ala Phe Met Ala Gly Asp 485 490 495 Cys Gln Thr Ser Thr Gln Phe Cys Val Ser Ala Pro Arg Lys Pro Pro 500 505 510 Leu Gln Pro Pro Val Asp Pro Val Val Lys Ala Arg Met Glu Ser Ser Ser 515 520 525 Val Ile Leu Ser Trp Ser Pro Pro Pro His Gly Glu Arg Pro Val Thr 530 535 540 Ile Asp Gly Tyr Leu Val Glu Lys Lys Lys Leu Gly Thr Tyr Thr Trp 545 550 555 560 Ile Arg Cys His Glu Ala Glu Trp Val Ala Thr Pro Glu Leu Thr Val 565 570 575 Ala Asp Val Ala Glu Glu Gly Asn Phe Gln Phe Arg Val Ser Ala Leu 580 585 590 Asn Ser Phe Gly Gln Ser Pro Tyr Leu Glu Phe Pro Gly Thr Val His 595 600 605 Leu Ala Pro Lys Leu Ala Val Arg Thr Pro Leu Lys Ala Val Gln Ala 610 615 620 Val Glu Gly Gly Glu Val Thr Phe Ser Val Asp Leu Thr Val Ala Ser 625 630 635 640 Ala Gly Glu Trp Phe Leu Asp Gly Gln Ala Leu Lys Ala Ser Ser Val 645 650 655 Tyr Glu Ile His Cys Asp Arg Thr Arg His Thr Leu Thr Ile Arg Glu 660 665 670 Val Pro Ala Ser Leu His Gly Ala Gln Leu Lys Phe Val Ala Asn Gly 675 680 685 Ile Glu Ser Ser Ile Arg Met Glu Val Arg Ala Ala Pro Gly Leu Thr 690 695 700 Ala Asn Lys Pro Pro Ala Ala Ala Ala Arg Glu Val Leu Ala Arg Leu 705 710 715 720 His Glu Glu Ala Gln Leu Leu Ala Glu Leu Ser Asp Gln Ala Ala Ala 725 730 735 Val Thr Trp Leu Lys Asp Gly Arg Thr Leu Ser Pro Gly Pro Lys Tyr 740 745 750 Glu Val Gln Ala Ser Ala Gly Arg Arg Val Leu Leu Val Arg Asp Val 755 760 765 Ala Arg Asp Asp Ala Gly Leu Tyr Glu Cys Val Ser Arg Gly Gly Arg 770 775 780 Ile Ala Tyr Gln Leu Ser Val Gln Gly Leu Ala Arg Phe Leu His Lys 785 790 795 800 Asp Met Ala Gly Ser Cys Val Asp Ala Val Ala Gly Gly Pro Ala Gln 805 810 815 Phe Glu Cys Glu Thr Ser Glu Ala His Val His Val His Trp Tyr Lys 820 825 830 Asp Gly Met Glu Leu Gly His Ser Gly Glu Arg Phe Leu Gln Glu Asp 835 840 845 Val Gly Thr Arg His Arg Leu Val Ala Ala Thr Val Thr Arg Gln Asp 850 855 860 Glu Gly Thr Tyr Ser Cys Arg Val Gly Glu Asp Ser Val Asp Phe Arg 865 870 875 880 Leu Arg Val Ser Glu Pro Lys Ala Val Phe Ala Lys Glu Gln Pro Ala 885 890 895 Cys Arg Glu Val Gln Ala Glu Val Gly Ala Ser Ala Thr Leu Ser Cys 900 905 910 Glu Val Ala Gln Asp Gln Met Glu Val Thr Trp Tyr Lys Asp Gly Lys 915 920 925 Lys Leu Ser Ser Ser Ser Lys Val His Val Glu Ala Val Gly Cys Met 930 935 940 Arg Arg Leu Val Val Gln Gln Val Gly Gln Ala Asp Ser Gly Glu Tyr 945 950 955 960 Ser Cys Glu Ala Arg Gly Gln Arg Val Ser Phe Arg Leu Asp Val Ala 965 970 975 Glu Pro Lys Val Val Phe Ala Lys Glu Gln Leu Ala Arg Arg Lys Leu 980 985 990 Gln Ala Glu Ala Gly Ala Ser Ala Thr Leu Ser Cys Glu Val Ala Gln 995 1000 1005 Ala Gln Thr Glu Val Thr Trp Tyr Lys Asp Gly Lys Lys Leu Ser Ser 1010 1015 1020 Ser Ser Lys Val Cys Met Glu Ala Thr Gly Cys Thr Arg Arg Leu Val 1025 1030 1035 1040 Val Gln Gln Ala Gly Gln Ala Asp Ala Gly Glu Tyr Ser Cys Glu Ala 1045 1050 1055 Gly Gly Gln Arg Leu Ser Phe His Leu Asp Val Lys Glu Pro Lys Val 1060 1065 1070 Val Phe Ala Lys Asp Gln Val Ala His Ser Glu Val Gln Ala Glu Ala 1075 1080 1085 Gly Ala Ser Ala Thr Leu Ser Cys Glu Val Ala Gln Ala Gln Thr Glu 1090 1095 1100 Val Met Trp Tyr Lys Asp Gly Lys Lys Leu Ser Ser Ser Leu Lys Val 1105 1110 1115 1120 His Val Glu Ala Lys Gly Cys Arg Arg Arg Leu Val Val Gln Gln Ala 1125 1130 1135 Gly Lys Thr Asp Ala Gly Asp Tyr Ser Cys Glu Ala Arg Gly Gln Arg 1140 1145 1150 Val Ser Phe Arg Leu His Ile Thr Glu Pro Lys Met Met Phe Ala Lys 1155 1160 1165 Glu Gln Ser Val His Asn Glu Val Gln Ala Glu Ala Gly Ala Ser Ala 1170 1175 1180 Met Leu Ser Cys Glu Val Ala Gln Ala Gln Thr Glu Val Thr Trp Tyr 1185 1190 1195 1200 Lys Asp Gly Lys Lys Leu Ser Ser Ser Ser Lys Val Gly Met Glu Val 1205 1210 1215 Lys Gly Cys Thr Arg Arg Leu Val Leu Pro Gln Ala Gly Lys Ala Asp 1220 1225 1230 Ala Gly Glu Tyr Ser Cys Glu Ala Gly Gly Gln Arg Val Ser Phe His 1235 1240 1245 Leu His Ile Thr Glu Pro Lys Gly Val Phe Ala Lys Glu Gln Ser Val 1250 1255 1260 His Asn Glu Val Gln Ala Glu Ala Gly Thr Thr Ala Met Leu Ser Cys 1265 1270 1275 1280 Glu Val Ala Gln Pro Gln Thr Glu Val Thr Trp Tyr Lys Asp Gly Lys 1285 1290 1295 Lys Leu Ser Ser Ser Ser Lys Val Arg Met Glu Val Lys Gly Cys Thr 1300 1305 1310 Arg Arg Leu Val Val Gln Gln Val Gly Lys Ala Asp Ala Gly Glu Tyr 1315 1320 1325 Ser Cys Glu Ala Gly Gly Gln Arg Val Ser Phe Gln Leu His Ile Thr 1330 1335 1340 Glu Pro Lys Ala Val Phe Ala Lys Glu Gln Leu Val His Asn Glu Val 1345 1350 1355 1360 Arg Thr Glu Ala Gly Ala Ser Ala Thr Leu Ser Cys Glu Val Ala Gln 1365 1370 1375 Ala Gln Thr Glu Val Thr Trp Tyr Lys Asp Gly Lys Lys Leu Ser Ser 1380 1385 1390 Ser Ser Lys Val Arg Ile Glu Ala Ala Gly Cys Met Arg Gln Leu Val 1395 1400 1405 Val Gln Gln Ala Gly Gln Ala Asp Ala Gly Glu Tyr Thr Cys Glu Ala 1410 1415 1420 Gly Gly Gln Arg Leu Ser Phe His Leu Asp Val Ser Glu Pro Lys Ala 1425 1430 1435 1440 Val Phe Ala Lys Glu Gln Leu Ala His Arg Lys Val Gln Ala Glu Ala 1445 1450 1455 Gly Ala Ile Ala Thr Leu Ser Cys Glu Val Ala Gln Ala Gln Thr Glu 1460 1465 1470 Val Thr Trp Tyr Lys Asp Gly Lys Lys Leu Ser Ser Ser Ser Lys Val 1475 1480 1485 Arg Met Glu Ala Val Gly Cys Thr Arg Arg Leu Val Val Gln Gln Ala 1490 1495 1500 Cys Gln Ala Asp Thr Gly Glu Tyr Ser Cys Glu Ala Gly Gly Gln Arg 1505 1510 1515 1520 Leu Ser Phe Ser Leu Asp Val Ala Glu Pro Lys Val Val Phe Ala Lys 1525 1530 1535 Glu Gln Pro Val His Arg Glu Val Gln Ala Gln Ala Gly Ala Ser Thr 1540 1545 1550 Thr Leu Ser Cys Glu Val Ala Gln Ala Gln Thr Glu Val Met Trp Tyr 1555 1560 1565 Lys Asp Gly Lys Lys Leu Ser Phe Ser Ser Lys Val Arg Met Glu Ala 1570 1575 1580 Val Gly Cys Thr Arg Arg Leu Val Val Gln Gln Ala Gly Gln Ala Val 1585 1590 1595 1600 Ala Gly Glu Tyr Ser Cys Glu Ala Gly Ser Gln Arg Leu Ser Phe His 1605 1610 1615 Leu His Val Ala Glu Pro Lys Ala Val Phe Ala Lys Glu Gln Pro Ala 1620 1625 1630 His Arg Glu Val Gln Ala Glu Ala Gly Ala Ser Ala Thr Leu Ser Cys 1635 1640 1645 Glu Val Ala Gln Ala Gln Thr Glu Val Thr Trp Tyr Lys Asp Gly Lys 1650 1655 1660 Lys Leu Ser Ser Ser Leu Lys Val His Val Glu Ala Ala Gly Cys Thr 1665 1670 1675 1680 Arg Arg Leu Val Val Gln Gln Ala Gly Gln Ala Asp Thr Gly Glu Tyr 1685 1690 1695 Ser Cys Glu Ala Gly Gly Gln Gln Leu Ser Phe Arg Leu Gln Val Ala 1700 1705 1710 Glu Pro Lys Ala Val Phe Ala Lys Glu Gln Pro Ala Ser Arg Glu Val 1715 1720 1725 Gln Ala Glu Ala Gly Thr Ser Ala Thr Leu Ser Cys Glu Val Ala Gln 1730 1735 1740 Ala Gln Thr Glu Val Thr Trp Tyr Lys Asp Gly Lys Lys Leu Ser Ser 1745 1750 1755 1760 Ser Ser Lys Val Arg Met Glu Ala Val Gly Cys Thr Arg Arg Leu Val 1765 1770 1775 Val Gln Glu Ala Gly Gln Ala Asp Ala Gly Glu Tyr Ser Cys Lys Ala 1780 1785 1790 Gly Asp Gln Arg Leu Ser Phe His Leu His Val Ala Glu Pro Lys Val 1795 1800 1805 Val Phe Ala Lys Glu Gln Pro Ala His Arg Glu Val Gln Ala Glu Ala 1810 1815 1820 Gly Ala Ser Ala Thr Leu Ser Cys Glu Val Ala Gln Ala Gln Thr Glu 1825 1830 1835 1840 Val Thr Trp Tyr Lys Asp Gly Lys Lys Leu Ser Ser Ser Ser Lys Val 1845 1850 1855 Arg Val Glu Ala Val Gly Cys Thr Arg Arg Leu Val Val Gln Gln Ala 1860 1865 1870 Gly Gln Ala Glu Ala Gly Glu Tyr Ser Cys Glu Ala Gly Gly Gln Gln 1875 1880 1885 Leu Ser Phe Arg Leu Gln Val Ala Glu Pro Lys Ala Val Phe Ala Lys 1890 1895 1900 Glu Gln Val Val Phe Ala Lys Asp Gln Pro Val His Arg Glu Val Gln 1905 1910 1915 1920 Ala Glu Ala Gly Thr Ser Thr Met Leu Ser Cys Glu Val Ala Gln Ala 1925 1930 1935 Gln Thr Glu Val Met Trp Tyr Lys Asp Gly Lys Lys Leu Ser Ser Ser Ser 1940 1945 1950 Ser Lys Met Arg Val Glu Ala Val Gly Cys Thr Arg Arg Leu Val Val 1955 1960 1965 Gln Glu Ala Gly Gln Ala Asp Ala Gly Glu Tyr Ser Cys Glu Ala Gly 1970 1975 1980 Gly Gln Arg Leu Ser Phe His Leu His Val Ala Glu Pro Lys Val Val 1985 1990 1995 2000 Phe Ala Lys Glu Gln Pro Ala Cys Arg Glu Val Gln Ala Glu Ala Gly 2005 2010 2015 Ala Ser Ala Thr Leu Ser Cys Glu Val Ala Gln Gly Gln Met Glu Val 2020 2025 2030 Thr Trp Tyr Lys Asp Gly Lys Lys Leu Ser Ser Ser Ser Lys Val His 2035 2040 2045 Met Glu Ala Ser Gly Tyr Thr Arg Arg Leu Val Val Gln Gln Ala Gly 2050 2055 2060 Gln Ala Asp Ala Gly Glu Tyr Ser Cys Glu Ala Gly Gly Gln Arg Leu 2065 2070 2075 2080 Ser Phe Arg Leu His Val Ala Glu Leu Glu Pro Gln Ile Ser Glu Arg 2085 2090 2095 Pro Cys Arg Arg Glu Pro Leu Val Val Lys Glu His Glu Asp Ile Ile 2100 2105 2110 Leu Thr Ala Thr Leu Ala Thr Pro Ser Ala Ala Thr Val Thr Trp Leu 2115 2120 2125 Lys Asp Gly Val Glu Ile Arg Arg Ser Lys Arg His Glu Thr Ala Ser 2130 2135 2140 Gln Gly Asp Thr His Thr Leu Thr Val His Gly Ala Gln Val Leu Asp 2145 2150 2155 2160 Ser Ala Ile Tyr Ser Cys Arg Val Gly Ala Glu Gly Gln Asp Phe Pro 2165 2170 2175 Val Gln Val Glu Glu Val Ala Ala Lys Phe Cys Arg Leu Leu Glu Pro 2180 2185 2190 Val Cys Gly Glu Leu Gly Gly Thr Val Thr Leu Ala Cys Glu Leu Ser 2195 2200 2205 Pro Ala Cys Ala Glu Val Val Trp Arg Cys Gly Asn Thr Gln Leu Arg 2210 2215 2220 Val Gly Lys Arg Phe Gln Met Val Ala Glu Gly Pro Val Arg Ser Leu 2225 2230 2235 2240 Thr Val Leu Gly Leu Arg Ala Glu Asp Ala Gly Glu Tyr Val Cys Glu 2245 2250 2255 Ser Arg Asp Asp His Thr Ser Ala Gln Leu Thr Val Ser Val Pro Arg 2260 2265 2270 Val Val Lys Phe Met Ser Gly Leu Ser Thr Val Val Ala Glu Glu Gly 2275 2280 2285 Gly Glu Ala Thr Phe Gln Cys Val Val Ser Pro Ser Asp Val Ala Val 2290 2295 2300 Val Trp Phe Arg Asp Gly Ala Leu Leu Gln Pro Ser Glu Lys Phe Ala 2305 2310 2315 2320 Ile Ser Gln Ser Gly Ala Ser His Ser Leu Thr Ile Ser Asp Leu Val 2325 2330 2335 Leu Glu Asp Ala Gly Gln Ile Thr Val Glu Ala Glu Gly Ala Ser Ser 2340 2345 2350 Ser Ala Ala Leu Arg Val Arg Glu Ala Pro Val Leu Phe Lys Lys Lys 2355 2360 2365 Leu Glu Pro Gln Thr Val Glu Glu Arg Ser Ser Val Thr Leu Glu Val 2370 2375 2380 Glu Leu Thr Arg Pro Trp Pro Glu Leu Arg Trp Thr Arg Asn Ala Thr 2385 2390 2395 2400 Ala Leu Ala Pro Gly Lys Asn Val Glu Ile His Ala Glu Gly Ala Arg 2405 2410 2415 His Arg Leu Val Leu His Asn Val Gly Phe Ala Asp Arg Gly Phe Phe 2420 2425 2430 Gly Cys Glu Thr Pro Asp Asp Lys Thr Gln Ala Lys Leu Thr Val Glu 2435 2440 2445 Met Arg Gln Val Arg Leu Val Arg Gly Leu Gln Ala Val Glu Ala Arg 2450 2455 2460 Glu Gln Gly Thr Ala Thr Met Glu Val Gln Leu Ser His Ala Asp Val 2465 2470 2475 2480 Asp Gly Ser Trp Thr Arg Asp Gly Leu Arg Phe Gln Gln Gly Pro Thr 2485 2490 2495 Cys His Leu Ala Val Arg Gly Pro Met His Thr Leu Thr Leu Ser Gly 2500 2505 2510 Leu Arg Pro Glu Asp Ser Gly Leu Met Val Phe Lys Ala Glu Gly Val 2515 2520 2525 His Thr Ser Ala Arg Leu Val Val Thr Glu Leu Pro Val Ser Phe Ser 2530 2535 2540 Arg Pro Leu Gln Asp Val Val Thr Thr Glu Lys Glu Lys Val Thr Leu 2545 2550 2555 2560 Glu Cys Glu Leu Ser Arg Pro Asn Val Asp Val Arg Trp Leu Lys Asp 2565 2570 2575 Gly Val Glu Leu Arg Ala Gly Lys Thr Met Ala Ile Ala Ala Gln Gly 2580 2585 2590 Ala Cys Arg Ser Leu Thr Ile Tyr Arg Cys Glu Phe Ala Asp Gln Gly 2595 2600 2605 Val Tyr Val Cys Asp Ala His Asp Ala Gln Ser Ser Ala Ser Val Lys 2610 2615 2620 Val Gln Gly Arg Asn Ile Gln Ile Val Arg Pro Leu Glu Asp Val Glu 2625 2630 2635 2640 Val Met Glu Lys Asp Gly Ala Thr Phe Ser Cys Glu Val Ser His Asp 2645 2650 2655 Glu Val Pro Gly Gln Trp Phe Trp Glu Gly Ser Lys Leu Arg Pro Thr 2660 2665 2670 Asp Asn Val Arg Ile Arg Gln Glu Gly Arg Thr Tyr Thr Leu Ile Tyr 2675 2680 2685 Arg Arg Val Leu Ala Glu Asp Ala Gly Glu Ile Gln Phe Val Ala Glu 2690 2695 2700 Asn Ala Glu Ser Arg Ala Gln Leu Arg Val Lys Glu Leu Pro Val Thr 2705 2710 2715 2720 Leu Val Arg Pro Leu Arg Asp Lys Ile Ala Met Glu Lys His Arg Gly 2725 2730 2735 Val Leu Glu Cys Gln Val Ser Arg Ala Ser Ala Gln Val Arg Trp Phe 2740 2745 2750 Lys Gly Ser Gln Glu Leu Gln Pro Gly Pro Lys Tyr Glu Leu Val Ser 2755 2760 2765 Asp Gly Leu Tyr Arg Lys Leu Ile Ile Ser Asp Val His Ala Glu Asp 2770 2775 2780 Glu Asp Thr Tyr Thr Cys Asp Ala Gly Asp Val Lys Thr Ser Ala Gln 2785 2790 2795 2800 Phe Phe Val Glu Glu Gln Ser Ile Thr Ile Val Arg Gly Leu Gln Asp 2805 2810 2815 Val Thr Val Met Glu Pro Ala Pro Ala Trp Phe Glu Cys Glu Thr Ser 2820 2825 2830 Ile Pro Ser Val Arg Pro Pro Lys Trp Leu Leu Gly Lys Thr Val Leu 2835 2840 2845 Gln Ala Gly Gly Asn Val Gly Leu Glu Gln Glu Gly Thr Val His Arg 2850 2855 2860 Leu Met Leu Arg Arg Thr Cys Ser Thr Met Thr Gly Pro Val His Phe 2865 2870 2875 2880 Thr Val Gly Lys Ser Arg Ser Ser Ala Arg Leu Val Val Ser Asp Ile 2885 2890 2895 Pro Val Val Leu Thr Arg Pro Leu Glu Pro Lys Thr Gly Arg Glu Leu 2900 2905 2910 Gln Ser Val Val Leu Ser Cys Asp Phe Arg Pro Ala Pro Lys Ala Val 2915 2920 2925 Gln Trp Tyr Lys Asp Asp Thr Pro Leu Ser Pro Ser Glu Lys Phe Lys 2930 2935 2940 Met Ser Leu Glu Gly Gln Met Ala Glu Leu Arg Ile Leu Arg Leu Met 2945 2950 2955 2960 Pro Ala Asp Ala Gly Val Tyr Arg Cys Gln Ala Gly Ser Ala His Ser 2965 2970 2975 Ser Thr Glu Val Thr Val Glu Ala Arg Glu Val Thr Val Thr Gly Pro 2980 2985 2990 Leu Gln Asp Ala Glu Ala Thr Glu Glu Gly Trp Ala Ser Phe Ser Cys 2995 3000 3005 Glu Leu Ser His Glu Asp Glu Glu Val Glu Trp Ser Leu Asn Gly Met 3010 3015 3020 Pro Leu Tyr Asn Asp Ser Phe His Glu Ile Ser His Lys Gly Arg Arg 3025 3030 3035 3040 His Thr Leu Val Leu Lys Ser Ile Gln Arg Ala Asp Ala Gly Ile Val 3045 3050 3055 Arg Ala Ser Ser Leu Lys Val Ser Thr Ser Ala Arg Leu Glu Val Arg 3060 3065 3070 Val Lys Pro Val Val Phe Leu Lys Ala Leu Asp Asp Leu Ser Ala Glu 3075 3080 3085 Glu Arg Gly Thr Leu Ala Leu Gln Cys Glu Val Ser Asp Pro Glu Ala 3090 3095 3100 His Val Val Trp Arg Lys Asp Gly Val Gln Leu Gly Pro Ser Asp Lys 3105 3110 3115 3120 Tyr Asp Phe Leu His Thr Ala Gly Thr Arg Gly Leu Val Val His Asp 3125 3130 3135 Val Ser Pro Glu Asp Ala Gly Leu Tyr Thr Cys His Val Gly Ser Glu 3140 3145 3150 Glu Thr Arg Ala Arg Val Arg Val His Asp Leu His Val Gly Ile Thr 3155 3160 3165 Lys Arg Leu Lys Thr Met Glu Val Leu Glu Gly Glu Ser Cys Ser Phe 3170 3175 3180 Glu Cys Val Leu Ser His Glu Ser Ala Ser Asp Pro Ala Met Trp Thr 3185 3190 3195 3200 Val Gly Gly Lys Thr Val Gly Ser Ser Ser Arg Phe Gln Ala Thr Arg 3205 3210 3215 Gln Gly Arg Lys Tyr Ile Leu Val Val Arg Glu Ala Ala Pro Ser Asp 3220 3225 3230 Ala Gly Glu Val Val Phe Ser Val Arg Gly Leu Thr Ser Lys Ala Ser 3235 3240 3245 Leu Ile Val Arg Glu Arg Pro Ala Ala Ile Ile Lys Pro Leu Glu Asp 3250 3255 3260 Gln Trp Val Ala Pro Gly Glu Asp Val Glu Leu Arg Cys Glu Leu Ser 3265 3270 3275 3280 Arg Ala Gly Thr Pro Val His Trp Leu Lys Asp Arg Lys Ala Ile Arg 3285 3290 3295 Lys Ser Gln Lys Tyr Asp Val Val Cys Glu Gly Thr Met Ala Met Leu 3300 3305 3310 Val Ile Arg Gly Ala Ser Leu Lys Asp Ala Gly Glu Tyr Thr Cys Glu 3315 3320 3325 Val Glu Ala Ser Lys Ser Thr Ala Ser Leu His Val Glu Glu Lys Ala 3330 3335 3340 Asn Cys Phe Thr Glu Glu Leu Thr Asn Leu Gln Val Glu Glu Lys Gly 3345 3350 3355 3360 Thr Ala Val Phe Thr Cys Lys Thr Glu His Pro Ala Ala Thr Val Thr 3365 3370 3375 Trp Arg Lys Gly Leu Leu Glu Leu Arg Ala Ser Gly Lys His Gln Pro 3380 3385 3390 Ser Gln Glu Gly Leu Thr Leu Arg Leu Thr Ile Ser Ala Leu Glu Lys 3395 3400 3405 Ala Asp Ser Asp Thr Tyr Thr Cys Asp Ile Gly Gln Ala Gln Ser Arg 3410 3415 3420 Ala Gln Leu Leu Val Gln Gly Arg Arg Val His Ile Ile Glu Asp Leu 3425 3430 3435 3440 Glu Asp Val Asp Val Gin Glu Gly Ser Ser Ala Thr Phe Arg Cys Arg 3445 3450 3455 Ile Ser Pro Ala Asn Tyr Glu Pro Val His Trp Phe Leu Asp Lys Thr 3460 3465 3470 Pro Leu His Ala Asn Glu Leu Asn Glu Ile Asp Ala Gln Pro Gly Gly 3475 3480 3485 Tyr His Val Leu Thr Leu Arg Gln Leu Ala Leu Lys Asp Ser Gly Thr 3490 3495 3500 Ile Tyr Phe Glu Ala Gly Asp Gln Arg Ala Ser Ala Ala Leu Arg Val 3505 3510 3515 3520 Thr Glu Lys Pro Ser Val Phe Ser Arg Glu Leu Thr Asp Ala Thr Ile 3525 3530 3535 Thr Glu Gly Glu Asp Leu Thr Leu Val Cys Glu Thr Ser Thr Cys Asp 3540 3545 3550 Ile Pro Val Cys Trp Thr Lys Asp Gly Lys Thr Leu Arg Gly Ser Ala 3555 3560 3565 Arg Cys Gln Leu Ser His Glu Gly His Arg Ala Gln Leu Leu Ile Thr 3570 3575 3580 Gly Ala Thr Leu Gln Asp Ser Gly Arg Tyr Lys Cys Glu Ala Gly Gly 3585 3590 3595 3600 Ala Cys Ser Ser Ser Ile Val Arg Val His Ala Arg Pro Val Arg Phe 3605 3610 3615 Gln Glu Ala Leu Lys Asp Leu Glu Val Leu Glu Gly Gly Ala Ala Thr 3620 3625 3630 Leu Arg Cys Val Leu Ser Ser Val Ala Ala Pro Val Lys Trp Cys Tyr 3635 3640 3645 Gly Asn Asn Val Leu Arg Pro Gly Asp Lys Tyr Ser Leu Arg Gln Glu 3650 3655 3660 Gly Ala Met Leu Glu Leu Val Val Arg Asn Leu Arg Pro Gln Asp Ser 3665 3670 3675 3680 Gly Arg Tyr Ser Cys Ser Phe Gly Asp Gln Thr Thr Ser Ala Thr Leu 3685 3690 3695 Thr Val Thr Ala Leu Pro Ala Gln Phe Ile Gly Lys Leu Arg Asn Lys 3700 3705 3710 Glu Ala Thr Glu Gly Ala Thr Ala Thr Leu Arg Cys Glu Leu Ser Lys 3715 3720 3725 Ala Ala Pro Val Glu Trp Arg Lys Gly Ser Glu Thr Leu Arg Asp Gly 3730 3735 3740 Asp Arg Tyr Cys Leu Arg Gln Asp Gly Ala Met Cys Glu Leu Gln Ile 3745 3750 3755 3760 Arg Gly Leu Ala Met Val Asp Ala Ala Glu Tyr Ser Cys Val Cys Gly 3765 3770 3775 Glu Glu Arg Thr Ser Ala Ser Leu Thr Ile Arg Pro Met Pro Ala His 3780 3785 3790 Phe Ile Gly Arg Leu Arg His Gln Glu Ser Ile Glu Gly Ala Thr Ala 3795 3800 3805 Thr Leu Arg Cys Glu Leu Ser Lys Ala Ala Pro Val Glu Trp Arg Lys 3810 3815 3820 Gly Arg Glu Ser Leu Arg Asp Gly Asp Arg His Ser Leu Arg Gln Asp 3825 3830 3835 3840 Gly Ala Val Cys Glu Leu Gln Ile Cys Gly Leu Ala Val Ala Asp Ala 3845 3850 3855 Gly Glu Tyr Ser Cys Val Cys Gly Glu Glu Arg Thr Ser Ala Thr Leu 3860 3865 3870 Thr Val Lys Ala Leu Pro Ala Lys Phe Thr Glu Gly Leu Arg Asn Glu 3875 3880 3885 Glu Ala Val Glu Gly Ala Thr Ala Met Leu Trp Cys Glu Leu Ser Lys 3890 3895 3900 Val Ala Pro Val Glu Trp Arg Lys Gly Pro Glu Asn Leu Arg Asp Gly 3905 3910 3915 3920 Asp Arg Tyr Ile Leu Arg Gln Glu Gly Thr Arg Cys Glu Leu Gln Ile 3925 3930 3935 Cys Gly Leu Ala Met Ala Asp Ala Gly Glu Tyr Leu Cys Val Cys Gly 3940 3945 3950 Gln Glu Arg Thr Ser Ala Thr Leu Thr Ile Arg Ala Leu Pro Ala Arg 3955 3960 3965 Phe Ile Glu Asp Val Lys Asn Gln Glu Ala Arg Glu Gly Ala Thr Ala 3970 3975 3980 Val Leu Gln Cys Glu Leu Asn Ser Ala Ala Pro Val Glu Trp Arg Lys 3985 3990 3995 4000 Gly Ser Glu Thr Leu Arg Asp Gly Asp Arg Tyr Ser Leu Arg Gln Asp 4005 4010 4015 Gly Thr Lys Cys Glu Leu Gln Ile Arg Gly Leu Ala Met Ala Asp Thr 4020 4025 4030 Gly Glu Tyr Ser Cys Val Cys Gly Gln Glu Arg Thr Ser Ala Met Leu 4035 4040 4045 Thr Val Arg Ala Leu Pro Ile Lys Phe Thr Glu Gly Leu Arg Asn Glu 4050 4055 4060 Glu Ala Thr Glu Gly Ala Thr Ala Val Leu Arg Cys Glu Leu Ser Lys 4065 4070 4075 4080 Met Ala Pro Val Glu Trp Trp Lys Gly His Glu Thr Leu Arg Asp Gly 4085 4090 4095 Asp Arg His Ser Leu Arg Gln Asp Gly Ala Arg Cys Glu Leu Gln Ile 4100 4105 4110 Arg Gly Leu Val Ala Glu Asp Ala Gly Glu Tyr Leu Cys Met Cys Gly 4115 4120 4125 Lys Glu Arg Thr Ser Ala Met Leu Thr Val Arg Ala Met Pro Ser Lys 4130 4135 4140 Phe Ile Glu Gly Leu Arg Asn Glu Glu Ala Thr Glu Gly Asp Thr Ala 4145 4150 4155 4160 Thr Leu Trp Cys Glu Leu Ser Lys Ala Ala Pro Val Glu Trp Arg Lys 4165 4170 4175 Gly His Glu Thr Leu Arg Asp Gly Asp Arg His Ser Leu Arg Gln Asp 4180 4185 4190 Gly Ser Arg Cys Glu Leu Gln Ile Arg Gly Leu Ala Val Val Asp Ala 4195 4200 4205 Gly Glu Tyr Ser Cys Val Cys Gly Gln Glu Arg Thr Ser Ala Thr Leu 4210 4215 4220 Thr Val Arg Ala Leu Pro Ala Arg Phe Ile Glu Asp Val Lys Asn Gln 4225 4230 4235 4240 Glu Ala Arg Glu Gly Ala Thr Ala Val Leu Gln Cys Glu Leu Ser Lys 4245 4250 4255 Ala Ala Pro Val Glu Trp Arg Lys Gly Ser Glu Thr Leu Arg Gly Gly 4260 4265 4270 Asp Arg Tyr Ser Leu Arg Gln Asp Gly Thr Arg Cys Glu Leu Gln Ile 4275 4280 4285 His Gly Leu Ser Val Ala Asp Thr Gly Glu Tyr Ser Cys Val Cys Gly 4290 4295 4300 Gln Glu Arg Thr Ser Ala Thr Leu Thr Val Arg Ala Leu Pro Ala Arg 4305 4310 4315 4320 Phe Thr Gln Asp Leu Lys Thr Lys Glu Ala Ser Glu Gly Ala Thr Ala 4325 4330 4335 Thr Leu Gln Cys Glu Leu Ser Lys Val Ala Pro Val Glu Trp Lys Lys 4340 4345 4350 Gly Pro Glu Thr Leu Arg Asp Gly Gly Arg Tyr Ser Leu Lys Gln Asp 4355 4360 4365 Gly Thr Arg Cys Glu Leu Gln Ile His Asp Leu Ser Val Ala Asp Ala 4370 4375 4380 Gly Glu Tyr Ser Cys Met Cys Gly Gin Glu Arg Thr Ser Ala Thr Leu 4385 4390 4395 4400 Thr Val Arg Ala Leu Pro Ala Arg Phe Thr Glu Gly Leu Arg Asn Glu 4405 4410 4415 Glu Ala Met Glu Gly Ala Thr Ala Thr Leu Gln Cys Glu Leu Ser Lys 4420 4425 4430 Ala Ala Pro Val Glu Trp Arg Lys Gly Leu Glu Ala Leu Arg Asp Gly 4435 4440 4445 Asp Lys Tyr Ser Leu Arg Gln Asp Gly Ala Val Cys Glu Leu Gln Ile 4450 4455 4460 His Gly Leu Ala Met Ala Asp Asn Gly Val Tyr Ser Cys Val Cys Gly 4465 4470 4475 4480 Gln Glu Arg Thr Ser Ala Thr Leu Thr Val Arg Ala Leu Pro Ala Arg 4485 4490 4495 Phe Ile Glu Asp Met Arg Asn Gln Lys Ala Thr Glu Gly Ala Thr Val 4500 4505 4510 Thr Leu Gln Cys Lys Leu Arg Lys Ala Ala Pro Val Glu Trp Arg Lys 4515 4520 4525 Gly Pro Asn Thr Leu Lys Asp Gly Asp Arg Tyr Ser Leu Lys Gln Asp 4530 4535 4540 Gly Thr Ser Cys Glu Leu Gln Ile Arg Gly Leu Val Ile Ala Asp Ala 4545 4550 4555 4560 Gly Glu Tyr Ser Cys Ile Cys Glu Gln Glu Arg Thr Ser Ala Thr Leu 4565 4570 4575 Thr Val Arg Ala Leu Pro Ala Arg Phe Ile Glu Asp Val Arg Asn His 4580 4585 4590 Glu Ala Thr Glu Gly Ala Thr Ala Val Leu Gln Cys Glu Leu Ser Lys 4595 4600 4605 Ala Ala Pro Val Glu Trp Arg Lys Gly Ser Glu Thr Leu Arg Asp Gly 4610 4615 4620 Asp Arg Tyr Ser Leu Arg Gln Asp Gly Thr Arg Cys Glu Leu Gln Ile 4625 4630 4635 4640 Arg Gly Leu Ala Val Glu Asp Thr Gly Glu Tyr Leu Cys Val Cys Gly 4645 4650 4655 Gln Glu Arg Thr Ser Ala Thr Leu Thr Val Arg Ala Leu Pro Ala Arg 4660 4665 4670 Phe Ile Asp Asn Met Thr Asn Gln Glu Ala Arg Glu Gly Ala Thr Ala 4675 4680 4685 Thr Leu His Cys Glu Leu Ser Lys Val Ala Pro Val Glu Trp Arg Lys 4690 4695 4700 Gly Pro Glu Thr Leu Arg Asp Gly Asp Arg His Ser Leu Arg Gln Asp 4705 4710 4715 4720 Gly Thr Arg Cys Glu Leu Gln Ile Arg Gly Leu Ser Val Ala Asp Ala 4725 4730 4735 Gly Glu Tyr Ser Cys Val Cys Gly Gln Glu Arg Thr Ser Ala Thr Leu 4740 4745 4750 Thr Ile Arg Ala Leu Pro Ala Lys Phe Thr Lys Gly Leu Arg Asn Glu 4755 4760 4765 Glu Ala Thr Glu Gly Ala Thr Ala Met Leu Gln Cys Glu Leu Ser Lys 4770 4775 4780 Val Ala Pro Val Glu Trp Arg Lys Gly Pro Glu Thr Leu Arg Asp Gly 4785 4790 4795 4800 Asp Arg Tyr Asn Leu Arg Gln Asp Gly Thr Arg Cys Glu Leu Gln Ile 4805 4810 4815 His Gly Leu Ser Val Ala Asp Thr Gly Glu Tyr Ser Cys Val Cys Gly 4820 4825 4830 Gln Glu Lys Thr Ser Ala Thr Leu Thr Val Lys Ala Pro Gln Pro Val 4835 4840 4845 Phe Arg Glu Pro Leu Gln Ser Leu Gln Ala Glu Glu Gly Ser Thr Ala 4850 4855 4860 Thr Leu Gln Cys Glu Leu Ser Glu Pro Thr Ala Thr Val Val Trp Ser 4865 4870 4875 4880 Lys Gly Gly Leu Gln Leu Gln Ala Asn Gly Arg Arg Glu Pro Arg Leu 4885 4890 4895 Gln Gly Cys Thr Ala Glu Leu Val Leu Gln Asp Leu Gln Arg Glu Asp 4900 4905 4910 Thr Gly Glu Tyr Thr Cys Thr Cys Gly Ser Gln Ala Thr Ser Ala Thr 4915 4920 4925 Leu Thr Val Thr Ala Ala Pro Val Arg Phe Leu Arg Glu Leu Gln His 4930 4935 4940 Gln Glu Val Asp Glu Gly Gly Thr Ala His Leu Cys Cys Glu Leu Ser 4945 4950 4955 4960 Arg Ala Gly Ala Ser Val Glu Trp Arg Lys Gly Ser Leu Gln Leu Phe 4965 4970 4975 Pro Cys Ala Lys Tyr Gln Met Val Gln Asp Gly Ala Ala Ala Glu Leu 4980 4985 4990 Leu Val Arg Gly Val Glu Gln Glu Asp Ala Gly Asp Tyr Thr Cys Asp 4995 5000 5005 Thr Gly His Thr Gln Ser Met Ala Ser Leu Ser Val Arg Val Pro Arg 5010 5015 5020 Pro Lys Phe Lys Thr Arg Leu Gln Ser Leu Glu Gln Glu Thr Gly Asp 5025 5030 5035 5040 Ile Ala Arg Leu Cys Cys Gln Leu Ser Asp Ala Glu Ser Gly Ala Val 5045 5050 5055 Val Gln Trp Leu Lys Glu Gly Val Glu Leu His Ala Gly Pro Lys Tyr 5060 5065 5070 Glu Met Arg Ser Gln Gly Ala Thr Arg Glu Leu Leu Ile His Gln Leu 5075 5080 5085 Glu Ala Lys Asp Thr Gly Glu Tyr Ala Cys Val Thr Gly Gly Gln Lys 5090 5095 5100 Thr Ala Ala Ser Leu Arg Val Thr Glu Pro Glu Val Thr Ile Val Arg 5105 5110 5115 5120 Gly Leu Val Asp Ala Glu Val Thr Ala Asp Glu Asp Val Glu Phe Ser 5125 5130 5135 Cys Glu Val Ser Arg Ala Gly Ala Thr Gly Val Gln Trp Cys Leu Gln 5140 5145 5150 Gly Leu Pro Leu Gln Ser Asn Glu Val Thr Glu Val Ala Val Arg Asp 5155 5160 5165 Gly Arg Ile His Thr Leu Arg Leu Lys Gly Val Thr Pro Glu Asp Ala 5170 5175 5180 Gly Thr Val Ser Phe His Leu Gly Asn His Ala Ser Ser Ala Gln Leu 5185 5190 5195 5200 Thr Val Arg Ala Pro Glu Val Thr Ile Leu Glu Pro Leu Gln Asp Val 5205 5210 5215 Gln Leu Ser Glu Gly Gln Asp Ala Ser Phe Gln Cys Arg Leu Ser Arg 5220 5225 5230 Ala Ser Gly Gln Glu Ala Arg Trp Ala Leu Gly Gly Val Pro Leu Gln 5235 5240 5245 Ala Asn Glu Met Asn Asp Ile Thr Val Glu Gln Gly Thr Leu His Leu 5250 5255 5260 Leu Thr Leu His Lys Val Thr Leu Glu Asp Ala Gly Thr Val Ser Phe 5265 5270 5275 5280 His Val Gly Thr Cys Ser Ser Glu Ala Gln Leu Lys Val Thr Ala Lys 5285 5290 5295 Asn Thr Val Val Arg Gly Leu Glu Asn Val Glu Ala Leu Glu Gly Gly 5300 5305 5310 Glu Ala Leu Phe Glu Cys Gln Leu Ser Gln Pro Glu Val Ala Ala His 5315 5320 5325 Thr Trp Leu Leu Asp Asp Glu Pro Val His Thr Ser Glu Asn Ala Glu 5330 5335 5340 Val Val Phe Phe Glu Asn Gly Leu Arg His Leu Leu Leu Leu Lys Asn 5345 5350 5355 5360 Leu Arg Pro Gln Asp Ser Cys Arg Val Thr Phe Leu Ala Gly Asp Met 5365 5370 5375 Val Thr Ser Ala Phe Leu Thr Val Arg Gly Trp Arg Leu Glu Ile Leu 5380 5385 5390 Glu Pro Leu Lys Asn Ala Ala Val Arg Ala Gly Ala Gln Ala Cys Phe 5395 5400 5405 Thr Cys Thr Leu Ser Glu Ala Val Pro Val Gly Glu Ala Ser Trp Tyr 5410 5415 5420 Ile Asn Gly Ala Ala Val Gln Pro Asp Asp Ser Asp Trp Thr Val Thr 5425 5430 5435 5440 Ala Asp Gly Ser His His Ala Leu Leu Leu Arg Ser Ala Gln Pro His 5445 5450 5455 His Ala Gly Glu Val Thr Phe Ala Cys Arg Asp Ala Val Ala Ser Ala 5460 5465 5470 Arg Leu Thr Val Leu Gly Leu Pro Asp Pro Pro Glu Asp Ala Glu Val 5475 5480 5485 Val Ala Arg Ser Ser His Thr Val Thr Leu Ser Trp Ala Ala Pro Met 5490 5495 5500 Ser Asp Gly Gly Gly Gly Leu Cys Gly Tyr Arg Val Glu Val Lys Glu 5505 5510 5515 5520 Gly Ala Thr Gly Gln Trp Arg Leu Cys His Glu Leu Val Pro Gly Pro 5525 5530 5535 Glu Cys Val Val Asp Gly Leu Ala Pro Gly Glu Thr Tyr Arg Phe Arg 5540 5545 5550 Val Ala Ala Val Gly Pro Val Gly Ala Gly Glu Pro Val His Leu Pro 5555 5560 5565 Gln Thr Val Arg Leu Ala Glu Pro Pro Lys Pro Val Pro Pro Gln Pro 5570 5575 5580 Ser Ala Pro Glu Ser Arg Gln Val Ala Ala Gly Glu Asp Val Ser Leu 5585 5590 5595 5600 Glu Leu Glu Val Val Ala Glu Ala Gly Glu Val Ile Trp His Lys Gly 5605 5610 5615 Met Glu Arg Ile Gln Pro Gly Gly Arg Phe Glu Val Val Ser Gln Gly 5620 5625 5630 Arg Gln Gln Met Leu Val Ile Lys Gly Phe Thr Ala Glu Asp Gln Gly 5635 5640 5645 Glu Tyr His Cys Gly Leu Ala Gln Gly Ser Ile Cys Pro Ala Ala Ala 5650 5655 5660 Thr Phe Gln Val Ala Leu Ser Pro Ala Ser Val Asp Glu Ala Pro Gln 5665 5670 5675 5680 Pro Ser Leu Pro Pro Glu Ala Ala Gln Glu Gly Asp Leu His Leu Leu 5685 5690 5695 Trp Glu Ala Leu Ala Arg Lys Arg Arg Met Ser Arg Glu Pro Thr Leu 5700 5705 5710 Asp Ser Ile Ser Glu Leu Pro Glu Glu Asp Gly Arg Ser Gln Arg Leu 5715 5720 5725 Pro Gln Glu Ala Glu Glu Val Ala Pro Asp Leu Ser Glu Gly Tyr Ser 5730 5735 5740 Thr Ala Asp Glu Leu Ala Arg Thr Gly Asp Ala Asp Leu Ser His Thr 5745 5750 5755 5760 Ser Ser Asp Asp Glu Ser Arg Ala Gly Thr Pro Ser Leu Val Thr Tyr 5765 5770 5775 Leu Lys Lys Ala Gly Arg Pro Gly Thr Ser Pro Leu Ala Ser Lys Val 5780 5785 5790 Gly Ala Pro Ala Ala Pro Ser Val Lys Pro Gln Gln Gln Gln Glu Pro 5795 5800 5805 Leu Ala Ala Val Arg Pro Pro Leu Gly Asp Leu Ser Thr Lys Asp Leu 5810 5815 5820 Gly Asp Pro Ser Met Asp Lys Ala Ala Val Lys Ile Gln Ala Ala Phe 5825 5830 5835 5840 Lys Gly Tyr Lys Val Arg Lys Glu Met Lys Gln Gln Glu Gly Pro Met 5845 5850 5855 Phe Ser His Thr Phe Gly Asp Thr Glu Ala Gln Val Gly Asp Ala Leu 5860 5865 5870 Arg Leu Glu Cys Val Val Ala Ser Lys Ala Asp Val Arg Ala Arg Trp 5875 5880 5885 Leu Lys Asp Gly Val Glu Leu Thr Asp Gly Arg His His His Ile Asp 5890 5895 5900 Gln Leu Gly Asp Gly Thr Cys Ser Leu Leu Ile Thr Gly Leu Asp Arg 5905 5910 5915 5920 Ala Asp Ala Gly Cys Tyr Thr Cys Gln Val Ser Asn Lys Phe Gly Gln 5925 5930 5935 Val Thr His Ser Ala Cys Val Val Val Ser Gly Ser Glu Ser Glu Ala 5940 5945 5950 Glu Ser Ser Ser Gly Gly Glu Leu Asp Asp Ala Phe Arg Arg Ala Ala 5955 5960 5965 Arg Arg Leu His Arg Leu Phe Arg Thr Lys Ser Pro Ala Glu Val Ser 5970 5975 5980 Asp Glu Glu Leu Phe Leu Ser Ala Asp Glu Gly Pro Ala Glu Pro Glu 5985 5990 5995 6000 Glu Pro Ala Asp Trp Gln Thr Tyr Arg Glu Asp Glu His Phe Ile Cys 6005 6010 6015 Ile Arg Phe Glu Ala Leu Thr Glu Ala Arg Gln Ala Val Thr Arg Phe 6020 6025 6030 Gln Glu Met Phe Ala Thr Leu Gly Ile Gly Val Glu Ile Lys Leu Val 6035 6040 6045 Glu Gln Gly Pro Arg Arg Val Glu Met Cys Ile Ser Lys Glu Thr Pro 6050 6055 6060 Ala Pro Val Val Pro Pro Glu Pro Leu Pro Ser Leu Leu Thr Ser Asp 6065 6070 6075 6080 Ala Ala Pro Val Phe Leu Thr Glu Leu Gln Asn Gln Glu Val Gln Asp 6085 6090 6095 Gly Tyr Pro Val Ser Phe Asp Cys Val Val Thr Gly Gln Pro Met Pro 6100 6105 6110 Ser Val Arg Trp Phe Lys Asp Gly Lys Leu Leu Glu Glu Asp Asp His 6115 6120 6125 Tyr Met Ile Asn Glu Asp Gln Gln Gly Gly His Gln Leu Ile Ile Thr 6130 6135 6140 Ala Val Val Pro Ala Asp Met Gly Val Tyr Arg Cys Leu Ala Glu Asn 6145 6150 6155 6160 Ser Met Gly Val Ser Ser Thr Lys Ala Glu Leu Arg Val Asp Leu Thr 6165 6170 6175 Ser Thr Asp Tyr Asp Thr Ala Ala Asp Ala Thr Glu Ser Ser Ser Ser Tyr 6180 6185 6190 Phe Ser Ala Gln Gly Tyr Leu Ser Ser Arg Glu Gln Glu Gly Thr Glu 6195 6200 6205 Ser Thr Thr Asp Glu Gly Gln Leu Pro Gln Val Val Glu Glu Leu Arg 6210 6215 6220 Asp Leu Gln Val Ala Pro Gly Thr Arg Leu Ala Lys Phe Gln Leu Lys 6225 6230 6235 6240 Val Lys Gly Tyr Pro Ala Pro Arg Leu Tyr Trp Phe Lys Asp Gly Gln 6245 6250 6255 Pro Leu Thr Ala Ser Ala His Ile Arg Met Thr Asp Lys Lys Ile Leu 6260 6265 6270 His Thr Leu Glu Ile Ile Ser Val Thr Arg Glu Asp Ser Gly Gln Tyr 6275 6280 6285 Ala Ala Tyr Ile Ser Asn Ala Met Gly Ala Ala Tyr Ser Ser Ala Arg 6290 6295 6300 Leu Leu Val Arg Gly Pro Asp Glu Pro Glu Glu Lys Pro Ala Ser Asp 6305 6310 6315 6320 Val His Glu Gln Leu Val Pro Pro Arg Met Leu Glu Arg Phe Thr Pro 6325 6330 6335 Lys Lys Val Lys Lys Gly Ser Ser Ile Thr Phe Ser Val Lys Val Glu 6340 6345 6350 Gly Arg Pro Val Pro Thr Val His Trp Leu Arg Glu Glu Ala Glu Arg 6355 6360 6365 Gly Val Leu Trp Ile Gly Pro Asp Thr Pro Gly Tyr Thr Val Ala Ser 6370 6375 6380 Ser Ala Gln Gln His Ser Leu Val Leu Leu Asp Val Gly Arg Gln His 6385 6390 6395 6400 Gln Gly Thr Tyr Thr Cys Ile Ala Ser Asn Ala Ala Gly Gln Ala Leu 6405 6410 6415 Cys Ser Ala Ser Leu His Val Ser Gly Leu Pro Lys Val Glu Glu Gln 6420 6425 6430 Glu Lys Val Lys Glu Ala Leu Ile Ser Thr Phe Leu Gln Gly Thr Thr 6435 6440 6445 Gln Ala Ile Ser Ala Gln Gly Leu Glu Thr Ala Ser Phe Ala Asp Leu 6450 6455 6460 Gly Gly Gln Arg Lys Glu Glu Pro Leu Ala Ala Lys Glu Ala Leu Gly 6465 6470 6475 6480 His Leu Ser Leu Ala Glu Val Gly Thr Glu Glu Phe Leu Gln Lys Leu 6485 6490 6495 Thr Ser Gln Ile Thr Glu Met Val Ser Ala Lys Ile Thr Gln Ala Lys 6500 6505 6510 Leu Gln Val Pro Gly Gly Asp Ser Asp Glu Asp Ser Lys Thr Pro Ser 6515 6520 6525 Ala Ser Pro Arg His Gly Arg Ser Arg Pro Ser Ser Ser Ile Gln Glu 6530 6535 6540 Ser Ser Ser Glu Ser Glu Asp Gly Asp Ala Arg Gly Glu Ile Phe Asp 6545 6550 6555 6560 Ile Tyr Val Val Thr Ala Asp Tyr Leu Pro Leu Gly Ala Glu Gln Asp 6565 6570 6575 Ala Ile Thr Leu Arg Glu Gly Gln Tyr Val Glu Val Leu Asp Ala Ala 6580 6585 6590 His Pro Leu Arg Trp Leu Val Arg Thr Lys Pro Thr Lys Ser Ser Pro 6595 6600 6605 Ser Arg Gln Gly Trp Val Ser Pro Ala Tyr Leu Asp Arg Arg Leu Lys 6610 6615 6620 Leu Ser Pro Glu Trp Gly Ala Ala Glu Ala Pro Glu Phe Pro Gly Glu 6625 6630 6635 6640 Ala Val Ser Glu Asp Glu Tyr Lys Ala Arg Leu Ser Ser Val Ile Gln 6645 6650 6655 Glu Leu Leu Ser Ser Glu Gln Ala Phe Val Glu Glu Leu Gln Phe Leu 6660 6665 6670 Gln Ser His His Leu Gln His Leu Glu Arg Cys Pro His Val Pro Ile 6675 6680 6685 Ala Val Ala Gly Gln Lys Ala Val Ile Phe Arg Asn Val Arg Asp Ile 6690 6695 6700 Gly Arg Phe His Ser Ser Phe Leu Gln Glu Leu Gln Gln Cys Asp Thr 6705 6710 6715 6720 Asp Asp Asp Val Ala Met Cys Phe Ile Lys Asn Gln Ala Ala Phe Glu 6725 6730 6735 Gln Tyr Leu Glu Phe Leu Val Gly Arg Val Gln Ala Glu Ser Val Val 6740 6745 6750 Val Ser Thr Ala Ile Gln Glu Phe Tyr Lys Lys Tyr Ala Glu Glu Ala 6755 6760 6765 Leu Leu Ala Gly Asp Pro Ser Gln Pro Pro Pro Pro Leu Gln His 6770 6775 6780 Tyr Leu Glu Gln Pro Val Glu Arg Val Gln Arg Tyr Gln Ala Leu Leu 6785 6790 6795 6800 Lys Glu Leu Ile Arg Asn Lys Ala Arg Asn Arg Gln Asn Cys Ala Leu 6805 6810 6815 Leu Glu Gln Ala Tyr Ala Val Val Ser Ala Leu Pro Gln Arg Ala Glu 6820 6825 6830 Asn Lys Leu His Val Ser Leu Met Glu Asn Tyr Pro Gly Thr Leu Gln 6835 6840 6845 Ala Leu Gly Glu Pro Ile Arg Gln Gly His Phe Ile Val Trp Glu Gly 6850 6855 6860 Ala Pro Gly Ala Arg Met Pro Trp Lys Gly His Asn Arg His Val Phe 6865 6870 6875 6880 Leu Phe Arg Asn His Leu Val Ile Cys Lys Pro Arg Arg Asp Ser Arg 6885 6890 6895 Thr Asp Thr Val Ser Tyr Val Phe Arg Asn Met Met Lys Leu Ser Ser 6900 6905 6910 Ile Asp Leu Asn Asp Gln Val Glu Gly Asp Asp Arg Ala Phe Glu Val 6915 6920 6925 Trp Gln Glu Arg Glu Asp Ser Val Arg Lys Tyr Leu Leu Gln Ala Arg 6930 6935 6940 Thr Ala Ile Ile Lys Ser Ser Trp Val Lys Glu Ile Cys Gly Ile Gln 6945 6950 6955 6960 Gln Arg Leu Ala Leu Pro Val Trp Arg Pro Pro Asp Phe Glu Glu Glu 6965 6970 6975 Leu Ala Asp Cys Thr Ala Glu Leu Gly Glu Thr Val Lys Leu Ala Cys 6980 6985 6990 Arg Val Thr Gly Thr Pro Lys Pro Val Ile Ser Trp Tyr Lys Asp Gly 6995 7000 7005 Lys Ala Val Gln Val Asp Pro His His Ile Leu Ile Glu Asp Pro Asp 7010 7015 7020 Gly Ser Cys Ala Leu Ile Leu Asp Ser Leu Thr Gly Val Asp Ser Gly 7025 7030 7035 7040 Gln Tyr Met Cys Phe Ala Ala Ser Ala Ala Gly Asn Cys Ser Thr Leu 7045 7050 7055 Gly Lys Ile Leu Val Gln Val Pro Pro Arg Phe Val Asn Lys Val Arg 7060 7065 7070 Ala Ser Pro Phe Val Glu Gly Glu Asp Ala Gln Phe Thr Cys Thr Ile 7075 7080 7085 Glu Gly Ala Pro Tyr Pro Gln Ile Arg Trp Tyr Lys Asp Gly Ala Leu 7090 7095 7100 Leu Thr Thr Gly Asn Lys Phe Gln Thr Leu Ser Glu Pro Arg Ser Gly 7105 7110 7115 7120 Leu Leu Val Leu Val Ile Arg Ala Ala Ser Lys Glu Asp Leu Gly Leu 7125 7130 7135 Tyr Glu Cys Glu Leu Val Asn Arg Leu Gly Ser Ala Arg Ala Ser Ala 7140 7145 7150 Glu Leu Arg Ile Gln Ser Pro Met Leu Gln Ala Gln Glu Gln Cys His 7155 7160 7165 Arg Glu Gln Leu Val Ala Ala Val Glu Asp Thr Thr Leu Glu Arg Ala 7170 7175 7180 Asp Gln Glu Val Thr Ser Val Leu Lys Arg Leu Leu Gly Pro Lys Ala 7185 7190 7195 7200 Pro Gly Pro Ser Thr Gly Asp Leu Thr Gly Pro Gly Pro Cys Pro Arg 7205 7210 7215 Gly Ala Pro Ala Leu Gln Glu Thr Gly Ser Gln Pro Pro Val Thr Gly 7220 7225 7230 Thr Ser Glu Ala Pro Ala Val Pro Pro Arg Val Pro Gln Pro Leu Leu 7235 7240 7245 His Glu Gly Pro Glu Gln Glu Pro Glu Ala Ile Ala Arg Ala Gln Glu 7250 7255 7260 Trp Thr Val Pro Ile Arg Met Glu Gly Ala Ala Trp Pro Gly Ala Gly 7265 7270 7275 7280 Thr Gly Glu Leu Leu Trp Asp Val His Ser His Val Val Arg Glu Thr 7285 7290 7295 Thr Gln Arg Thr Tyr Thr Tyr Gln Ala Ile Asp Thr His Thr Ala Arg 7300 7305 7310 Pro Pro Ser Met Gln Val Thr Ile Glu Asp Val Gln Ala Gln Thr Gly 7315 7320 7325 Gly Thr Ala Gln Phe Glu Ala Ile Ile Glu Gly Asp Pro Gln Pro Ser 7330 7335 7340 Val Thr Trp Tyr Lys Asp Ser Val Gln Leu Val Asp Ser Thr Arg Leu 7345 7350 7355 7360 Ser Gln Gln Gln Glu Gly Thr Thr Tyr Ser Leu Val Leu Arg His Val 7365 7370 7375 Ala Ser Lys Asp Ala Gly Val Tyr Thr Cys Leu Ala Gln Asn Thr Gly 7380 7385 7390 Gly Gln Val Leu Cys Lys Ala Glu Leu Leu Val Leu Gly Gly Asp Asn 7395 7400 7405 Glu Pro Asp Ser Glu Lys Gln Ser His Arg Arg Lys Leu His Ser Phe 7410 7415 7420 Tyr Glu Val Lys Glu Glu Ile Gly Arg Gly Val Phe Gly Phe Val Lys 7425 7430 7435 7440 Arg Val Gln His Lys Gly Asn Lys Ile Leu Cys Ala Ala Lys Phe Ile 7445 7450 7455 Pro Leu Arg Ser Arg Thr Arg Ala Gln Ala Tyr Arg Glu Arg Asp Ile 7460 7465 7470 Leu Ala Ala Leu Ser His Pro Leu Val Thr Gly Leu Leu Asp Gln Phe 7475 7480 7485 Glu Thr Arg Lys Thr Leu Ile Leu Ile Leu Glu Leu Cys Ser Ser Glu 7490 7495 7500 Glu Leu Leu Asp Arg Leu Tyr Arg Lys Gly Val Val Thr Glu Ala Glu 7505 7510 7515 7520 Val Lys Val Tyr Ile Gln Gln Leu Val Glu Gly Leu His Tyr Leu His 7525 7530 7535 Ser His Gly Val Leu His Leu Asp Ile Lys Pro Ser Asn Ile Leu Met 7540 7545 7550 Val His Pro Ala Arg Glu Asp Ile Lys Ile Cys Asp Phe Gly Phe Ala 7555 7560 7565 Gln Asn Ile Thr Pro Ala Glu Leu Gln Phe Ser Gln Tyr Gly Ser Pro 7570 7575 7580 Glu Phe Val Ser Pro Glu Ile Ile Gln Gln Asn Pro Val Ser Glu Ala 7585 7590 7595 7600 Ser Asp Ile Trp Ala Met Gly Val Ile Ser Tyr Leu Ser Leu Thr Cys 7605 7610 7615 Ser Ser Pro Phe Ala Gly Glu Ser Asp Arg Ala Thr Leu Leu Asn Val 7620 7625 7630 Leu Glu Gly Arg Val Ser Trp Ser Ser Pro Met Ala Ala His Leu Ser 7635 7640 7645 Glu Asp Ala Lys Asp Phe Ile Lys Ala Thr Leu Gln Arg Ala Pro Gln 7650 7655 7660 Ala Arg Pro Ser Ala Ala Gln Cys Leu Ser His Pro Trp Phe Leu Lys 7665 7670 7675 7680 Ser Met Pro Ala Glu Glu Ala His Phe Ile Asn Thr Lys Gln Leu Lys 7685 7690 7695 Phe Leu Leu Ala Arg Ser Arg Trp Gln Arg Ser Leu Met Ser Tyr Lys 7700 7705 7710 Ser Ile Leu Val Met Arg Ser Ile Pro Glu Leu Leu Arg Gly Pro Pro 7715 7720 7725 Asp Ser Pro Ser Leu Gly Val Ala Arg His Leu Cys Arg Asp Thr Gly 7730 7735 7740 Gly Ser Ser Ser Ser Ser Ser Ser Ser Asp Asn Glu Leu Ala Pro Phe 7745 7750 7755 7760 Ala Arg Ala Lys Ser Leu Pro Pro Ser Pro Val Thr His Ser Pro Leu 7765 7770 7775 Leu His Pro Arg Gly Phe Leu Arg Pro Ser Ala Ser Leu Pro Glu Glu 7780 7785 7790 Ala Glu Ala Ser Glu Arg Ser Thr Glu Ala Pro Ala Pro Pro Ala Ser 7795 7800 7805 Pro Glu Gly Ala Gly Pro Pro Ala Ala Gln Gly Cys Val Pro Arg His 7810 7815 7820 Ser Val Ile Arg Ser Leu Phe Tyr His Gln Ala Gly Glu Ser Pro Glu 7825 7830 7835 7840 His Gly Ala Leu Ala Pro Gly Ser Arg Arg His Pro Ala Arg Arg Arg 7845 7850 7855 His Leu Leu Lys Gly Gly Tyr Ile Ala Gly Ala Leu Pro Gly Leu Arg 7860 7865 7870 Glu Pro Leu Met Glu His Arg Val Leu Glu Glu Glu Ala Ala Arg Glu 7875 7880 7885 Glu Gln Ala Thr Leu Leu Ala Lys Ala Pro Ser Phe Glu Thr Ala Leu 7890 7895 7900 Arg Leu Pro Ala Ser Gly Thr His Leu Ala Pro Gly His Ser His Ser 7905 7910 7915 7920 Leu Glu His Asp Ser Pro Ser Thr Pro Arg Pro Ser Ser Glu Ala Cys 7925 7930 7935 Gly Glu Ala Gln Arg Leu Pro Ser Ala Pro Ser Gly Gly Ala Pro Ile 7940 7945 7950 Arg Asp Met Gly His Pro Gln Gly Ser Lys Gln Leu Pro Ser Thr Gly 7955 7960 7965 Gly His Pro Gly Thr Ala Gln Pro Glu Arg Pro Ser Pro Asp Ser Pro 7970 7975 7980 Trp Gly Gln Pro Ala Pro Phe Cys His Pro Lys Gln Gly Ser Ala Pro 7985 7990 7995 8000 Gln Glu Gly Cys Ser Pro His Pro Ala Val Ala Pro Cys Pro Pro Gly 8005 8010 8015 Ser Phe Pro Pro Gly Ser Cys Lys Glu Ala Pro Leu Val Pro Ser Ser 8020 8025 8030 Pro Phe Leu Gly Gln Pro Gln Ala Pro Pro Ala Pro Ala Lys Ala Ser 8035 8040 8045 Pro Pro Leu Asp Ser Lys Met Gly Pro Gly Asp Ile Ser Leu Pro Gly 8050 8055 8060 Arg Pro Lys Pro Gly Pro Cys Ser Ser Pro Gly Ser Ala Ser Gln Ala 8065 8070 8075 8080 Ser Ser Ser Gln Val Ser Ser Leu Arg Val Gly Ser Ser Gln Val Gly 8085 8090 8095 Thr Glu Pro Gly Pro Ser Leu Asp Ala Glu Gly Trp Thr Gln Glu Ala 8100 8105 8110 Glu Asp Leu Ser Asp Ser Thr Pro Thr Leu Gln Arg Pro Gln Glu Gln 8115 8120 8125 Ala Thr Met Arg Lys Phe Ser Leu Gly Gly Arg Gly Gly Tyr Ala Gly 8130 8135 8140 Val Ala Gly Tyr Gly Thr Phe Ala Phe Gly Gly Asp Ala Gly Gly Met 8145 8150 8155 8160 Leu Gly Gln Gly Pro Met Trp Ala Arg Ile Ala Trp Ala Val Ser Gln 8165 8170 8175 Ser Glu Glu Glu Glu Gln Glu Glu Ala Arg Ala Glu Ser Gln Ser Glu 8180 8185 8190 Glu Gln Gln Glu Ala Arg Ala Glu Ser Pro Leu Pro Gln Val Ser Ala 8195 8200 8205 Arg Pro Val Pro Glu Val Gly Arg Ala Pro Thr Arg Ser Ser Pro Glu 8210 8215 8220 Pro Thr Pro Trp Glu Asp Ile Gly Gln Val Ser Leu Val Gln Ile Arg 8225 8230 8235 8240 Asp Leu Ser Gly Asp Ala Glu Ala Ala Asp Thr Ile Ser Leu Asp Ile 8245 8250 8255 Ser Glu Val Asp Pro Ala Tyr Leu Asn Leu Ser Asp Leu Tyr Asp Ile 8260 8265 8270 Lys Tyr Leu Pro Phe Glu Phe Met Ile Phe Arg Lys Val Pro Lys Ser 8275 8280 8285 Ala Gln Pro Glu Pro Pro Ser Pro Met Ala Glu Glu Glu Leu Ala Glu 8290 8295 8300 Phe Pro Glu Pro Thr Trp Pro Trp Pro Gly Glu Leu Gly Pro His Ala 8305 8310 8315 8320 Gly Leu Glu Ile Thr Glu Glu Ser Glu Asp Val Asp Ala Leu Leu Ala 8325 8330 8335 Glu Ala Ala Val Gly Arg Lys Arg Lys Trp Ser Ser Pro Ser Arg Ser 8340 8345 8350 Leu Phe His Phe Pro Gly Arg His Leu Pro Leu Asp Glu Pro Ala Glu 8355 8360 8365 Leu Gly Leu Arg Glu Arg Val Lys Ala Ser Val Glu His Ile Ser Arg 8370 8375 8380 Ile Leu Lys Gly Arg Pro Glu Gly Leu Glu Lys Glu Gly Pro Pro Arg 8385 8390 8395 8400 Lys Lys Pro Gly Leu Ala Ser Phe Arg Leu Ser Gly Leu Lys Ser Trp 8405 8410 8415 Asp Arg Ala Pro Thr Phe Leu Arg Glu Leu Ser Asp Glu Thr Val Val 8420 8425 8430 Leu Gly Gln Ser Val Thr Leu Ala Cys Gln Val Ser Ala Gln Pro Ala 8435 8440 8445 Ala Gln Ala Thr Trp Ser Lys Asp Gly Ala Pro Leu Glu Ser Ser Ser 8450 8455 8460 Arg Val Leu Ile Ser Ala Thr Leu Lys Asn Phe Gln Leu Leu Thr Ile 8465 8470 8475 8480 Leu Val Val Val Ala Glu Asp Leu Gly Val Tyr Thr Cys Ser Val Ser 8485 8490 8495 Asn Ala Leu Gly Thr Val Thr Thr Thr Gly Val Leu Arg Lys Ala Glu 8500 8505 8510 Arg Pro Ser Ser Ser Pro Cys Pro Asp Ile Gly Glu Val Tyr Ala Asp 8515 8520 8525 Gly Val Leu Leu Val Trp Lys Pro Val Glu Ser Tyr Gly Pro Val Thr 8530 8535 8540 Tyr Ile Val Gln Cys Ser Leu Glu Gly Gly Ser Trp Thr Thr Leu Ala 8545 8550 8555 8560 Ser Asp Ile Phe Asp Cys Cys Tyr Leu Thr Ser Lys Leu Ser Arg Gly 8565 8570 8575 Gly Thr Tyr Thr Phe Arg Thr Ala Cys Val Ser Lys Ala Gly Met Gly 8580 8585 8590 Pro Tyr Ser Ser Pro Ser Glu Gln Val Leu Leu Gly Gly Pro Ser His 8595 8600 8605 Leu Ala Ser Glu Glu Glu Ser Gln Gly Arg Ser Ala Gln Pro Leu Pro 8610 8615 8620 Ser Thr Lys Thr Phe Ala Phe Gln Thr Gln Ile Gln Arg Gly Arg Phe 8625 8630 8635 8640 Ser Val Val Arg Gln Cys Trp Glu Lys Ala Ser Gly Arg Ala Leu Ala 8645 8650 8655 Ala Lys Ile Ile Pro Tyr His Pro Lys Asp Lys Thr Ala Val Leu Arg 8660 8665 8670 Glu Tyr Glu Ala Leu Lys Gly Leu Arg His Pro His Leu Ala Gln Leu 8675 8680 8685 His Ala Ala Tyr Leu Ser Pro Arg His Leu Val Leu Ile Leu Glu Leu 8690 8695 8700 Cys Ser Gly Pro Glu Leu Leu Pro Cys Leu Ala Glu Arg Ala Ser Tyr 8705 8710 8715 8720 Ser Glu Ser Glu Val Lys Asp Tyr Leu Trp Gln Met Leu Ser Ala Thr 8725 8730 8735 Gln Tyr Leu His Asn Gln His Ile Leu His Leu Asp Leu Arg Ser Glu 8740 8745 8750 Asn Met Ile Ile Thr Glu Tyr Asn Leu Leu Lys Val Val Asp Leu Gly 8755 8760 8765 Asn Ala Gln Ser Leu Ser Gln Glu Lys Val Leu Pro Ser Asp Lys Phe 8770 8775 8780 Lys Asp Tyr Leu Glu Thr Met Glu Leu Leu Glu Gly Gln Gly Ala Val 8785 8790 8795 8800 Pro Gln Thr Asp Ile Trp Ala Ile Gly Val Thr Ala Phe Ile Met Leu 8805 8810 8815 Ser Ala Glu Tyr Pro Val Ser Ser Glu Gly Ala Arg Asp Leu Gln Arg 8820 8825 8830 Gly Leu Arg Lys Gly Leu Val Arg Leu Ser Arg Cys Tyr Ala Gly Leu 8835 8840 8845 Ser Gly Gly Ala Val Ala Phe Leu Arg Ser Thr Leu Cys Ala Gln Pro 8850 8855 8860 Trp Gly Arg Pro Cys Ala Ser Ser Cys Leu Gln Cys Pro Trp Leu Thr 8865 8870 8875 8880 Glu Glu Gly Pro Ala Cys Ser Arg Pro Ala Pro Val Thr Phe Pro Thr 8885 8890 8895 Ala Arg Leu Arg Val Phe Val Arg Asn Arg Glu Lys Arg Arg Ala Leu 8900 8905 8910 Leu Tyr Lys Arg His Asn Leu Ala Gln Val Arg 8915 8920 <210> 18 <211> 1046 <212> PRT <213> Homo sapiens <400> 18 Met Ala Ser Ser Val Gly Asn Val Ala Asp Ser Thr Glu Pro Thr Lys 1 5 10 15 Arg Met Leu Ser Phe Gln Gly Leu Ala Glu Leu Ala His Arg Glu Tyr 20 25 30 Gln Ala Gly Asp Phe Glu Ala Ala Glu Arg His Cys Met Gln Leu Trp 35 40 45 Arg Gln Glu Pro Asp Asn Thr Gly Val Leu Leu Leu Leu Leu Ser Ser Ile 50 55 60 His Phe Gln Cys Arg Arg Leu Asp Arg Ser Ala His Phe Ser Thr Leu 65 70 75 80 Ala Ile Lys Gln Asn Pro Leu Leu Ala Glu Ala Tyr Ser Asn Leu Gly 85 90 95 Asn Val Tyr Lys Glu Arg Gly Gln Leu Gln Glu Ala Ile Glu His Tyr 100 105 110 Arg His Ala Leu Arg Leu Lys Pro Asp Phe Ile Asp Gly Tyr Ile Asn 115 120 125 Leu Ala Ala Ala Leu Val Ala Ala Gly Asp Met Glu Gly Ala Val Gln 130 135 140 Ala Tyr Val Ser Ala Leu Gln Tyr Asn Pro Asp Leu Tyr Cys Val Arg 145 150 155 160 Ser Asp Leu Gly Asn Leu Leu Lys Ala Leu Gly Arg Leu Glu Glu Ala 165 170 175 Lys Ala Cys Tyr Leu Lys Ala Ile Glu Thr Gln Pro Asn Phe Ala Val 180 185 190 Ala Trp Ser Asn Leu Gly Cys Val Phe Asn Ala Gln Gly Glu Ile Trp 195 200 205 Leu Ala Ile His His Phe Glu Lys Ala Val Thr Leu Asp Pro Asn Phe 210 215 220 Leu Asp Ala Tyr Ile Asn Leu Gly Asn Val Leu Lys Glu Ala Arg Ile 225 230 235 240 Phe Asp Arg Ala Val Ala Ala Tyr Leu Arg Ala Leu Ser Leu Ser Pro 245 250 255 Asn His Ala Val Val His Gly Asn Leu Ala Cys Val Tyr Tyr Glu Gln 260 265 270 Gly Leu Ile Asp Leu Ala Ile Asp Thr Tyr Arg Arg Ala Ile Glu Leu 275 280 285 Gln Pro His Phe Pro Asp Ala Tyr Cys Asn Leu Ala Asn Ala Leu Lys 290 295 300 Glu Lys Gly Ser Val Ala Glu Ala Glu Asp Cys Tyr Asn Thr Ala Leu 305 310 315 320 Arg Leu Cys Pro Thr His Ala Asp Ser Leu Asn Asn Leu Ala Asn Ile 325 330 335 Lys Arg Glu Gln Gly Asn Ile Glu Glu Ala Val Arg Leu Tyr Arg Lys 340 345 350 Ala Leu Glu Val Phe Pro Glu Phe Ala Ala Ala His Ser Asn Leu Ala 355 360 365 Ser Val Leu Gln Gln Gln Gly Lys Leu Gln Glu Ala Leu Met His Tyr 370 375 380 Lys Glu Ala Ile Arg Ile Ser Pro Thr Phe Ala Asp Ala Tyr Ser Asn 385 390 395 400 Met Gly Asn Thr Leu Lys Glu Met Gln Asp Val Gln Gly Ala Leu Gln 405 410 415 Cys Tyr Thr Arg Ala Ile Gln Ile Asn Pro Ala Phe Ala Asp Ala His 420 425 430 Ser Asn Leu Ala Ser Ile His Lys Asp Ser Gly Asn Ile Pro Glu Ala 435 440 445 Ile Ala Ser Tyr Arg Thr Ala Leu Lys Leu Lys Pro Asp Phe Pro Asp 450 455 460 Ala Tyr Cys Asn Leu Ala His Cys Leu Gln Ile Val Cys Asp Trp Thr 465 470 475 480 Asp Tyr Asp Glu Arg Met Lys Lys Leu Val Ser Ile Val Ala Asp Gln 485 490 495 Leu Glu Lys Asn Arg Leu Pro Ser Val His Pro His His Ser Met Leu 500 505 510 Tyr Pro Leu Ser His Gly Phe Arg Lys Ala Ile Ala Glu Arg His Gly 515 520 525 Asn Leu Cys Leu Asp Lys Ile Asn Val Leu His Lys Pro Pro Tyr Glu 530 535 540 His Pro Lys Asp Leu Lys Leu Ser Asp Gly Arg Leu Arg Val Gly Tyr 545 550 555 560 Val Ser Ser Asp Phe Gly Asn His Pro Thr Ser His Leu Met Gln Ser 565 570 575 Ile Pro Gly Met His Asn Pro Asp Lys Phe Glu Val Phe Cys Tyr Ala 580 585 590 Leu Ser Pro Asp Asp Gly Thr Asn Phe Arg Val Lys Val Met Ala Glu 595 600 605 Ala Asn His Phe Ile Asp Leu Ser Gln Ile Pro Cys Asn Gly Lys Ala 610 615 620 Ala Asp Arg Ile His Gln Asp Gly Ile His Ile Leu Val Asn Met Asn 625 630 635 640 Gly Tyr Thr Lys Gly Ala Arg Asn Glu Leu Phe Ala Leu Arg Pro Ala 645 650 655 Pro Ile Gln Ala Met Trp Leu Gly Tyr Pro Gly Thr Ser Gly Ala Leu 660 665 670 Phe Met Asp Tyr Ile Ile Thr Asp Gln Glu Thr Ser Pro Ala Glu Val 675 680 685 Ala Glu Gln Tyr Ser Glu Lys Leu Ala Tyr Met Pro His Thr Phe Phe 690 695 700 Ile Gly Asp His Ala Asn Met Phe Pro His Leu Lys Lys Lys Ala Val 705 710 715 720 Ile Asp Phe Lys Ser Asn Gly His Ile Tyr Asp Asn Arg Ile Val Leu 725 730 735 Asn Gly Ile Asp Leu Lys Ala Phe Leu Asp Ser Leu Pro Asp Val Lys 740 745 750 Ile Val Lys Met Lys Cys Pro Asp Gly Gly Asp Asn Ala Asp Ser Ser 755 760 765 Asn Thr Ala Leu Asn Met Pro Val Ile Pro Met Asn Thr Ile Ala Glu 770 775 780 Ala Val Ile Glu Met Ile Asn Arg Gly Gln Ile Gln Ile Thr Ile Asn 785 790 795 800 Gly Phe Ser Ile Ser Asn Gly Leu Ala Thr Thr Gln Ile Asn Asn Lys 805 810 815 Ala Ala Thr Gly Glu Glu Val Pro Arg Thr Ile Ile Val Thr Thr Arg 820 825 830 Ser Gln Tyr Gly Leu Pro Glu Asp Ala Ile Val Tyr Cys Asn Phe Asn 835 840 845 Gln Leu Tyr Lys Ile Asp Pro Ser Thr Leu Gln Met Trp Ala Asn Ile 850 855 860 Leu Lys Arg Val Pro Asn Ser Val Leu Trp Leu Leu Arg Phe Pro Ala 865 870 875 880 Val Gly Glu Pro Asn Ile Gln Gln Tyr Ala Gln Asn Met Gly Leu Pro 885 890 895 Gln Asn Arg Ile Ile Phe Ser Pro Val Ala Pro Lys Glu Glu His Val 900 905 910 Arg Arg Gly Gln Leu Ala Asp Val Cys Leu Asp Thr Pro Leu Cys Asn 915 920 925 Gly His Thr Thr Gly Met Asp Val Leu Trp Ala Gly Thr Pro Met Val 930 935 940 Thr Met Pro Gly Glu Thr Leu Ala Ser Arg Val Ala Ala Ser Gln Leu 945 950 955 960 Thr Cys Leu Gly Cys Leu Glu Leu Ile Ala Lys Asn Arg Gln Glu Tyr 965 970 975 Glu Asp Ile Ala Val Lys Leu Gly Thr Asp Leu Glu Tyr Leu Lys Lys 980 985 990 Val Arg Gly Lys Val Trp Lys Gln Arg Ile Ser Ser Pro Leu Phe Asn 995 1000 1005 Thr Lys Gln Tyr Thr Met Glu Leu Glu Arg Leu Tyr Leu Gln Met Trp 1010 1015 1020 Glu His Tyr Ala Ala Gly Asn Lys Pro Asp His Met Ile Lys Pro Val 1025 1030 1035 1040 Glu Val Thr Glu Ser Ala 1045 <210> 19 <211> 301 <212> PRT <213> Homo sapiens <400> 19 Met Glu Phe Val Leu Leu Gly Phe Ser Asp Ile Pro Asn Leu His Trp 1 5 10 15 Met Leu Phe Ser Ile Phe Leu Leu Met Tyr Leu Met Ile Leu Met Cys 20 25 30 Asn Gly Ile Ile Ile Leu Leu Ile Lys Ile His Pro Ala Leu Gln Thr 35 40 45 Pro Met Tyr Phe Phe Leu Ser Asn Phe Ser Leu Leu Glu Ile Cys Tyr 50 55 60 Val Thr Ile Ile Ile Pro Arg Met Leu Met Asp Ile Trp Thr Gln Lys 65 70 75 80 Gly Asn Ile Ser Leu Phe Ala Cys Ala Thr Gln Met Cys Phe Phe Leu 85 90 95 Met Leu Gly Gly Thr Glu Cys Leu Leu Leu Thr Val Met Ala Tyr Asp 100 105 110 Arg Tyr Val Ala Ile Cys Lys Pro Leu Gln Tyr Pro Leu Val Met Asn 115 120 125 His Lys Val Cys Ile Gln Leu Ile Ile Ala Ser Trp Thr Ile Thr Ile 130 135 140 Pro Val Val Ile Gly Glu Thr Cys Gln Ile Phe Leu Leu Pro Phe Cys 145 150 155 160 Gly Thr Asn Thr Ile Asn His Phe Phe Cys Asp Ile Pro Ile Leu 165 170 175 Lys Leu Ala Cys Gly Asn Ile Phe Val Asn Glu Ile Thr Val His Val 180 185 190 Val Ala Val Val Phe Ile Thr Val Pro Phe Leu Leu Ile Val Val Ser 195 200 205 Tyr Gly Lys Ile Ile Ser Asn Ile Leu Lys Leu Ser Ser Ala Arg Gly 210 215 220 Lys Ala Lys Ala Phe Ser Thr Cys Ser Ser His Leu Ile Val Val Ile 225 230 235 240 Leu Phe Phe Gly Ala Gly Thr Ile Thr Tyr Leu Gln Pro Lys Pro His 245 250 255 Gln Phe Gln Arg Met Gly Lys Leu Ile Ser Leu Phe Tyr Thr Ile Leu 260 265 270 Ile Pro Thr Leu Asn Pro Ile Ile Tyr Thr Leu Arg Asn Lys Asp Ile 275 280 285 Met Val Ala Leu Arg Lys Leu Leu Ala Lys Leu Leu Thr 290 295 300 <210> 20 <211> 569 <212> PRT <213> Homo sapiens <400> 20 Met Gly Ser Ala Val Met Asp Thr Lys Lys Lys Lys Asp Val Ser Ser 1 5 10 15 Pro Gly Gly Ser Gly Gly Lys Lys Asn Ala Ser Gln Lys Arg Arg Ser 20 25 30 Leu Arg Val His Ile Pro Asp Leu Ser Ser Phe Ala Met Pro Leu Leu 35 40 45 Asp Gly Asp Leu Glu Gly Ser Gly Lys His Ser Ser Arg Lys Val Asp 50 55 60 Ser Pro Phe Gly Pro Gly Ser Pro Ser Lys Gly Phe Phe Ser Arg Gly 65 70 75 80 Pro Gln Pro Arg Pro Ser Ser Pro Met Ser Ala Pro Val Arg Pro Lys 85 90 95 Thr Ser Pro Gly Ser Pro Lys Thr Val Phe Pro Phe Ser Tyr Gln Glu 100 105 110 Ser Pro Pro Arg Ser Pro Arg Arg Met Ser Phe Ser Gly Ile Phe Arg 115 120 125 Ser Ser Ser Lys Glu Ser Ser Pro Asn Ser Asn Pro Ala Thr Ser Pro 130 135 140 Gly Gly Ile Arg Phe Phe Ser Arg Ser Arg Lys Thr Ser Gly Leu Ser 145 150 155 160 Ser Ser Pro Ser Thr Pro Thr Gln Val Thr Lys Gln His Thr Phe Pro 165 170 175 Leu Glu Ser Tyr Lys His Glu Pro Glu Arg Leu Glu Asn Arg Ile Tyr 180 185 190 Ala Ser Ser Ser Pro Pro Asp Thr Gly Gln Arg Phe Cys Pro Ser Ser 195 200 205 Phe Gln Ser Pro Thr Arg Pro Pro Leu Ala Ser Pro Thr His Tyr Ala 210 215 220 Pro Ser Lys Ala Ala Ala Leu Ala Ala Ala Leu Gly Pro Ala Glu Ala 225 230 235 240 Gly Met Leu Glu Lys Leu Glu Phe Glu Asp Glu Ala Val Glu Asp Ser 245 250 255 Glu Ser Gly Val Tyr Met Arg Phe Met Arg Ser His Lys Cys Tyr Asp 260 265 270 Ile Val Pro Thr Ser Ser Lys Leu Val Val Phe Asp Thr Thr Leu Gln 275 280 285 Val Lys Lys Ala Phe Phe Ala Leu Val Ala Asn Gly Val Arg Ala Ala 290 295 300 Pro Leu Trp Glu Ser Lys Lys Gln Ser Phe Val Gly Met Leu Thr Ile 305 310 315 320 Thr Asp Phe Ile Asn Ile Leu His Arg Tyr Tyr Lys Ser Pro Met Val 325 330 335 Gln Ile Tyr Glu Leu Glu Glu His Lys Ile Glu Thr Trp Arg Glu Leu 340 345 350 Tyr Leu Gln Glu Thr Phe Lys Pro Leu Val Asn Ile Ser Pro Asp Ala 355 360 365 Ser Leu Phe Asp Ala Val Tyr Ser Leu Ile Lys Asn Lys Ile His Arg 370 375 380 Leu Pro Val Ile Asp Pro Ile Ser Gly Asn Ala Leu Tyr Ile Leu Thr 385 390 395 400 His Lys Arg Ile Leu Lys Phe Leu Gln Leu Phe Met Ser Asp Met Pro 405 410 415 Lys Pro Ala Phe Met Lys Gln Asn Leu Asp Glu Leu Gly Ile Gly Thr 420 425 430 Tyr His Asn Ile Ala Phe Ile His Pro Asp Thr Pro Ile Ile Lys Ala 435 440 445 Leu Asn Ile Phe Val Glu Arg Arg Ile Ser Ala Leu Pro Val Val Asp 450 455 460 Glu Ser Gly Lys Val Val Asp Ile Tyr Ser Lys Phe Asp Val Ile Asn 465 470 475 480 Leu Ala Ala Glu Lys Thr Tyr Asn Asn Leu Asp Ile Thr Val Thr Gln 485 490 495 Ala Leu Gln His Arg Ser Gln Tyr Phe Glu Gly Val Val Lys Cys Asn 500 505 510 Lys Leu Glu Ile Leu Glu Thr Ile Val Asp Arg Ile Val Arg Ala Glu 515 520 525 Val His Arg Leu Val Val Val Asn Glu Ala Asp Ser Ile Val Gly Ile 530 535 540 Ile Ser Leu Ser Asp Ile Leu Gln Ala Leu Ile Leu Thr Pro Ala Gly 545 550 555 560 Ala Lys Gln Lys Glu Thr Glu Thr Glu 565 <210> 21 <211> 737 <212> PRT <213> Homo sapiens <400> 21 Met Pro Asp His Asp Ser Thr Ala Leu Leu Ser Arg Gln Thr Lys Arg 1 5 10 15 Arg Arg Val Asp Ile Gly Val Lys Arg Thr Val Gly Thr Ala Ser Ala 20 25 30 Phe Phe Ala Lys Ala Arg Ala Thr Phe Phe Ser Ala Met Asn Pro Gln 35 40 45 Gly Ser Glu Gln Asp Val Glu Tyr Ser Val Val Gln His Ala Asp Gly 50 55 60 Glu Lys Ser Asn Val Leu Arg Lys Leu Leu Lys Arg Ala Asn Ser Tyr 65 70 75 80 Glu Asp Ala Met Met Pro Phe Pro Gly Ala Thr Ile Ile Ser Gln Leu 85 90 95 Leu Lys Asn Asn Met Asn Lys Asn Gly Gly Thr Glu Pro Ser Phe Gln 100 105 110 Ala Ser Gly Leu Ser Ser Thr Gly Ser Glu Val His Gln Glu Asp Ile 115 120 125 Cys Ser Asn Ser Ser Arg Asp Ser Pro Pro Glu Cys Leu Ser Pro Phe 130 135 140 Gly Arg Pro Thr Met Ser Gln Phe Asp Met Asp Arg Leu Cys Asp Glu 145 150 155 160 His Leu Arg Ala Lys Arg Ala Arg Val Glu Asn Ile Ile Arg Gly Met 165 170 175 Ser His Ser Pro Ser Val Ala Leu Arg Gly Asn Glu Asn Glu Arg Glu 180 185 190 Met Ala Pro Gln Ser Val Ser Pro Arg Glu Ser Tyr Arg Glu Asn Lys 195 200 205 Arg Lys Gln Lys Leu Pro Gln Gln Gln Gln Gln Ser Phe Gln Gln Leu 210 215 220 Val Ser Ala Arg Lys Glu Gln Lys Arg Glu Glu Arg Arg Gln Leu Lys 225 230 235 240 Gln Gln Leu Glu Asp Met Gln Lys Gln Leu Arg Gln Leu Gln Glu Lys 245 250 255 Phe Tyr Gln Ile Tyr Asp Ser Thr Asp Ser Glu Asn Asp Glu Asp Gly 260 265 270 Asn Leu Ser Glu Asp Ser Met Arg Ser Glu Ile Leu Asp Ala Arg Ala 275 280 285 Gln Asp Ser Val Gly Arg Ser Asp Asn Glu Met Cys Glu Leu Asp Pro 290 295 300 Gly Gln Phe Ile Asp Arg Ala Arg Ala Leu Ile Arg Glu Gln Glu Met 305 310 315 320 Ala Glu Asn Lys Pro Lys Arg Glu Gly Asn Asn Lys Glu Arg Asp His 325 330 335 Gly Pro Asn Ser Leu Gln Pro Glu Gly Lys His Leu Ala Glu Thr Leu 340 345 350 Lys Gln Glu Leu Asn Thr Ala Met Ser Gln Val Val Asp Thr Val Val 355 360 365 Lys Val Phe Ser Ala Lys Pro Ser Arg Gln Val Pro Gln Val Phe Pro 370 375 380 Pro Leu Gln Ile Pro Gln Ala Arg Phe Ala Val Asn Gly Glu Asn His 385 390 395 400 Asn Phe His Thr Ala Asn Gln Arg Leu Gln Cys Phe Gly Asp Val Ile 405 410 415 Ile Pro Asn Pro Leu Asp Thr Phe Gly Asn Val Gln Met Ala Ser Ser 420 425 430 Thr Asp Gln Thr Glu Ala Leu Pro Leu Val Val Arg Lys Asn Ser Ser 435 440 445 Asp Gln Ser Ala Ser Gly Pro Ala Ala Gly Gly His His Gln Pro Leu 450 455 460 His Gln Ser Pro Leu Ser Ala Thr Thr Gly Phe Thr Thr Ser Thr Phe 465 470 475 480 Arg His Pro Phe Pro Leu Pro Leu Met Ala Tyr Pro Phe Gln Ser Pro 485 490 495 Leu Gly Ala Pro Ser Gly Ser Phe Ser Gly Lys Asp Arg Ala Ser Pro 500 505 510 Glu Ser Leu Asp Leu Thr Arg Asp Thr Thr Ser Leu Arg Thr Lys Met 515 520 525 Ser Ser His His Leu Ser His His Pro Cys Ser Pro Ala His Pro Pro 530 535 540 Ser Thr Ala Glu Gly Leu Ser Leu Ser Leu Ile Lys Ser Glu Cys Gly 545 550 555 560 Asp Leu Gln Asp Met Ser Glu Ile Ser Pro Tyr Ser Gly Ser Ala Met 565 570 575 Gln Glu Gly Leu Ser Pro Asn His Leu Lys Lys Ala Lys Leu Met Phe 580 585 590 Phe Tyr Thr Arg Tyr Pro Ser Ser Asn Met Leu Lys Thr Tyr Phe Ser 595 600 605 Asp Val Lys Phe Asn Arg Cys Ile Thr Ser Gln Leu Ile Lys Trp Phe 610 615 620 Ser Asn Phe Arg Glu Phe Tyr Tyr Ile Gln Met Glu Lys Tyr Ala Arg 625 630 635 640 Gln Ala Ile Asn Asp Gly Val Thr Ser Thr Glu Glu Leu Ser Ile Thr 645 650 655 Arg Asp Cys Glu Leu Tyr Arg Ala Leu Asn Met His Tyr Asn Lys Ala 660 665 670 Asn Asp Phe Glu Val Pro Glu Arg Phe Leu Glu Val Ala Gln Ile Thr 675 680 685 Leu Arg Glu Phe Phe Asn Ala Ile Ile Ala Gly Lys Asp Val Asp Pro 690 695 700 Ser Trp Lys Lys Ala Ile Tyr Lys Val Ile Cys Lys Leu Asp Ser Glu 705 710 715 720 Val Pro Glu Ile Phe Lys Ser Pro Asn Cys Leu Gln Glu Leu Leu His 725 730 735 Glu <210> 22 <211> 1446 <212> PRT <213> Homo sapiens <400> 22 Met Ala Arg Ala Gln Ala Leu Val Leu Ala Leu Thr Phe Gln Leu Cys 1 5 10 15 Ala Pro Glu Thr Glu Thr Pro Ala Ala Gly Cys Thr Phe Glu Glu Ala 20 25 30 Ser Asp Pro Ala Val Pro Cys Glu Tyr Ser Gln Ala Gln Tyr Asp Asp 35 40 45 Phe Gln Trp Glu Gln Val Arg Ile His Pro Gly Thr Arg Ala Pro Ala 50 55 60 Asp Leu Pro His Gly Ser Tyr Leu Met Val Asn Thr Ser Gln His Ala 65 70 75 80 Pro Gly Gln Arg Ala His Val Ile Phe Gln Ser Leu Ser Glu Asn Asp 85 90 95 Thr His Cys Val Gln Phe Ser Tyr Phe Leu Tyr Ser Arg Asp Gly His 100 105 110 Ser Pro Gly Thr Leu Gly Val Tyr Val Arg Val Asn Gly Gly Pro Leu 115 120 125 Gly Ser Ala Val Trp Asn Met Thr Gly Ser His Gly Arg Gln Trp His 130 135 140 Gln Ala Glu Leu Ala Val Ser Thr Phe Trp Pro Asn Glu Tyr Gln Val 145 150 155 160 Leu Phe Glu Ala Leu Ile Ser Pro Asp Arg Arg Gly Tyr Met Gly Leu 165 170 175 Asp Asp Ile Leu Leu Leu Ser Tyr Pro Cys Ala Lys Ala Pro His Phe 180 185 190 Ser Arg Leu Gly Asp Val Glu Val Asn Ala Gly Gln Asn Ala Ser Phe 195 200 205 Gln Cys Met Ala Ala Gly Arg Ala Ala Glu Ala Glu Arg Phe Leu Leu 210 215 220 Gln Arg Gln Ser Gly Ala Leu Val Pro Ala Ala Gly Val Arg His Ile 225 230 235 240 Ser His Arg Arg Phe Leu Ala Thr Phe Pro Leu Ala Ala Val Ser Arg 245 250 255 Ala Glu Gln Asp Leu Tyr Arg Cys Val Ser Gln Ala Pro Arg Gly Ala 260 265 270 Gly Val Ser Asn Phe Ala Glu Leu Ile Val Lys Glu Pro Pro Thr Pro 275 280 285 Ile Ala Pro Pro Gln Leu Leu Arg Ala Gly Pro Thr Tyr Leu Ile Ile 290 295 300 Gln Leu Asn Thr Asn Ser Ile Ile Gly Asp Gly Pro Ile Val Arg Lys 305 310 315 320 Glu Ile Glu Tyr Arg Met Ala Arg Gly Pro Trp Ala Glu Val His Ala 325 330 335 Val Ser Leu Gln Thr Tyr Lys Leu Trp His Leu Asp Pro Asp Thr Glu 340 345 350 Tyr Glu Ile Ser Val Leu Leu Thr Arg Pro Gly Asp Gly Gly Thr Gly 355 360 365 Arg Pro Gly Pro Pro Leu Ile Ser Arg Thr Lys Cys Ala Glu Pro Met 370 375 380 Arg Ala Pro Lys Gly Leu Ala Phe Ala Glu Ile Gln Ala Arg Gln Leu 385 390 395 400 Thr Leu Gln Trp Glu Pro Leu Gly Tyr Asn Val Thr Arg Cys His Thr 405 410 415 Tyr Thr Val Ser Leu Cys Tyr His Tyr Thr Leu Gly Ser Ser His Asn 420 425 430 Gln Thr Ile Arg Glu Cys Val Lys Thr Glu Gin Gly Val Ser Arg Tyr 435 440 445 Thr Ile Lys Asn Leu Leu Pro Tyr Arg Asn Val His Val Arg Leu Val 450 455 460 Leu Thr Asn Pro Glu Gly Arg Lys Glu Gly Lys Glu Val Thr Phe Gln 465 470 475 480 Thr Asp Glu Asp Val Pro Ser Gly Ile Ala Ala Glu Ser Leu Thr Phe 485 490 495 Thr Pro Leu Glu Asp Met Ile Phe Leu Lys Trp Glu Glu Pro Gln Glu 500 505 510 Pro Asn Gly Leu Ile Thr Gln Tyr Glu Ile Ser Tyr Gln Ser Ile Glu 515 520 525 Ser Ser Asp Pro Ala Val Asn Val Pro Gly Pro Arg Arg Thr Ile Ser 530 535 540 Lys Leu Arg Asn Glu Thr Tyr His Val Phe Ser Asn Leu His Pro Gly 545 550 555 560 Thr Thr Tyr Leu Phe Ser Val Arg Ala Arg Thr Gly Lys Gly Phe Gly 565 570 575 Gln Ala Ala Leu Thr Glu Ile Thr Thr Asn Ile Ser Ala Pro Ser Phe 580 585 590 Asp Tyr Ala Asp Met Pro Ser Pro Leu Gly Glu Ser Glu Asn Thr Ile 595 600 605 Thr Val Leu Leu Arg Pro Ala Gln Gly Arg Gly Ala Pro Ile Ser Val 610 615 620 Tyr Gln Val Ile Val Glu Glu Glu Arg Ala Arg Arg Leu Arg Arg Glu 625 630 635 640 Pro Gly Gly Gln Asp Cys Phe Pro Val Pro Leu Thr Phe Glu Ala Ala 645 650 655 Leu Ala Arg Gly Leu Val His Tyr Phe Gly Ala Glu Leu Ala Ala Ser 660 665 670 Ser Leu Pro Glu Ala Met Pro Phe Thr Val Gly Asp Asn Gln Thr Tyr 675 680 685 Arg Gly Phe Trp Asn Pro Pro Leu Glu Pro Arg Lys Ala Tyr Leu Ile 690 695 700 Tyr Phe Gln Ala Ala Ser His Leu Lys Gly Glu Thr Arg Leu Asn Cys 705 710 715 720 Ile Arg Ile Ala Arg Lys Ala Ala Cys Lys Glu Ser Lys Arg Pro Leu 725 730 735 Glu Val Ser Gln Arg Ser Glu Glu Met Gly Leu Ile Leu Gly Ile Cys 740 745 750 Ala Gly Gly Leu Ala Val Leu Ile Leu Leu Leu Gly Ala Ile Ile Val 755 760 765 Ile Ile Arg Lys Gly Arg Asp His Tyr Ala Tyr Ser Tyr Tyr Pro Lys 770 775 780 Pro Val Asn Met Thr Lys Ala Thr Val Asn Tyr Arg Gln Glu Lys Thr 785 790 795 800 His Met Met Ser Ala Val Asp Arg Ser Phe Thr Asp Gln Ser Thr Leu 805 810 815 Gln Glu Asp Glu Arg Leu Gly Leu Ser Phe Met Asp Thr His Gly Tyr 820 825 830 Ser Thr Arg Gly Asp Gln Arg Ser Gly Gly Val Thr Glu Ala Ser Ser 835 840 845 Leu Leu Gly Gly Ser Pro Arg Arg Pro Cys Gly Arg Lys Gly Ser Pro 850 855 860 Tyr His Thr Gly Gln Leu His Pro Ala Val Arg Val Ala Asp Leu Leu 865 870 875 880 Gln His Ile Asn Gln Met Lys Thr Ala Glu Gly Tyr Gly Phe Lys Gln 885 890 895 Glu Tyr Glu Ser Phe Phe Glu Gly Trp Asp Ala Thr Lys Lys Lys Asp 900 905 910 Lys Val Lys Gly Ser Arg Gln Glu Pro Met Pro Ala Tyr Asp Arg His 915 920 925 Arg Val Lys Leu His Pro Met Leu Gly Asp Pro Asn Ala Asp Tyr Ile 930 935 940 Asn Ala Asn Tyr Ile Asp Gly Tyr His Arg Ser Asn His Phe Ile Ala 945 950 955 960 Thr Gln Gly Pro Lys Pro Glu Met Val Tyr Asp Phe Trp Arg Met Val 965 970 975 Trp Gln Glu His Cys Ser Ser Ile Val Met Ile Thr Lys Leu Val Glu 980 985 990 Val Gly Arg Val Lys Cys Ser Arg Tyr Trp Pro Glu Asp Ser Asp Thr 995 1000 1005 Tyr Gly Asp Ile Lys Ile Met Leu Val Lys Thr Glu Thr Leu Ala Glu 1010 1015 1020 Tyr Val Val Arg Thr Phe Ala Leu Glu Arg Arg Gly Tyr Ser Ala Arg 1025 1030 1035 1040 His Glu Val Arg Gln Phe His Phe Thr Ala Trp Pro Glu His Gly Val 1045 1050 1055 Pro Tyr His Ala Thr Gly Leu Leu Ala Phe Ile Arg Arg Val Lys Ala 1060 1065 1070 Ser Thr Pro Pro Asp Ala Gly Pro Ile Val Ile His Cys Ser Ala Gly 1075 1080 1085 Thr Gly Arg Thr Gly Cys Tyr Ile Val Leu Asp Val Met Leu Asp Met 1090 1095 1100 Ala Glu Cys Glu Gly Val Val Asp Ile Tyr Asn Cys Val Lys Thr Leu 1105 1110 1115 1120 Cys Ser Arg Arg Val Asn Met Ile Gln Thr Glu Glu Gln Tyr Ile Phe 1125 1130 1135 Ile His Asp Ala Ile Leu Glu Ala Cys Leu Cys Gly Glu Thr Thr Ile 1140 1145 1150 Pro Val Ser Glu Phe Lys Ala Thr Tyr Lys Glu Met Ile Arg Ile Asp 1155 1160 1165 Pro Gln Ser Asn Ser Ser Gln Leu Arg Glu Glu Phe Gln Thr Leu Asn 1170 1175 1180 Ser Val Thr Pro Pro Leu Asp Val Glu Glu Cys Ser Ile Ala Leu Leu 1185 1190 1195 1200 Pro Arg Asn Arg Asp Lys Asn Arg Ser Met Asp Val Leu Pro Pro Asp 1205 1210 1215 Arg Cys Leu Pro Phe Leu Ile Ser Thr Asp Gly Asp Ser Asn Asn Tyr 1220 1225 1230 Ile Asn Ala Ala Leu Thr Asp Ser Tyr Thr Arg Ser Ala Ala Phe Ile 1235 1240 1245 Val Thr Leu His Pro Leu Gln Ser Thr Thr Pro Asp Phe Trp Arg Leu 1250 1255 1260 Val Tyr Asp Tyr Gly Cys Thr Ser Ile Val Met Leu Asn Gln Leu Asn 1265 1270 1275 1280 Gln Ser Asn Ser Ala Trp Pro Cys Leu Gln Tyr Trp Pro Glu Pro Gly 1285 1290 1295 Arg Gln Gln Tyr Gly Leu Met Glu Val Glu Phe Met Ser Gly Thr Ala 1300 1305 1310 Asp Glu Asp Leu Val Ala Arg Val Phe Arg Val Gln Asn Ile Ser Arg 1315 1320 1325 Leu Gln Glu Gly His Leu Leu Val Arg His Phe Gln Phe Leu Arg Trp 1330 1335 1340 Ser Ala Tyr Arg Asp Thr Pro Asp Ser Lys Lys Ala Phe Leu His Leu 1345 1350 1355 1360 Leu Ala Glu Val Asp Lys Trp Gln Ala Glu Ser Gly Asp Gly Arg Thr 1365 1370 1375 Ile Val His Cys Leu Asn Gly Gly Gly Arg Ser Gly Thr Phe Cys Ala 1380 1385 1390 Cys Ala Thr Val Leu Glu Met Ile Arg Cys His Asn Leu Val Asp Val 1395 1400 1405 Phe Phe Ala Ala Lys Thr Leu Arg Asn Tyr Lys Pro Asn Met Val Glu 1410 1415 1420 Thr Met Asp Gln Tyr His Phe Cys Tyr Asp Val Ala Leu Glu Tyr Leu 1425 1430 1435 1440 Glu Gly Leu Glu Ser Arg 1445 <210> 23 <211> 674 <212> PRT <213> Homo sapiens <400> 23 Met Thr Ile Arg His Gln Gly Gln Gln Tyr Arg Pro Arg Met Ala Phe 1 5 10 15 Leu Gln Lys Ile Glu Ala Leu Val Lys Asp Met Gln Asn Pro Glu Thr 20 25 30 Gly Val Arg Met Gln Asn Gln Arg Val Leu Val Thr Ser Val Pro His 35 40 45 Ala Met Thr Gly Ser Asp Val Leu Gln Trp Ile Val Gln Arg Leu Trp 50 55 60 Ile Ser Ser Leu Glu Ala Gln Asn Leu Gly Asn Phe Ile Val Arg Tyr 65 70 75 80 Gly Tyr Ile Tyr Pro Leu Gln Asp Pro Lys Asn Leu Ile Leu Lys Pro 85 90 95 Asp Gly Ser Leu Tyr Arg Phe Gln Thr Pro Tyr Phe Trp Pro Thr Gln 100 105 110 Gln Trp Pro Ala Glu Asp Thr Asp Tyr Ala Ile Tyr Leu Ala Lys Arg 115 120 125 Asn Ile Lys Lys Lys Gly Ile Leu Glu Glu Tyr Glu Lys Glu Asn Tyr 130 135 140 Asn Phe Leu Asn Gln Lys Met Asn Tyr Lys Trp Asp Phe Val Ile Met 145 150 155 160 Gln Ala Lys Glu Gln Tyr Arg Ala Gly Lys Glu Arg Asn Lys Ala Asp 165 170 175 Arg Tyr Ala Leu Asp Cys Gln Glu Lys Ala Tyr Trp Leu Val His Arg 180 185 190 Cys Pro Pro Gly Met Asp Asn Val Leu Asp Tyr Gly Leu Asp Arg Val 195 200 205 Thr Asn Pro Asn Glu Val Lys Val Asn Gln Lys Gln Thr Val Val Ala 210 215 220 Val Lys Lys Glu Ile Met Tyr Tyr Gln Gln Ala Leu Met Arg Ser Thr 225 230 235 240 Val Lys Ser Ser Val Ser Leu Gly Gly Ile Val Lys Tyr Ser Glu Gln 245 250 255 Phe Ser Ser Asn Asp Ala Ile Met Ser Gly Cys Leu Pro Ser Asn Pro 260 265 270 Trp Ile Thr Asp Asp Thr Gln Phe Trp Asp Leu Asn Ala Lys Leu Val 275 280 285 Glu Ile Pro Thr Lys Met Arg Val Glu Arg Trp Ala Phe Asn Phe Ser 290 295 300 Glu Leu Ile Arg Asp Pro Lys Gly Arg Gln Ser Phe Gln Tyr Phe Leu 305 310 315 320 Lys Lys Glu Phe Ser Gly Glu Asn Leu Gly Phe Trp Glu Ala Cys Glu 325 330 335 Asp Leu Lys Tyr Gly Asp Gln Ser Lys Val Lys Glu Lys Ala Glu Glu 340 345 350 Ile Tyr Lys Leu Phe Leu Ala Pro Gly Ala Arg Arg Trp Ile Asn Ile 355 360 365 Asp Gly Lys Thr Met Asp Ile Thr Val Lys Gly Leu Lys His Pro His 370 375 380 Arg Tyr Val Leu Asp Ala Ala Gln Thr His Ile Tyr Met Leu Met Lys 385 390 395 400 Lys Asp Ser Tyr Ala Arg Tyr Leu Lys Ser Pro Ile Tyr Lys Asp Met 405 410 415 Leu Ala Lys Ala Ile Glu Pro Gln Glu Thr Thr Lys Lys Ser Ser Thr 420 425 430 Leu Pro Phe Met Arg Arg His Leu Arg Ser Ser Pro Ser Pro Val Ile 435 440 445 Leu Arg Gln Leu Glu Glu Glu Ala Lys Ala Arg Glu Ala Ala Asn Thr 450 455 460 Val Asp Ile Thr Gln Pro Gly Gln His Met Ala Pro Ser Pro His Leu 465 470 475 480 Thr Val Tyr Thr Gly Thr Cys Met Pro Pro Ser Pro Ser Ser Pro Phe 485 490 495 Ser Ser Ser Cys Arg Ser Pro Arg Lys Pro Phe Ala Ser Pro Ser Arg 500 505 510 Phe Ile Arg Arg Pro Ser Thr Thr Ile Cys Pro Ser Pro Ile Arg Val 515 520 525 Ala Leu Glu Ser Ser Ser Gly Leu Glu Gln Lys Gly Glu Cys Ser Gly 530 535 540 Ser Met Ala Pro Arg Gly Pro Ser Val Thr Glu Ser Ser Glu Ala Ser 545 550 555 560 Leu Asp Thr Ser Trp Pro Arg Ser Arg Pro Arg Ala Pro Pro Lys Ala 565 570 575 Arg Met Ala Leu Ser Phe Ser Arg Phe Leu Arg Arg Gly Cys Leu Ala 580 585 590 Ser Pro Val Phe Ala Arg Leu Ser Pro Lys Cys Pro Ala Val Ser His 595 600 605 Gly Arg Val Gln Pro Leu Gly Asp Val Gly Gln Gln Leu Pro Arg Leu 610 615 620 Lys Ser Lys Arg Val Ala Asn Phe Phe Gln Ile Lys Met Asp Val Pro 625 630 635 640 Thr Gly Ser Gly Thr Cys Leu Met Asp Ser Glu Asp Ala Gly Thr Gly 645 650 655 Glu Ser Gly Asp Arg Ala Thr Glu Lys Glu Val Ile Cys Pro Trp Glu 660 665 670 Ser Leu <210> 24 <211> 1032 <212> PRT <213> Homo sapiens <400> 24 Met Ala Glu Pro Ser Ala Ala Thr Gln Ser His Ser Ile Ser Ser Ser 1 5 10 15 Ser Phe Gly Ala Glu Pro Ser Ala Pro Gly Gly Gly Gly Ser Pro Gly 20 25 30 Ala Cys Pro Ala Leu Gly Thr Lys Ser Cys Ser Ser Ser Cys Ala Asp 35 40 45 Ser Phe Val Ser Ser Ser Ser Ser Ser Gln Pro Val Ser Leu Phe Ser Thr 50 55 60 Ser Gln Glu Gly Leu Ser Ser Leu Cys Ser Asp Glu Pro Ser Ser Glu 65 70 75 80 Ile Met Thr Ser Ser Phe Leu Ser Ser Ser Glu Ile His Asn Thr Gly 85 90 95 Leu Thr Ile Leu His Gly Glu Lys Ser His Val Leu Gly Ser Gln Pro 100 105 110 Ile Leu Ala Lys Glu Gly Lys Asp His Leu Asp Leu Leu Asp Met Lys 115 120 125 Lys Met Glu Lys Pro Gln Gly Thr Ser Asn Asn Val Ser Asp Ser Ser 130 135 140 Val Ser Leu Ala Ala Gly Val His Cys Asp Arg Pro Ser Ile Pro Ala 145 150 155 160 Ser Phe Pro Glu His Pro Ala Phe Leu Ser Lys Lys Ile Gly Gln Val 165 170 175 Glu Glu Gln Ile Asp Lys Glu Thr Lys Asn Pro Asn Gly Val Ser Ser 180 185 190 Arg Glu Ala Lys Thr Ala Leu Asp Ala Asp Asp Arg Phe Thr Leu Leu 195 200 205 Thr Ala Gln Lys Pro Pro Thr Glu Tyr Ser Lys Val Glu Gly Ile Tyr 210 215 220 Thr Tyr Ser Leu Ser Pro Ser Lys Val Ser Gly Asp Asp Val Ile Glu 225 230 235 240 Lys Asp Ser Pro Glu Ser Pro Phe Glu Val Ile Ile Asp Lys Ala Ala 245 250 255 Phe Asp Lys Glu Phe Lys Asp Ser Tyr Lys Glu Ser Thr Asp Asp Phe 260 265 270 Gly Ser Trp Ser Val His Thr Asp Lys Glu Ser Ser Glu Asp Ile Ser 275 280 285 Glu Thr Asn Asp Lys Leu Phe Pro Leu Arg Asn Lys Glu Ala Gly Arg 290 295 300 Tyr Pro Met Ser Ala Leu Leu Ser Arg Gln Phe Ser His Thr Asn Ala 305 310 315 320 Ala Leu Glu Glu Val Ser Arg Cys Val Asn Asp Met His Asn Phe Thr 325 330 335 Asn Glu Ile Leu Thr Trp Asp Leu Val Pro Gln Val Lys Gln Gln Thr 340 345 350 Asp Lys Ser Ser Asp Cys Ile Thr Lys Thr Thr Gly Leu Asp Met Ser 355 360 365 Glu Tyr Asn Ser Glu Ile Pro Val Val Asn Leu Lys Thr Ser Thr His 370 375 380 Gln Lys Thr Pro Val Cys Ser Ile Asp Gly Ser Thr Pro Ile Thr Lys 385 390 395 400 Ser Thr Gly Asp Trp Ala Glu Ala Ser Leu Gln Gln Glu Asn Ala Ile 405 410 415 Thr Gly Lys Pro Val Pro Asp Ser Leu Asn Ser Thr Lys Glu Phe Ser 420 425 430 Ile Lys Gly Val Gln Gly Asn Met Gln Lys Gln Asp Asp Thr Leu Ala 435 440 445 Glu Leu Pro Gly Ser Pro Pro Glu Lys Cys Asp Ser Leu Gly Ser Gly 450 455 460 Val Ala Thr Val Lys Val Val Leu Pro Asp Asp His Leu Lys Asp Glu 465 470 475 480 Met Asp Trp Gln Ser Ser Ala Leu Gly Glu Ile Thr Glu Ala Asp Ser 485 490 495 Ser Gly Glu Ser Asp Asp Thr Val Ile Glu Asp Ile Thr Ala Asp Thr 500 505 510 Ser Phe Glu Asn Asn Lys Ile Gln Ala Glu Lys Pro Val Ser Ile Pro 515 520 525 Ser Ala Val Val Lys Thr Gly Glu Arg Glu Ile Lys Glu Ile Pro Ser 530 535 540 Cys Glu Arg Glu Glu Lys Thr Ser Lys Asn Phe Glu Glu Leu Val Ser 545 550 555 560 Asp Ser Glu Leu His Gln Asp Gln Pro Asp Ile Leu Gly Arg Ser Pro 565 570 575 Ala Ser Glu Ala Ala Cys Ser Lys Val Pro Asp Thr Asn Val Ser Leu 580 585 590 Glu Asp Val Ser Glu Val Ala Pro Glu Lys Pro Ile Thr Thr Glu Asn 595 600 605 Pro Lys Leu Pro Ser Thr Val Ser Pro Asn Val Phe Asn Glu Thr Glu 610 615 620 Phe Ser Leu Asn Val Thr Thr Ser Ala Tyr Leu Glu Ser Leu His Gly 625 630 635 640 Lys Asn Val Lys His Ile Asp Asp Ser Ser Pro Glu Asp Leu Ile Ala 645 650 655 Ala Phe Thr Glu Thr Arg Asp Lys Gly Ile Val Asp Ser Glu Arg Asn 660 665 670 Ala Phe Lys Ala Ile Ser Glu Lys Met Thr Asp Phe Lys Thr Thr Pro 675 680 685 Pro Val Glu Val Leu His Glu Asn Glu Ser Gly Gly Ser Glu Ile Lys 690 695 700 Asp Ile Gly Ser Lys Tyr Ser Glu Gln Ser Lys Glu Thr Asn Gly Ser 705 710 715 720 Glu Pro Leu Gly Val Phe Pro Thr Gin Gly Thr Pro Val Ala Ser Leu 725 730 735 Asp Leu Glu Gln Glu Gln Leu Thr Ile Lys Ala Leu Lys Glu Leu Gly 740 745 750 Glu Arg Gln Val Glu Lys Ser Thr Ser Ala Gln Arg Asp Ala Glu Leu 755 760 765 Pro Ser Glu Glu Val Leu Lys Gln Thr Phe Thr Phe Ala Pro Glu Ser 770 775 780 Trp Pro Gln Arg Ser Tyr Asp Ile Leu Glu Arg Asn Val Lys Asn Gly 785 790 795 800 Ser Asp Leu Gly Ile Ser Gln Lys Pro Ile Thr Ile Arg Glu Thr Thr 805 810 815 Arg Val Asp Ala Val Ser Ser Leu Ser Lys Thr Glu Leu Val Lys Lys 820 825 830 His Val Leu Ala Arg Leu Leu Thr Asp Phe Ser Val His Asp Leu Ile 835 840 845 Phe Trp Arg Asp Val Lys Lys Thr Gly Phe Val Phe Gly Thr Thr Leu 850 855 860 Ile Met Leu Leu Ser Leu Ala Ala Phe Ser Val Ile Ser Val Val Ser 865 870 875 880 Tyr Leu Ile Leu Ala Leu Leu Ser Val Thr Ile Ser Phe Arg Ile Tyr 885 890 895 Lys Ser Val Ile Gln Ala Val Gln Lys Ser Glu Glu Gly His Pro Phe 900 905 910 Lys Ala Tyr Leu Asp Val Asp Ile Thr Leu Ser Ser Glu Ala Phe His 915 920 925 Asn Tyr Met Asn Ala Ala Met Val His Ile Asn Arg Ala Leu Lys Leu 930 935 940 Ile Ile Arg Leu Phe Leu Val Glu Asp Leu Val Asp Ser Leu Lys Leu 945 950 955 960 Ala Val Phe Met Trp Leu Met Thr Tyr Val Gly Ala Val Phe Asn Gly 965 970 975 Ile Thr Leu Leu Ile Leu Ala Glu Leu Leu Ile Phe Ser Val Pro Ile 980 985 990 Val Tyr Glu Lys Tyr Lys Thr Gln Ile Asp His Tyr Val Gly Ile Ala 995 1000 1005 Arg Asp Gln Thr Lys Ser Ile Val Glu Lys Ile Gln Ala Lys Leu Pro 1010 1015 1020 Gly Ile Ala Lys Lys Lys Ala Glu 1025 1030 <210> 25 <211> 1101 <212> PRT <213> Homo sapiens <400> 25 Met Asp Arg Ala Pro Thr Glu Gln Asn Val Lys Leu Ser Ala Glu Val 1 5 10 15 Glu Pro Phe Ile Pro Gln Lys Lys Ser Pro Asp Thr Phe Met Ile Pro 20 25 30 Met Ala Leu Pro Asn Asp Asn Gly Ser Val Ser Gly Val Glu Pro Thr 35 40 45 Pro Ile Pro Ser Tyr Leu Ile Thr Cys Tyr Pro Phe Val Gln Glu Asn 50 55 60 Gln Ser Asn Arg Gln Phe Pro Leu Tyr Asn Asn Asp Ile Arg Trp Gln 65 70 75 80 Gln Pro Asn Pro Asn Pro Thr Gly Pro Tyr Phe Ala Tyr Pro Ile Ile 85 90 95 Ser Ala Gln Pro Val Ser Thr Glu Tyr Thr Tyr Tyr Gln Leu Met 100 105 110 Pro Ala Pro Cys Ala Gln Val Met Gly Phe Tyr His Pro Phe Pro Thr 115 120 125 Pro Tyr Ser Asn Thr Phe Gln Ala Ala Asn Thr Val Asn Ala Ile Thr 130 135 140 Thr Glu Cys Thr Glu Arg Pro Ser Gln Leu Gly Gln Val Phe Pro Leu 145 150 155 160 Ser Ser His Arg Ser Arg Asn Ser Asn Arg Gly Ser Val Val Pro Lys 165 170 175 Gln Gln Leu Leu Gln Gln His Ile Lys Ser Lys Arg Pro Leu Val Lys 180 185 190 Asn Val Ala Thr Gln Lys Glu Thr Asn Ala Ala Gly Pro Asp Ser Arg 195 200 205 Ser Lys Ile Val Leu Leu Val Asp Ala Ser Gln Gln Thr Asp Phe Pro 210 215 220 Ser Asp Ile Ala Asn Lys Ser Leu Ser Glu Thr Thr Ala Thr Met Leu 225 230 235 240 Trp Lys Ser Lys Gly Arg Arg Arg Arg Ala Ser His Pro Thr Ala Glu 245 250 255 Ser Ser Ser Glu Gln Gly Ala Ser Glu Ala Asp Ile Asp Ser Asp Ser 260 265 270 Gly Tyr Cys Ser Pro Lys His Ser Asn Asn Gln Pro Ala Ala Gly Ala 275 280 285 Leu Arg Asn Pro Asp Ser Gly Thr Met Asn His Val Glu Ser Ser Met 290 295 300 Cys Ala Gly Gly Val Asn Trp Ser Asn Val Thr Cys Gln Ala Thr Gln 305 310 315 320 Lys Lys Pro Trp Met Glu Lys Asn Gln Thr Phe Ser Arg Gly Gly Arg 325 330 335 Gln Thr Glu Gln Arg Asn Asn Ser Gln Val Gly Phe Arg Cys Arg Gly 340 345 350 His Ser Thr Ser Ser Glu Arg Arg Gln Asn Leu Gln Lys Arg Pro Asp 355 360 365 Asn Lys His Leu Ser Ser Ser Gln Ser His Arg Ser Asp Pro Asn Ser 370 375 380 Glu Ser Leu Tyr Phe Glu Asp Glu Asp Gly Phe Gln Glu Leu Asn Glu 385 390 395 400 Asn Gly Asn Ala Lys Asp Glu Asn Ile Gln Gln Lys Leu Ser Ser Lys 405 410 415 Val Leu Asp Asp Leu Pro Glu Asn Ser Pro Ile Asn Ile Val Gln Thr 420 425 430 Pro Ile Pro Ile Thr Thr Ser Val Pro Lys Arg Ala Lys Ser Gln Lys 435 440 445 Lys Lys Ala Leu Ala Ala Ala Leu Ala Thr Ala Gln Glu Tyr Ser Glu 450 455 460 Ile Ser Met Glu Gln Lys Lys Leu Gln Glu Ala Leu Ser Lys Ala Ala 465 470 475 480 Gly Lys Lys Asn Lys Thr Pro Val Gln Leu Asp Leu Gly Asp Met Leu 485 490 495 Ala Ala Leu Glu Lys Gln Gln Gln Ala Met Lys Ala Arg Gln Ile Thr 500 505 510 Asn Thr Arg Pro Leu Ser Tyr Thr Val Val Thr Ala Ala Ser Phe His 515 520 525 Thr Lys Asp Ser Thr Asn Arg Lys Pro Leu Thr Lys Ser Gln Pro Cys 530 535 540 Leu Thr Ser Phe Asn Ser Val Asp Ile Ala Ser Ser Lys Ala Lys Lys 545 550 555 560 Gly Lys Glu Lys Glu Ile Ala Lys Leu Lys Arg Pro Thr Ala Leu Lys 565 570 575 Lys Val Ile Leu Lys Glu Arg Glu Glu Lys Lys Gly Arg Leu Thr Val 580 585 590 Asp His Asn Leu Leu Gly Ser Glu Glu Pro Thr Glu Met His Leu Asp 595 600 605 Phe Ile Asp Asp Leu Pro Gln Glu Ile Val Ser Gln Glu Asp Thr Gly 610 615 620 Leu Ser Met Pro Ser Asp Thr Ser Leu Ser Pro Ala Ser Gln Asn Ser 625 630 635 640 Pro Tyr Cys Met Thr Pro Val Ser Gln Gly Ser Pro Ala Ser Ser Gly 645 650 655 Ile Gly Ser Pro Met Ala Ser Ser Thr Ile Thr Lys Ile His Ser Lys 660 665 670 Arg Phe Arg Glu Tyr Cys Asn Gln Val Leu Cys Lys Glu Ile Asp Glu 675 680 685 Cys Val Thr Leu Leu Leu Gln Glu Leu Val Ser Phe Gln Glu Arg Ile 690 695 700 Tyr Gln Lys Asp Pro Val Arg Ala Lys Ala Arg Arg Arg Leu Val Met 705 710 715 720 Gly Leu Arg Glu Val Thr Lys His Met Lys Leu Asn Lys Ile Lys Cys 725 730 735 Val Ile Ile Ser Pro Asn Cys Glu Lys Ile Gln Ser Lys Gly Gly Leu 740 745 750 Asp Glu Ala Leu Tyr Asn Val Ile Ala Met Ala Arg Glu Gln Glu Ile 755 760 765 Pro Phe Val Phe Ala Leu Gly Arg Lys Ala Leu Gly Arg Cys Val Asn 770 775 780 Lys Leu Val Pro Val Ser Val Val Gly Ile Phe Asn Tyr Phe Gly Ala 785 790 795 800 Glu Ser Leu Phe Asn Lys Leu Val Glu Leu Thr Glu Glu Ala Arg Lys 805 810 815 Ala Tyr Lys Asp Met Val Ala Ala Met Glu Gln Glu Gln Ala Glu Glu 820 825 830 Ala Leu Lys Asn Val Lys Lys Val Pro His His Met Gly His Ser Arg 835 840 845 Asn Pro Ser Ala Ala Ser Ala Ile Ser Phe Cys Ser Val Ile Ser Glu 850 855 860 Pro Ile Ser Glu Val Asn Glu Lys Glu Tyr Glu Thr Asn Trp Arg Asn 865 870 875 880 Met Val Glu Thr Ser Asp Gly Leu Glu Ala Ser Glu Asn Glu Lys Glu 885 890 895 Val Ser Cys Lys His Ser Thr Ser Glu Lys Pro Ser Lys Leu Pro Phe 900 905 910 Asp Thr Pro Pro Ile Gly Lys Gln Pro Ser Leu Val Ala Thr Gly Ser 915 920 925 Thr Thr Ser Ala Thr Ser Ala Gly Lys Ser Thr Ala Ser Asp Lys Glu 930 935 940 Glu Val Lys Pro Asp Asp Leu Glu Trp Ala Ser Gln Gln Ser Thr Glu 945 950 955 960 Thr Gly Ser Leu Asp Gly Ser Cys Arg Asp Leu Leu Asn Ser Ser Ile 965 970 975 Thr Ser Thr Thr Ser Thr Leu Val Pro Gly Met Leu Glu Glu Glu Glu 980 985 990 Asp Glu Asp Glu Glu Glu Glu Glu Asp Tyr Thr His Glu Pro Ile Ser 995 1000 1005 Val Glu Val Gln Leu Asn Ser Arg Ile Glu Ser Trp Val Ser Glu Thr 1010 1015 1020 Gln Arg Thr Met Glu Thr Leu Gln Leu Gly Lys Thr Leu Asn Gly Ser 1025 1030 1035 1040 Glu Glu Asp Asn Val Glu Gln Ser Gly Glu Glu Glu Ala Glu Ala Pro 1045 1050 1055 Glu Val Leu Glu Pro Gly Met Asp Ser Glu Ala Trp Thr Ala Asp Gln 1060 1065 1070 Gln Ala Ser Pro Gly Gln Gln Lys Ser Ser Asn Cys Ser Ser Leu Asn 1075 1080 1085 Lys Glu His Ser Asp Ser Asn Tyr Thr Thr Gln Thr Thr 1090 1095 1100 <210> 26 <211> 2364 <212> PRT <213> Homo sapiens <400> 26 Met Thr Thr Thr Val Ala Thr Asp Tyr Asp Asn Ile Glu Ile Gln Gln 1 5 10 15 Gln Tyr Ser Asp Val Asn Asn Arg Trp Asp Val Asp Asp Trp Asp Asn 20 25 30 Glu Asn Ser Ser Ala Arg Leu Phe Glu Arg Ser Arg Ile Lys Ala Leu 35 40 45 Ala Asp Glu Arg Glu Ala Val Gln Lys Lys Thr Phe Thr Lys Trp Val 50 55 60 Asn Ser His Leu Ala Arg Val Ser Cys Arg Ile Thr Asp Leu Tyr Thr 65 70 75 80 Asp Leu Arg Asp Gly Arg Met Leu Ile Lys Leu Leu Glu Val Leu Ser 85 90 95 Gly Glu Arg Leu Pro Lys Pro Thr Lys Gly Arg Met Arg Ile His Cys 100 105 110 Leu Glu Asn Val Asp Lys Ala Leu Gln Phe Leu Lys Glu Gln Arg Val 115 120 125 His Leu Glu Asn Met Gly Ser His Asp Ile Val Asp Gly Asn His Arg 130 135 140 Leu Thr Leu Gly Leu Ile Trp Thr Ile Ile Leu Arg Phe Gln Ile Gln 145 150 155 160 Asp Ile Ser Val Glu Thr Glu Asp Asn Lys Glu Lys Lys Ser Ala Lys 165 170 175 Asp Ala Leu Leu Leu Trp Cys Gln Met Lys Thr Ala Gly Tyr Pro Asn 180 185 190 Val Asn Ile His Asn Phe Thr Thr Ser Trp Arg Asp Gly Met Ala Phe 195 200 205 Asn Ala Leu Ile His Lys His Arg Pro Asp Leu Ile Asp Phe Asp Lys 210 215 220 Leu Lys Lys Ser Asn Ala His Tyr Asn Leu Gln Asn Ala Phe Asn Leu 225 230 235 240 Ala Glu Gln His Leu Gly Leu Thr Lys Leu Leu Asp Pro Glu Asp Ile 245 250 255 Ser Val Asp His Pro Asp Glu Lys Ser Ile Ile Thr Tyr Val Val Thr 260 265 270 Tyr Tyr His Tyr Phe Ser Lys Met Lys Ala Leu Ala Val Glu Gly Lys 275 280 285 Arg Ile Gly Lys Val Leu Asp Asn Ala Ile Glu Thr Glu Lys Met Ile 290 295 300 Glu Lys Tyr Glu Ser Leu Ala Ser Asp Leu Leu Glu Trp Ile Glu Gln 305 310 315 320 Thr Ile Ile Ile Leu Asn Asn Arg Lys Phe Ala Asn Ser Leu Val Gly 325 330 335 Val Gln Gln Gln Leu Gln Ala Phe Asn Thr Tyr Arg Thr Val Glu Lys 340 345 350 Pro Pro Lys Phe Thr Glu Lys Gly Asn Leu Glu Val Leu Leu Phe Thr 355 360 365 Ile Gln Ser Lys Met Arg Ala Asn Asn Gln Lys Val Tyr Met Pro Arg 370 375 380 Glu Gly Lys Leu Ile Ser Asp Ile Asn Lys Ala Trp Glu Arg Leu Glu 385 390 395 400 Lys Ala Glu His Glu Arg Glu Leu Ala Leu Arg Asn Glu Leu Ile Arg 405 410 415 Gln Glu Lys Leu Glu Gln Leu Ala Arg Arg Phe Asp Arg Lys Ala Ala 420 425 430 Met Arg Glu Thr Trp Leu Ser Glu Asn Gln Arg Leu Val Ser Gln Asp 435 440 445 Asn Phe Gly Phe Asp Leu Pro Ala Val Glu Ala Ala Thr Lys Lys His 450 455 460 Glu Ala Ile Glu Thr Asp Ile Ala Ala Tyr Glu Glu Arg Val Gln Ala 465 470 475 480 Val Val Ala Val Ala Arg Glu Leu Glu Ala Glu Asn Tyr His Asp Ile 485 490 495 Lys Arg Ile Thr Ala Arg Lys Asp Asn Val Ile Arg Leu Trp Glu Tyr 500 505 510 Leu Leu Glu Leu Leu Arg Ala Arg Arg Arg Gln Arg Leu Glu Met Asn Leu 515 520 525 Gly Leu Gln Lys Ile Phe Gln Glu Met Leu Tyr Ile Met Asp Trp Met 530 535 540 Asp Glu Met Lys Val Leu Val Leu Ser Gln Asp Tyr Gly Lys His Leu 545 550 555 560 Leu Gly Val Glu Asp Leu Leu Gln Lys His Thr Leu Val Glu Ala Asp 565 570 575 Ile Gly Ile Gln Ala Glu Arg Val Arg Gly Val Asn Ala Ser Ala Gln 580 585 590 Lys Phe Ala Thr Asp Gly Glu Gly Tyr Lys Pro Cys Asp Pro Gln Val 595 600 605 Ile Arg Asp Arg Val Ala His Met Glu Phe Cys Tyr Gln Glu Leu Cys 610 615 620 Gln Leu Ala Ala Glu Arg Arg Ala Arg Leu Glu Glu Ser Arg Arg Leu 625 630 635 640 Trp Lys Phe Phe Trp Glu Met Ala Glu Glu Glu Gly Trp Ile Arg Glu 645 650 655 Lys Glu Lys Ile Leu Ser Ser Asp Asp Tyr Gly Lys Asp Leu Thr Ser 660 665 670 Val Met Arg Leu Leu Ser Lys His Arg Ala Phe Glu Asp Glu Met Ser 675 680 685 Gly Arg Ser Gly His Phe Glu Gln Ala Ile Lys Glu Gly Glu Asp Met 690 695 700 Ile Ala Glu Glu His Phe Gly Ser Glu Lys Ile Arg Glu Arg Ile Ile 705 710 715 720 Tyr Ile Arg Glu Gln Trp Ala Asn Leu Glu Gln Leu Ser Ala Ile Arg 725 730 735 Lys Lys Arg Leu Glu Glu Ala Ser Leu Leu His Gln Phe Gln Ala Asp 740 745 750 Ala Asp Asp Ile Asp Ala Trp Met Leu Asp Ile Leu Lys Ile Val Ser 755 760 765 Ser Ser Asp Val Gly His Asp Glu Tyr Ser Thr Gln Ser Leu Val Lys 770 775 780 Lys His Lys Asp Val Ala Glu Glu Ile Ala Asn Tyr Arg Pro Thr Leu 785 790 795 800 Asp Thr Leu His Glu Gln Ala Ser Ala Leu Pro Gln Glu His Ala Glu 805 810 815 Ser Pro Asp Val Arg Gly Arg Leu Ser Gly Ile Glu Glu Arg Tyr Lys 820 825 830 Glu Val Ala Glu Leu Thr Arg Leu Arg Lys Gln Ala Leu Gln Asp Thr 835 840 845 Leu Ala Leu Tyr Lys Met Phe Ser Glu Ala Asp Ala Cys Glu Leu Trp 850 855 860 Ile Asp Glu Lys Glu Gln Trp Leu Asn Asn Met Gln Ile Pro Glu Lys 865 870 875 880 Leu Glu Asp Leu Glu Val Ile Gln His Arg Phe Glu Ser Leu Glu Pro 885 890 895 Glu Met Asn Asn Gln Ala Ser Arg Val Ala Val Val Asn Gln Ile Ala 900 905 910 Arg Gln Leu Met His Ser Gly His Pro Ser Glu Lys Glu Ile Lys Ala 915 920 925 Gln Gln Asp Lys Leu Asn Thr Arg Trp Ser Gln Phe Arg Glu Leu Val 930 935 940 Asp Arg Lys Lys Asp Ala Leu Leu Ser Ala Leu Ser Ile Gln Asn Tyr 945 950 955 960 His Leu Glu Cys Asn Glu Thr Lys Ser Trp Ile Arg Glu Lys Thr Lys 965 970 975 Val Ile Glu Ser Thr Gln Asp Leu Gly Asn Asp Leu Ala Gly Val Met 980 985 990 Ala Leu Gln Arg Lys Leu Thr Gly Met Glu Arg Asp Leu Val Ala Ile 995 1000 1005 Glu Ala Lys Leu Ser Asp Leu Gln Lys Glu Ala Glu Lys Leu Glu Ser 1010 1015 1020 Glu His Pro Asp Gln Ala Gln Ala Ile Leu Ser Arg Leu Ala Glu Ile 1025 1030 1035 1040 Ser Asp Val Trp Glu Glu Met Lys Thr Thr Leu Lys Asn Arg Glu Ala 1045 1050 1055 Ser Leu Gly Glu Ala Ser Lys Leu Gln Gln Phe Leu Arg Asp Leu Asp 1060 1065 1070 Asp Phe Gln Ser Trp Leu Ser Arg Thr Gln Thr Ala Ile Ala Ser Glu 1075 1080 1085 Asp Met Pro Asn Thr Leu Thr Glu Ala Glu Lys Leu Leu Thr Gln His 1090 1095 1100 Glu Asn Ile Lys Asn Glu Ile Asp Asn Tyr Glu Glu Asp Tyr Gln Lys 1105 1110 1115 1120 Met Arg Asp Met Gly Glu Met Val Thr Gln Gly Gln Thr Asp Ala Gln 1125 1130 1135 Tyr Met Phe Leu Arg Gln Arg Leu Gln Ala Leu Asp Thr Gly Trp Asn 1140 1145 1150 Glu Leu His Lys Met Trp Glu Asn Arg Gln Asn Leu Leu Ser Gln Ser 1155 1160 1165 His Ala Tyr Gln Gln Phe Leu Arg Asp Thr Lys Gln Ala Glu Ala Phe 1170 1175 1180 Leu Asn Asn Gln Glu Tyr Val Leu Ala His Thr Glu Met Pro Thr Thr 1185 1190 1195 1200 Leu Glu Gly Ala Glu Ala Ala Ile Lys Lys Gln Glu Asp Phe Met Thr 1205 1210 1215 Thr Met Asp Ala Asn Glu Glu Lys Ile Asn Ala Val Val Glu Thr Gly 1220 1225 1230 Arg Arg Leu Val Ser Asp Gly Asn Ile Asn Ser Asp Arg Ile Gln Glu 1235 1240 1245 Lys Val Asp Ser Ile Asp Asp Arg His Arg Lys Asn Arg Glu Thr Ala 1250 1255 1260 Ser Glu Leu Leu Met Arg Leu Lys Asp Asn Arg Asp Leu Gln Lys Phe 1265 1270 1275 1280 Leu Gln Asp Cys Gln Glu Leu Ser Leu Trp Ile Asn Glu Lys Met Leu 1285 1290 1295 Thr Ala Gln Asp Met Ser Tyr Asp Glu Ala Arg Asn Leu His Ser Lys 1300 1305 1310 Trp Leu Lys His Gln Ala Phe Met Ala Glu Leu Ala Ser Asn Lys Glu 1315 1320 1325 Trp Leu Asp Lys Ile Glu Lys Glu Gly Met Gln Leu Ile Ser Glu Lys 1330 1335 1340 Pro Glu Thr Glu Ala Val Val Lys Glu Lys Leu Thr Gly Leu His Lys 1345 1350 1355 1360 Met Trp Glu Val Leu Glu Ser Thr Thr Gln Thr Lys Ala Gln Arg Leu 1365 1370 1375 Phe Asp Ala Asn Lys Ala Glu Leu Phe Thr Gln Ser Cys Ala Asp Leu 1380 1385 1390 Asp Lys Trp Leu His Gly Leu Glu Ser Gln Ile Gln Ser Asp Asp Tyr 1395 1400 1405 Gly Lys Asp Leu Thr Ser Val Asn Ile Leu Leu Lys Lys Gln Gln Met 1410 1415 1420 Leu Glu Asn Gln Met Glu Val Arg Lys Lys Glu Ile Glu Glu Leu Gln 1425 1430 1435 1440 Ser Gln Ala Gln Ala Leu Ser Gln Glu Gly Lys Ser Thr Asp Glu Val 1445 1450 1455 Asp Ser Lys Arg Leu Thr Val Gln Thr Lys Phe Met Glu Leu Leu Glu 1460 1465 1470 Pro Leu Asn Glu Arg Lys His Asn Leu Leu Ala Ser Lys Glu Ile His 1475 1480 1485 Gln Phe Asn Arg Asp Val Glu Asp Glu Ile Leu Trp Val Gly Glu Arg 1490 1495 1500 Met Pro Leu Ala Thr Ser Thr Asp His Gly His Asn Leu Gln Thr Val 1505 1510 1515 1520 Gln Leu Leu Ile Lys Lys Asn Gln Thr Leu Gln Lys Glu Ile Gln Gly 1525 1530 1535 His Gln Pro Arg Ile Asp Asp Ile Phe Glu Arg Ser Gln Asn Ile Val 1540 1545 1550 Thr Asp Ser Ser Ser Leu Ser Ala Glu Ala Ile Arg Gln Arg Leu Ala 1555 1560 1565 Asp Leu Lys Gln Leu Trp Gly Leu Leu Ile Glu Glu Thr Glu Lys Arg 1570 1575 1580 His Arg Arg Leu Glu Glu Ala His Arg Ala Gln Gln Tyr Tyr Phe Asp 1585 1590 1595 1600 Ala Ala Glu Ala Glu Ala Trp Met Ser Glu Gln Glu Leu Tyr Met Met 1605 1610 1615 Ser Glu Glu Lys Ala Lys Asp Glu Gln Ser Ala Val Ser Met Leu Lys 1620 1625 1630 Lys His Gln Ile Leu Glu Gln Ala Val Glu Asp Tyr Ala Glu Thr Val 1635 1640 1645 His Gln Leu Ser Lys Thr Ser Arg Ala Leu Val Ala Asp Ser His Pro 1650 1655 1660 Glu Ser Glu Arg Ile Ser Met Arg Gln Ser Lys Val Asp Lys Leu Tyr 1665 1670 1675 1680 Ala Gly Leu Lys Asp Leu Ala Glu Glu Arg Arg Gly Lys Leu Asp Glu 1685 1690 1695 Arg His Arg Leu Phe Gln Leu Asn Arg Glu Val Asp Asp Leu Glu Gln 1700 1705 1710 Trp Ile Ala Glu Arg Glu Val Val Ala Gly Ser His Glu Leu Gly Gln 1715 1720 1725 Asp Tyr Glu His Val Thr Met Leu Gln Glu Arg Phe Arg Glu Phe Ala 1730 1735 1740 Arg Asp Thr Gly Asn Ile Gly Gln Glu Arg Val Asp Thr Val Asn His 1745 1750 1755 1760 Leu Ala Asp Glu Leu Ile Asn Ser Gly His Ser Asp Ala Ala Thr Ile 1765 1770 1775 Ala Glu Trp Lys Asp Gly Leu Asn Glu Ala Trp Ala Asp Leu Leu Glu 1780 1785 1790 Leu Ile Asp Thr Arg Thr Gln Ile Leu Ala Ala Ser Tyr Glu Leu His 1795 1800 1805 Lys Phe Tyr His Asp Ala Lys Glu Ile Phe Gly Arg Ile Gln Asp Lys 1810 1815 1820 His Lys Lys Leu Pro Glu Glu Leu Gly Arg Asp Gln Asn Thr Val Glu 1825 1830 1835 1840 Thr Leu Gln Arg Met His Thr Thr Phe Glu His Asp Ile Gln Ala Leu 1845 1850 1855 Gly Thr Gln Val Arg Gln Leu Gln Glu Asp Ala Ala Arg Leu Gln Ala 1860 1865 1870 Ala Tyr Ala Gly Asp Lys Ala Asp Asp Ile Gln Lys Arg Glu Asn Glu 1875 1880 1885 Val Leu Glu Ala Trp Lys Ser Leu Leu Asp Ala Cys Glu Ser Arg Arg 1890 1895 1900 Val Arg Leu Val Asp Thr Gly Asp Lys Phe Arg Phe Phe Ser Met Val 1905 1910 1915 1920 Arg Asp Leu Met Leu Trp Met Glu Asp Val Ile Arg Gln Ile Glu Ala 1925 1930 1935 Gln Glu Lys Pro Arg Asp Val Ser Ser Val Glu Leu Leu Met Asn Asn 1940 1945 1950 His Gln Gly Ile Lys Ala Glu Ile Asp Ala Arg Asn Asp Ser Phe Thr 1955 1960 1965 Thr Cys Ile Glu Leu Gly Lys Ser Leu Leu Ala Arg Lys His Tyr Ala 1970 1975 1980 Ser Glu Glu Ile Lys Glu Lys Leu Leu Gln Leu Thr Glu Lys Arg Lys 1985 1990 1995 2000 Glu Met Ile Asp Lys Trp Glu Asp Arg Trp Glu Trp Leu Arg Leu Ile 2005 2010 2015 Leu Glu Val His Gln Phe Ser Arg Asp Ala Ser Val Ala Glu Ala Trp 2020 2025 2030 Leu Leu Gly Gln Glu Pro Tyr Leu Ser Ser Arg Glu Ile Gly Gln Ser 2035 2040 2045 Val Asp Glu Val Glu Lys Leu Ile Lys Arg His Glu Ala Phe Glu Lys 2050 2055 2060 Ser Ala Ala Thr Trp Asp Glu Arg Phe Ser Ala Leu Glu Arg Leu Thr 2065 2070 2075 2080 Thr Leu Glu Leu Leu Glu Val Arg Arg Gln Gln Glu Glu Glu Glu Arg 2085 2090 2095 Lys Arg Arg Pro Pro Ser Pro Glu Pro Ser Thr Lys Val Ser Glu Glu 2100 2105 2110 Ala Glu Ser Gln Gln Gln Trp Asp Thr Ser Lys Gly Glu Gln Val Ser 2115 2120 2125 Gln Asn Gly Leu Pro Ala Glu Gln Gly Ser Pro Arg Met Ala Glu Thr 2130 2135 2140 Val Asp Thr Ser Glu Met Val Asn Gly Ala Thr Glu Gln Arg Thr Ser 2145 2150 2155 2160 Ser Lys Glu Ser Ser Pro Ile Pro Ser Pro Thr Ser Asp Arg Lys Ala 2165 2170 2175 Lys Thr Ala Leu Pro Ala Gln Ser Ala Ala Thr Leu Pro Ala Arg Thr 2180 2185 2190 Gln Glu Thr Pro Ser Ala Gln Met Glu Gly Phe Leu Asn Arg Lys His 2195 2200 2205 Glu Trp Glu Ala His Asn Lys Lys Ala Ser Ser Arg Ser Trp His Asn 2210 2215 2220 Val Tyr Cys Val Ile Asn Asn Gln Glu Met Gly Phe Tyr Lys Asp Ala 2225 2230 2235 2240 Lys Thr Ala Ala Ser Gly Ile Pro Tyr His Ser Glu Val Pro Val Ser 2245 2250 2255 Leu Lys Glu Ala Val Cys Glu Val Ala Leu Asp Tyr Lys Lys Lys Lys 2260 2265 2270 His Val Phe Lys Leu Arg Leu Asn Asp Gly Asn Glu Tyr Leu Phe Gln 2275 2280 2285 Ala Lys Asp Asp Glu Glu Met Asn Thr Trp Ile Gln Ala Ile Ser Ser 2290 2295 2300 Ala Ile Ser Ser Asp Lys His Glu Val Ser Ala Ser Thr Gln Ser Thr 2305 2310 2315 2320 Pro Ala Ser Ser Arg Ala Gln Thr Leu Pro Thr Ser Val Val Thr Ile 2325 2330 2335 Thr Ser Glu Ser Ser Pro Gly Lys Arg Glu Lys Asp Lys Glu Lys Asp 2340 2345 2350 Lys Glu Lys Arg Phe Ser Leu Phe Gly Lys Lys Lys 2355 2360 <210> 27 <211> 8797 <212> PRT <213> Homo sapiens <400> 27 Met Ala Thr Ser Arg Gly Ala Ser Arg Cys Pro Arg Asp Ile Ala Asn 1 5 10 15 Val Met Gln Arg Leu Gln Asp Glu Gln Glu Ile Val Gln Lys Arg Thr 20 25 30 Phe Thr Lys Trp Ile Asn Ser His Leu Ala Lys Arg Lys Pro Pro Met 35 40 45 Val Val Asp Asp Leu Phe Glu Asp Met Lys Asp Gly Val Lys Leu Leu 50 55 60 Ala Leu Leu Glu Val Leu Ser Gly Gln Lys Leu Pro Cys Glu Gln Gly 65 70 75 80 Arg Arg Met Lys Arg Ile His Ala Val Ala Asn Ile Gly Thr Ala Leu 85 90 95 Lys Phe Leu Glu Gly Arg Lys Ile Lys Leu Val Asn Ile Asn Ser Thr 100 105 110 Asp Ile Ala Asp Gly Arg Pro Ser Ile Val Leu Gly Leu Met Trp Thr 115 120 125 Ile Ile Leu Tyr Phe Gln Ile Glu Glu Leu Thr Ser Asn Leu Pro Gln 130 135 140 Leu Gln Ser Leu Ser Ser Ser Ala Ser Ser Val Asp Ser Ile Val Ser 145 150 155 160 Ser Glu Thr Pro Ser Pro Pro Ser Lys Arg Lys Val Thr Thr Lys Ile 165 170 175 Gln Gly Asn Ala Lys Lys Ala Leu Leu Lys Trp Val Gln Tyr Thr Ala 180 185 190 Gly Lys Gln Thr Gly Ile Glu Val Lys Asp Phe Gly Lys Ser Trp Arg 195 200 205 Ser Gly Val Ala Phe His Ser Val Ile His Ala Ile Arg Pro Glu Leu 210 215 220 Val Asp Leu Glu Thr Val Lys Gly Arg Ser Asn Arg Glu Asn Leu Glu 225 230 235 240 Asp Ala Phe Thr Ile Ala Glu Thr Glu Leu Gly Ile Pro Arg Leu Leu 245 250 255 Asp Pro Glu Asp Val Asp Val Asp Lys Pro Asp Glu Lys Ser Ile Met 260 265 270 Thr Tyr Val Ala Gln Phe Leu Lys His Tyr Pro Asp Ile His Asn Ala 275 280 285 Ser Thr Asp Gly Gln Glu Asp Asp Glu Ile Leu Pro Gly Phe Pro Ser 290 295 300 Phe Ala Asn Ser Val Gln Asn Phe Lys Arg Glu Asp Arg Val Ile Phe 305 310 315 320 Lys Glu Met Lys Val Trp Ile Glu Gln Phe Glu Arg Asp Leu Thr Arg 325 330 335 Ala Gln Met Val Glu Ser Asn Leu Gln Asp Lys Tyr Gln Ser Phe Lys 340 345 350 His Phe Arg Val Gln Tyr Glu Met Lys Arg Lys Gln Ile Glu His Leu 355 360 365 Ile Gln Pro Leu His Arg Asp Gly Lys Leu Ser Leu Asp Gln Ala Leu 370 375 380 Val Lys Gln Ser Trp Asp Arg Val Thr Ser Arg Leu Phe Asp Trp His 385 390 395 400 Ile Gln Leu Asp Lys Ser Leu Pro Ala Pro Leu Gly Thr Ile Gly Ala 405 410 415 Trp Leu Tyr Arg Ala Glu Val Ala Leu Arg Glu Glu Ile Thr Val Gln 420 425 430 Gln Val His Glu Glu Thr Ala Asn Thr Ile Gln Arg Lys Leu Glu Gln 435 440 445 His Lys Asp Leu Leu Gln Asn Thr Asp Ala His Lys Arg Ala Phe His 450 455 460 Glu Ile Tyr Arg Thr Arg Ser Val Asn Gly Ile Pro Val Pro Pro Asp 465 470 475 480 Gln Leu Glu Asp Met Ala Glu Arg Phe His Phe Val Ser Ser Thr Ser 485 490 495 Glu Leu His Leu Met Lys Met Glu Phe Leu Glu Leu Lys Tyr Arg Leu 500 505 510 Leu Ser Leu Leu Val Leu Ala Glu Ser Lys Leu Lys Ser Trp Ile Ile 515 520 525 Lys Tyr Gly Arg Arg Glu Ser Val Glu Gln Leu Leu Gln Asn Tyr Val 530 535 540 Ser Phe Ile Glu Asn Ser Lys Phe Phe Glu Gln Tyr Glu Val Thr Tyr 545 550 555 560 Gln Ile Leu Lys Gln Thr Ala Glu Met Tyr Val Lys Ala Asp Gly Ser 565 570 575 Val Glu Glu Ala Glu Asn Val Met Lys Phe Met Asn Glu Thr Thr Ala 580 585 590 Gln Trp Arg Asn Leu Ser Val Glu Val Arg Ser Val Arg Ser Met Leu 595 600 605 Glu Glu Val Ile Ser Asn Trp Asp Arg Tyr Gly Asn Thr Val Ala Ser 610 615 620 Leu Gln Ala Trp Leu Glu Asp Ala Glu Lys Met Leu Asn Gln Ser Glu 625 630 635 640 Asn Ala Lys Lys Asp Phe Phe Arg Asn Leu Pro His Trp Ile Gln Gln 645 650 655 His Thr Ala Met Asn Asp Ala Gly Asn Phe Leu Ile Glu Thr Cys Asp 660 665 670 Glu Met Val Ser Arg Asp Leu Lys Gln Gln Leu Leu Leu Leu Leu Asn Gly 675 680 685 Arg Trp Arg Glu Leu Phe Met Glu Val Lys Gln Tyr Ala Gln Ala Asp 690 695 700 Glu Met Asp Arg Met Lys Lys Glu Tyr Thr Asp Cys Val Val Thr Leu 705 710 715 720 Ser Ala Phe Ala Thr Glu Ala His Lys Lys Leu Ser Glu Pro Leu Glu 725 730 735 Val Ser Phe Met Asn Val Lys Leu Leu Ile Gln Asp Leu Glu Asp Ile 740 745 750 Glu Gln Arg Val Pro Val Met Asp Ala Gln Tyr Lys Ile Ile Thr Lys 755 760 765 Thr Ala His Leu Ile Thr Lys Glu Ser Pro Gln Glu Glu Gly Lys Glu 770 775 780 Met Phe Ala Thr Met Ser Lys Leu Lys Glu Gln Leu Thr Lys Val Lys 785 790 795 800 Glu Cys Tyr Ser Pro Leu Leu Tyr Glu Ser Gln Gln Leu Leu Ile Pro 805 810 815 Leu Glu Glu Leu Glu Lys Gln Met Thr Ser Phe Tyr Asp Ser Leu Gly 820 825 830 Lys Ile Asn Glu Ile Ile Thr Val Leu Glu Arg Glu Ala Gln Ser Ser 835 840 845 Ala Leu Phe Lys Gln Lys His Gln Glu Leu Leu Ala Cys Gln Glu Asn 850 855 860 Cys Lys Lys Thr Leu Thr Leu Ile Glu Lys Gly Ser Gln Ser Val Gln 865 870 875 880 Lys Phe Val Thr Leu Ser Asn Val Leu Lys His Phe Asp Gln Thr Arg 885 890 895 Leu Gln Arg Gln Ile Ala Asp Ile His Val Ala Phe Gln Ser Met Val 900 905 910 Lys Lys Thr Gly Asp Trp Lys Lys His Val Glu Thr Asn Ser Arg Leu 915 920 925 Met Lys Lys Phe Glu Glu Ser Arg Ala Glu Leu Glu Lys Val Leu Arg 930 935 940 Ile Ala Gln Glu Gly Leu Glu Glu Lys Gly Asp Pro Glu Glu Leu Leu 945 950 955 960 Arg Arg His Thr Glu Phe Phe Ser Gln Leu Asp Gln Arg Val Leu Asn 965 970 975 Ala Phe Leu Lys Ala Cys Asp Glu Leu Thr Asp Ile Leu Pro Glu Gln 980 985 990 Glu Gln Gln Gly Leu Gln Glu Ala Val Arg Lys Leu His Lys Gln Trp 995 1000 1005 Lys Asp Leu Gln Gly Glu Ala Pro Tyr His Leu Leu His Leu Lys Ile 1010 1015 1020 Asp Val Glu Lys Asn Arg Phe Leu Ala Ser Val Glu Glu Cys Arg Thr 1025 1030 1035 1040 Glu Leu Asp Arg Glu Thr Lys Leu Met Pro Gln Glu Gly Ser Glu Lys 1045 1050 1055 Ile Ile Lys Glu His Arg Val Phe Phe Ser Asp Lys Gly Pro His His 1060 1065 1070 Leu Cys Glu Lys Arg Leu Gln Leu Ile Glu Glu Leu Cys Val Lys Leu 1075 1080 1085 Pro Val Arg Asp Pro Val Arg Asp Thr Pro Gly Thr Cys His Val Thr 1090 1095 1100 Leu Lys Glu Leu Arg Ala Ala Ile Asp Ser Thr Tyr Arg Lys Leu Met 1105 1110 1115 1120 Glu Asp Pro Asp Lys Trp Lys Asp Tyr Thr Ser Arg Phe Ser Glu Phe 1125 1130 1135 Ser Ser Trp Ile Ser Thr Asn Glu Thr Gln Leu Lys Gly Ile Lys Gly 1140 1145 1150 Glu Ala Ile Asp Thr Ala Asn His Gly Glu Val Lys Arg Ala Val Glu 1155 1160 1165 Glu Ile Arg Asn Gly Val Thr Lys Arg Gly Glu Thr Leu Ser Trp Leu 1170 1175 1180 Lys Ser Arg Leu Lys Val Leu Thr Glu Val Ser Ser Glu Asn Glu Ala 1185 1190 1195 1200 Gln Lys Gln Gly Asp Glu Leu Ala Lys Leu Ser Ser Ser Phe Lys Ala 1205 1210 1215 Leu Val Thr Leu Leu Ser Glu Val Glu Lys Met Leu Ser Asn Phe Gly 1220 1225 1230 Asp Cys Val Gln Tyr Lys Glu Ile Val Lys Asn Ser Leu Glu Glu Leu 1235 1240 1245 Ile Ser Gly Ser Lys Glu Val Gln Glu Gln Ala Glu Lys Ile Leu Asp 1250 1255 1260 Thr Glu Asn Leu Phe Glu Ala Gln Gln Leu Leu Leu His His Gln Gln 1265 1270 1275 1280 Lys Thr Lys Arg Ile Ser Ala Lys Lys Arg Asp Val Gln Gln Gln Ile 1285 1290 1295 Ala Gln Ala Gln Gln Gly Glu Gly Gly Leu Pro Asp Arg Gly His Glu 1300 1305 1310 Glu Leu Arg Lys Leu Glu Ser Thr Leu Asp Gly Leu Glu Arg Ser Arg 1315 1320 1325 Glu Arg Gln Glu Arg Arg Ile Gln Val Thr Leu Arg Lys Trp Glu Arg 1330 1335 1340 Phe Glu Thr Asn Lys Glu Thr Val Val Arg Tyr Leu Phe Gln Thr Gly 1345 1350 1355 1360 Ser Ser His Glu Arg Phe Leu Ser Phe Ser Ser Leu Glu Ser Leu Ser 1365 1370 1375 Ser Glu Leu Glu Gln Thr Lys Glu Phe Ser Lys Arg Thr Glu Ser Ile 1380 1385 1390 Ala Val Gln Ala Glu Asn Leu Val Lys Glu Ala Ser Glu Ile Pro Leu 1395 1400 1405 Gly Pro Gln Asn Lys Gln Leu Leu Gln Gln Gln Ala Lys Ser Ile Lys 1410 1415 1420 Glu Gln Val Lys Lys Leu Glu Asp Thr Leu Glu Glu Asp Ile Lys Thr 1425 1430 1435 1440 Met Glu Met Val Lys Thr Lys Trp Asp His Phe Gly Ser Asn Phe Glu 1445 1450 1455 Thr Leu Ser Val Trp Ile Thr Glu Lys Glu Lys Glu Leu Asn Ala Leu 1460 1465 1470 Glu Thr Ser Ser Ser Ala Met Asp Met Gln Ile Ser Gln Ile Lys Val 1475 1480 1485 Thr Ile Gln Glu Ile Glu Ser Lys Leu Ser Ser Ile Val Gly Leu Glu 1490 1495 1500 Glu Glu Ala Gln Ser Phe Ala Gln Phe Val Thr Thr Gly Glu Ser Ala 1505 1510 1515 1520 Arg Ile Lys Ala Lys Leu Thr Gln Ile Arg Arg Tyr Gly Glu Glu Leu 1525 1530 1535 Arg Glu His Ala Gln Cys Leu Glu Gly Thr Ile Leu Gly His Leu Ser 1540 1545 1550 Gln Gln Gln Lys Phe Glu Glu Asn Leu Arg Lys Ile Gln Gln Ser Val 1555 1560 1565 Ser Glu Phe Glu Asp Lys Leu Ala Val Pro Ile Lys Ile Cys Ser Ser 1570 1575 1580 Ala Thr Glu Thr Tyr Lys Val Leu Gln Glu His Met Asp Leu Cys Gln 1585 1590 1595 1600 Ala Leu Glu Ser Leu Ser Ser Ala Ile Thr Ala Phe Ser Ala Ser Ala 1605 1610 1615 Arg Lys Val Val Asn Arg Asp Ser Cys Val Gln Glu Ala Ala Ala Leu 1620 1625 1630 Gln Gln Gln Tyr Glu Asp Ile Leu Arg Arg Ala Lys Glu Arg Gln Thr 1635 1640 1645 Ala Leu Glu Asn Leu Leu Ala His Trp Gln Arg Leu Glu Lys Glu Leu 1650 1655 1660 Ser Ser Phe Leu Thr Trp Leu Glu Arg Gly Glu Ala Lys Ala Ser Ser 1665 1670 1675 1680 Pro Glu Met Asp Ile Ser Ala Asp Arg Val Lys Val Glu Gly Glu Leu 1685 1690 1695 Gln Leu Ile Gln Ala Leu Gln Asn Glu Val Val Ser Gln Ala Ser Phe 1700 1705 1710 Tyr Ser Lys Leu Leu Gln Leu Lys Glu Ser Leu Phe Ser Val Ala Ser 1715 1720 1725 Lys Asp Asp Val Lys Met Met Lys Leu His Leu Glu Gln Leu Asp Glu 1730 1735 1740 Arg Trp Arg Asp Leu Pro Gln Ile Ile Asn Lys Arg Ile Asn Phe Leu 1745 1750 1755 1760 Gln Ser Val Val Ala Glu His Gln Gln Phe Asp Glu Leu Leu Leu Ser 1765 1770 1775 Phe Ser Val Trp Ile Lys Leu Phe Leu Ser Glu Leu Gln Thr Thr Ser 1780 1785 1790 Glu Ile Ser Ile Met Asp His Gln Val Ala Leu Thr Arg His Lys Asp 1795 1800 1805 His Ala Ala Glu Val Glu Ser Lys Lys Gly Glu Leu Gln Ser Leu Gln 1810 1815 1820 Gly His Leu Ala Lys Leu Gly Ser Leu Gly Arg Ala Glu Asp Leu His 1825 1830 1835 1840 Leu Leu Gln Gly Lys Ala Glu Asp Cys Phe Gln Leu Phe Glu Glu Ala 1845 1850 1855 Ser Gln Val Val Glu Arg Arg Gln Leu Ala Leu Ser His Leu Ala Glu 1860 1865 1870 Phe Leu Gln Ser His Ala Ser Leu Ser Gly Ile Leu Arg Gln Leu Arg 1875 1880 1885 Gln Thr Val Glu Ala Thr Asn Ser Met Asn Lys Asn Glu Ser Asp Leu 1890 1895 1900 Ile Glu Lys Asp Leu Asn Asp Ala Leu Gln Asn Ala Lys Ala Leu Glu 1905 1910 1915 1920 Ser Ala Ala Val Ser Leu Asp Gly Ile Leu Ser Lys Ala Gln Tyr His 1925 1930 1935 Leu Lys Ile Gly Ser Ser Glu Gln Arg Thr Ser Cys Arg Ala Thr Ala 1940 1945 1950 Asp Gln Leu Cys Gly Glu Val Glu Arg Ile Gln Asn Leu Leu Gly Thr 1955 1960 1965 Lys Gln Ser Glu Ala Asp Ala Leu Ala Val Leu Lys Lys Ala Phe Gln 1970 1975 1980 Asp Gln Lys Glu Glu Leu Leu Lys Ser Ile Glu Asp Ile Glu Glu Arg 1985 1990 1995 2000 Thr Asp Lys Glu Arg Leu Lys Glu Pro Thr Arg Gln Ala Leu Gln Gln 2005 2010 2015 Arg Leu Arg Val Phe Asn Gln Leu Glu Asp Glu Leu Asn Ser His Glu 2020 2025 2030 His Glu Leu Cys Trp Leu Lys Asp Lys Ala Lys Gln Ile Ala Gln Lys 2035 2040 2045 Asp Val Ala Phe Ala Pro Glu Val Asp Arg Glu Ile Asn Arg Leu Glu 2050 2055 2060 Val Thr Trp Asp Asp Thr Lys Arg Leu Ile His Glu Asn Gln Gly Gln 2065 2070 2075 2080 Cys Cys Gly Leu Ile Asp Leu Met Arg Glu Tyr Gln Asn Leu Lys Ser 2085 2090 2095 Ala Val Ser Lys Val Leu Glu Asn Ala Ser Ser Val Ile Val Thr Arg 2100 2105 2110 Thr Thr Ile Lys Asp Gln Glu Asp Leu Lys Trp Ala Phe Ser Lys His 2115 2120 2125 Glu Thr Ala Lys Asn Lys Met Asn Tyr Lys Gln Lys Asp Leu Asp Asn 2130 2135 2140 Phe Thr Ser Lys Gly Lys His Leu Leu Ser Glu Leu Lys Lys Ile His 2145 2150 2155 2160 Ser Ser Asp Phe Ser Leu Val Lys Thr Asp Met Glu Ser Thr Val Asp 2165 2170 2175 Lys Trp Leu Asp Val Ser Glu Lys Leu Glu Glu Asn Met Asp Arg Leu 2180 2185 2190 Arg Val Ser Leu Ser Ile Trp Asp Asp Val Leu Ser Thr Arg Asp Glu 2195 2200 2205 Ile Glu Gly Trp Ser Asn Asn Cys Val Pro Gln Met Ala Glu Asn Ile 2210 2215 2220 Ser Asn Leu Asp Asn His Leu Arg Ala Glu Glu Leu Leu Lys Glu Phe 2225 2230 2235 2240 Glu Ser Glu Val Lys Asn Lys Ala Leu Arg Leu Glu Glu Leu His Ser 2245 2250 2255 Lys Val Asn Asp Leu Lys Glu Leu Thr Lys Asn Leu Glu Thr Pro Pro 2260 2265 2270 Asp Leu Gln Phe Ile Glu Ala Asp Leu Met Gln Lys Leu Glu His Ala 2275 2280 2285 Lys Glu Ile Thr Glu Val Ala Lys Gly Thr Leu Lys Asp Phe Thr Ala 2290 2295 2300 Gln Ser Thr Gln Val Glu Lys Phe Ile Asn Asp Ile Thr Thr Trp Phe 2305 2310 2315 2320 Thr Lys Val Glu Glu Ser Leu Met Asn Cys Ala Gln Asn Glu Thr Cys 2325 2330 2335 Glu Ala Leu Lys Lys Val Lys Asp Ile Gln Lys Glu Leu Gln Ser Gln 2340 2345 2350 Gln Ser Asn Ile Ser Ser Thr Gln Glu Asn Leu Asn Ser Leu Cys Arg 2355 2360 2365 Lys Tyr His Ser Ala Glu Leu Glu Ser Leu Gly Arg Ala Met Thr Gly 2370 2375 2380 Leu Ile Lys Lys His Glu Ala Val Ser Gln Leu Cys Ser Lys Thr Gln 2385 2390 2395 2400 Ala Ser Leu Gln Glu Ser Leu Glu Lys His Phe Ser Glu Ser Met Gln 2405 2410 2415 Glu Phe Gln Glu Trp Phe Leu Gly Ala Lys Ala Ala Ala Lys Glu Ser 2420 2425 2430 Ser Asp Arg Thr Gly Asp Ser Lys Val Leu Glu Ala Lys Leu His Asp 2435 2440 2445 Leu Gln Asn Ile Leu Asp Ser Val Ser Asp Gly Gln Ser Lys Leu Asp 2450 2455 2460 Ala Val Thr Gln Glu Gly Gln Thr Leu Tyr Ala His Leu Ser Lys Gln 2465 2470 2475 2480 Ile Val Ser Ser Ile Gln Glu Gln Ile Thr Lys Ala Asn Glu Glu Phe 2485 2490 2495 Gln Ala Phe Leu Lys Gln Cys Leu Lys Asp Lys Gln Ala Leu Gln Asp 2500 2505 2510 Cys Ala Ser Glu Leu Gly Ser Phe Glu Asp Gln His Arg Lys Leu Asn 2515 2520 2525 Leu Trp Ile His Glu Met Glu Glu Arg Phe Asn Thr Glu Asn Leu Gly 2530 2535 2540 Glu Ser Lys Gln His Ile Pro Glu Lys Lys Asn Glu Val His Lys Val 2545 2550 2555 2560 Glu Met Phe Leu Gly Glu Leu Leu Ala Ala Arg Glu Ser Leu Asp Lys 2565 2570 2575 Leu Ser Gln Arg Gly Gln Leu Leu Ser Glu Glu Gly His Gly Ala Gly 2580 2585 2590 Gln Glu Gly Arg Leu Cys Ser Gln Leu Leu Thr Ser His Gln Asn Leu 2595 2600 2605 Leu Arg Met Thr Lys Glu Lys Leu Arg Ser Cys Gln Val Ala Leu Gln 2610 2615 2620 Glu His Glu Ala Leu Glu Glu Ala Leu Gln Ser Met Trp Phe Trp Val 2625 2630 2635 2640 Lys Ala Ile Gln Asp Arg Leu Ala Cys Ala Glu Ser Thr Leu Gly Ser 2645 2650 2655 Lys Asp Thr Leu Glu Lys Arg Leu Ser Gln Ile Gln Asp Ile Leu Leu 2660 2665 2670 Met Lys Gly Glu Gly Glu Val Lys Leu Asn Met Ala Ile Gly Lys Gly 2675 2680 2685 Glu Gln Ala Leu Arg Ser Ser Asn Lys Glu Gly Gln Arg Val Ile Gln 2690 2695 2700 Thr Gln Leu Glu Thr Leu Lys Glu Val Trp Ala Asp Ile Met Ser Ser 2705 2710 2715 2720 Ser Val His Ala Gln Ser Thr Leu Glu Ser Val Ile Ser Gln Trp Asn 2725 2730 2735 Asp Tyr Val Glu Arg Lys Asn Gln Leu Glu Gln Trp Met Glu Ser Val 2740 2745 2750 Asp Gln Lys Ile Glu His Pro Leu Gln Pro Gln Pro Gly Leu Lys Glu 2755 2760 2765 Lys Phe Val Leu Leu Asp His Leu Gln Ser Ile Leu Ser Glu Ala Glu 2770 2775 2780 Asp His Thr Arg Ala Leu His Arg Leu Ile Ala Lys Ser Arg Glu Leu 2785 2790 2795 2800 Tyr Glu Lys Thr Glu Asp Glu Ser Phe Lys Asp Thr Ala Gln Glu Glu 2805 2810 2815 Leu Lys Thr Gln Phe Asn Asp Ile Met Thr Val Ala Lys Glu Lys Met 2820 2825 2830 Arg Lys Val Glu Glu Ile Val Lys Asp His Leu Met Tyr Leu Asp Ala 2835 2840 2845 Val His Glu Phe Thr Asp Trp Leu His Ser Ala Lys Glu Glu Leu His 2850 2855 2860 Arg Trp Ser Asp Met Ser Gly Asp Ser Ser Ala Thr Gln Lys Lys Leu 2865 2870 2875 2880 Ser Lys Ile Lys Glu Leu Ile Asp Ser Arg Glu Ile Gly Ala Ser Arg 2885 2890 2895 Leu Ser Arg Val Glu Ser Leu Ala Pro Glu Val Lys Gln Asn Thr Thr 2900 2905 2910 Ala Ser Gly Cys Glu Leu Met His Thr Glu Met Gln Ala Leu Arg Ala 2915 2920 2925 Asp Trp Lys Gln Trp Glu Asp Ser Val Phe Gln Thr Gln Ser Cys Leu 2930 2935 2940 Glu Asn Leu Val Ser Gln Met Ala Leu Ser Glu Gln Glu Phe Ser Gly 2945 2950 2955 2960 Gln Val Ala Gln Leu Glu Gln Ala Leu Glu Gln Phe Ser Ala Leu Leu 2965 2970 2975 Lys Thr Trp Ala Gln Gln Leu Thr Leu Leu Glu Gly Lys Asn Thr Asp 2980 2985 2990 Glu Glu Ile Val Glu Cys Trp His Lys Gly Gin Glu Ile Leu Asp Ala 2995 3000 3005 Leu Gln Lys Ala Glu Pro Arg Thr Glu Asp Leu Lys Ser Gln Leu Asn 3010 3015 3020 Glu Leu Cys Arg Phe Ser Arg Asp Leu Ser Thr Tyr Ser Gly Lys Val 3025 3030 3035 3040 Ser Gly Leu Ile Lys Glu Tyr Asn Cys Leu Cys Leu Gln Ala Ser Lys 3045 3050 3055 Gly Cys Gln Asn Lys Glu Gln Ile Leu Gln Gln Arg Phe Arg Lys Ala 3060 3065 3070 Phe Arg Asp Phe Gln Gln Trp Leu Val Asn Ala Lys Ile Thr Thr Ala 3075 3080 3085 Lys Cys Phe Asp Ile Pro Gln Asn Ile Ser Glu Val Ser Thr Ser Leu 3090 3095 3100 Gln Lys Ile Gln Glu Phe Leu Ser Glu Ser Glu Asn Gly Gln His Lys 3105 3110 3115 3120 Leu Asn Met Met Leu Ser Lys Gly Glu Leu Leu Ser Thr Leu Leu Thr 3125 3130 3135 Lys Glu Lys Ala Lys Gly Ile Gln Ala Lys Val Thr Ala Ala Lys Glu 3140 3145 3150 Asp Trp Lys Asn Phe His Ser Asn Leu His Gln Lys Glu Ser Ala Leu 3155 3160 3165 Glu Asn Leu Lys Ile Gln Met Lys Asp Phe Glu Val Ser Ala Glu Pro 3170 3175 3180 Ile Gln Asp Trp Leu Ser Lys Thr Glu Lys Met Val His Glu Ser Ser 3185 3190 3195 3200 Asn Arg Leu Tyr Asp Leu Pro Ala Lys Arg Arg Glu Gln Gln Lys Leu 3205 3210 3215 Gln Ser Val Leu Glu Glu Ile His Cys Tyr Glu Pro Gln Leu Asn Arg 3220 3225 3230 Leu Lys Glu Lys Ala Gln Gln Leu Trp Glu Gly Gln Ala Ala Ser Lys 3235 3240 3245 Ser Phe Arg His Arg Val Ser Gln Leu Ser Ser Gln Tyr Leu Ala Leu 3250 3255 3260 Ser Asn Leu Thr Lys Glu Lys Val Ser Arg Leu Asp Arg Ile Val Ala 3265 3270 3275 3280 Glu His Asn Gln Phe Ser Leu Gly Ile Lys Glu Leu Gln Asp Trp Met 3285 3290 3295 Thr Asp Ala Ile His Met Leu Asp Ser Tyr Cys His Pro Thr Ser Asp 3300 3305 3310 Lys Ser Val Leu Asp Ser Arg Thr Leu Lys Leu Glu Ala Leu Leu Ser 3315 3320 3325 Val Lys Gln Glu Lys Glu Ile Gln Met Lys Met Ile Val Thr Arg Gly 3330 3335 3340 Glu Ser Val Leu Gln Asn Thr Ser Pro Glu Gly Ile Pro Thr Ile Gln 3345 3350 3355 3360 Gln Gln Leu Gln Ser Val Lys Asp Met Trp Ala Ser Leu Leu Ser Ala 3365 3370 3375 Gly Ile Arg Cys Lys Ser Gln Leu Glu Gly Ala Leu Ser Lys Trp Thr 3380 3385 3390 Ser Tyr Gln Asp Gly Val Arg Gln Phe Ser Gly Trp Met Asp Ser Met 3395 3400 3405 Glu Ala Asn Leu Asn Glu Ser Glu Arg Gln His Ala Glu Leu Arg Asp 3410 3415 3420 Lys Thr Thr Met Leu Gly Lys Ala Lys Leu Leu Asn Glu Glu Val Leu 3425 3430 3435 3440 Ser Tyr Ser Ser Leu Leu Glu Thr Ile Glu Val Lys Gly Ala Gly Met 3445 3450 3455 Thr Glu His Tyr Val Thr Gln Leu Glu Leu Gln Asp Leu Gln Glu Arg 3460 3465 3470 Tyr Arg Ala Ile Gln Glu Arg Ala Lys Glu Ala Val Thr Lys Ser Glu 3475 3480 3485 Lys Leu Val Arg Leu His Gln Glu Tyr Gln Arg Asp Leu Lys Ala Phe 3490 3495 3500 Glu Val Trp Leu Gly Gin Glu Gln Glu Lys Leu Asp Gln Tyr Ser Val 3505 3510 3515 3520 Leu Glu Gly Asp Ala His Thr His Glu Thr Thr Leu Arg Asp Leu Gln 3525 3530 3535 Glu Leu Gln Val His Cys Ala Glu Gly Gin Ala Leu Leu Asn Ser Val 3540 3545 3550 Leu His Thr Arg Glu Asp Val Ile Pro Ser Gly Ile Pro Gln Ala Glu 3555 3560 3565 Asp Arg Ala Leu Glu Ser Leu Arg Gln Asp Trp Gln Ala Tyr Gln His 3570 3575 3580 Arg Leu Ser Glu Thr Arg Thr Gln Phe Asn Asn Val Val Asn Lys Leu 3585 3590 3595 3600 Arg Leu Met Glu Gln Lys Phe Gln Gln Val Asp Glu Trp Leu Lys Thr 3605 3610 3615 Ala Glu Glu Lys Val Ser Pro Arg Thr Arg Arg Gln Ser Asn Arg Ala 3620 3625 3630 Thr Lys Glu Ile Gln Leu His Gln Met Lys Lys Trp His Glu Glu Val 3635 3640 3645 Thr Ala Tyr Arg Asp Glu Val Glu Glu Val Gly Ala Arg Ala Gln Glu 3650 3655 3660 Ile Leu Asp Glu Ser His Val Asn Ser Arg Met Gly Cys Gln Ala Thr 3665 3670 3675 3680 Gln Leu Thr Ser Arg Tyr Gln Ala Leu Leu Leu Gln Val Leu Glu Gln 3685 3690 3695 Ile Lys Phe Leu Glu Glu Glu Ile Gln Ser Leu Glu Glu Ser Glu Ser 3700 3705 3710 Ser Leu Ser Ser Tyr Ser Asp Trp Tyr Gly Ser Thr His Lys Asn Phe 3715 3720 3725 Lys Asn Val Ala Thr Lys Ile Asp Lys Val Asp Thr Val Met Met Gly 3730 3735 3740 Lys Lys Leu Lys Thr Leu Glu Val Leu Leu Lys Asp Met Glu Lys Gly 3745 3750 3755 3760 His Ser Leu Leu Lys Ser Ala Arg Glu Lys Gly Glu Arg Ala Val Lys 3765 3770 3775 Tyr Leu Glu Glu Gly Glu Ala Glu Arg Leu Arg Lys Glu Ile His Asp 3780 3785 3790 His Met Glu Gln Leu Lys Glu Leu Thr Ser Thr Val Arg Lys Glu His 3795 3800 3805 Met Thr Leu Glu Lys Gly Leu His Leu Ala Lys Glu Phe Ser Asp Lys 3810 3815 3820 Cys Lys Ala Leu Thr Gln Trp Ile Ala Glu Tyr Gln Glu Ile Leu His 3825 3830 3835 3840 Val Pro Glu Glu Pro Lys Met Glu Leu Tyr Glu Lys Lys Ala Gln Leu 3845 3850 3855 Ser Lys Tyr Lys Ser Leu Gln Gln Thr Val Leu Ser His Glu Pro Ser 3860 3865 3870 Val Lys Ser Val Arg Glu Lys Gly Glu Ala Leu Leu Glu Leu Val Gln 3875 3880 3885 Asp Val Thr Leu Lys Asp Lys Ile Asp Gln Leu Gln Ser Asp Tyr Gln 3890 3895 3900 Asp Leu Cys Ser Ile Gly Lys Glu His Val Phe Ser Leu Glu Ala Lys 3905 3910 3915 3920 Val Lys Asp His Glu Asp Tyr Asn Ser Glu Leu Gln Glu Val Glu Lys 3925 3930 3935 Trp Leu Leu Gln Met Ser Gly Arg Leu Val Ala Pro Asp Leu Leu Glu 3940 3945 3950 Thr Ser Ser Leu Glu Thr Ile Thr Gln Gln Leu Ala His His Lys Ala 3955 3960 3965 Met Met Glu Glu Ile Ala Gly Phe Glu Asp Arg Leu Asn Asn Leu Gln 3970 3975 3980 Met Lys Gly Asp Thr Leu Ile Gly Gln Cys Ala Asp His Leu Gln Ala 3985 3990 3995 4000 Lys Leu Lys Gln Asn Val His Ala His Leu Gln Gly Thr Lys Asp Ser 4005 4010 4015 Tyr Ser Ala Ile Cys Ser Thr Ala Gln Arg Met Tyr Gln Ser Leu Glu 4020 4025 4030 His Glu Leu Gln Lys His Val Ser Arg Gln Asp Thr Leu Gln Gln Cys 4035 4040 4045 Gln Ala Trp Leu Ser Ala Val Gln Pro Asp Leu Glu Pro Ser Pro Gln 4050 4055 4060 Pro Pro Leu Ser Arg Ala Glu Ala Ile Lys Gln Val Lys His Phe Arg 4065 4070 4075 4080 Ala Leu Gln Glu Gln Ala Arg Thr Tyr Leu Asp Leu Leu Cys Ser Met 4085 4090 4095 Cys Asp Leu Ser Asn Ala Ser Val Lys Thr Thr Ala Lys Asp Ile Gln 4100 4105 4110 Gln Thr Glu Gln Thr Ile Glu Gln Lys Leu Val Gln Ala Gln Asn Leu 4115 4120 4125 Thr Gln Gly Trp Glu Glu Ile Lys His Leu Lys Ser Glu Leu Trp Ile 4130 4135 4140 Tyr Leu Gln Asp Ala Asp Gln Gln Leu Gln Asn Met Lys Arg Arg His 4145 4150 4155 4160 Ser Glu Leu Glu Leu Asn Ile Ala Gln Asn Met Val Ser Gln Val Lys 4165 4170 4175 Asp Phe Val Lys Lys Leu Gln Ser Lys Gln Ala Ser Val Asn Thr Ile 4180 4185 4190 Ile Glu Lys Val Asn Lys Leu Thr Lys Lys Glu Glu Ser Pro Glu His 4195 4200 4205 Lys Glu Ile Asn His Leu Asn Asp Gln Trp Leu Asp Leu Cys Arg Gln 4210 4215 4220 Ser Asn Asn Leu Cys Leu Gln Arg Glu Glu Asp Leu Gln Arg Thr Arg 4225 4230 4235 4240 Asp Tyr His Asp Cys Met Asn Val Val Glu Val Phe Leu Glu Lys Phe 4245 4250 4255 Thr Thr Glu Trp Asp Asn Leu Ala Arg Ser Asp Ala Glu Ser Thr Ala 4260 4265 4270 Val His Leu Glu Ala Leu Lys Lys Leu Ala Leu Ala Leu Gln Glu Arg 4275 4280 4285 Lys Tyr Ala Ile Glu Asp Leu Lys Asp Gln Lys Gln Lys Met Ile Glu 4290 4295 4300 His Leu Asn Leu Asp Asp Lys Glu Leu Val Lys Glu Gln Thr Ser His 4305 4310 4315 4320 Leu Glu Gln Arg Trp Phe Gln Leu Glu Asp Leu Ile Lys Arg Lys Ile 4325 4330 4335 Gln Val Ser Val Thr Asn Leu Glu Glu Leu Asn Val Val Gln Ser Arg 4340 4345 4350 Phe Gln Glu Leu Met Glu Trp Ala Glu Glu Gln Gln Pro Asn Ile Ala 4355 4360 4365 Glu Ala Leu Lys Gln Ser Pro Pro Asp Met Ala Gln Asn Leu Leu 4370 4375 4380 Met Asp His Leu Ala Ile Cys Ser Glu Leu Glu Ala Lys Gln Met Leu 4385 4390 4395 4400 Leu Lys Ser Leu Ile Lys Asp Ala Asp Arg Val Met Ala Asp Leu Gly 4405 4410 4415 Leu Asn Glu Arg Gln Val Ile Gln Lys Ala Leu Ser Asp Ala Gln Ser 4420 4425 4430 His Val Asn Cys Leu Ser Asp Leu Val Gly Gln Arg Arg Lys Tyr Leu 4435 4440 4445 Asn Lys Ala Leu Ser Glu Lys Thr Gln Phe Leu Met Ala Val Phe Gln 4450 4455 4460 Ala Thr Ser Gln Ile Gln Gln His Glu Arg Lys Ile Met Phe Arg Glu 4465 4470 4475 4480 His Ile Cys Leu Leu Pro Asp Asp Val Ser Lys Gln Val Lys Thr Cys 4485 4490 4495 Lys Ser Ala Gln Ala Ser Leu Lys Thr Tyr Gln Asn Glu Val Thr Gly 4500 4505 4510 Leu Trp Ala Gln Gly Arg Glu Leu Met Lys Glu Val Thr Glu Gln Glu 4515 4520 4525 Lys Ser Glu Val Leu Gly Lys Leu Gln Glu Leu Gln Ser Val Tyr Asp 4530 4535 4540 Ser Val Leu Gln Lys Cys Ser His Arg Leu Gln Glu Leu Glu Lys Asn 4545 4550 4555 4560 Leu Val Ser Arg Lys His Phe Lys Glu Asp Phe Asp Lys Ala Cys His 4565 4570 4575 Trp Leu Lys Gln Ala Asp Ile Val Thr Phe Pro Glu Ile Asn Leu Met 4580 4585 4590 Asn Glu Ser Ser Glu Leu His Thr Gln Leu Ala Lys Tyr Gln Asn Ile 4595 4600 4605 Leu Glu Gln Ser Pro Glu Tyr Glu Asn Leu Leu Leu Thr Leu Gln Arg 4610 4615 4620 Thr Gly Gln Thr Ile Leu Pro Ser Leu Asn Glu Val Asp His Ser Tyr 4625 4630 4635 4640 Leu Ser Glu Lys Leu Asn Ala Leu Pro Arg Gln Phe Asn Val Ile Val 4645 4650 4655 Ala Leu Ala Lys Asp Lys Phe Tyr Lys Val Gln Glu Ala Ile Leu Ala 4660 4665 4670 Arg Lys Glu Tyr Ala Ser Leu Ile Glu Leu Thr Thr Gln Ser Leu Ser 4675 4680 4685 Glu Leu Glu Ala Gln Phe Leu Arg Met Ser Lys Val Pro Thr Asp Leu 4690 4695 4700 Ala Val Glu Glu Ala Leu Ser Leu Gln Asp Gly Cys Arg Ala Ile Leu 4705 4710 4715 4720 Asp Glu Val Ala Gly Leu Gly Glu Ala Val Asp Glu Leu Asn Gln Lys 4725 4730 4735 Lys Glu Gly Phe Arg Ser Thr Gly Gln Pro Trp Gln Pro Asp Lys Met 4740 4745 4750 Leu His Leu Val Thr Leu Tyr His Arg Leu Lys Arg Gln Thr Glu Gln 4755 4760 4765 Arg Val Ser Leu Leu Glu Asp Thr Thr Ser Ala Tyr Gln Glu His Glu 4770 4775 4780 Lys Met Cys Gln Gln Leu Glu Arg Gln Leu Lys Ser Val Lys Glu Glu 4785 4790 4795 4800 Gln Ser Lys Val Asn Glu Glu Thr Leu Pro Ala Glu Glu Lys Leu Lys 4805 4810 4815 Met Tyr His Ser Leu Ala Gly Ser Leu Gln Asp Ser Gly Ile Val Leu 4820 4825 4830 Lys Arg Val Thr Ile His Leu Glu Asp Leu Ala Pro His Leu Asp Pro 4835 4840 4845 Leu Ala Tyr Glu Lys Ala Arg His Gln Ile Gln Ser Trp Gln Gly Glu 4850 4855 4860 Leu Lys Leu Leu Thr Ser Ala Ile Gly Glu Thr Val Thr Glu Cys Glu 4865 4870 4875 4880 Ser Arg Met Val Gln Ser Ile Asp Phe Gln Thr Glu Met Ser Arg Ser 4885 4890 4895 Leu Asp Trp Leu Arg Arg Val Lys Ala Glu Leu Ser Gly Pro Val Tyr 4900 4905 4910 Leu Asp Leu Asn Leu Gln Asp Ile Gln Glu Glu Ile Arg Lys Ile Gln 4915 4920 4925 Ile His Gln Glu Glu Val Gln Ser Ser Leu Arg Ile Met Asn Ala Leu 4930 4935 4940 Ser His Lys Glu Lys Glu Lys Phe Thr Lys Ala Lys Glu Leu Ile Ser 4945 4950 4955 4960 Ala Asp Leu Glu His Ser Leu Ala Glu Leu Ser Glu Leu Asp Gly Asp 4965 4970 4975 Ile Gln Glu Ala Leu Arg Thr Arg Gln Ala Thr Leu Thr Glu Ile Tyr 4980 4985 4990 Ser Gln Cys Gln Arg Tyr Tyr Gln Val Phe Gln Ala Ala Asn Asp Trp 4995 5000 5005 Leu Glu Asp Ala Gln Glu Leu Leu Gln Leu Ala Gly Asn Gly Leu Asp 5010 5015 5020 Val Glu Ser Ala Glu Glu Asn Leu Lys Ser His Met Glu Phe Phe Ser 5025 5030 5035 5040 Thr Glu Asp Gln Phe His Ser Asn Leu Glu Glu Leu His Ser Leu Val 5045 5050 5055 Ala Thr Leu Asp Pro Leu Ile Lys Pro Thr Gly Lys Glu Asp Leu Glu 5060 5065 5070 Gln Lys Val Ala Ser Leu Glu Leu Arg Ser Gln Arg Met Ser Arg Asp 5075 5080 5085 Ser Gly Ala Gln Val Asp Leu Leu Gln Arg Cys Thr Ala Gln Trp His 5090 5095 5100 Asp Tyr Gln Lys Ala Arg Glu Glu Val Ile Glu Leu Met Asn Asp Thr 5105 5110 5115 5120 Glu Lys Lys Leu Ser Glu Phe Ser Leu Leu Lys Thr Ser Ser Ser His 5125 5130 5135 Glu Ala Glu Glu Lys Leu Ser Glu His Lys Ala Leu Val Ser Val Val 5140 5145 5150 Asn Ser Phe His Glu Lys Ile Val Ala Leu Glu Glu Lys Ala Ser Gln 5155 5160 5165 Leu Glu Lys Thr Gly Asn Asp Ala Ser Lys Ala Thr Leu Ser Arg Ser 5170 5175 5180 Met Thr Thr Val Trp Gln Arg Trp Thr Arg Leu Arg Ala Val Ala Gln 5185 5190 5195 5200 Asp Gln Glu Lys Ile Leu Glu Asp Ala Val Asp Glu Trp Thr Gly Phe 5205 5210 5215 Asn Asn Lys Val Lys Lys Ala Thr Glu Met Ile Asp Gln Leu Gln Asp 5220 5225 5230 Lys Leu Pro Gly Ser Ser Ala Glu Lys Ala Ser Lys Ala Glu Leu Leu 5235 5240 5245 Thr Leu Leu Glu Tyr His Asp Thr Phe Val Leu Glu Leu Glu Gln Gln 5250 5255 5260 Gln Ser Ala Leu Gly Met Leu Arg Gln Gln Thr Leu Ser Met Leu Gln 5265 5270 5275 5280 Asp Gly Ala Ala Pro Thr Pro Gly Glu Glu Pro Leu Met Gln Glu 5285 5290 5295 Ile Thr Ala Met Gln Asp Arg Cys Leu Asn Met Gln Glu Lys Val Lys 5300 5305 5310 Thr Asn Gly Lys Leu Val Lys Gln Glu Leu Lys Asp Arg Glu Met Val 5315 5320 5325 Glu Thr Gln Ile Asn Ser Val Lys Cys Trp Val Gln Glu Thr Lys Glu 5330 5335 5340 Tyr Leu Gly Asn Pro Thr Ile Glu Ile Asp Ala Gln Leu Glu Glu Leu 5345 5350 5355 5360 Gln Ile Leu Leu Thr Glu Ala Thr Asn His Arg Gln Asn Ile Glu Lys 5365 5370 5375 Met Ala Glu Glu Gln Lys Glu Lys Tyr Leu Gly Leu Tyr Thr Ile Leu 5380 5385 5390 Pro Ser Glu Leu Ser Leu Gln Leu Ala Glu Val Ala Leu Asp Leu Lys 5395 5400 5405 Ile Arg Asp Gln Ile Gln Asp Lys Ile Lys Glu Val Glu Gln Ser Lys 5410 5415 5420 Ala Thr Ser Gln Glu Leu Ser Arg Gln Ile Gln Lys Leu Ala Lys Asp 5425 5430 5435 5440 Leu Thr Thr Ile Leu Thr Lys Leu Lys Ala Lys Thr Asp Asn Val Val 5445 5450 5455 Gln Ala Lys Thr Asp Gln Lys Val Leu Gly Glu Glu Leu Asp Gly Cys 5460 5465 5470 Asn Ser Lys Leu Met Glu Leu Asp Ala Ala Val Gln Lys Phe Leu Glu 5475 5480 5485 Gln Asn Gly Gln Leu Gly Lys Pro Leu Ala Lys Lys Ile Gly Lys Leu 5490 5495 5500 Thr Glu Leu His Gln Gln Thr Ile Arg Gln Ala Glu Asn Arg Leu Ser 5505 5510 5515 5520 Lys Leu Asn Gln Ala Ala Ser His Leu Glu Glu Tyr Asn Glu Met Leu 5525 5530 5535 Glu Leu Ile Leu Lys Trp Ile Glu Lys Ala Lys Val Leu Ala His Gly 5540 5545 5550 Thr Ile Ala Trp Asn Ser Ala Ser Gln Leu Arg Glu Gln Tyr Ile Leu 5555 5560 5565 His Gln Thr Leu Leu Glu Glu Ser Lys Glu Ile Asp Ser Glu Leu Glu 5570 5575 5580 Ala Met Thr Glu Lys Leu Gln Tyr Leu Thr Ser Val Tyr Cys Thr Glu 5585 5590 5595 5600 Lys Met Ser Gln Gln Val Ala Glu Leu Gly Arg Glu Thr Glu Glu Leu 5605 5610 5615 Arg Gln Met Ile Lys Ile Arg Leu Gln Asn Leu Gln Asp Ala Ala Lys 5620 5625 5630 Asp Met Lys Lys Phe Glu Ala Glu Leu Lys Lys Leu Gln Ala Ala Leu 5635 5640 5645 Glu Gln Ala Gln Ala Thr Leu Thr Ser Pro Glu Val Gly Arg Leu Ser 5650 5655 5660 Leu Lys Glu Gln Leu Ser His Arg Gln His Leu Leu Ser Glu Met Glu 5665 5670 5675 5680 Ser Leu Lys Pro Lys Val Gln Ala Val Gln Leu Cys Gln Ser Ala Leu 5685 5690 5695 Arg Ile Pro Glu Asp Val Val Ala Ser Leu Pro Leu Cys His Ala Ala 5700 5705 5710 Leu Arg Leu Gln Glu Glu Ala Ser Arg Leu Gln His Thr Ala Ile Gln 5715 5720 5725 Gln Cys Asn Ile Met Gln Glu Ala Val Val Gln Tyr Glu Gln Tyr Glu 5730 5735 5740 Gln Glu Met Lys His Leu Gln Gln Leu Ile Glu Gly Ala His Arg Glu 5745 5750 5755 5760 Ile Glu Asp Lys Pro Val Ala Thr Ser Asn Ile Gln Glu Leu Gln Ala 5765 5770 5775 Gln Ile Ser Arg His Glu Glu Leu Ala Gln Lys Ile Lys Gly Tyr Gln 5780 5785 5790 Glu Gln Ile Ala Ser Leu Asn Ser Lys Cys Lys Met Leu Thr Met Lys 5795 5800 5805 Ala Lys His Ala Thr Met Leu Leu Thr Val Thr Glu Val Glu Gly Leu 5810 5815 5820 Ala Glu Gly Thr Glu Asp Leu Asp Gly Glu Leu Leu Pro Thr Pro Ser 5825 5830 5835 5840 Ala His Pro Ser Val Val Met Met Thr Ala Gly Arg Cys His Thr Leu 5845 5850 5855 Leu Ser Pro Val Thr Glu Glu Ser Gly Glu Glu Gly Thr Asn Ser Glu 5860 5865 5870 Ile Ser Ser Pro Pro Ala Cys Arg Ser Pro Ser Pro Val Ala Asn Thr 5875 5880 5885 Asp Ala Ser Val Asn Gln Asp Ile Ala Tyr Tyr Gln Ala Leu Ser Ala 5890 5895 5900 Glu Arg Leu Gln Thr Asp Ala Ala Lys Ile His Pro Ser Thr Ser Ala 5905 5910 5915 5920 Ser Gln Glu Phe Tyr Glu Pro Gly Leu Glu Pro Ser Ala Thr Ala Lys 5925 5930 5935 Leu Gly Asp Leu Gln Arg Ser Trp Glu Thr Leu Lys Asn Val Ile Ser 5940 5945 5950 Glu Lys Gln Arg Thr Leu Tyr Glu Ala Leu Glu Arg Gln Gln Lys Tyr 5955 5960 5965 Gln Asp Ser Leu Gln Ser Ile Ser Thr Lys Met Glu Ala Ile Glu Leu 5970 5975 5980 Lys Leu Ser Glu Ser Pro Glu Pro Gly Arg Ser Pro Glu Ser Gln Met 5985 5990 5995 6000 Ala Glu His Gln Ala Leu Met Asp Glu Ile Leu Met Leu Gln Asp Glu 6005 6010 6015 Ile Asn Glu Leu Gln Ser Ser Leu Ala Glu Glu Leu Val Ser Glu Ser 6020 6025 6030 Cys Glu Ala Asp Pro Ala Glu Gln Leu Ala Leu Gln Ser Thr Leu Thr 6035 6040 6045 Val Leu Ala Glu Arg Met Ser Thr Ile Arg Met Lys Ala Ser Gly Lys 6050 6055 6060 Arg Gln Leu Leu Glu Glu Lys Leu Asn Asp Gln Leu Glu Glu Gln Arg 6065 6070 6075 6080 Gln Glu Gln Ala Leu Gln Arg Tyr Arg Cys Glu Ala Asp Glu Leu Asp 6085 6090 6095 Ser Trp Leu Leu Ser Thr Lys Ala Thr Leu Asp Thr Ala Leu Ser Pro 6100 6105 6110 Pro Lys Glu Pro Met Asp Met Glu Ala Gln Leu Met Asp Cys Gln Asn 6115 6120 6125 Met Leu Val Glu Ile Glu Gln Lys Val Val Ala Leu Ser Glu Leu Ser 6130 6135 6140 Val His Asn Glu Asn Leu Leu Leu Glu Gly Lys Ala His Thr Lys Asp 6145 6150 6155 6160 Glu Ala Glu Gln Leu Ala Gly Lys Leu Arg Arg Leu Lys Gly Ser Leu 6165 6170 6175 Leu Glu Leu Gln Arg Ala Leu His Asp Lys Gln Leu Asn Met Gln Gly 6180 6185 6190 Thr Ala Gln Glu Lys Glu Glu Ser Asp Val Asp Leu Thr Ala Thr Gln 6195 6200 6205 Ser Pro Gly Val Gln Glu Trp Leu Ala Gln Ala Arg Thr Thr Trp Thr 6210 6215 6220 Gln Gln Arg Gln Ser Ser Leu Gln Gln Gln Lys Glu Leu Glu Gln Glu 6225 6230 6235 6240 Leu Ala Glu Gln Lys Ser Leu Leu Arg Ser Val Ala Ser Arg Gly Glu 6245 6250 6255 Glu Ile Leu Ile Gln His Ser Ala Ala Glu Thr Ser Gly Asp Ala Gly 6260 6265 6270 Glu Lys Pro Asp Val Leu Ser Gln Glu Leu Gly Met Glu Gly Glu Lys 6275 6280 6285 Ser Ser Ala Glu Asp Gln Met Arg Met Lys Trp Glu Ser Leu His Gln 6290 6295 6300 Glu Phe Ser Thr Lys Gln Lys Leu Leu Gln Asn Val Leu Glu Gln Glu 6305 6310 6315 6320 Gln Glu Gln Val Leu Tyr Ser Arg Pro Asn Arg Leu Leu Ser Gly Val 6325 6330 6335 Pro Leu Tyr Lys Gly Asp Val Pro Thr Gln Asp Lys Ser Ala Val Thr 6340 6345 6350 Ser Leu Leu Asp Gly Leu Asn Gln Ala Phe Glu Glu Val Ser Ser Gln 6355 6360 6365 Ser Gly Gly Ala Lys Arg Gln Ser Ile His Leu Glu Gln Lys Leu Tyr 6370 6375 6380 Asp Gly Val Ser Ala Thr Ser Thr Trp Leu Asp Asp Val Glu Glu Arg 6385 6390 6395 6400 Leu Phe Val Ala Thr Ala Leu Leu Pro Glu Glu Thr Glu Thr Cys Leu 6405 6410 6415 Phe Asn Gln Glu Ile Leu Ala Lys Asp Ile Lys Glu Met Ser Glu Glu 6420 6425 6430 Met Asp Lys Asn Lys Asn Leu Phe Ser Gln Ala Phe Pro Glu Asn Gly 6435 6440 6445 Asp Asn Arg Asp Val Ile Glu Asp Thr Leu Gly Cys Leu Leu Gly Arg 6450 6455 6460 Leu Ser Leu Leu Asp Ser Val Val Asn Gln Arg Cys His Gln Met Lys 6465 6470 6475 6480 Glu Arg Leu Gln Gln Ile Leu Asn Phe Gln Asn Asp Leu Lys Val Leu 6485 6490 6495 Phe Thr Ser Leu Ala Asp Asn Lys Tyr Ile Ile Leu Gln Lys Leu Ala 6500 6505 6510 Asn Val Phe Glu Gln Pro Val Ala Glu Gln Ile Glu Ala Ile Gln Gln 6515 6520 6525 Ala Glu Asp Gly Leu Lys Glu Phe Asp Ala Gly Ile Ile Glu Leu Lys 6530 6535 6540 Arg Arg Gly Asp Lys Leu Gln Val Glu Gln Pro Ser Met Gln Glu Leu 6545 6550 6555 6560 Ser Lys Leu Gln Asp Met Tyr Asp Glu Leu Met Met Ile Ile Gly Ser 6565 6570 6575 Arg Arg Ser Gly Leu Asn Gln Asn Leu Thr Leu Lys Ser Gln Tyr Glu 6580 6585 6590 Arg Ala Leu Gln Asp Leu Ala Asp Leu Leu Glu Thr Gly Gln Glu Lys 6595 6600 6605 Met Ala Gly Asp Gln Lys Ile Ile Val Ser Ser Lys Glu Glu Ile Gln 6610 6615 6620 Gln Leu Leu Asp Lys His Lys Glu Tyr Phe Gln Gly Leu Glu Ser His 6625 6630 6635 6640 Met Ile Leu Thr Glu Thr Leu Phe Arg Lys Ile Ile Ser Phe Ala Val 6645 6650 6655 Gln Lys Glu Thr Gln Phe His Thr Glu Leu Met Ala Gln Ala Ser Ala 6660 6665 6670 Val Leu Lys Arg Ala His Lys Arg Gly Val Glu Leu Glu Tyr Ile Leu 6675 6680 6685 Glu Thr Trp Ser His Leu Asp Glu Asp Gln Gln Glu Leu Ser Arg Gln 6690 6695 6700 Leu Glu Val Val Glu Ser Ser Ile Pro Ser Val Gly Leu Val Glu Glu 6705 6710 6715 6720 Asn Glu Asp Arg Leu Ile Asp Arg Ile Thr Leu Tyr Gln His Leu Lys 6725 6730 6735 Ser Ser Leu Asn Glu Tyr Gln Pro Lys Leu Tyr Gln Val Leu Asp Asp 6740 6745 6750 Gly Lys Arg Leu Leu Ile Ser Ile Ser Cys Ser Asp Leu Glu Ser Gln 6755 6760 6765 Leu Asn Gln Leu Gly Glu Cys Trp Leu Ser Asn Thr Asn Lys Met Ser 6770 6775 6780 Lys Glu Leu His Arg Leu Glu Thr Ile Leu Lys His Trp Thr Arg Tyr 6785 6790 6795 6800 Gln Ser Glu Ser Ala Asp Leu Ile His Trp Leu Gln Ser Ala Lys Asp 6805 6810 6815 Arg Leu Glu Phe Trp Thr Gln Gln Ser Val Thr Val Pro Gln Glu Leu 6820 6825 6830 Glu Met Val Arg Asp His Leu Asn Ala Phe Leu Glu Phe Ser Lys Glu 6835 6840 6845 Val Asp Ala Gln Ser Ser Leu Lys Ser Ser Val Leu Ser Thr Gly Asn 6850 6855 6860 Gln Leu Leu Arg Leu Lys Lys Val Asp Thr Ala Thr Leu Arg Ser Glu 6865 6870 6875 6880 Leu Ser Arg Ile Asp Ser Gln Trp Thr Asp Leu Leu Thr Asn Ile Pro 6885 6890 6895 Ala Val Gln Glu Lys Leu His Gln Leu Gln Met Asp Lys Leu Pro Ser 6900 6905 6910 Arg His Ala Ile Ser Glu Val Met Ser Trp Ile Ser Leu Met Glu Asn 6915 6920 6925 Val Ile Gln Lys Asp Glu Asp Asn Ile Lys Asn Ser Ile Gly Tyr Lys 6930 6935 6940 Ala Ile His Glu Tyr Leu Gln Lys Tyr Lys Gly Phe Lys Ile Asp Ile 6945 6950 6955 6960 Asn Cys Lys Gln Leu Thr Val Asp Phe Val Asn Gln Ser Val Leu Gln 6965 6970 6975 Ile Ser Ser Gln Asp Val Glu Ser Lys Arg Ser Asp Lys Thr Asp Phe 6980 6985 6990 Ala Glu Gln Leu Gly Ala Met Asn Lys Ser Trp Gln Ile Leu Gln Gly 6995 7000 7005 Leu Val Thr Glu Lys Ile Gln Leu Leu Glu Gly Leu Leu Glu Ser Trp 7010 7015 7020 Ser Glu Tyr Glu Asn Asn Val Gln Cys Leu Lys Thr Trp Phe Glu Thr 7025 7030 7035 7040 Gln Glu Lys Arg Leu Lys Gln Gln His Arg Ile Gly Asp Gln Ala Ser 7045 7050 7055 Val Gln Asn Ala Leu Lys Asp Cys Gln Asp Leu Glu Asp Leu Ile Lys 7060 7065 7070 Ala Lys Glu Lys Glu Val Glu Lys Ile Glu Gln Asn Gly Leu Ala Leu 7075 7080 7085 Ile Gln Asn Lys Lys Glu Asp Val Ser Ser Ile Val Met Ser Thr Leu 7090 7095 7100 Arg Glu Leu Gly Gln Thr Trp Ala Asn Leu Asp His Met Val Gly Gln 7105 7110 7115 7120 Leu Lys Ile Leu Leu Lys Ser Val Leu Asp Gln Trp Ser Ser His Lys 7125 7130 7135 Val Ala Phe Asp Lys Ile Asn Ser Tyr Leu Met Glu Ala Arg Tyr Ser 7140 7145 7150 Leu Ser Arg Phe Arg Leu Leu Thr Gly Ser Leu Glu Ala Val Gln Val 7155 7160 7165 Gln Val Asp Asn Leu Gln Asn Leu Gln Asp Asp Leu Glu Lys Gln Glu 7170 7175 7180 Arg Ser Leu Gln Lys Phe Gly Ser Ile Thr Asn Gln Leu Leu Lys Glu 7185 7190 7195 7200 Cys His Pro Pro Val Thr Glu Thr Leu Thr Asn Thr Leu Lys Glu Val 7205 7210 7215 Asn Met Arg Trp Asn Asn Leu Leu Glu Glu Ile Ala Glu Gln Leu Gln 7220 7225 7230 Ser Ser Lys Ala Leu Leu Gln Leu Trp Gln Arg Tyr Lys Asp Tyr Ser 7235 7240 7245 Lys Gln Cys Ala Ser Thr Val Gln Gln Gln Glu Asp Arg Thr Asn Glu 7250 7255 7260 Leu Leu Lys Ala Ala Thr Asn Lys Asp Ile Ala Asp Asp Glu Val Ala 7265 7270 7275 7280 Thr Trp Ile Gln Asp Cys Asn Asp Leu Leu Lys Gly Leu Gly Thr Val 7285 7290 7295 Lys Asp Ser Leu Phe Phe Leu His Glu Leu Gly Glu Gln Leu Lys Gln 7300 7305 7310 Gln Val Asp Ala Ser Ala Ala Ser Ala Ile Gln Ser Asp Gln Leu Ser 7315 7320 7325 Leu Ser Gln His Leu Cys Ala Leu Glu Gln Ala Leu Cys Lys Gln Gln 7330 7335 7340 Thr Ser Leu Gln Ala Gly Val Leu Asp Tyr Glu Thr Phe Ala Lys Ser 7345 7350 7355 7360 Leu Glu Ala Leu Glu Ala Trp Ile Val Glu Ala Glu Glu Ile Leu Gln 7365 7370 7375 Gly Gln Asp Pro Ser His Ser Ser Asp Leu Ser Thr Ile Gln Glu Arg 7380 7385 7390 Met Glu Glu Leu Lys Gly Gln Met Leu Lys Phe Ser Ser Met Ala Pro 7395 7400 7405 Asp Leu Asp Arg Leu Asn Glu Leu Gly Tyr Arg Leu Pro Leu Asn Asp 7410 7415 7420 Lys Glu Ile Lys Arg Met Gln Asn Leu Asn Arg His Trp Ser Leu Ile 7425 7430 7435 7440 Ser Ser Gln Thr Thr Glu Arg Phe Ser Lys Leu Gln Ser Phe Leu Leu 7445 7450 7455 Gln His Gln Thr Phe Leu Glu Lys Cys Glu Thr Trp Met Glu Phe Leu 7460 7465 7470 Val Gln Thr Glu Gln Lys Leu Ala Val Glu Ile Ser Gly Asn Tyr Gln 7475 7480 7485 His Leu Leu Glu Gln Gln Arg Ala His Glu Leu Phe Gln Ala Glu Met 7490 7495 7500 Phe Ser Arg Gln Gln Ile Leu His Ser Ile Ile Ile Asp Gly Gln Arg 7505 7510 7515 7520 Leu Leu Glu Gln Gly Gln Val Asp Asp Arg Asp Glu Phe Asn Leu Lys 7525 7530 7535 Leu Thr Leu Leu Ser Asn Gln Trp Gln Gly Val Ile Arg Arg Ala Gln 7540 7545 7550 Gln Arg Arg Gly Ile Ile Asp Ser Gln Ile Arg Gln Trp Gln Arg Tyr 7555 7560 7565 Arg Glu Met Ala Glu Lys Leu Arg Lys Trp Leu Val Glu Val Ser Tyr 7570 7575 7580 Leu Pro Met Ser Gly Leu Gly Ser Val Pro Ile Pro Leu Gln Gln Ala 7585 7590 7595 7600 Arg Thr Leu Phe Asp Glu Val Gln Phe Lys Glu Lys Val Phe Leu Arg 7605 7610 7615 Gln Gln Gly Ser Tyr Ile Leu Thr Val Glu Ala Gly Lys Gln Leu Leu 7620 7625 7630 Leu Ser Ala Asp Ser Gly Ala Glu Ala Ala Leu Gln Ala Glu Leu Ala 7635 7640 7645 Glu Ile Gln Glu Lys Trp Lys Ser Ala Ser Met Arg Leu Glu Glu Gln 7650 7655 7660 Lys Lys Lys Leu Ala Phe Leu Leu Lys Asp Trp Glu Lys Cys Glu Lys 7665 7670 7675 7680 Gly Ile Ala Asp Ser Leu Glu Lys Leu Arg Thr Phe Lys Lys Lys Leu 7685 7690 7695 Ser Gln Ser Leu Pro Asp His His Glu Glu Leu His Ala Glu Gln Met 7700 7705 7710 Arg Cys Lys Glu Leu Glu Asn Ala Val Gly Ser Trp Thr Asp Asp Leu 7715 7720 7725 Thr Gln Leu Ser Leu Leu Lys Asp Thr Leu Ser Ala Tyr Ile Ser Ala 7730 7735 7740 Asp Asp Ile Ser Ile Leu Asn Glu Arg Val Glu Leu Leu Gln Arg Gln 7745 7750 7755 7760 Trp Glu Glu Leu Cys His Gln Leu Ser Leu Arg Arg Gln Gln Ile Gly 7765 7770 7775 Glu Arg Leu Asn Glu Trp Ala Val Phe Ser Glu Lys Asn Lys Glu Leu 7780 7785 7790 Cys Glu Trp Leu Thr Gln Met Glu Ser Lys Val Ser Gln Asn Gly Asp 7795 7800 7805 Ile Leu Ile Glu Glu Met Ile Glu Lys Leu Lys Lys Asp Tyr Gln Glu 7810 7815 7820 Glu Ile Ala Ile Ala Gln Glu Asn Lys Ile Gln Leu Gln Gln Met Gly 7825 7830 7835 7840 Glu Arg Leu Ala Lys Ala Ser His Glu Ser Lys Ala Ser Glu Ile Glu 7845 7850 7855 Tyr Lys Leu Gly Lys Val Asn Asp Arg Trp Gln His Leu Leu Asp Leu 7860 7865 7870 Ile Ala Ala Arg Val Lys Lys Leu Lys Glu Thr Leu Val Ala Val Gln 7875 7880 7885 Gln Leu Asp Lys Asn Met Ser Ser Leu Arg Thr Trp Leu Ala His Ile 7890 7895 7900 Glu Ser Glu Leu Ala Lys Pro Ile Val Tyr Asp Ser Cys Asn Ser Glu 7905 7910 7915 7920 Glu Ile Gln Arg Lys Leu Asn Glu Gln Gln Glu Leu Gln Arg Asp Ile 7925 7930 7935 Glu Lys His Ser Thr Gly Val Ala Ser Val Leu Asn Leu Cys Glu Val 7940 7945 7950 Leu Leu His Asp Cys Asp Ala Cys Ala Thr Asp Ala Glu Cys Asp Ser 7955 7960 7965 Ile Gln Gln Ala Thr Arg Asn Leu Asp Arg Arg Trp Arg Asn Ile Cys 7970 7975 7980 Ala Met Ser Met Glu Arg Arg Leu Lys Ile Glu Glu Thr Trp Arg Leu 7985 7990 7995 8000 Trp Gln Lys Phe Leu Asp Asp Tyr Ser Arg Phe Glu Asp Trp Leu Lys 8005 8010 8015 Ser Ser Glu Arg Thr Ala Ala Phe Pro Ser Ser Ser Gly Val Ile Tyr 8020 8025 8030 Thr Val Ala Lys Glu Glu Leu Lys Lys Phe Glu Ala Phe Gln Arg Gln 8035 8040 8045 Val His Glu Cys Leu Thr Gln Leu Glu Leu Ile Asn Lys Gln Tyr Arg 8050 8055 8060 Arg Leu Ala Arg Glu Asn Arg Thr Asp Ser Ala Cys Ser Leu Lys Gln 8065 8070 8075 8080 Met Val His Glu Gly Asn Gln Arg Trp Asp Asn Leu Gln Lys Arg Val 8085 8090 8095 Thr Ser Ile Leu Arg Arg Leu Lys His Phe Ile Gly Gln Arg Glu Glu 8100 8105 8110 Phe Glu Thr Ala Arg Asp Ser Ile Leu Val Trp Leu Thr Glu Met Asp 8115 8120 8125 Leu Gln Leu Thr Asn Ile Glu His Phe Ser Glu Cys Asp Val Gln Ala 8130 8135 8140 Lys Ile Lys Gln Leu Lys Ala Phe Gln Gln Glu Ile Ser Leu Asn His 8145 8150 8155 8160 Asn Lys Ile Glu Gln Ile Ile Ala Gln Gly Glu Gln Leu Ile Glu Lys 8165 8170 8175 Ser Glu Pro Leu Asp Ala Ala Ile Ile Glu Glu Glu Leu Asp Glu Leu 8180 8185 8190 Arg Arg Tyr Cys Gln Glu Val Phe Gly Arg Val Glu Arg Tyr His Lys 8195 8200 8205 Lys Leu Ile Arg Leu Pro Leu Pro Asp Asp Glu His Asp Leu Ser Asp 8210 8215 8220 Arg Glu Leu Glu Leu Glu Asp Ser Ala Ala Leu Ser Asp Leu His Trp 8225 8230 8235 8240 His Asp Arg Ser Ala Asp Ser Leu Leu Ser Pro Gln Pro Ser Ser Asn 8245 8250 8255 Leu Ser Leu Ser Leu Ala Gln Pro Leu Arg Ser Glu Arg Ser Gly Arg 8260 8265 8270 Asp Thr Pro Ala Ser Val Asp Ser Ile Pro Leu Glu Trp Asp His Asp 8275 8280 8285 Tyr Asp Leu Ser Arg Asp Leu Glu Ser Ala Met Ser Arg Ala Leu Pro 8290 8295 8300 Ser Glu Asp Glu Glu Gly Gln Asp Asp Lys Asp Phe Tyr Leu Arg Gly 8305 8310 8315 8320 Ala Val Gly Leu Ser Gly Asp His Ser Ala Leu Glu Ser Gln Ile Arg 8325 8330 8335 Gln Leu Gly Lys Ala Leu Asp Asp Ser Arg Phe Gln Ile Gln Gln Thr 8340 8345 8350 Glu Asn Ile Ile Arg Ser Lys Thr Pro Thr Gly Pro Glu Leu Asp Thr 8355 8360 8365 Ser Tyr Lys Gly Tyr Met Lys Leu Leu Gly Glu Cys Ser Ser Ser Ile 8370 8375 8380 Asp Ser Val Lys Arg Leu Glu His Lys Leu Lys Glu Glu Glu Glu Ser 8385 8390 8395 8400 Leu Pro Gly Phe Val Asn Leu His Ser Thr Glu Thr Gln Thr Ala Gly 8405 8410 8415 Val Ile Asp Arg Trp Glu Leu Leu Gln Ala Gln Ala Leu Ser Lys Glu 8420 8425 8430 Leu Arg Met Lys Gln Asn Leu Gln Lys Trp Gln Gln Phe Asn Ser Asp 8435 8440 8445 Leu Asn Ser Ile Trp Ala Trp Leu Gly Asp Thr Glu Glu Glu Leu Glu 8450 8455 8460 Gln Leu Gln Arg Leu Glu Leu Ser Thr Asp Ile Gln Thr Ile Glu Leu 8465 8470 8475 8480 Gln Ile Lys Lys Leu Lys Glu Leu Gln Lys Ala Val Asp His Arg Lys 8485 8490 8495 Ala Ile Ile Leu Ser Ile Asn Leu Cys Ser Pro Glu Phe Thr Gln Ala 8500 8505 8510 Asp Ser Lys Glu Ser Arg Asp Leu Gln Asp Arg Leu Ser Gln Met Asn 8515 8520 8525 Gly Arg Trp Asp Arg Val Cys Ser Leu Leu Glu Glu Trp Arg Gly Leu 8530 8535 8540 Leu Gln Asp Ala Leu Met Gln Cys Gln Gly Phe His Glu Met Ser His 8545 8550 8555 8560 Gly Leu Leu Leu Met Leu Glu Asn Ile Asp Arg Arg Lys Asn Glu Ile 8565 8570 8575 Val Pro Ile Asp Ser Asn Leu Asp Ala Glu Ile Leu Gln Asp His His 8580 8585 8590 Lys Gln Leu Met Gln Ile Lys His Glu Leu Leu Glu Ser Gln Leu Arg 8595 8600 8605 Val Ala Ser Leu Gln Asp Met Ser Cys Gln Leu Leu Val Asn Ala Glu 8610 8615 8620 Gly Thr Asp Cys Leu Glu Ala Lys Glu Lys Val His Val Ile Gly Asn 8625 8630 8635 8640 Arg Leu Lys Leu Leu Leu Lys Glu Val Ser Arg His Ile Lys Glu Leu 8645 8650 8655 Glu Lys Leu Leu Asp Val Ser Ser Ser Gln Gln Asp Leu Ser Ser Trp 8660 8665 8670 Ser Ser Ala Asp Glu Leu Asp Thr Ser Gly Ser Val Ser Pro Thr Ser 8675 8680 8685 Gly Arg Ser Thr Pro Asn Arg Gln Lys Thr Pro Arg Gly Lys Cys Ser 8690 8695 8700 Leu Ser Gln Pro Gly Pro Ser Val Ser Ser Pro His Ser Arg Ser Thr 8705 8710 8715 8720 Lys Gly Gly Ser Asp Ser Ser Leu Ser Glu Pro Gly Pro Gly Arg Ser 8725 8730 8735 Gly Arg Gly Phe Leu Phe Arg Val Leu Arg Ala Ala Leu Pro Leu Gln 8740 8745 8750 Leu Leu Leu Leu Leu Leu Ile Gly Leu Ala Cys Leu Val Pro Met Ser 8755 8760 8765 Glu Glu Asp Tyr Ser Cys Ala Leu Ser Asn Asn Phe Ala Arg Ser Phe 8770 8775 8780 His Pro Met Leu Arg Tyr Thr Asn Gly Pro Pro Pro Leu 8785 8790 8795 <210> 28 <211> 467 <212> PRT <213> Homo sapiens <400> 28 Met Trp Arg Cys Pro Leu Gly Leu Leu Leu Leu Leu Leu Pro Leu Ala Gly 1 5 10 15 His Leu Ala Leu Gly Ala Gln Gln Gly Arg Gly Arg Arg Glu Leu Ala 20 25 30 Pro Gly Leu His Leu Arg Gly Ile Arg Asp Ala Gly Gly Arg Tyr Cys 35 40 45 Gln Glu Gln Asp Leu Cys Cys Arg Gly Arg Ala Asp Asp Cys Ala Leu 50 55 60 Pro Tyr Leu Gly Ala Ile Cys Tyr Cys Asp Leu Phe Cys Asn Arg Thr 65 70 75 80 Val Ser Asp Cys Cys Pro Asp Phe Trp Asp Phe Cys Leu Gly Val Pro 85 90 95 Pro Pro Phe Pro Pro Ile Gln Gly Cys Met His Gly Gly Arg Ile Tyr 100 105 110 Pro Val Leu Gly Thr Tyr Trp Asp Asn Cys Asn Arg Cys Thr Cys Gln 115 120 125 Glu Asn Arg Gln Trp Gln Cys Asp Gln Glu Pro Cys Leu Val Asp Pro 130 135 140 Asp Met Ile Lys Ala Ile Asn Gln Gly Asn Tyr Gly Trp Gln Ala Gly 145 150 155 160 Asn His Ser Ala Phe Trp Gly Met Thr Leu Asp Glu Gly Ile Arg Tyr 165 170 175 Arg Leu Gly Thr Ile Arg Pro Ser Ser Ser Val Met Asn Met His Glu 180 185 190 Ile Tyr Thr Val Leu Asn Pro Gly Glu Val Leu Pro Thr Ala Phe Glu 195 200 205 Ala Ser Glu Lys Trp Pro Asn Leu Ile His Glu Pro Leu Asp Gln Gly 210 215 220 Asn Cys Ala Gly Ser Trp Ala Phe Ser Thr Ala Ala Val Ala Ser Asp 225 230 235 240 Arg Val Ser Ile His Ser Leu Gly His Met Thr Pro Val Leu Ser Pro 245 250 255 Gln Asn Leu Leu Ser Cys Asp Thr His Gln Gln Gln Gly Cys Arg Gly 260 265 270 Gly Arg Leu Asp Gly Ala Trp Trp Phe Leu Arg Arg Arg Gly Val Val 275 280 285 Ser Asp His Cys Tyr Pro Phe Ser Gly Arg Glu Arg Asp Glu Ala Gly 290 295 300 Pro Ala Pro Pro Cys Met Met His Ser Arg Ala Met Gly Arg Gly Lys 305 310 315 320 Arg Gln Ala Thr Ala His Cys Pro Asn Ser Tyr Val Asn Asn Asn Asp 325 330 335 Ile Tyr Gln Val Thr Pro Val Tyr Arg Leu Gly Ser Asn Asp Lys Glu 340 345 350 Ile Met Lys Glu Leu Met Glu Asn Gly Pro Val Gln Ala Leu Met Glu 355 360 365 Val His Glu Asp Phe Phe Leu Tyr Lys Gly Gly Ile Tyr Ser His Thr 370 375 380 Pro Val Ser Leu Gly Arg Pro Glu Arg Tyr Arg Arg His Gly Thr His 385 390 395 400 Ser Val Lys Ile Thr Gly Trp Gly Glu Glu Thr Leu Pro Asp Gly Arg 405 410 415 Thr Leu Lys Tyr Trp Thr Ala Ala Asn Ser Trp Gly Pro Ala Trp Gly 420 425 430 Glu Arg Gly His Phe Arg Ile Val Arg Gly Val Asn Glu Cys Asp Ile 435 440 445 Glu Ser Phe Val Leu Gly Val Trp Gly Arg Val Gly Met Glu Asp Met 450 455 460 Gly His His 465 <210> 29 <211> 372 <212> PRT <213> Homo sapiens <400> 29 Met Ser Lys Ala Phe Gly Leu Leu Arg Gln Ile Cys Gln Ser Ile Leu 1 5 10 15 Ala Glu Ser Ser Gln Ser Pro Ala Asp Leu Glu Glu Lys Lys Glu Glu 20 25 30 Asp Ser Asn Met Lys Arg Glu Gln Pro Arg Glu Arg Pro Arg Ala Trp 35 40 45 Asp Tyr Pro His Gly Leu Val Gly Leu His Asn Ile Gly Gln Thr Cys 50 55 60 Cys Leu Asn Ser Leu Ile Gln Val Phe Val Met Asn Val Asp Phe Thr 65 70 75 80 Arg Ile Leu Lys Arg Ile Thr Val Pro Arg Gly Ala Asp Glu Gln Arg 85 90 95 Arg Ser Val Pro Phe Gln Met Leu Leu Leu Leu Glu Lys Met Gln Asp 100 105 110 Ser Arg Gln Lys Ala Val Arg Pro Leu Glu Leu Ala Tyr Cys Leu Gln 115 120 125 Lys Cys Asn Val Pro Leu Phe Val Gln His Asp Ala Ala Gln Leu Tyr 130 135 140 Leu Lys Leu Trp Asn Leu Ile Lys Asp Gln Ile Thr Asp Val His Leu 145 150 155 160 Val Glu Arg Leu Gln Ala Leu Tyr Thr Ile Arg Val Lys Asp Ser Leu 165 170 175 Ile Cys Val Asp Cys Ala Met Glu Ser Ser Arg Asn Ser Ser Met Leu 180 185 190 Thr Leu Pro Leu Ser Leu Phe Asp Val Asp Ser Lys Pro Leu Lys Thr 195 200 205 Leu Glu Asp Ala Leu His Cys Phe Phe Gln Pro Arg Glu Leu Ser Ser 210 215 220 Lys Ser Lys Cys Phe Cys Glu Asn Cys Gly Lys Lys Thr Arg Gly Lys 225 230 235 240 Gln Val Leu Lys Leu Thr His Leu Pro Gln Thr Leu Thr Ile His Leu 245 250 255 Met Arg Phe Ser Ile Arg Asn Ser Gln Thr Arg Lys Ile Cys His Ser 260 265 270 Leu Tyr Phe Pro Gln Ser Leu Asp Phe Ser Gln Ile Leu Pro Met Lys 275 280 285 Arg Glu Ser Cys Asp Ala Glu Glu Gln Ser Gly Gly Gln Tyr Glu Leu 290 295 300 Phe Ala Val Ile Ala His Val Gly Met Ala Asp Ser Gly His Tyr Cys 305 310 315 320 Val Tyr Ile Arg Asn Ala Val Asp Gly Lys Trp Phe Cys Phe Asn Asp 325 330 335 Ser Asn Ile Cys Leu Val Ser Trp Glu Asp Ile Gln Cys Thr Tyr Gly 340 345 350 Asn Pro Asn Tyr His Trp Gln Glu Thr Ala Tyr Leu Leu Val Tyr Met 355 360 365 Lys Met Glu Cys 370 <210> 30 <211> 811 <212> PRT <213> Homo sapiens <400> 30 Met Asn Lys Val Glu Gln Lys Ser Gln Glu Ser Val Ser Phe Lys Asp 1 5 10 15 Val Thr Val Gly Phe Thr Gln Glu Glu Trp Gln His Leu Asp Pro Ser 20 25 30 Gln Arg Ala Leu Tyr Arg Asp Val Met Leu Glu Asn Tyr Ser Asn Leu 35 40 45 Val Ser Val Gly Tyr Cys Val His Lys Pro Glu Val Ile Phe Arg Leu 50 55 60 Gln Gln Gly Glu Glu Pro Trp Lys Gln Glu Glu Glu Phe Pro Ser Gln 65 70 75 80 Ser Phe Pro Glu Val Trp Thr Ala Asp His Leu Lys Glu Arg Ser Gln 85 90 95 Glu Asn Gln Ser Lys His Leu Trp Glu Val Val Phe Ile Asn Asn Glu 100 105 110 Met Leu Thr Lys Glu Gln Gly Asp Val Ile Gly Ile Pro Phe Asn Val 115 120 125 Asp Val Ser Ser Phe Pro Ser Arg Lys Met Phe Cys Gln Cys Asp Ser 130 135 140 Cys Gly Met Ser Phe Asn Thr Val Ser Glu Leu Val Ile Ser Lys Ile 145 150 155 160 Asn Tyr Leu Gly Lys Lys Ser Asp Glu Phe Asn Ala Cys Gly Lys Leu 165 170 175 Leu Leu Asn Ile Lys His Asp Glu Thr His Thr Gln Glu Lys Asn Glu 180 185 190 Val Leu Lys Asn Arg Asn Thr Leu Ser His His Glu Glu Thr Leu Gln 195 200 205 His Glu Lys Ile Gln Thr Leu Glu His Asn Phe Glu Tyr Ser Ile Cys 210 215 220 Gln Glu Thr Leu Leu Glu Lys Ala Val Phe Asn Thr Gln Lys Arg Glu 225 230 235 240 Asn Ala Glu Glu Asn Asn Cys Asp Tyr Asn Glu Phe Gly Arg Thr Leu 245 250 255 Cys Asp Ser Ser Ser Leu Leu Phe His Gln Ile Ser Pro Ser Arg Asp 260 265 270 Asn His Tyr Glu Phe Ser Asp Cys Glu Lys Phe Leu Cys Val Lys Ser 275 280 285 Thr Leu Ser Lys Pro His Gly Val Ser Met Lys His Tyr Asp Cys Gly 290 295 300 Glu Ser Gly Asn Asn Phe Arg Arg Lys Leu Cys Leu Ser His Leu Gln 305 310 315 320 Lys Gly Asp Lys Gly Glu Lys His Phe Glu Cys Asn Glu Cys Gly Lys 325 330 335 Ala Phe Trp Glu Lys Ser His Leu Thr Arg His Gln Arg Val His Thr 340 345 350 Gly Gln Lys Pro Phe Gln Cys Asn Glu Cys Glu Lys Ala Phe Trp Asp 355 360 365 Lys Ser Asn Leu Thr Lys His Gln Arg Ser His Thr Gly Glu Lys Pro 370 375 380 Phe Glu Cys Asn Glu Cys Gly Lys Ala Phe Ser His Lys Ser Ala Leu 385 390 395 400 Thr Leu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Gln Cys Asn 405 410 415 Ala Cys Gly Lys Thr Phe Cys Gln Lys Ser Asp Leu Thr Lys His Gln 420 425 430 Arg Thr His Thr Gly Leu Lys Pro Tyr Glu Cys Tyr Glu Cys Gly Lys 435 440 445 Ser Phe Arg Val Thr Ser His Leu Lys Val His Gln Arg Thr His Thr 450 455 460 Gly Glu Lys Pro Phe Glu Cys Leu Glu Cys Gly Lys Ser Phe Ser Glu 465 470 475 480 Lys Ser Asn Leu Thr Gln His Gln Arg Ile His Ile Gly Asp Lys Ser 485 490 495 Tyr Glu Cys Asn Ala Cys Gly Lys Thr Phe Tyr His Lys Ser Leu Leu 500 505 510 Thr Arg His Gln Ile Ile His Thr Gly Trp Lys Pro Tyr Glu Cys Tyr 515 520 525 Glu Cys Gly Lys Thr Phe Cys Leu Lys Ser Asp Leu Thr Val His Gln 530 535 540 Arg Thr His Thr Gly Gln Lys Pro Phe Ala Cys Pro Glu Cys Gly Lys 545 550 555 560 Phe Phe Ser His Lys Ser Thr Leu Ser Gln His Tyr Arg Thr His Thr 565 570 575 Gly Glu Lys Pro Tyr Glu Cys His Glu Cys Gly Lys Ile Phe Tyr Asn 580 585 590 Lys Ser Tyr Leu Thr Lys His Asn Arg Thr His Thr Gly Glu Lys Pro 595 600 605 Tyr Glu Cys Asn Glu Cys Gly Lys Ala Phe Tyr Gln Lys Ser Gln Leu 610 615 620 Thr Gln His Gln Arg Ile His Ile Gly Glu Lys Pro Tyr Lys Cys Asn 625 630 635 640 Glu Cys Gly Lys Ala Phe Cys His Lys Ser Ala Leu Ile Val His Gln 645 650 655 Arg Thr His Thr Gln Glu Lys Pro Tyr Lys Cys Asn Glu Cys Gly Lys 660 665 670 Ser Phe Cys Val Lys Ser Gly Leu Ile Phe His Glu Arg Lys His Thr 675 680 685 Gly Glu Lys Pro Tyr Glu Cys Asn Glu Cys Gly Lys Phe Phe Arg His 690 695 700 Lys Ser Ser Leu Thr Val His His Arg Ala His Thr Gly Glu Lys Ser 705 710 715 720 Cys Gln Cys Asn Glu Cys Gly Lys Ile Phe Tyr Arg Lys Ser Glu Leu 725 730 735 Ala Gln His Gln Arg Ser His Thr Gly Glu Lys Pro Tyr Glu Cys Asn 740 745 750 Thr Cys Arg Lys Thr Phe Ser Gln Lys Ser Asn Leu Ile Val His Gln 755 760 765 Arg Arg His Ile Gly Glu Asn Leu Met Asn Glu Met Asp Ile Arg Asn 770 775 780 Phe Gln Pro Gln Val Ser Leu His Asn Ala Ser Glu Tyr Ser His Cys 785 790 795 800 Gly Glu Ser Pro Asp Asp Ile Leu Asn Val Gln 805 810 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 31 tgctttcgtc ttcgccagta aa 22 <210> 32 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 32 cacccaccta gcattttaag aggaaa 26 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 33 acttagatgg tggctgagac tga 23 <210> 34 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 34 ccagggaagt tctacagtcc tct 23 <210> 35 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 35 tgtgctagtc tgtaactttc caattttct 29 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 36 tccagcacag aaagcttcag tc 22 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 37 caatagcagc tctggcaaag aaat 24 <210> 38 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 38 gcgtaaacta gagcagcgaa ga 22 <210> 39 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 39 catctgcgtt atctaggaat tcagca 26 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 40 cagtggtgtc ttttgaaaga agagg 25 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 41 aagattttgc aggatgggag tgat 24 <210> 42 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 42 cctcacctgt aaatctgagt acaagtg 27 <210> 43 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 43 ctacagactt tgagagtcaa gataaacca 29 <210> 44 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 44 gtgaagatga tgattctgat tcaagagagt 29 <210> 45 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 45 ttgtttttgt aatgcctttt ctcttattcc tc 32 <210> 46 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 46 ctttttattt ccatggtgtc atttcctatt ca 32 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 47 tatctttgca attcatatgc tttactggga 30 <210> 48 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 48 ttcttgcatt ggcagtgaaa tcg 23 <210> 49 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 49 gctatctacc aatgcactga cagt 24 <210> 50 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 50 gttcttcaag agggattgct aaatataggg 30 <210> 51 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 51 atttagaaga gccaatgctt taggaaaaa 29 <210> 52 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 52 tgagttattt tccacatttt atctggccta 30 <210> 53 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 53 tgaaaataac ctgattggct gtcatca 27 <210> 54 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 54 cagatcaga cattcccagt agtaaagatt 30 <210> 55 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 55 ataaatggaa gctgctgtga caaaac 26 <210> 56 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 56 ctaggtgcta ttacatggta tttcagacc 29 <210> 57 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 57 tcttcttcta gatcatctga atcactgct 29 <210> 58 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> BAZ2B <400> 58 tgaatgtttt ccaaaaataa agtcttgcca 30 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CDCA2 <400> 59 tatgcctgtg tcgttttgtt tttattttgt 30 <210> 60 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CDCA2 <400> 60 gggaccaat tacttttcct tcagca 26 <210> 61 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CDCA2 <400> 61 tgaagaacgt gtggcatcag at 22 <210> 62 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CDCA2 <400> 62 agaagtcatc ctttctttca cactttatgt 30 <210> 63 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> CDCA2 <400> 63 caggcaatcc ataatgttta ctcaaatct 29 <210> 64 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CDCA2 <400> 64 tttgaagtct ctgtgagctc tgaaag 26 <210> 65 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CDCA2 <400> 65 tgtgggcagc tctgtagaaa tt 22 <210> 66 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CDCA2 <400> 66 aagaccttcg ttttctaaat ccttctgtag 30 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 67 gctgtagcag tgccggatat 20 <210> 68 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 68 acatgaagtc catcagctgt caag 24 <210> 69 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 69 cttgggagca gggtgattac ag 22 <210> 70 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 70 gaagcaaaga gccctgaatg ac 22 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 71 ggcaaaggca gtgttgagac 20 <210> 72 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 72 gtgtccaggc ccaccacat 19 <210> 73 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 73 ccgggatttc ttgacagctg at 22 <210> 74 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 74 tgattccctg ctttggtcca atc 23 <210> 75 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 75 cccactctga ggacctctgt a 21 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CFP <400> 76 gaatgggcag tgctctggaa 20 <210> 77 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CHSY3 <400> 77 aagagtttct tagatcgcta aacagca 27 <210> 78 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CHSY3 <400> 78 caccatcctc ctgagaactt ctc 23 <210> 79 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CHSY3 <400> 79 attaacagtg aaactcagtc attctccttt 30 <210> 80 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> CHSY3 <400> 80 catgttttca aagttctcca tgaatctca 29 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CLCN2 <400> 81 ggctcattgg catttgtcgt 20 <210> 82 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CLCN2 <400> 82 tcacagcaca gggtgtgaaa g 21 <210> 83 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CLCN2 <400> 83 gggaccctcc tgatcagata gt 22 <210> 84 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CLCN2 <400> 84 gtccagagtc catgattctg ct 22 <210> 85 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CLCN2 <400> 85 ggttaatgac gtggtctcag cat 23 <210> 86 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CLCN2 <400> 86 gggccttatg tttgggaaca ca 22 <210> 87 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CLCN2 <400> 87 atctgaggga agcctggttt c 21 <210> 88 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CLCN2 <400> 88 cccagatgga attcatacgg aca 23 <210> 89 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 89 cctcggcacc tttcatgtac at 22 <210> 90 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 90 acatcactct ccattctctg caga 24 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 91 gtcgccgagc ttcagagaag 20 <210> 92 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 92 cccagcccag acagtatgta t 21 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 93 gggatgctga tcaaacagca 20 <210> 94 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 94 gctcccgctg tactctctg 19 <210> 95 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 95 tgaagcctgc ttcatagaga aactg 25 <210> 96 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 96 tccctaagtg ctgacttcct ct 22 <210> 97 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 97 ccaccataaa ggtattttct caaatgttcc 30 <210> 98 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 98 gagactcttt tataccactt ccaagct 27 <210> 99 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 99 acgatttcct ggtagaccac aaac 24 <210> 100 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 100 aatcagattc ttctcctggg ttgaaag 27 <210> 101 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 101 tcccttgttc ctcagtggct at 22 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 102 gtcactggcg tatcctcctt 20 <210> 103 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 103 gaagcccaag cctctgaca 19 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 104 ctgcggtaca aggtggtgat 20 <210> 105 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 105 ctggaggagg aggaacagtc a 21 <210> 106 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 106 ggaggaggag gagtcggaat c 21 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 107 gccctgggaa atctccgaaa 20 <210> 108 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DHX37 <400> 108 ggcgctacaa catcaaggg 19 <210> 109 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 109 gggaaatgat cctaccctca ctct 24 <210> 110 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 110 cctgcagcac actggttgt 19 <210> 111 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 111 ccgacagcta tgagatggag gaa 23 <210> 112 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 112 gaagaggaag atgtgttcct ttgga 25 <210> 113 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 113 tgaattcgga tgcagagctt ct 22 <210> 114 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 114 gccagcccaa aatctgtgat ct 22 <210> 115 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 115 gtgtcctctc tcctccatag gt 22 <210> 116 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 116 ggtggcacca aagctgtatt tg 22 <210> 117 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 117 ctccaggaag cctacgtgat g 21 <210> 118 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 118 cagttgagca ggtactggga g 21 <210> 119 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 119 caggaaaagt ggatgagatg tggt 24 <210> 120 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> EGFR <400> 120 tccatgtaaa atagagccat agtggaga 28 <210> 121 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCRL4 <400> 121 ggtgccagga gaatgtggta tc 22 <210> 122 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCRL4 <400> 122 cccacctgtg gtctcatttt ca 22 <210> 123 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> FCRL4 <400> 123 caacagggac tcttgtaagt atttgaga 28 <210> 124 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCRL4 <400> 124 ggctctcagg gtgaatagtt cg 22 <210> 125 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FCRL4 <400> 125 tcacagtgac attcagcacc at 22 <210> 126 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FCRL4 <400> 126 ctcctggcac cgagaggaca t 21 <210> 127 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FCRL4 <400> 127 gctcagtttc ctatccctgt catt 24 <210> 128 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> FCRL4 <400> 128 agctgggatc ttcttatccc aca 23 <210> 129 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GALNT7 <400> 129 cggaggaaga tgaggctgaa ga 22 <210> 130 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GALNT7 <400> 130 cgggtcactc accctcat 18 <210> 131 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GALNT7 <400> 131 gggtggtgat gaagatgggt atg 23 <210> 132 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GALNT7 <400> 132 gtgattaccg atacggttca gtttttg 27 <210> 133 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GALNT7 <400> 133 ccaatgcacc tgtattcttg tttcc 25 <210> 134 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GALNT7 <400> 134 ccttcccttc tttcatttcg aaatacc 27 <210> 135 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GALNT7 <400> 135 caggctgtat tctacaaggc ttct 24 <210> 136 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GALNT7 <400> 136 atctggagac ctggatcata gagac 25 <210> 137 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 137 tgcctgatgg acaatttaca aagtaca 27 <210> 138 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 138 tggaaaagca aatacttacc aaaatggtg 29 <210> 139 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 139 agcgagtcct cacctctgat ta 22 <210> 140 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 140 caaagagctg acatataacc tacccat 27 <210> 141 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 141 gggttcagaa tattggtggc atct 24 <210> 142 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 142 acaagtaaca tttacctttt ccaattgagc 30 <210> 143 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 143 tgtcaattac cacaggttta gtccttatg 29 <210> 144 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 144 ggacatggtg cccaaaggaa ata 23 <210> 145 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 145 aggttctcca tatcgagaca aaattacc 28 <210> 146 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GRIK2 <400> 146 tgccagaaca atgaagatgc ca 22 <210> 147 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL16 <400> 147 ccacagcttc ctctcgagaa aa 22 <210> 148 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IL16 <400> 148 caatagtcct gctatccagg aaca 24 <210> 149 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> IL16 <400> 149 tttctgactg catcaaaaac ttatttagcc 30 <210> 150 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IL16 <400> 150 tctgctgact tgtaaacttt ggga 24 <210> 151 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL16 <400> 151 cctgatgcag gagcttctac tg 22 <210> 152 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL16 <400> 152 caccatttgt cttaccttcc agact 25 <210> 153 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IL16 <400> 153 ggaacccatt accttctccc tcat 24 <210> 154 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL16 <400> 154 gatgacaatc gtgacaggtc cat 23 <210> 155 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LIMK2 <400> 155 gcagcctgtg ggagctttat a 21 <210> 156 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> LIMK2 <400> 156 gtgtccggca ttctgcatg 19 <210> 157 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LIMK2 <400> 157 gcttcactgg gagaccacat tg 22 <210> 158 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LIMK2 <400> 158 tttgttggtg ggactcacca tt 22 <210> 159 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LONP2 <400> 159 gttcaggttg tgggcagtaa ct 22 <210> 160 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> LONP2 <400> 160 cctcatttta caggtgttgg gaaac 25 <210> 161 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> LONP2 <400> 161 tttttctttt aggttgcaga gaacaca 27 <210> 162 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> LONP2 <400> 162 agaatgaatc acctccattt catacatcg 29 <210> 163 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LONP2 <400> 163 ctttctctag gcgcacctat gt 22 <210> 164 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> LONP2 <400> 164 acagggaatt ttccaaatct tacctca 27 <210> 165 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LONP2 <400> 165 aaagaaagct gggtcagggt tt 22 <210> 166 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LONP2 <400> 166 ctgggattcc ctcaaggtct tt 22 <210> 167 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MTFR1L <400> 167 catagaccct gcccaacatc tc 22 <210> 168 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MTFR1L <400> 168 cctcttctgg gaagttctcc attc 24 <210> 169 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MTFR1L <400> 169 tttccctggt ccaggagtga ta 22 <210> 170 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MTFR1L <400> 170 cagctcagta gtgcggctta 20 <210> 171 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MYO1G <400> 171 ctgctccagt gtgaccagt 19 <210> 172 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MYO1G <400> 172 tacaagatga cctgtgaata cacatgg 27 <210> 173 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYO1G <400> 173 actcacactg tgcacagtca tg 22 <210> 174 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MYO1G <400> 174 cctgtgtcct ctagttgctg aga 23 <210> 175 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYO1G <400> 175 cgtactcttc ctgttcctgc tt 22 <210> 176 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYO1G <400> 176 cccattacca tgcactccac aa 22 <210> 177 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYO1G <400> 177 gcccaccttc tccagtaggt ag 22 <210> 178 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MYO1G <400> 178 aaggacgtgc tgctcaagt 19 <210> 179 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 179 cacctgcacg gtgactgaa 19 <210> 180 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 180 gatcttgagc acgaagttct cct 23 <210> 181 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 181 gcccgagaac ctcagagatg 20 <210> 182 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 182 acaaggccac acatgatctt tacc 24 <210> 183 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 183 gaggaggatg atcactacat gattaatgaa 30 <210> 184 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 184 caaaccagac gcagtactca ca 22 <210> 185 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 185 gagctctcag atgagactgt gg 22 <210> 186 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 186 gatggccact cacccgatt 19 <210> 187 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 187 ccacgtgctg agcctatgtc 20 <210> 188 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 188 ctcgcgattg cgcacgaaga 20 <210> 189 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 189 gtatctttga cctcgtatgt ccttcc 26 <210> 190 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 190 cataacctcc gtctgggctt 20 <210> 191 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 191 cagctcccat gagtgatgga g 21 <210> 192 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 192 ctgccacacg gaagcggta 19 <210> 193 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 193 cacctgagca gagcgtttgt a 21 <210> 194 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 194 ctgcgtgatc ttggccgata 20 <210> 195 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 195 acctgggacc actcactcat 20 <210> 196 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OBSCN <400> 196 ccagacaggt tggaggactc a 21 <210> 197 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> OGT <400> 197 gttataatac agctctccgt ctgtgt 26 <210> 198 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> OGT <400> 198 ctgctttccc tctactatca tgctaaa 27 <210> 199 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OGT <400> 199 aacaataagg ctgcaactgg aga 23 <210> 200 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> OGT <400> 200 gtctctaaca tacttgcata ctcacgtt 28 <210> 201 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OGT <400> 201 ccagaaccaa cgaaacgtat gc 22 <210> 202 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> OGT <400> 202 cgacactgga agtgtataga tgaaagtaat 30 <210> 203 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> OGT <400> 203 tgtattggag aaataaaacc tttggcttct 30 <210> 204 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> OGT <400> 204 attaatttgg atggcacgcg tataac 26 <210> 205 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OR10AG1 <400> 205 ggtggagaag gctttagcct ttc 23 <210> 206 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> OR10AG1 <400> 206 ctcaagcttg cttgtggaaa catattt 27 <210> 207 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> OR10AG1 <400> 207 aaatatgttt ccacaagcaa gcttgag 27 <210> 208 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OR10AG1 <400> 208 gatgaaccac aaagtctgca ttcag 25 <210> 209 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PRKAG2 <400> 209 gtgccaggtc atcttacaat aattgc 26 <210> 210 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PRKAG2 <400> 210 acaacattgc cttcatacat ccaga 25 <210> 211 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRKAG2 <400> 211 ccagcaccca cctgaaacaa ta 22 <210> 212 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PRKAG2 <400> 212 gcatgagctt cagtgggatc ttc 23 <210> 213 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PRKAG2 <400> 213 cgctaaaaac tacttacaaa aagctgga 28 <210> 214 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PRKAG2 <400> 214 cagcctcttc gatgctgtat actc 24 <210> 215 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PRKAG2 <400> 215 acttctggaa aggaggtctt acct 24 <210> 216 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRKAG2 <400> 216 gacacccacg tagagttcca tg 22 <210> 217 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 217 ctctctagta caggctccga agta 24 <210> 218 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 218 aagcgatcca tatcaaactg gct 23 <210> 219 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 219 gggcaatgaa aatgaaagag agatg 25 <210> 220 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 220 gctcctctcg cttctgttct tt 22 <210> 221 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 221 ctgagcagga tgttgagtat tcagt 25 <210> 222 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 222 ccgtgccacc atttttgttc at 22 <210> 223 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 223 cccttttggc aggcctacta tg 22 <210> 224 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 224 gccatctctc tttcattttc attgcc 26 <210> 225 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 225 ctggtttcag cccgaaaaga ac 22 <210> 226 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PROX1 <400> 226 atcagtgctg tcatagattt ggtagaac 28 <210> 227 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PTPRU <400> 227 gcttgctgtc ctcatccttc tc 22 <210> 228 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PTPRU <400> 228 cagctcttag ccactattcc tctg 24 <210> 229 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PTPRU <400> 229 tggagacctt gtctcaggga c 21 <210> 230 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PTPRU <400> 230 cctcgaccag cttggtgatc 20 <210> 231 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PTPRU <400> 231 gtggaccgca gcttcaca 18 <210> 232 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PTPRU <400> 232 gggaccctat tgtctcaggt 20 <210> 233 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RGS9 <400> 233 gtcagtcggc tttttcctgt tc 22 <210> 234 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> RGS9 <400> 234 gggtctattc caggccaaga cta 23 <210> 235 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RGS9 <400> 235 cccatctgac cgtgtacacc 20 <210> 236 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RGS9 <400> 236 ctctccaagg ccactctgat g 21 <210> 237 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RGS9 <400> 237 gggatgtgtc aggaggctat ga 22 <210> 238 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RGS9 <400> 238 catggtgctg tacacaaagc tg 22 <210> 239 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> RGS9 <400> 239 catcgggctt ggagcagaa 19 <210> 240 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RGS9 <400> 240 cagaaacctg ctgaaggaca ga 22 <210> 241 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 241 atccaaagtt tcaggagatg atgttattga 30 <210> 242 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 242 tgaaatgtct tcggatgatt ctttatcagt 30 <210> 243 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 243 gatacgaatg tctccttaga agatgtga 28 <210> 244 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 244 gtttaacatt tttcccatgt aatgactcca 30 <210> 245 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 245 gacatttcag agactaatga caagcttttt 30 <210> 246 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 246 gatcccaagt cagtatttcg ttagtaaagt 30 <210> 247 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 247 gtctctgaga cccaagactc aatt 24 <210> 248 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 248 gcagttgccg agatcttttg aa 22 <210> 249 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 249 accaaatttc gagcaacatt tgaataatca 30 <210> 250 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 250 ttctgcagtg ttatttctga accga 25 <210> 251 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 251 acccataacg agtcgtctcc tt 22 <210> 252 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 252 taggatggag ttacccattt tggttttt 28 <210> 253 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 253 agaaatcaag acgatgtcac atacattca 29 <210> 254 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 254 catcccaccc tactgctgaa tc 22 <210> 255 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 255 ttcttcaagc atgccaggta ca 22 <210> 256 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 256 tacaagtgct gggaaatcca cag 23 <210> 257 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 257 ggagagcaag agtgtgtgtc ttc 23 <210> 258 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 258 acgggaacaa gaaattcctt ttgtg 25 <210> 259 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 259 ctctctaaat cttttgctgt ggattttgg 29 <210> 260 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 260 agtgatactt cactctctcc agcaa 25 <210> 261 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 261 ccagaagcac aatttttgat cgact 25 <210> 262 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SECISBP2L <400> 262 aatgttcagt acattgaata gttgtgtgtt ttt 33 <210> 263 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 263 tttgaaagga aactatcctc accaaaaga 29 <210> 264 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 264 ttcctttggc taaatatttg gaggcta 27 <210> 265 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 265 caagtgctgg ttcctctcta gt 22 <210> 266 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 266 cctgaagata cattagaatc ggcctta 27 <210> 267 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 267 gcctgttgca gctgtcagat at 22 <210> 268 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 268 agtaggccga cagttctgga tta 23 <210> 269 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 269 ctgacatctt caataacagc tccagaa 27 <210> 270 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 270 cggagttgat tctctgctcc att 23 <210> 271 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 271 ggacaaaatg aaagagtaca cactgga 27 <210> 272 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLF2 <400> 272 cagccttttt cttcaagacc attttct 27 <210> 273 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 273 caacattgag atccagcagc agta 24 <210> 274 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 274 gggcatcctg attttaggca tc 22 <210> 275 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 275 gtctctctgg atcaatgaga agatgc 26 <210> 276 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 276 ccatggccac atcaaatgtt ttaact 26 <210> 277 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 277 gtatgagcag aacagaatag ggctt 25 <210> 278 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 278 cgttctcgcg cttctggata tc 22 <210> 279 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 279 cgacctctga tcgtaaagcc aa 22 <210> 280 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 280 gctgttacct gcttgaggct tt 22 <210> 281 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 281 gcatcgagga gcggtataag ga 22 <210> 282 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 282 gcttctctgg gatctgcatg tt 22 <210> 283 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 283 tttacaacca tgttggtttt gttttcca 28 <210> 284 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 284 ggccttgttt gcatcaaaga gc 22 <210> 285 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 285 gggatcctct ttttcataca gatcaagg 28 <210> 286 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 286 gcatgttttc cattgatacc caaaagag 28 <210> 287 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 287 tcttccgcca tctcctctga ta 22 <210> 288 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SPTBN1 <400> 288 aaccgcttct ctttgtcttt ctct 24 <210> 289 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 289 acagctgtag tcttcctctg aca 23 <210> 290 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 290 ctccgattcc tccctttctg ag 22 <210> 291 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 291 tcactgagac tgtgtctcaa gact 24 <210> 292 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 292 tgtagcctca aacagatggt tcac 24 <210> 293 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 293 catactccat acctcatgtt gacttctt 28 <210> 294 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 294 aaaacaggaa aggagcttac agaaatttg 29 <210> 295 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 295 aataattgat cacaagtttg tttacattct gtt 33 <210> 296 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 296 gtggaaagca gcatcccaag c 21 <210> 297 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 297 gattgagctt ggagagccga tt 22 <210> 298 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 298 agaggaatta gatggctgta attcaaagtt 30 <210> 299 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 299 tcatagacac tctgcaattc ctgaag 26 <210> 300 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 300 cagatgatgt gagcaaacaa gtcaa 25 <210> 301 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 301 tttttgatcc actgattcca tccact 26 <210> 302 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 302 tgtgattggt tttcagtaga gatgtcaaaa 30 <210> 303 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 303 aggtaaagga cctgttccat ttctg 25 <210> 304 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 304 acagaaaact gaacttatgg atccatgaaa 30 <210> 305 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 305 gctgttgaag cagctgctta tt 22 <210> 306 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 306 tgcactttat ttgagggcag agataaataa 30 <210> 307 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 307 cctggtcttg ttacacatgc tttag 25 <210> 308 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 308 ggaggaatta gaaaagcaga tgacgt 26 <210> 309 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 309 agcttttgaa aaattcaaaa atcttctcca 30 <210> 310 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 310 ctcatttcca gagagaagac agagtaattt 30 <210> 311 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 311 tgcttatgac ccgatcctcc tt 22 <210> 312 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 312 tgcctgcctt gtaccaatgt c 21 <210> 313 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 313 gggcagctac cttgagcttt tt 22 <210> 314 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 314 cagtttaact cagacttgaa cagcatc 27 <210> 315 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 315 cttcaacagc tcattggttc gatc 24 <210> 316 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 316 ctgctcatga gtgttggtta ttatttcc 28 <210> 317 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 317 cagctgatgg atatcagaag tcgt 24 <210> 318 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 318 gggaacattg taggtaccag agaaattat 29 <210> 319 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 319 ccctgcagct gaatactact gg 22 <210> 320 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 320 gaagatggac tcaaagaatt tgatgcag 28 <210> 321 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 321 cattcgtgta ttactacttt cagtgtgga 29 <210> 322 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 322 gcaaagaaga cctagaacag aaagtg 26 <210> 323 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 323 cctactaaga ggtggttgag gac 23 <210> 324 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 324 ggtagaaagc agttctcata atctcagc 28 <210> 325 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 325 ctcatgatgt cagccccacac tt 22 <210> 326 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 326 agtattcttt cttccttccc aggatattct 30 <210> 327 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 327 ccagaatttc ctatttagta gtgcagcaa 29 <210> 328 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 328 gaacagagat tcctgtgttc agga 24 <210> 329 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 329 caatccgcag taccttctcc aa 22 <210> 330 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 330 caaaatgatc ctttcagtaa tgagaaagca 30 <210> 331 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 331 acatttgtaa cacatacacg ttgaggt 27 <210> 332 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 332 catgaacgat gctggcaatt ttctaa 26 <210> 333 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 333 ccagttctgt ttcggcgata gt 22 <210> 334 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SYNE1 <400> 334 agtaaaagat tttgggaaga gttggagaag 30 <210> 335 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TINAGL1 <400> 335 ggccatgatg cactgagtct t 21 <210> 336 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TINAGL1 <400> 336 gctcggctgt gcatcataca 20 <210> 337 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TINAGL1 <400> 337 tgattcatga gcctcttgac caag 24 <210> 338 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TINAGL1 <400> 338 gaatggattg agacacgatc ggat 24 <210> 339 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> USP18 <400> 339 ggcaaatctg tcagtccatc ct 22 <210> 340 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> USP18 <400> 340 catgcagtca agaagaggaa aacg 24 <210> 341 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> USP18 <400> 341 atgagtgttc atgtgtgtct aagtacc 27 <210> 342 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> USP18 <400> 342 tcttaccaag tgcacatcag tgatc 25 <210> 343 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> USP18 <400> 343 ccctttatag cctggttggt tt 22 <210> 344 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> USP18 <400> 344 agaaataata caaatgctca tcagcctgaa 30 <210> 345 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> USP18 <400> 345 ctggagggca gtatgagctt tt 22 <210> 346 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> USP18 <400> 346 gcaggaggca attgtggatg at 22 <210> 347 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ZNF33A <400> 347 ttaatgtgga tgtaagttct tttccttcca 30 <210> 348 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ZNF33A <400> 348 gtaacaattt cccacaggca ttaaattca 29 <210> 349 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ZNF33A <400> 349 cctcttgttc catcagatat ctccgt 26 <210> 350 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ZNF33A <400> 350 actttcacca caatcatagt gtttcataga 30

Claims (7)

mutation in the gene encoding BAZ2B, mutation in the gene encoding CDCA2, mutation in the gene encoding CFP, mutation in the gene encoding CHSY3, mutation in the gene encoding CLCN2, mutation in the gene encoding DHX37, EGFR mutation in gene encoding FAM178A (SLF2) mutation in gene encoding FAM54B (MTFR1L) mutation in gene encoding FCRL4 mutation in gene encoding GALNT7 mutation in gene encoding GRIK2 mutation, mutation in gene encoding IL16, mutation in gene encoding LIMK2, mutation in gene encoding LONP2, mutation in gene encoding MYO1G, mutation in gene encoding OBSCN, mutation in gene encoding OGT, mutation in the gene encoding OR10AG1, mutation in the gene encoding PRKAG2, mutation in the gene encoding PROX1, mutation in the gene encoding PTPRU, mutation in the gene encoding RGS9, mutation in the gene encoding RTN3, SECISBP2L Select from the group consisting of a mutation in the gene encoding SPTBN1, a mutation in the gene encoding SPTBN1, a mutation in the gene encoding SYNE1, a mutation in the gene encoding TINAGL1, a mutation in the gene encoding USP18 and a mutation in the gene encoding ZNF33A A kit for prognostic diagnosis of kidney cancer capable of detecting a mutation in at least one gene.
The method according to claim 1,
The mutation of the gene encoding BAZ2B is, in the amino acid sequence of SEQ ID NO: 1, a nonsense mutation that is E1830*, G1717V, R1565G, W1246C, S1226G, I1153K, E1064Q, R1021H, Q854K, E616D, S561N, H560Q, Q321H, H295Q and S241T at least one missense mutation selected from the group consisting of;
The CDCA2 encoding gene mutation is at least one missense mutation selected from the group consisting of S210Y, I246V, G742V and A876V in the amino acid sequence of SEQ ID NO: 2;
The gene mutation encoding the CFP is at least one selected from the group consisting of a frame shift insert (FS ins) mutation, R359Q, T151I, P144L, E135K and S27L, in the amino acid sequence of SEQ ID NO: 3, E323Gfs*34 is a missense mutation;
The gene mutation encoding CHSY3 is a missense mutation that is at least one selected from the group consisting of K299N, K619N, H622N and I628M in the amino acid sequence of SEQ ID NO: 4;
The gene mutation encoding the CLCN2 is a missense mutation that is at least one of R881H and L724P in the amino acid sequence of SEQ ID NO: 5, and at least one of E871Gfs*35 and G498Afs*14 A frame shift delete (FS del) mutation , is an in-frame insertion (IF ins) mutation that is R646dup;
The gene mutation encoding DHX37 is at least one missense mutation selected from the group consisting of K990N, S831G, A669T, L388P, R249W, M214V, and K129T in the amino acid sequence of SEQ ID NO: 6, a splice mutation that is X957_splice (chromosome C for T at position 125435351), a splice_region mutation in which the base G is substituted with A at chromosome position 125449470, a frame shift deletion mutation, E26Sfs*15;
The EGFR-encoding gene mutation is at least one missense mutation selected from the group consisting of G225C, E330K, H805R, R832H, L838M, L838P and S1042N in the amino acid sequence of SEQ ID NO: 7, L267Tfs*32, a frame shift insertion mutation ego;
The gene mutation encoding FAM178A (SLF2) is at least one missense mutation selected from the group consisting of G118R, H126R, K235N, S515C, L1048F and D1142E in the amino acid sequence of SEQ ID NO: 8, a frame shift deletion that is K235Nfs*6 is a mutation;
The gene mutation encoding FAM54B (MTFR1L) is, in the amino acid sequence of SEQ ID NO: 9, a splice mutation that is X80_splice (base G is replaced with T at chromosome position 26152903), and a missense mutation that is P94H;
The gene mutation encoding FCRL4 is a missense mutation that is at least one selected from the group consisting of a frame shift deletion mutation of L346Pfs*28, P295L, K185R, I168V and A18T in the amino acid sequence of SEQ ID NO:10;
The gene mutation encoding GALNT7 is at least one missense mutation selected from the group consisting of a frame shift insertion mutation that is R10Nfs*13, H253R, L361I, K363R and G390R in the amino acid sequence of SEQ ID NO: 11;
The gene mutation encoding GRIK2 is a missense mutation that is at least one selected from the group consisting of T425K, R748Q, K797R and N802S in the amino acid sequence of SEQ ID NO: 12, a nonsense mutation that is W613*, and a frame shift insertion mutation that is N849Kfs*11 ego;
The IL16-encoding gene mutation is at least one missense mutation selected from the group consisting of R134M, L450I, G464V, G749E and A1291V in the amino acid sequence of SEQ ID NO: 13; in the amino acid sequence of LIMK2 shown in SEQ ID NO: 14, it is a missense mutation that is at least one of L232P and P403L;
the gene mutation encoding LONP2 is at least one missense mutation selected from the group consisting of Q112H, L440V, I627M and K786E in the amino acid sequence of SEQ ID NO: 15;
The gene mutation encoding MYO1G is a missense mutation that is at least one selected from the group consisting of T698S, K418M, P225S and M166V in the amino acid sequence of SEQ ID NO: 16, or a nonsense mutation that is K418*;
The gene mutation encoding the OBSCN is at least one missense mutation selected from the group consisting of E268K, A3942V, C5529F, R6172C, E6502G, W8453R, V8800F and R8898Q in the amino acid sequence of SEQ ID NO: 17, a nonsense mutation that is Q1913* ;
the gene mutation encoding the OGT is a missense mutation that is at least one selected from the group consisting of G35V, R348S, S399F and V843I in the amino acid sequence of SEQ ID NO: 18;
the gene mutation encoding OR10AG1 is a missense mutation that is at least one of L204F and L156F in the amino acid sequence of SEQ ID NO: 19;
The gene mutation encoding the PRKAG2 is a missense mutation that is at least one selected from the group consisting of V463G, F149S and A44V in the amino acid sequence of SEQ ID NO: 20, and I391_G393delinsM in-frame deletion (in-frame delete, IF del) mutation ego;
The gene mutation encoding PROX1 is a missense mutation that is at least one selected from the group consisting of M85I, R156H, I172L, V225D and K240N in the amino acid sequence of SEQ ID NO: 21, a frame shift insertion mutation that is E139Rfs*15;
the gene mutation encoding the PTPRU is a missense mutation that is at least one selected from the group consisting of R771L, R835L and R974G in the amino acid sequence of SEQ ID NO: 22;
The gene mutation encoding RGS9 is a missense mutation that is at least one selected from the group consisting of N38K 3D, V60F 3D and R515W in the amino acid sequence of SEQ ID NO: 23, a frame shift insertion mutation that is R549Pfs*27;
The gene mutation encoding RTN3 is a missense mutation that is at least one selected from the group consisting of E260D, S312N and E622K in the amino acid sequence of SEQ ID NO: 24;
The gene mutation encoding SECISBP2L is, in the amino acid sequence of SEQ ID NO: 25, at least one missense mutation selected from the group consisting of E990D, G962S, V869E, F700L, S654I and P652R, a frame shift insertion mutation that is V789Sfs*2, C275 * is a nonsense mutation, a frame shift deletion mutation that is N193Kfs*2;
The gene mutation encoding SPTBN1 is at least one missense mutation selected from the group consisting of I45F, F855V, H1316P, A1875V 3D, N2205K 3D and G2343S in the amino acid sequence of SEQ ID NO: 26, a frame shift deletion mutation that is K1354Nfs*39 , E2007* is a nonsense mutation that is 3D;
The gene mutation encoding SYNE1 is, in the amino acid sequence of SEQ ID NO: 27, E8769V, Q8752H, R8468H, R8468S, L6746V, Q6554R, K5499T, R5087W, A4515G, Q4029H, Q2734K, L2692M, K2554N, E1651K, A1393V, K919N, G688W, A missense mutation that is at least one selected from the group consisting of M339T and T229I, a frame shift deletion mutation that is V8096Hfs*15, a nonsense mutation that is at least one selected from the group consisting of Q7230*, E7207* and Q846*, a splice mutation that is X6733_splice (C is replaced by T at chromosome position 152557951);
the gene mutation encoding TINAGL1 is a missense mutation of C226F or a frame shift deletion mutation of C309Vfs*2 in the amino acid sequence of SEQ ID NO: 28;
The gene mutation encoding USP18 is a missense mutation that is at least one selected from the group consisting of R44S, P45S, T80N and N325S in the amino acid sequence of SEQ ID NO: 29, a splice mutation that is X134_splice (base G at chromosome position 18650021 is C replaced by );
The gene mutation encoding ZNF33A is, in the amino acid sequence of SEQ ID NO: 30, a frame shift deletion mutation that is at least one of Y162* and S291Lfs*8, a missense mutation that is at least one selected from the group consisting of K166M, D272E and Y275H; A kit for prognostic diagnosis of kidney cancer.
The method according to claim 1,
SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36, SEQ ID NO: 37 and SEQ ID NO: 38, SEQ ID NO: 39 and SEQ ID NO: 40, SEQ ID NO: 41 and SEQ ID NO: for mutation detection of BAZ2B SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44, SEQ ID NO: 45 and SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48, SEQ ID NO: 49 and SEQ ID NO: 50, SEQ ID NO: 51 and SEQ ID NO: 52, SEQ ID NO: 53 and SEQ ID NO: 54, SEQ ID NO: 55 and SEQ ID NO: 56, and at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 57 and SEQ ID NO: 58;
At least one selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 59 and SEQ ID NO: 60, SEQ ID NO: 61 and SEQ ID NO: 62, SEQ ID NO: 63 and SEQ ID NO: 64, and SEQ ID NO: 65 and SEQ ID NO: 66 for CDCA2 mutation detection of primer sets;
Base sequences represented by SEQ ID NO: 67 and SEQ ID NO: 68, SEQ ID NO: 69 and SEQ ID NO: 70, SEQ ID NO: 71 and SEQ ID NO: 72, SEQ ID NO: 73 and SEQ ID NO: 74, and SEQ ID NO: 75 and SEQ ID NO: 76 for mutation detection of CFP at least one primer set selected from the group consisting of pairs;
at least one primer set selected from the nucleotide sequence pair shown in SEQ ID NO: 77 and SEQ ID NO: 78, and SEQ ID NO: 79 and SEQ ID NO: 80 for detecting CHSY3 mutation;
At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 81 and SEQ ID NO: 82, SEQ ID NO: 83 and SEQ ID NO: 84, SEQ ID NO: 85 and SEQ ID NO: 86, and SEQ ID NO: 87 and SEQ ID NO: 88 for mutation detection of CLCN2 of primer sets;
SEQ ID NO: 89 and SEQ ID NO: 90, SEQ ID NO: 91 and SEQ ID NO: 92, SEQ ID NO: 93 and SEQ ID NO: 94, SEQ ID NO: 95 and SEQ ID NO: 96, SEQ ID NO: 97 and SEQ ID NO: 98, SEQ ID NO: 99 and At least one primer selected from the group consisting of a base sequence pair represented by SEQ ID NO: 100, SEQ ID NO: 101 and SEQ ID NO: 102, SEQ ID NO: 103 and SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106, and SEQ ID NO: 107 and SEQ ID NO: 108 set;
SEQ ID NO: 109 and SEQ ID NO: 110, SEQ ID NO: 111 and SEQ ID NO: 112, SEQ ID NO: 113 and SEQ ID NO: 114, SEQ ID NO: 115 and SEQ ID NO: 116, SEQ ID NO: 117 and SEQ ID NO: 118, and SEQ ID NO: 119 for mutation detection of EGFR and at least one primer set selected from the group consisting of a nucleotide sequence pair represented by SEQ ID NO: 120;
At least one selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 121 and SEQ ID NO: 122, SEQ ID NO: 123 and SEQ ID NO: 124, SEQ ID NO: 125 and SEQ ID NO: 126, and SEQ ID NO: 127 and SEQ ID NO: 128 for mutation detection of FCRL4 of primer sets;
At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 129 and SEQ ID NO: 130, SEQ ID NO: 131 and SEQ ID NO: 132, SEQ ID NO: 133 and SEQ ID NO: 134, and SEQ ID NO: 135 and SEQ ID NO: 136 for mutation detection of GALNT7 of primer sets;
SEQ ID NO: 137 and SEQ ID NO: 138, SEQ ID NO: 139 and SEQ ID NO: 140, SEQ ID NO: 141 and SEQ ID NO: 142, SEQ ID NO: 143 and SEQ ID NO: 144, and SEQ ID NO: 145 and SEQ ID NO: 146 for mutation detection of GRIK2 at least one primer set selected from the group consisting of pairs;
At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 147 and SEQ ID NO: 148, SEQ ID NO: 149 and SEQ ID NO: 150, SEQ ID NO: 151 and SEQ ID NO: 152, and SEQ ID NO: 153 and SEQ ID NO: 154 for IL16 mutation detection of primer sets;
at least one primer set selected from the nucleotide sequence pair shown in SEQ ID NO: 155 and SEQ ID NO: 156, and SEQ ID NO: 157 and SEQ ID NO: 158 for detecting LIMK2 mutation;
At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 159 and SEQ ID NO: 160, SEQ ID NO: 161 and SEQ ID NO: 162, SEQ ID NO: 163 and SEQ ID NO: 164, and SEQ ID NO: 165 and SEQ ID NO: 166 for mutation detection of LONP2 of primer sets;
at least one primer set selected from the nucleotide sequence pair shown in SEQ ID NO: 167 and SEQ ID NO: 168, and SEQ ID NO: 169 and SEQ ID NO: 170 for detecting mutations in MTFR1L;
At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 171 and SEQ ID NO: 172, SEQ ID NO: 173 and SEQ ID NO: 174, SEQ ID NO: 175 and SEQ ID NO: 176, and SEQ ID NO: 177 and SEQ ID NO: 178 for MYO1G mutation detection of primer sets;
SEQ ID NO: 179 and SEQ ID NO: 180, SEQ ID NO: 181 and SEQ ID NO: 182, SEQ ID NO: 183 and SEQ ID NO: 184, SEQ ID NO: 185 and SEQ ID NO: 186, SEQ ID NO: 187 and SEQ ID NO: 188, SEQ ID NO: 189 and at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 190, SEQ ID NO: 191 and SEQ ID NO: 192, SEQ ID NO: 193 and SEQ ID NO: 194, and SEQ ID NO: 195 and SEQ ID NO: 196;
At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 197 and SEQ ID NO: 198, SEQ ID NO: 199 and SEQ ID NO: 200, SEQ ID NO: 201 and SEQ ID NO: 202, and SEQ ID NO: 203 and SEQ ID NO: 204 for mutation detection of OGT of primer sets;
a primer set of at least one of the nucleotide sequence pairs shown in SEQ ID NO: 205 and SEQ ID NO: 206, and SEQ ID NO: 207 and SEQ ID NO: 208 for detecting a mutation of OR10AG1;
At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 209 and SEQ ID NO: 210, SEQ ID NO: 211 and SEQ ID NO: 212, SEQ ID NO: 213 and SEQ ID NO: 214, and SEQ ID NO: 215 and SEQ ID NO: 216 for mutation detection of PRKAG2 of primer sets;
SEQ ID NO: 217 and SEQ ID NO: 218, SEQ ID NO: 219 and SEQ ID NO: 220, SEQ ID NO: 221 and SEQ ID NO: 222, SEQ ID NO: 223 and SEQ ID NO: 224, and SEQ ID NO: 225 and SEQ ID NO: 226 for mutation detection of PROX1 at least one primer set selected from the group consisting of pairs;
at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 227 and SEQ ID NO: 228, SEQ ID NO: 229 and SEQ ID NO: 230, and SEQ ID NO: 231 and SEQ ID NO: 232 for detecting mutations in PTPRU;
At least one selected from the group consisting of a base sequence pair represented by SEQ ID NO: 233 and SEQ ID NO: 234, SEQ ID NO: 235 and SEQ ID NO: 236, SEQ ID NO: 237 and SEQ ID NO: 238, and SEQ ID NO: 239 and SEQ ID NO: 240 for mutation detection of RGS9 of primer sets;
at least one primer set selected from the group consisting of a base sequence pair represented by SEQ ID NO: 241 and SEQ ID NO: 242, SEQ ID NO: 243 and SEQ ID NO: 244, and SEQ ID NO: 245 and SEQ ID NO: 246 for detecting mutations in RTN3;
SEQ ID NO: 247 and SEQ ID NO: 248, SEQ ID NO: 249 and SEQ ID NO: 250, SEQ ID NO: 251 and SEQ ID NO: 252, SEQ ID NO: 253 and SEQ ID NO: 254, SEQ ID NO: 255 and SEQ ID NO: 256, SEQ ID NO: 257 and SEQ ID NO: 257 for mutation detection of SECISBP2L at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 258, SEQ ID NO: 259 and SEQ ID NO: 260, and SEQ ID NO: 261 and SEQ ID NO: 262;
SEQ ID NO: 263 and SEQ ID NO: 264, SEQ ID NO: 265 and SEQ ID NO: 266, SEQ ID NO: 267 and SEQ ID NO: 268, SEQ ID NO: 269 and SEQ ID NO: 270, and SEQ ID NO: 271 and SEQ ID NO: 272 for mutation detection of SLF2 at least one primer set selected from the group consisting of pairs;
SEQ ID NO: 273 and SEQ ID NO: 274, SEQ ID NO: 275 and SEQ ID NO: 276, SEQ ID NO: 277 and SEQ ID NO: 278, SEQ ID NO: 279 and SEQ ID NO: 280, SEQ ID NO: 281 and SEQ ID NO: 282, SEQ ID NO: 283 and at least one primer set selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 284, SEQ ID NO: 285 and SEQ ID NO: 286, and SEQ ID NO: 287 and SEQ ID NO: 288;
SEQ ID NO: 289 and SEQ ID NO: 290, SEQ ID NO: 291 and SEQ ID NO: 292, SEQ ID NO: 293 and SEQ ID NO: 294, SEQ ID NO: 295 and SEQ ID NO: 296, SEQ ID NO: 297 and SEQ ID NO: 298, SEQ ID NO: 299 for mutation detection of SYNE1 SEQ ID NO: 300, SEQ ID NO: 301 and SEQ ID NO: 302, SEQ ID NO: 303 and SEQ ID NO: 304, SEQ ID NO: 305 and SEQ ID NO: 306, SEQ ID NO: 307 and SEQ ID NO: 308, SEQ ID NO: 309 and SEQ ID NO: 310, SEQ ID NO: 311 and SEQ ID NO: 312, SEQ ID NO: 313 and SEQ ID NO: 314, SEQ ID NO: 315 and SEQ ID NO: 316, SEQ ID NO: 317 and SEQ ID NO: 318, SEQ ID NO: 319 and SEQ ID NO: 320, SEQ ID NO: 321 and SEQ ID NO: 322, SEQ ID NO: 323 and SEQ ID NO: 324, SEQ ID NO: 325 and SEQ ID NO: 326, SEQ ID NO: 327 and SEQ ID NO: 328, SEQ ID NO: 329 and SEQ ID NO: 330, SEQ ID NO: 331 and SEQ ID NO: 332, and a base sequence pair represented by SEQ ID NO: 333 and SEQ ID NO: 334 selected from the group consisting of at least one primer set;
a primer set of at least one of SEQ ID NO: 335 and SEQ ID NO: 336, and a base sequence pair represented by SEQ ID NO: 337 and SEQ ID NO: 338 for detecting TINAGL1 mutation;
At least one selected from the group consisting of nucleotide sequence pairs represented by SEQ ID NO: 339 and SEQ ID NO: 340, SEQ ID NO: 341 and SEQ ID NO: 342, SEQ ID NO: 343 and SEQ ID NO: 344, and SEQ ID NO: 345 and SEQ ID NO: 346 for mutation detection of USP18 of primer sets; and
SEQ ID NO: 347 and SEQ ID NO: 348, and at least one primer set of the nucleotide sequence pair shown in SEQ ID NO: 349 and SEQ ID NO: 350 for detecting a mutation of ZNF33A; a primer set for prognostic diagnosis of at least one kidney cancer selected from A kit for prognostic diagnosis of kidney cancer, including.
preparing sample DNA from a sample of a renal cancer patient;
amplifying the sample DNA using the kit for prognostic diagnosis of renal cancer of claim 1; and
A method of providing information necessary for prognostic diagnosis of kidney cancer, comprising the step of confirming the presence or absence of a mutation from the amplification result.
5. The method according to claim 4,
The method provides information necessary for prognostic diagnosis of renal cancer, which predicts the overall survival rate or disease-free survival rate of renal cancer patients.
6. The method of claim 5,
DHX37, FAM178A, FCRL4, GALNT7, GRIK2, PRKAG2, USP18, BAZ2B, CDCA2, CFP, CHSY3, CLCN2, IL16, OBSCN, OR10AG1, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SPTB33A, MYO1G, and SPTBN When a mutation is identified in at least one gene selected from the gene group consisting of, determining that the survival rate of the subject is not good; Method of providing information necessary for prognostic diagnosis of kidney cancer further comprising a.
6. The method of claim 5,
TINAGL1, FAM178A (SLF2), FCRL4, PRKAG2, USP18, BAZ2B, CDCA2, CFP, CHSY3, CLCN2, IL16, OBSCN, OR10AG1, PROX1, PTPRU, RGS9, RTN3, SECISBP2L, SYNE1, ZNF33A, EGFR, FAM54B (MTFR1L) , when a mutation is identified in at least one gene selected from the gene group consisting of LIMK2 and LONP2, determining that the subject has a high recurrence rate of kidney cancer; information necessary for prognostic diagnosis of kidney cancer further comprising how to provide.

Images