KR20210074722A - Composition comprising circular RNA for treating or diagnosing vascular calcification - Google Patents

Abstract

An embodiment of the present invention provides a pharmaceutical composition for treating or preventing vascular calcification-related diseases, including circular RNA Smoc1. According to an embodiment of the present invention, since overexpression of circular RNA Smoc1 (circSmoc1) in cells reduces vascular calcification, it can be utilized to prevent or treat vascular calcification-related diseases.

Description

Composition comprising circular RNA for treating or diagnosing vascular calcification comprising circular RNA

The present invention relates to a composition for treating or preventing vascular calcification-related diseases, and a composition for diagnosis.

Vascular calcification refers to the deposition of minerals such as calcium phosphate in bones and soft tissues. Calcification in soft tissues such as blood vessels, kidneys, brain, heart, and lungs is called ectopic calcification, and pathologically, unlike in areas that are calcified normally, such as bones or teeth, pathological characteristics of disease are indicated. Extensive vascular calcification, including coronary arteries, is commonly observed in patients with chronic kidney disease. Conventional risk factors such as hypertension, diabetes, dyslipidemia, aging, and smoking influence the occurrence of vascular calcification.

Vascular calcification is classified into two types: atherosclerotic calcification and medial artery calcification. In the case of chronic kidney disease patients, the concentration of calcium-phosphorus complex is increased due to decreased renal function. If this phenomenon continues, vascular calcification occurs in the vascular smooth muscle cells constituting the medial artery. Although several drugs such as phosphate binders, active vitamin D analogs, and calcium analogs have been developed to control these vascular calcifications, vascular calcifications are still common in chronic kidney disease patients.

Several factors and mechanisms can influence the pathogenesis of vascular calcification. Vascular calcification is associated with cardiovascular disease, and cardiovascular disease is currently one of the diseases with high mortality. Therefore, for a more effective treatment of vascular calcification, it is necessary to find a new mechanism involved in the occurrence of vascular calcification.

Currently, microRNAs (miRNAs) involved in vascular calcification have been studied, but circular RNAs (circRNAs) have not yet been studied. Circular RNA is one of non-translated RNA (noncoding RNA) and is mainly generated through back-splicing. Circular RNA is mainly made from the exon region of a protein-coding gene, and is produced when a rear 5' splice site is combined with a front 3' splice site. Circular RNA lacks 5' and 3' ends and is therefore not easily digested by nucleases. Such circular RNA can function as a miRNA sponge, a protein sponge attached to RNA, or a transcription factor regulator. Recently, circular RNAs involved in translation have also been reported. In the past, circular RNA was considered a by-product of messenger RNA (mRNA), but it is starting to attract attention as it has been confirmed that a large amount of circular RNA is expressed through multiple RNA sequencing (RNA-sequencing, RNA-seq) in various tissues. did. Circular RNA has been actively studied in neurons, but studies in vascular smooth muscle cells have not been conducted much. Therefore, there was a need to study the function of circular RNA in vascular smooth muscle cells.

Numerous papers and patent documents are referenced throughout this specification and their citations are indicated. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly describe the level of the technical field to which the present invention pertains and the content of the present invention.

Korean Patent Registration No. 10-1775385

One object of the present invention is to provide a composition for treating or preventing vascular calcification-related diseases, including circular RNA, specifically circSmoc1 (SPARC related modular calcium binding 1).

Another object of the present invention is to provide a composition for diagnosing a vascular calcification-related disease comprising circular RNA, specifically circSmoc1, and a method for diagnosing a vascular calcification-related disease using the same.

The present inventors studied the role and regulation of circular RNA expressed in vascular smooth muscle cells, and the present invention based on the discovery of circular RNA Smoc1 (circSmoc1) produced by Smoc1 among circular RNAs whose expression level changes significantly upon induction of vascular calcification. was completed. The present invention is based on the finding that the expression level of circSmoc1 is significantly decreased upon induction of vascular calcification.

One aspect of the present invention provides a pharmaceutical composition for treating or preventing vascular calcification-related diseases comprising the circular RNA Smoc1.

According to an embodiment of the present invention, the circular RNA Smoc1 may include any one sequence selected from the group consisting of SEQ ID NOs: 1 to 3.

According to an embodiment of the present invention, the circular RNA Smoc1 may act as a miRNA inhibitor.

According to an embodiment of the present invention, the vascular calcification-related disease may be vascular calcification, end-stage renal failure, atherosclerosis, hypertension, myocardial infarction, or thrombosis.

Another aspect of the present invention provides a method for diagnosing vascular calcification-related diseases, comprising measuring the expression level of circular RNA Smoc1.

According to an embodiment of the present invention, in the step of measuring the expression level of the circular RNA Smoc1, a primer including one or more sequences selected from the group consisting of SEQ ID NOs: 4 to 7 may be used.

According to an embodiment of the present invention, when the expression level of the circular RNA Smoc1 is decreased, it can be determined that a vascular calcification-related disease occurs or is highly likely to occur.

Another aspect of the present invention provides a composition for diagnosis of vascular calcification disease comprising a primer comprising one or more sequences selected from the group consisting of SEQ ID NOs: 4 to 7.

According to an embodiment of the present invention, since overexpression of circular RNA Smoc1 (circSmoc1) in cells reduces vascular calcification, it can be utilized to prevent or treat vascular calcification-related diseases.

According to an embodiment of the present invention, circular RNA Smoc1 (circSmoc1) can be utilized as a biomarker usable for diagnosis of vascular calcification-related diseases. In particular, among clinical patients with a high possibility of vascular calcification, such as chronic renal failure, it is difficult to diagnose vascular calcification by conventional methods, such as vascular calcification inside blood vessels and vascular calcification around stents that are difficult to observe even on X-ray and cardiac CT It can be used as a biomarker to identify a patient or diagnose vascular calcification.

It should be understood that the effects of the present invention are not limited to the above-described effects, and include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

1 shows the change in the expression level of circSmoc1 according to the induction of vascular calcification in rat vascular smooth muscle cells.
2 shows RT-PCR results for confirming the expression of circSmoc1 in human cardiac arterial smooth muscle cells.
3 shows the results of calcium analysis confirming that calcification is reduced during circSmoc1 overexpression.
4 shows the staining results of alizarin red to confirm the calcification reduction according to the overexpression of circSmoc1.
5 shows the results of calcium analysis confirming that calcification is promoted when circSmoc1 is inhibited by siRNA treatment of circSmoc1.
6 shows the results of staining with alizarin red to confirm the results of promoting calcification according to the inhibition of circSmoc1.
7 shows the results of confirming the preservation of circSmoc1 in the UCSC gene browser in humans, mice, and rats.

Hereinafter, the present invention will be described with reference to the accompanying drawings. However, the present invention may be embodied in several different forms, and thus is not limited to the embodiments described herein.

The terms used herein are used only to describe specific embodiments, and are not intended to limit the present invention. The singular expression includes the plural expression unless the context clearly dictates otherwise. In the present specification, terms such as "comprise" or "have" are intended to designate the existence of features, numbers, steps, operations, components, parts, or combinations thereof, described in the specification, unless specifically stated to the contrary. However, it is to be understood that this does not preclude the possibility of the presence or addition of one or more other features or numbers, steps, operations, components, parts, or combinations thereof.

One aspect of the present invention provides a pharmaceutical composition for treating or preventing vascular calcification-related diseases, comprising circular RNA Smoc1 (circSmoc1).

When the circular RNA Smoc1 is silenced in cells, vascular calcification can be promoted, and when the circular RNA Smoc1 is overexpressed, vascular calcification can be reduced.

The circular RNA Smoc1 (circSmoc1) may include any one of SEQ ID NOs: 1 to 3. The circular RNA Smoc1 (circSmoc1) is formed by reverse splicing, is expressed in Smoc1, and is resistant to RNase R digestion.

The vascular calcification is one of the common complications of chronic kidney disease, and is often associated with cardiovascular disease. The vascular calcification-related disease may be vascular calcification, end-stage renal failure, atherosclerosis, hypertension, myocardial infarction or thrombosis.

The circular RNA Smoc1 can act as a miRNA inhibitor, and the function of the circular RNA Smoc1 can be inferred through microRNA (miRNA) microarray and/or luciferase reporter assay. The circular RNA Smoc1 may play an anti-calcification role by functioning as a miRNA sponge.

The circular RNA Smoc1 is expressed in cardiac smooth muscle cells in humans and is conserved in humans, rats and mice, so it can serve as a therapeutic target to solve the problem of vascular calcification ( FIGS. 2 and 7 ).

The composition comprising the circular RNA Smoc1 according to an embodiment of the present invention may exhibit therapeutic, ameliorating or preventing effects on vascular calcification-related diseases by inhibiting or resolving vascular calcification.

As used herein, the term “prevention” refers to any action that inhibits or delays the occurrence, spread, and recurrence of calcification of blood vessels by administration of the pharmaceutical composition according to an embodiment of the present invention. As used herein, the term “treatment” refers to any action that improves or beneficially changes the symptoms of an individual suspected or developed with vascular calcification by administration of the pharmaceutical composition according to an embodiment of the present invention.

The pharmaceutical composition may be administered in the form of various parenteral formulations, such as injections.

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspension solutions, emulsions, lyophilized formulations, suppositories, and the like. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerol, gelatin, etc. may be used.

An effective dosage for the human body of the pharmaceutical composition according to an embodiment of the present invention may vary depending on the patient's age, weight, sex, dosage form, health status, and disease level, and adjustment of dosage is conventional in the art. It is obvious to those skilled in the art, and according to the judgment of the doctor, it may be divided and administered once or several times a day at regular time intervals.

The pharmaceutical composition according to an embodiment of the present invention may further include a known therapeutic agent for vascular calcification-related diseases in addition to circSmoc1 as an active ingredient, and may be used in combination with other known treatments for the treatment of these diseases.

Another aspect of the present invention provides a method for diagnosing vascular calcification-related diseases, comprising measuring the expression level of circular RNA Smoc1.

According to an embodiment of the present invention, in the step of measuring the expression level of the circular RNA Smoc1, a primer including one or more sequences selected from the group consisting of SEQ ID NOs: 4 to 7 may be used.

Another aspect of the present invention provides a composition for diagnosis of vascular calcification disease comprising a primer comprising one or more sequences selected from the group consisting of SEQ ID NOs: 4 to 7.

Example

Example 1. Cell culture and calcification induction

Dulbecco's modified Eagle's medium containing 10% fetal bovine serum (FBS) by separating vascular smooth muscle cells from 6-week-old Sprague Dawley rats (Samtaco Bio Korea) ) was cultured. In the experimental group, vascular smooth muscle cells were treated with 2 mM inorganic phosphate (Pi) for 6 hours, 3 days, and 6 days, respectively, in order to induce vascular calcification, and the control group in which only the medium was replaced with a normal medium was also cultured. RNA was extracted from the cultured vascular smooth muscle cells.

A10 cells, a cell line of vascular smooth muscle cells, were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum (FBS), and used for calcium analysis and alizarin red staining.

Human coronary artery smooth muscle cells were cultured in medium 231 containing smooth muscle growth supplement or smooth muscle differentiation supplement.

Example 2. RNA Isolation and RNA Sequence Analysis

RNA was isolated from the cells cultured in Example 1 using TRIzol reagent, and the separated RNA was treated with DNase I to remove the remaining DNA from the RNA.

RNA integrity was confirmed with a bioanalyzer, ribosomal RNA was removed using the Ribo-Zero Gold rRNA removal kit, and an RNA-sequence library was created using the TruSeq Stranded Total RNA Kit. . The library was sequenced with Hiseq2500.

Example 3. Identification and quantification of circular RNA

Using Trimmomatic, the expression of circular RNA was calculated using the STAR aligner and DCC algorithm, except for the sequencing results of low quality among the sequencing results obtained from Example 2 above.

Example 4. Complementary DNA Synthesis and Amplification

The same amount of RNA was reverse transcribed using a random hexamer and RevertAid reverse transcriptase to synthesize a complementary DNA of the RNA obtained in Example 2. A rat primer (see Table 1 below) capable of confirming circular RNA expression was prepared and semi-quantitative PCR was performed. PCR results were quantified using Image J program.

As a result of the experiment, it was confirmed that the circular RNA circSmoc1 generated from the gene smoc1 was expressed in vascular smooth muscle cells with a significant change in concentration as inorganic phosphate induced vascular calcification ( FIG. 1 ).

Primer name Sequence (5'→3') product size (bp) SEQ ID NO: circ_smoc1_rat_Fwd CTG CAC GGA CGA GCC ACT GAT G 155 4 circ_smoc1_rat_Rev CAC AGC CCC TAC CTT ATG GAT TAA GC 5

In addition, human primers (see Table 2 below) were prepared and expression was confirmed by semi-quantitative PCR (FIG. 2).

Primer name Sequence (5'→3') product size (bp) SEQ ID NO: circ_smoc1_human_Fwd CTG CAC AGA AGA GCC ACT GAT G 155 6 circ_smoc1_human_Rev CAC AGC CCC AAC TCT ATG GAT TAA AC 7

Example 5. Circular RNA cloning

To construct the circSmoc1 overexpression vector, the entire circRNA sequence was synthesized with primers (see Table 3 below). The primer sequence included a part of the circular RNA exon sequence, a restriction enzyme, and a vector sequence.

For cloning, pcDNA3.1(+) Laccase2 MCS exon vector (Addgene plasmid #69893) was used as a vector for constructing a circular RNA overexpression vector. The pcDNA3.1(+) Laccase2 MCS exon vector was cut with restriction enzymes (PacI, SacII) at the site to insert the circular RNA, and circSmoc1 synthesized as a primer was inserted into the site to prepare a circSmoc1 overexpression vector.

Primer name Sequence (5'→3') product size (bp) SEQ ID NO: Smoc1_lac_L_Fwd TTTATGCAGAAATTAATTAAGTGCAGTGTCATACGTAC 325 8 Smoc1_lac_L_Rev GAATACTTACGCTCCGCGGCTGAATTTCTTACATTGG 9

Example 6. Construction of siRNA

For functional study of circular RNA, siRNA was prepared at the site where circular RNA was spliced (see Table 4 below). Horizon Discovery siDesign center was used for siRNA production, and production was completed after confirming that the siRNA sequence did not form a secondary structure inside.

Primer name Sequence (5'→3') SEQ ID NO: smoc1_siRNA_1_sense AAA UUC AGG UGC AGU GUC UUU 10 smoc1_siRNA_1_antisense UGA CAC UGC ACC UGA AUU UUU 11 smoc1_siRNA_2_sense AGA AAU UCA GGU GCA GUU UUU 12 smoc1_siRNA_2_antisense ACA CUG CAC CUG AAU UUC UUU 13

Example 7. Calcium Measurement Assay

For overexpression vector transfection (transfection), 3.5 × 10 ⁴ cells were inoculated in a 24-well plate, and one day later, 0.25 μg laccase2 vector or a vector containing circSmoc1 in laccase2 vector was transfected. For 3 days from the next day, the cells inducing calcification of the experimental group were treated with 2 mM inorganic phosphate, and the control group was cultured by changing the normal medium without inorganic phosphate. The next day, the amount of calcium was measured using QuantiChrom calcium assay kit, and the amount of protein was measured using Bio-Rad protein assay dye reagent concentrate.

On the other hand, for siRNA transfection, 2.0 × 10 ⁴ cells were inoculated in a 24-well plate, and transfected using Lipofectamine™ 3000 after 1 day, and the final concentration of siRNA was 30 nM. . Afterwards, the experimental group was treated with inorganic phosphoric acid for 3 days, and the amount of calcium and protein was measured as above.

As a result of the experiment, it was confirmed that when the vector containing circSmoc1 was transfected and overexpressed, the concentration of calcium ions was decreased compared to the case where the empty vector (EV) was transfected ( FIG. 3 ).

In addition, when circSmoc1 was knocked down by injecting sicircSmoc1_1 and sicircSmoc1_2, it was confirmed that the amount of calcium ions increased compared to the control group (FIG. 5).

Example 8. Alizarin Red Staining and Quantification

To examine the effect on vascular calcification when circSmoc1 is overexpressed or inhibited with siRNA in cells, a vascular smooth muscle cell line was inoculated into a 24-well plate. After 1 day, cells were treated with circSmoc1 overexpressing vector or siRNA. From the next day, 4 mM inorganic phosphoric acid was treated for 3 hours.

Thereafter, cells were washed with PBS and distilled water for alizarin red staining, and fixed with 10% formalin at room temperature for 1 hour. After that, formalin was removed and the cells were washed again with distilled water. When there was no water, 40 mM alizarin red solution (pH 4.2) was treated and left overnight at room temperature. To quantify alizarin red staining, 300 μL of 10% cetylpyridinium chloride was added to each well and left for 30 minutes.

Thereafter, 200 μL of the cell fluid was removed, and the microplate absorbance at 562 nM was measured using a spectrophotometer.

As a result of the experiment, it was confirmed that when circSmoc1 was overexpressed, intracellular calcium precipitation was significantly reduced (FIG. 4), and when circSmoc1 was knocked down, intracellular calcium accumulation was significantly increased (FIG. 6).

The description of the present invention described above is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. For example, each component described as a single type may be implemented in a dispersed form, and likewise components described as distributed may be implemented in a combined form.

The scope of the present invention is indicated by the following claims, and all changes or modifications derived from the meaning and scope of the claims and their equivalent concepts should be construed as being included in the scope of the present invention.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Composition comprising circular RNA for treating or diagnosing vascular calcification <130> P-190257 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 286 <212> DNA <213> Artificial Sequence <220> <223> human circSmoc1 (hg19) <400> 1 gtgcagtgcc atacttacac tgggtactgc tggtgtgtca ccccggatgg gaagcccatc 60 agtggctctt ctgtgcagaa taaaactcct gtatgttcag gttcagtcac cgacaagccc 120 ttgagccagg gtaactcagg aaggaaagat gacgggtcta agccgacacc cacgatggag 180 acccagccgg tgttcgatgg agatgaaatc acagccccaa ctctatggat taaacacttg 240 gtgatcaagg actccaaact gaacaacacc aacataagaa attcag 286 <210> 2 <211> 286 <212> DNA <213> Artificial Sequence <220> <223> rat circSmoc1 (rn6) <400> 2 gtgcagtgtc atacgtacac agggtactgc tggtgtgtca ccccagacgg gaagcccatc 60 agtggctcgt ccgtgcagaa taaaactcct gtatgttcag gtccagtcac tgacaagccc 120 ttgagccagg gtaactcagg aaggaaagat gatggctcta aacccacgcc cacgatggag 180 acccagcctg tgttcgatgg agatgaaatc acagccccta ccttatggat taagcacttg 240 gtaatcaaag actccaaatt gaataacacc aatgtaagaa attcag 286 <210> 3 <211> 319 <212> DNA <213> Artificial Sequence <220> <223> mouse circSmoc1 (mm9) <400> 3 gtgcagtgcc atacgtacac agggtactgc tggtgtgtca ccccagatgg caagcccatc 60 agtggttctt ccgtgcagaa taaaactcct gtatgttcag gtccagttac cgacaagccc 120 ttgagccagg gtaattcagg aagaaaagtc tcctttcgtt tctttttaac cctcaattca 180 gatgatggct ctaaacccac gcccacgatg gagacccaac ctgtgttcga tggagatgaa 240 atcacagccc ccaccttatg gattaagcac ttggtaatca aagactccaa gttgaataac 300 accaacgtaa gaaattcag 319 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (circ_smoc1_rat_Fwd) <400> 4 ctgcacggac gagccactga tg 22 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer (circ_smoc1_rat_Rev) <400> 5 cacagcccct accttatgga ttaagc 26 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (circ_smoc1_human_Fwd) <400> 6 ctgcacagaa gagccactga tg 22 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer (circ_smoc1_human_Rev) <400> 7 cacagcccca actctatgga ttaaac 26 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer (Smoc1_lac_L_Fwd) <400> 8 tttatgcaga aattaattaa gtgcagtgtc atacgtac 38 <210> 9 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer (Smoc1_lac_L_Rev) <400> 9 gaatacttac gctccgcggc tgaatttctt acattgg 37 <210> 10 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> primer (smoc1_siRNA_1_sense) <400> 10 aaauucaggu gcagugucuu u 21 <210> 11 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> primer (smoc1_siRNA_1_antisense) <400> 11 ugacacugca ccugaauuuu u 21 <210> 12 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> primer (smoc1_siRNA_2_sense) <400> 12 agaaauucag gugcaguuuu u 21 <210> 13 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> primer (smoc1_siRNA_2_antisense) <400> 13 acacugcacc ugaauuucuu u 21

Claims (8)

A pharmaceutical composition for treating or preventing vascular calcification-related diseases comprising circular RNA Smoc1. According to claim 1,
The circular RNA Smoc1 is a pharmaceutical composition for treating or preventing vascular calcification-related diseases, characterized in that it comprises any one sequence selected from the group consisting of SEQ ID NOs: 1 to 3. According to claim 1,
The circular RNA Smoc1 is a pharmaceutical composition for the treatment or prevention of vascular calcification-related diseases, characterized in that it acts as a miRNA inhibitor. According to claim 1,
The vascular calcification-related disease is vascular calcification, end-stage renal failure, atherosclerosis, hypertension, myocardial infarction or thrombosis, a pharmaceutical composition for treating or preventing vascular calcification-related diseases. A method for diagnosing vascular calcification-related diseases, comprising measuring the expression level of circular RNA Smoc1. 6. The method of claim 5,
In the measuring the expression level of the circular RNA Smoc1, a method for diagnosing a vascular calcification-related disease, characterized in that using a primer having one or more sequences selected from the group consisting of SEQ ID NOs: 4 to 7. 6. The method of claim 5,
A method for diagnosing a vascular calcification-related disease, characterized in that it is determined that a vascular calcification-related disease occurs or is highly likely to occur when the expression level of the circular RNA Smoc1 is reduced. A composition for diagnosis of vascular calcification disease comprising a primer having one or more sequences selected from the group consisting of SEQ ID NOs: 4 to 7.

Images