KR20210050631A - Method for producing oligosaccharides derived from isomaltulose using sugar transferase for preparing highly polymerized isomaltooligosaccharide - Google Patents

Abstract

The present invention relates to a method for preparing isomaltulose-derived oligosaccharides using a sugar transferase (TP-DDase) for preparing highly polymerized isomaltooligosaccharides. Specifically, the highly polymerized isomaltooligosaccharide production enzyme has a novel oligosaccharide production activity by reacting with isomaltulose. Therefore, it is possible to prepare highly polymerized isomaltooligosaccharides consisting only of α-1,6 bonds derived from isomaltulose.

Description

{Method for producing oligosaccharides derived from isomaltulose using sugar transferase for preparing highly polymerized isomaltooligosaccharide}

The present invention relates to a method for preparing oligosaccharides derived from isomaltulose using a sugar transfer enzyme for preparing highly polymerized isomaltooligosaccharides.

Sugars, substances that give off sweet taste, are divided into monosaccharides, disaccharides, and polysaccharides according to the number of sugar molecules. Glucose and fructose are monosaccharides with a single molecule, sucrose sugar is a disaccharide with two molecules, and oligosaccharide belongs to a polysaccharide in which three or more molecules are aggregated. Since sugars are contained in most fruits, dairy products, and grains, they can be consumed through food, supply energy, and provide mental satisfaction. Monosaccharides with smaller particles are faster to digest and consume, but polysaccharides have a low calorie level at the level of one-third of sugar because they are difficult to digest and consume, and free of biological effects that exert biological effects on individuals by stimulating the growth of symbiotic or beneficial microorganisms in the intestine. It is also called biotics, and is known to act like water-soluble dietary fiber in the body.

Excessive intake of sugar and fructose, which occupy a large amount of sugar, can increase calories to cause obesity, or increase blood triglycerides to increase the risk of adult diseases such as cardiovascular disease.In children, diseases such as tooth decay and hyperactivity disorder As the harmfulness controversy continues, such as being reported to be related to the risk of occurrence, more and more consumers are using oligosaccharides as a substitute for sugar for sweetness for health. Examples of oligosaccharides that can be easily encountered in Korea are fructooligosaccharides and isomaltoligosaccharides.

Fructo-oligosaccharide refers to a mixture of sugars with a structure similar to sugar, in which 1 to 3 fructose are bonded to the fructose residues of sugar. Its constituents are 1-Kestose (GF2), nystose (GF3), and fructosyl nystose (GF4). Isomalto-oligosaccharide (IMO) is a branched bond in the form of α-(1,4)- and/or α-(1,6)-glucoside bonds in which glucose is from 2 to 2 degrees of polymerization (DP). Refers to a 10-phosphorus saccharide and includes other high-end branched oligosaccharides such as isomaltose, panose, isomaltotriose, isomaltotetraose, and isopanose. It is known as a growth factor of bifidobacteria, which is represented by useful bacteria in the intestine. Both fructooligosaccharide and isomaltooligosaccharide belong to oligosaccharides, which are polysaccharides, but the difference between the two appears in the components that make up the oligosaccharides. Fructoligosaccharide is manufactured by connecting glucose by processing sugar (fructose + glucose), and isomaltooligosaccharide is made by connecting glucose by processing starch powder (glucose + glucose) such as rice or corn.

Bifidobacteria in the intestine have a close relationship with the health of the host such as nutrition, immunity, aging, suppression of intestinal decay substances, and synthesis of vitamins. In order to proliferate Bifidobacteria, foods containing Bifidobacteria and a Bifidobacteria growth promoting substance added to foods are being sold, and various types of oligosaccharides are being developed as a promoting substance for Bifidobacteria. Most of the fructooligosaccharides are indigestible and do not decompose in the small intestine, reach the large intestine, and promote proliferation by selectively used by the bifidus bacteria living in the intestine. Overdose is known to cause diarrhea. On the other hand, isomaltooligosaccharide is known to be excellent in safety as it is in the middle of indigestibility and digestibility, so irritation to the intestines is weak, and the maximum non-acting amount is similar to that of sugar. In recent years, as the awareness of oligosaccharides and bifidobacteria has increased in Korea, oligosaccharides have been added to various types of foods such as beverages, dairy products, and pastes. In particular, isomaltooligosaccharides with a high degree of polymerization are known to have health functional effects (Toshiyuki Kaneko et al. Biosci. Biotech. Biochem., 58(12): 2288-2290, 1994).

On the other hand, isomaltulose, also called palatinose, is a disaccharide in which dextrose and fructose have alpha-1,6 bonds, and is a sweetener component that is difficult to caries and has the characteristics of slow digestion and absorption. . It is known that general oligosaccharide-producing enzymes with sugar transfer activity do not have the activity of producing oligosaccharides using isomaltulose as a substrate.

Accordingly, the present inventors studied a method for preparing oligosaccharides using isomaltulose as a substrate, and as a result, a highly polymerized isomaltooligosaccharide-producing enzyme reacts with isomaltulose to produce novel oligosaccharides. The present invention was completed by confirming that the production of maltulose-derived highly polymerized isomaltooligosaccharide was possible.

It is an object of the present invention to provide a method for preparing a highly polymerized oligosaccharide from isomaltulose by using a sugar transfer enzyme for producing a highly polymerized isomaltooligosaccharide.

In order to achieve the above object, the present invention

1) preparing a culture obtained by culturing a transformant transformed with a recombinant vector containing a gene of glycotransferase (TP-DDase) consisting of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5;

2) obtaining a glycosyltransferase (TP-DDase) from the culture; And

3) reacting by adding the glycotransferase (TP-DDase) obtained in step 2) to isomaltulose; It provides a method for producing isomaltulose-derived isomaltooligosaccharide comprising a.

The present invention relates to a method for preparing oligosaccharides derived from isomaltulose using a sugar transfer enzyme (TP-DDase) for preparing highly polymerized isomaltooligosaccharides, wherein the enzyme for producing isomaltooligosaccharides reacts with isomaltulose to produce isomaltooligosaccharides. It is active, and from this, it is possible to prepare isomaltooligosaccharides consisting only of α-1,6 bonds derived from isomaltulose.

1 is a schematic diagram showing a nucleotide sequence encoding an oligosaccharide producing enzyme (Tt-LIMO) derived from isomaltulose derived from a Thermoanaerobacter thermocopriae strain.
2 is an image showing an isomaltulose-derived oligosaccharide-producing enzyme (Tt-LIMO) recombinant vector in which the nucleotide sequence encoding isomaltulose-derived oligosaccharide-producing enzyme (Tt-LIMO) is cloned.
3 is a diagram showing the results of SDS-PAGE analysis of isomaltulose-derived oligosaccharide enzyme (Tt-LIMO).
4 is a diagram showing the results of thin layer chromatography (TLC) analysis for each reaction substrate type of isomaltulose-derived oligosaccharide enzyme (Tt-LIMO).
5 is a diagram showing the results of HPAEC-PAD analysis for analyzing the constituent sugar content of a product produced by reacting isomaltulose and dextrin with isomaltulose-derived oligosaccharide enzyme (Tt-LIMO).
6 shows the HPAEC-PAD analysis results of a product (D) produced by reacting a maltooligosaccharide standard product (A), an isomaltooligosaccharide standard product (B), an isomaltulose standard product (C), and an oligosaccharide enzyme (Tt-LIMO). It is a diagram shown.
7 is a diagram showing a standard chromatogram for confirming Panose and IG 2 to 7 RT (IG2: isomaltose, IG3: isomaltotriose, IG4: isomaltotetraose, P: Panose).

Hereinafter, the present invention will be described in detail.

The present invention comprises the steps of: 1) preparing a culture obtained by culturing a transformant transformed with a recombinant vector containing a gene of glycotransferase (TP-DDase) consisting of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5;

2) obtaining a glycosyltransferase (TP-DDase) from the culture; And

3) reacting by adding the glycotransferase (TP-DDase) obtained in step 2) to isomaltulose; It provides a method for producing isomaltulose-derived isomaltooligosaccharide comprising a.

Another name for the isomaltulose is palatinose, which has the structure of Formula 1 below. Isomaltulose is a structural isomer of sugar that forms α-1,6 bonds of glucose and fructose. When ingested, it does not cause tooth decay, and the increase or decrease of blood insulin concentration is gentle, so it can be applied as a diabetic diet. There is an advantage that it is possible.

<Formula 1>

The reaction of step 3) refers to a reaction performed by a sugar transfer enzyme. The reaction solution generally refers to a solution containing at least one or more of a solution containing isomaltulose as a substrate, a solubilized starch, water, and any other components, and further containing an active glycotransferase thereto. The reaction solution is where the step of contacting isomaltulose, solubilized starch, and sugar transferase with water, as a substrate, is carried out. In the above reaction, the solubilized starch is transferred to isomaltulose through the activity of the sugar transfer enzyme to form a bond to generate isomaltulose-derived isomaltooligosaccharide.

The reaction between the substrates in step 3) and the sugar transfer enzyme may be performed at 20 to 60°C, preferably at 30 to 50°C.

The reaction between the substrate and the glycotransferase in step 3) may be performed for 2 to 10 hours, preferably for 3 to 9 hours, and more preferably for 4 to 8 hours.

The sugar transfer enzyme of step 3) may be added 20 to 80 µl, preferably 30 to 70 µl, and more preferably 40 to 60 µl.

The concentration of isomaltulose may be 2 to 10 mM, preferably 3 to 8 mM, and more preferably 4 to 6 mM.

The isomaltooligosaccharide produced by the above method may be an isomaltooligosaccharide having a degree of polymerization of 7 to 10.

The isomaltooligosaccharide produced by the above method may be an isomaltooligosaccharide composed of only α-1,6 bonds.

The product obtained in step 3) may be an isomaltooligosaccharide having a degree of polymerization of 4 to 10, a degree of polymerization of 5 to 9, a degree of polymerization of 6 to 8, and preferably a degree of polymerization of 7.

In addition, the product obtained in step 3) may contain 0.3 to 11.5% by weight based on the total weight, preferably 3 to 11.5% by weight, and more preferably 6 to 11.4%. I can.

In addition, in the product obtained in step 3), isomaltulose (palatinose) of <Chemical Formula 1> is arranged on the far right, and one glucose is linked to the left carbon 6 by α-1,6 bonds to polymerize oligos. It can be the same day.

In the present invention, isomaltulose-derived oligosaccharide-producing enzyme (Tt-LIMO) is used in the same meaning as a glycosyltransferase (TP-DDase) for producing highly polymerized isomaltoligosaccharide.

The glycotransferase (TP-DDase) for preparing highly polymerized isomaltooligosaccharide consisting of the amino acid sequence of SEQ ID NO: 5 can prepare isomaltooligosaccharide using isomaltulose as a substrate.

It is preferable that the isomaltooligosaccharide has the structure of Formula 1 for isomaltose having a polymerization degree of 2, and isomaltotriose having a polymerization degree of 3 in Formula 2, or isomaltooligosaccharide having a polymerization degree of 4 to 10.

<Formula 2>

<Formula 3>

<Formula 4>

The glycotransferase may be dextran dextrinase.

The highly polymerized isomaltooligosaccharide may have a degree of polymerization of 7 to 10.

The glycotransferase may be derived from a Thermoanaerobacter thermocopriae strain.

Carbohydrate activating enzymes that undergo a sugar transfer reaction are largely classified into four categories: glycosyl transferase (GTase), transglucosidases (TGase), glycoside phosphorylase (GPase), and glycoside hydrolases (GHase). Among them, glycosyl transferase (GTase) is the sugar transfer efficiency. This is good and has excellent ability to transfer sugars to various receptors.

Dextran dextrinase (DDase) is a type of glycosyl transferase (GTase), which transfers the glucosyl group end of the non-reducing end of the α-1,4 bond to the α-1,6 bond. .

The α-1,4 bond refers to a type of covalent bond in which α-D glucose molecules are connected to each other through an adjacent α-D glucose molecule ring and carbons 1 and 4.

The α-1,6 bond refers to a type of covalent bond in which α-D glucose molecules are connected to each other through an adjacent α-D glucose molecule ring and carbons 1 and 6.

Isomaltooligosaccharide of the present invention refers to a polysaccharide having a degree of polymerization of 3 to 10 in which glucose is formed by branching bonds of α-(1,4)- and/or α-(1,6)-glucoside.

The molecular weight of the isomaltooligosaccharide of the present invention can be expressed as a weight average degree of polymerization (DPw) or a number average degree of polymerization (DPn).

In the present invention, the dextran dextrinase may also be referred to as a glycosyltransferase, and may be described as DDase or TP-DDase.

In the present invention, the glycosyltransferase (TP-DDase) can produce not only isomaltooligosaccharides having a low polymerization degree of 2 to 6, but also highly polymerized isomaltooligosaccharides having a polymerization degree of 7 to 10.

In addition, the glycotransferase (TP-DDase) includes a'variant', and the'variant' refers to a protein having 90% or more homology with a glycotransferase (TP-DDase) having the amino acid sequence of SEQ ID NO: 5 Say.

The term "homology" is intended to indicate the degree of similarity with the amino acid sequence of a wild type protein, and is preferably 90 with the amino acid sequence encoding the glycotransferase (TP-DDase) of the present invention (SEQ ID NO: 5). % Or more, more preferably 95% or more, and even more preferably 98% or more of an amino acid sequence that may be identical. The comparison of homology can be performed with the naked eye or using a comparison program that is easy to purchase. Commercially available computer programs can calculate the homology between two or more sequences as a percentage (%), and the homology (%) can be calculated for adjacent sequences.

In addition, the glycotransferase (TP-DDase) or a homologue thereof of the present invention includes an amino acid sequence variant having enzymatic activity. Sequence variant refers to a protein having a sequence different from a natural amino acid sequence and one or more amino acid residues. The variant protein exhibits the same biological activity as the wild-type protein, but may be a variant in which the properties of the protein are modified. Preferably, the structural stability of the protein against heat, pH, etc. can be increased by mutations and modifications on the amino acid sequence. For example, a natural protein may exhibit enzyme activity even in strong acidity, which does not show enzyme activity, and may exhibit enzyme activity even at low or high temperatures. In addition, it may be a variant in which the substrate specificity of the glycosyltransferase is enhanced or the type of substrate reacting with the enzyme is expanded by mutations and modifications in the amino acid sequence.

The glycotransferase (TP-DDase) of the present invention can be produced through a genetic engineering method using an amino acid sequence represented by SEQ ID NO: 5 or a nucleotide sequence encoding it. In the present invention, the recombinant vector is preferably an expression vector for efficient expression of the glycotransferase (TP-DDase) gene.

In the present invention, "expression vector" refers to a recombinant vector capable of expressing a peptide of interest in a suitable host cell, and refers to a gene construct comprising essential regulatory elements operatively linked to express a gene insert. The expression vector of the present invention is an element generally possessed by a suitable expression vector and includes expression control elements such as a promoter, an operator, and an initiation codon. The start and stop codons are generally considered to be part of the nucleotide sequence encoding the polypeptide and must exhibit an action in the individual when the gene construct is administered and must be in frame with the coding sequence. The promoter of the vector can be constitutive or inducible. In addition, it may include a signal sequence for the release of the fusion polypeptide in order to facilitate the separation of the protein from the cell culture. Specific initiation signals may also be required for efficient translation of the inserted nucleic acid sequence. These signals include the ATG initiation codon and adjacent sequences. In some cases, exogenous translational control signals should be provided, which may include the ATG initiation codon. These exogenous translational control signals and initiation codons can be of a variety of natural and synthetic sources. Expression efficiency can be increased by introduction of appropriate transcriptional or translation enhancing factors.

As for the expression vector, all conventional expression vectors can be used. For example, plasmid DNA, phage DNA, or the like can be used. Specific examples of plasmid DNA include commercial plasmids such as pET28a and pET. Other examples of plasmids that can be used in the present invention include E. coli-derived plasmids (pET28a, pET, pGEX, pQE, pDEST and pCOLD), Bacillus subtilis-derived plasmids (pUB110 and pTP5), and yeast-derived plasmids ( YEp13, YEp24 and YCp50). Specific examples of phage DNA include λ-phage (Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, and λZAP). In addition, animal viruses such as retrovirus, adenovirus or vaccinia virus, insect viruses such as baculovirus may also be used, and the glycotransferase (TP-DDase) ) For efficient expression of the gene, it is preferable to use the E. coli-derived plasmids (pET28a, pET, pGEX, pQE, pDEST and pCOLD). These expression vectors have different expression levels and expressions of proteins depending on the host cell, so you can select and use the most suitable host cell for the purpose.

In the present invention, a transformant is obtained by introducing the recombinant vector of the present invention into a host suitable for the expression vector used when constructing the recombinant vector. Types of host include Esherichia, Pseudomonas, Ralstonia, Alcaligenes, Comamonas, Burkholderia, Agrobacterium, Flavobacterium, Vibrio, Enterobacter, Rhizobium, Gluconobacter, Acinetobacter ), Moraxella, Nitrosomonas, Aeromonas, Paracoccus, Bacillus, Clostridium, Lactobacillus (Lactobacillus), Corynebacterium, Arthrobacter, Achromobacter, Micrococcus, Mycobacterium, Streptococcus ), Streptomyces, Actinomyces, Nocardia, and methylobacterium. In addition to the above bacteria, yeasts such as Saccharomyces genus and Candida genus, and various fungi can be used as hosts. In the present invention, using one E. coli selected from the group consisting of BL21 (DE3), Rosetta (DE3), Rosetta2 (DE3), ArcticExpress (DE3), STAR (DE3), C41 (DE3) and C43 (DE3) as a host It is more preferable. When bacteria such as E. coli are used as a host, the recombinant vector of the present invention is capable of autonomous replication in the host itself, and is necessary for expression of a promoter, DNA containing a glycotransferase gene, and transcription termination sequence. It is desirable to have a configuration. As a method for introducing recombinant DNA into bacteria, the calcium chloride method, the electroporation method (Method Enzymol., 194, 182-187 (1990)), and the spheroplast method (Proc. atl. Acad. Sci. USA, 84, 1929) -1933 (1978)), lithium acetate method (J. Bacteriol., 153, 63-168 (1983)), etc. can be used.

In addition, the recombinant vector is a fragment for inhibiting expression having various functions for inhibiting, amplifying, or inducing expression, or for the purpose of secretion of a resistant gene against an antibiotic or a marker for selection of a transformant or outside the microbial cells. It is also possible to include a gene or the like encoding a signal.

In the present invention, the preparation of glycosyltransferase (TP-DDase) is performed after generating and accumulating a glycosyltransferase (TP-DDase), which is a gene product, in a culture (cultured cells or culture supernatant) in which the transformant is cultivated. , By obtaining a glycosyltransferase (TP-DDase) from the culture.

As a method of culturing the transformant of the present invention, a conventional method used for culturing a host may be used.

In addition, as a cultivation method, any method used for cultivation of ordinary microorganisms, such as a batch type, a flow batch type, a continuous culture type, and a reactor type, can be used. Examples of the medium for transformants obtained using bacteria such as E. coli as a host include complete medium or synthetic medium such as LB medium and M9 medium. In addition, the cultivation temperature can be cultivated in the range of the above-mentioned appropriate temperature to accumulate and recover the glycotransferase in the cells.

Carbon sources necessary for the growth of microorganisms include, for example, sugars such as glucose, fructose, sucrose, maltose, galactose, and starch; Lower alcohols such as ethanol, propanol and butanol; polyhydric alcohols such as glycerol; Organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid, and gluconic acid; Fatty acids, such as propionic acid, butanoic acid, pentanoic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, and dodecanoic acid, can be used.

Examples of the nitrogen source include ammonium salts such as ammonia, ammonium chloride, ammonium sulfate, and ammonium phosphate, as well as those derived from natural products such as peptone, meat juice, yeast extract, malt extract, casein decomposition product, and corn steep liquor. In addition, examples of the inorganic substance include first potassium phosphate, second potassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, and the like. In addition, antibiotics such as kanamycin, ampicillin, tetracycline, chloramphenicol, and streptomycin may be added to the culture solution.

In the case of culturing the transformed microorganism, a desired protein can be produced by adding an inducer suitable for the type of promoter to the medium. As an example of the inducer, isopropyl-β-D-thiogalactopyranoside (IPTG), tetracycline, indoleacrylic acid (IAA), and the like may be used as the inducer. Acquisition and purification of the glycotransferase can be accomplished by centrifugal recovery of the cells or supernatant from the culture to be obtained, and cell disruption, extraction, affinity chromatography, cation or anion exchange chromatography, gel filtration, etc., alone or in an appropriate combination. Can be done. Confirmation that the obtained purified material is the target enzyme can be performed by a conventional method, for example, SDS-polyacrylamide gel electrophoresis (SDS-PAGE), western blotting, or the like.

In addition, cultivation of a transformant using a microorganism as a host, production of glycotransferase (TP-DDase) by the transformant and accumulation in the cells, and recovery of glycotransferase (TP-DDase) from the cells are described above. It is not limited to the method of.

In a specific embodiment of the present invention, the present inventors use the gene encoding the glycolytic enzyme Tt-LIMO isolated from the thermoan aerobacter thermocopria strain, and cut 2463 bp of Tt-ILMO with restriction enzymes EcoRI and XhoI. Preparation of an oligosaccharide derived from isomaltulose, a glycotransferase (TP-DDase), in a transformant prepared by preparing a recombinant vector including the encoding nucleotide sequence (see FIGS. 1 and 2) and introducing the recombinant vector into E. coli The enzyme was produced. As a result of reacting the glycotransferase with isomaltulose substrate and soluble starch, it was confirmed that isomaltooligosaccharides with a long polymerization degree of constituent sugars consisting of only α-1,6 bonds and having a degree of polymerization of 7 can be produced ( 4 to 6).

Therefore, unlike a general oligosaccharide-producing enzyme that does not have activity to produce oligosaccharides using isomaltulose as a substrate, the method for producing isomaltulose using the oligosaccharide-producing enzyme derived from isomaltulose, the sugar transfer enzyme of the present invention, is isomaltulose. As a substrate, an expensive high polymerization degree of isomaltooligosaccharide having a degree of polymerization of 2 to 7 consisting only of α-1,6 bonds can be prepared.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following Examples and Experimental Examples.

<Example 1> Preparation of a recombinant expression vector and transformant comprising a sequence encoding isomaltulose-derived isomaltoligosaccharide producing enzyme (Tt-LIMO)

<1-1> Amplification of nucleotide sequence encoding isomaltulose-derived isomaltooligosaccharide producing enzyme (Tt-LIMO)

In order to produce a glycotransferase (TP-DDase), isomaltulose-derived isomaltooligosaccharide producing enzyme (Tt-LIMO) protein, the nucleotide sequence encoding the enzyme was amplified.

Specifically, using the DNA isolated from the thermoanaerobacter thermocopriae (Thermoanaerobacter thermocopriae) strain (RIKEN, Tokyo, Japan) as a template, the base of Table 1 including restriction enzyme sites (EcoRI, XhoI) Polymerase chain reaction (PCR) was performed using a primer pair having a sequence.

As a result, a base encoding TP-DDase containing 2463 bp (SEQ ID NO: 2) of the C-terminus of the entire gene (cyclic isomaltooligosaccharide glycotransferase, cyclo-isomaltooligosacharride glucanotransferase, TPCITase; 4680 bp) (SEQ ID NO: 1) A PCR product of the sequence was obtained (Fig. 1).

Sequence number Sequence (5'-3') SEQ ID NO: 3 (forward direction) GGATCCCCGGAATTCATGATTTATGTAAAGCGTACGATAACCAC SEQ ID NO: 4 (reverse direction) ATGCGGCCGCTCGAGTTAAAAATCAGGTAATCGTAGATCAAACC

<1-2> Preparation of recombinant vector and transformant

For the cloning of glycotransferase (TP-DDase), the PCR product (TP-DDase) obtained in large quantities through the polymerase chain reaction (PCR) was used in the expression vector pET28a() using restriction enzymes NdeI and XhoI. A recombinant vector (Tt-LIMO plasmid vector) was constructed.

The prepared recombinant vector was transformed into E. coli BL21 (DE3) strain following a conventional transformation method. After analyzing the activity of the isomaltulose-derived isomaltooligosaccharide producing enzyme (Tt-LIMO) of the produced transformant, the transformant showing the highest activity was isolated, and the introduced isomaltulose-derived isomalto The amino acid sequence of SEQ ID NO: 5 was obtained by analyzing the nucleotide sequence encoding the oligosaccharide producing enzyme (Tt-LIMO).

<Example 2> Isomaltooligosaccharide-producing enzyme derived from isomaltulose (Tt-LIMO) Manufacturing and recovery of

The transformant into which the nucleotide sequence encoding the isomaltulose-derived isomaltooligosaccharide producing enzyme (Tt-LIMO) prepared in <Example 1-2> was introduced was prepared in 500 ml of 50 µg/ml kanamycin. LB (Difco, Sparks, MD, USA) to obtain a colony of transformants containing a nucleotide sequence encoding the enzyme isomaltulose-derived isomaltooligosaccharide production enzyme was plated on a flask containing medium, and pre-cultured at 37°C. . When the optical density (OD) of the culture medium during cultivation became 0.5 at 600 nm, 0.1 mM isoprophyl-β-D-1-thiogalactopyranoside (IPTG), which is a protein expression inducing agent, was added, and 150 rev/during at 18° C. for 21 hours. Incubated with stirring at min. The cultured cells were recovered by centrifugation for 10 minutes at 10000 rpm and 4° C., suspended in 25 ml of lysis buffer, and disrupted using a sonicator. After centrifuging the cell lysate at 12,000 rpm for 30 minutes, the obtained supernatant was loaded onto a DEAE-650M column and purified. As an adsorbent for protein, a 20 mM sodium phosphate buffer (pH 7.4) was used, and purification was completed by taking the protein not adsorbed to the column. The purity of the finally purified protein was confirmed by 10% Tris-Glycine SDS-PAGE Gel analysis. The analysis result of the SDS-PAGE electrophoresis analysis is shown in FIG. 3, and it was confirmed that a recombinant protein of 92.4 kDa, which is an expected size of isomaltulose-derived isomaltooligosaccharide producing enzyme (Tt-LIMO), was successfully produced (FIG. 3 ).

<Example 3> Product analysis by isomaltulose-derived isomaltooligosaccharide producing enzyme (Tt-LIMO) using thin layer chromatography (TLC) analysis

<3-1> Reaction of isomaltulose-derived isomaltooligosaccharide-producing enzyme (Tt-LIMO) with substrate

By using various monosaccharides and disaccharides as an acceptor, the soluble starch is transferred from the soluble starch to another donor in the state of being bound to the enzyme active site, according to the type of binding and the degree of polymerization. Reactivity was confirmed.

Substrates include glucose, manose, fructose, galactose, rhamnose, arabinose, ribose, palatinose, and melibiose. (melibiose) was used, and isomaltulose-derived isomaltooligosaccharide prepared in <Example 2> was prepared in 50 μL of 80 mM BR buffer (pH 5.5) containing 5 mM final concentration of each substrate (Tt- LIMO) 50 μL was added and reacted at 40° C. for 6 hours. Then, the reaction was stopped by heating at 100° C. for 5 minutes, and then analyzed by thin layer chromatography (TLC).

<3-2> Thin layer chromatography (TLC) analysis

To measure substrate specificity, 4 mM acceptor (glucose, mannose, fructose, galactose, rhamnose, arabinose, ribose, palatinose, melibiose, kojibiose, sophorose, maltose, cellobiose, isomaltose, gentiobiose, trehalose, sucrose, raffinose, lactose) were added, and the enzyme was added thereto, followed by reaction at 40°C for 3 hours. Thereafter, the reaction was stopped by treatment at 100° C. for 5 minutes and analyzed by TLC. After dropping onto a 60F254 silica gel plate, the mixture was developed using a solvent having a composition of nitromethane/1-propanol/water (2:5:1.5, v/v/v). The developed TLC was colored with a solution of 0.03 g naphthol, 100 mL of H2SO4, and 900 mL of methanol, and the pattern was confirmed.

As a result, as shown in Figure 4, among the substrates used, palatinose acts as an acceptor to isomaltulose-derived isomaltooligosaccharide-producing enzyme (Tt-LIMO), which is another donor, soluble It was confirmed that the polymerization reaction of oligosaccharides occurred by reacting with soluble starch (FIG. 4).

<Example 4> Product analysis by isomaltulose-derived isomaltooligosaccharide producing enzyme (Tt-LIMO) using HPAEC-PAD (High Performance Anion Exchange Chromatography with pulsed amperometric detection) analysis

After each substrate was treated by the method of <Example 3-1>, HPAEC-PAD analysis was performed.

<4-1> HPAEC-PAD analysis

As analysis instruments, DIONEX ICS-5000+ SP (Thermo Fisher Scientific, USA) and DIONEX ICS-5000+ DC (Thermo Fisher Scientific) were used, and HPAEC-PAD analysis was performed according to the analysis conditions shown in Table 2 below.

Column CarboPacPA-200 Eluent 1 D.W. Eluent 2 500mM NaOH Eluent 3 1M Na-Acetate Gradient condition time E1 E2 E3 0.00 78.0 22.0 00.0 20.00 80.0 18.0 02.0 30.00 65.0 20.0 15.0 70.00 00.0 30.0 70.0 80.00 78.0 22.0 00.0 Flow Rate 0.5ml/min Detection Pulsed amperometry, gold electrode

As a result, after checking the retention time (RT) in Table 3 below and setting the analysis conditions for separating all components of the product, isomaltulose-derived isomaltooligosaccharide-producing enzyme (Tt-LIMO) was performed for each substrate type. Qualitative and quantitative analysis of the reaction product was performed, and the RT values of the material used as the standard are shown in Table 3.

Per composition Retention Time (RT) (min) Glucose (G1) 2.767 Isomaltose (IM2) 3.484 Isomaltotriose (IM3) 4.900 Maltose (M2) 6.00 Isomaltotetraose (IM4) 7.400 Panose 9.899 Isomaltopentaose (IM5) 10.500 Maltotriose (M3) 13.217 Isomaltohexaose (IM6) 13.967 Isomaltoheptaose (IM7) 16.834 19.667 22.80 Maltopentaose (M5) 27.32 Maltohexaose (M6) 31.63 Maltoheptaose (M7) 35.08

<3-2> Product analysis of isomaltulose substrate

Transglucosidease, which is used for the production of general isomaltooligosaccharide, uses maltose as a substrate and is mainly used to prepare short isomaltooligosaccharides (IMO, DP 2-3), which uses isomaltulose (palatinose) as a substrate. It was not reported to have glycosyltransfer activity, and it was confirmed that the polymerized activity was shown using starch as a donor as a result of the substrate-specific reaction by applying the developed high-polymerization isomaltooligosaccharide-producing enzyme. As a result of HPAEC-PAD analysis of the reaction product, the peak of the product was confirmed at a location different from the substances of the maltooligosaccharide series (MOs) and isomaltooligosaccharide series (IMOs) that were put as standard products, and this can be inferred through the TLC reaction result. Therefore, the constituent sugars of the reactants of the highly polymerized isomaltooligosaccharide-reducing enzyme (Tt-LIMO) and the substrate mixture derived from the thermophilic strain are the single component of the isomaltulose substrate (acceptor) due to the TP-LIMO action. reducing end) As a result of hydrolysis and sugar transfer reaction, isomaltulose derived isomaltulose (G ⁶ + ¹ palatinos (6.96), G ⁶ + ¹ G ⁶ + ¹ palatinose (10.03), G ⁶ + ¹ G ⁶ + ¹ G ⁶ + ¹ palatinose (14.33)) were identified.

<3-3> Analysis of products of maltooligosaccharide-based substrates

Constructed using the retention time of the product when a maltooligosaccharide-based substrate (G2: maltose, G3: maltotriose, G4: maltotetraose, G5: maltopentaose) and isomaltulose-derived isomaltooligosaccharide producing enzyme (Tt-LIMO) are reacted. The degree of polymerization of sugar was analyzed.

As a result, as shown in FIG. 6, α-1,4 bonds of maltooligosaccharide were hydrolyzed to generate glucose, and α-1,6 bonds were generated through the sugar transfer reaction to the non-reducing end, and the composition in the reaction solution Among the sugars, 44-51% of glucose was produced. As shown in Table 4 below, isomaltooligosaccharides having a polymerization degree of 6 or less accounted for 38 to 40% of the total product, and isomaltooligosaccharides having a polymerization degree of 7 or more accounted for 2.1 to 6.3%. In addition, the substrate with the highest ratio of isomaltooligosaccharide in the product was maltotetraose (M4). When a maltooligosaccharide-based substrate is used, double and triple peaks are found when isomaltooligosaccharides with a degree of polymerization of 6 or more are generated, which is not an isomaltooligosaccharide consisting of pure α-1,6 bonds, but isomaalto where α-1,4 bonds are present at the same time. It was confirmed to be an oligosaccharide.

Substrate/Product Non-isomaltooligosaccharide (%) DP 6 or less Isomaltooligosaccharide (%) DP 7 or higher Isomaltooligosaccharide (%) maltose 58.8188 38.0334 3.1478 Maltotriose 58.077 39.7637 2.1593 Maltotetraose 53.8184 39.8555 6.3261 Maltopentaose 59.5695 38.2983 2.1322

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Method for producing oligosaccharides derived from isomaltulose using sugar transferase for preparing highly polymerized isomaltooligosaccharide <130> 2019p-09-026 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 4680 <212> DNA <213> Artificial Sequence <220> <223> TPCITase coding sequence <400> 1 atgttgtctc tttatagaag aaaactcttt ataacaattt taatagtaat tttcgtgttg 60 tctaactttt tcacattatt tacttatcct atctcaccag gagtttctgt tgcttatgcc 120 gcttcaacag gtaatttgat tcaacgggtt tatacagata aagctcgata taatccaggg 180 gatcttgtta ccattagtgc tgatttaatt aataaaactg gttcgacatg gtccggcact 240 ttaactcttc agattaataa actagaaagc caaatttaca ctgcaagtca gtcagttact 300 cttgccaatg gggattcaac tacaatcaca tttacatgga ctgctccacc taccgacttt 360 gttggttatt atgccggaat tgcggcagga agtacagatt tcaatggaac aggtatcgat 420 gtaagttcct ctccgcttcg gtttcctcgc tatggtttta tctcaaactt tcctgtttca 480 cagactgccc agcaatccac agatatagtt aaacagatgg tggaagacta tcatcttaat 540 atttttcaat tttacgactg gatgtggcgg catgagaagc taattaagcg aaccaatgga 600 gttatagatt ctacttgggt ggatcttttt gatcgcacac tttcttggca aactatacaa 660 aacaatgttg cagcagttca ttcctttaat gcttatgcca tggcttacgc tatgagttat 720 gcagctcgtg aaggatatga acaaatgtgg ggaatcagcc ctagctgggg tatctttcaa 780 gatacggcac atcaaagcca gtttaacgtg gattttcata atggcaagtt tctgtggctt 840 tttaatccag caaatgtgaa ttggcagagt tggatcatta gtgaatacaa agatgctatc 900 aatacggcag gttttgatgg catacagatc gatcaaatgg ggcagcgaga caatgtttac 960 gattatacta gcttttccgt tactttgcct agtacattcg ctcagtttct tcaacaagtt 1020 aagtcagaat tagaatctaa taatgcaaaa aaaaatgttg ttacttttaa tattgttgat 1080 ggtacagtga acggttgggg ggcgggagaa attgctcgtt atggtgccag cgactttgac 1140 ttcagcgaga tttggtggaa agctaacaca tataatgatc tccgaaatta catcgaatgg 1200 ctcaggcaaa acaatggtgg caagcctgtt gtacttgcag cttatatgaa ttacaacgag 1260 gaatacggtc caatatatga agctgaatcc gctattctat caggcgttag tgtcaataca 1320 aaccattctg gttatacggg cactggcttt gtcgatgggt ttgaaacggt gggtgattct 1380 atcacgtgga caattgactt ccctgagact ggtgattatt cgtttgtttt tcgttatgca 1440 aatgccactg gtgctactgc tactcgtaat gtttatgtag atggacgatt tctgggacaa 1500 gtctcatttg ctaatcaggt ggattgggat acttgggcga cggacgcgtg gattcaaata 1560 gagggactta ctgctggtac tcatagtgtg acattaaagt atgacagtga caatataggc 1620 gctataaacg tcgatcattt aactcttgga gagtttgagg aacattcagt tcgattggca 1680 gatgcaatga tgtttgctag cggtgctaca cacattgagc ttggtgatac taatcagatg 1740 ttagcgcatg aatattatcc gaaccgttcc aagtcaatgc gtaattctct caaggcagcg 1800 atgagagact actatagttt tgctactgct tatgaaaatt tactctttga tcctgatata 1860 gttccagctg accaaggcaa ccaatggatt gcactgacaa ccggacaacc tttaagcggc 1920 aacggaactt ctggtactat ttggcaaatg attaaacgca agtctgatta tgatatcata 1980 catttgatta atctaatggg caatgatgat cagtggcgta acccagctgt tcagcctact 2040 ttccaaagca acattggagt taaatactat ccaggaccta atgccgctgt cagtggcgta 2100 tatcttgcca gtccggatct cgatcacggt atgaccattc cactcactta tacgacgggt 2160 aatgatagcc gaggtaacta tatccagttt gttgtgccaa gcttaaagta ctgggatatg 2220 atttatgtaa agcgtacgat aaccacaccg ccagatggac agtatgaagc agaatatgct 2280 attaaaagtg gcactaacat caataccgat catacaggat atactggcag cggttttgta 2340 gacaactttg atgctagtga taaaggtgta tcgtttatta taaatgttcc aactagtgat 2400 acctacacgc ttcgattccg atatggaaac ggcggtacta ctattgccac gcgaacttta 2460 tttattgatg gtcagtatgc aggtactctc caattccgaa atctttataa ctgggatgtg 2520 tgggatacag tggaaaccac tgtgtggctt tcagcgggtg ttcatcaagt ggtactttgg 2580 tacagttccg aaaatgatgg tgctattaat cttgataacc tgattgttct acaacaaact 2640 actccaacaa gaacttcggc tcgctccttt tggatgaata actggtccaa cttgataggt 2700 attcacatgg ctagcaaatt aagcccgact gataatggaa attatggccc tcgcctggct 2760 gaacttcatt tcagaggcga ttggcctact aatcaaatcg tagatgcaac tgcttttttc 2820 cgagatgaaa cggatcttac tcccataaag tataccaatg ctcatagctt tgattctgaa 2880 gcatggtttg aaaacgacgg gactcttacc gtgagatatc tgacctataa tggctcagcc 2940 ttgccagtac agattaccaa acaatacgcc atggtgccta accaaaattt tcttgtgatc 3000 aaatatactt ttttaaacca gacaagtagc gcacgtactt taaactttct agaacaagtt 3060 catttgaaca acaggactag tagcgatccg aatccagggt ggcaacatgg ctggtgggac 3120 gtgagtcgaa atgcacttgg tactgacatg agccagactg gtcagttcta tattgaattg 3180 ggtgcttttc agactatgga tagttatcag gtgggtaatg acgccgattc caatcctaac 3240 agtcagacgt catcaccgtg gtatcagttc gacgccaacg gtgttctaaa taggtgcggt 3300 gatctttggt cacagaatct tagcatgggt tttcagaaac ttattaccgt gcctgctgga 3360 ggtagtgtaa cattggcttt ttattatgct atcggttcaa ctcaggagga agcggaagca 3420 gcagcagatt tagctcgatc tcagacagct gactactggt ttacccaaac tgctgccgag 3480 tataataatt ggcttaacag cggccagcgg gttaatacgt ctgatattgg tatcaatact 3540 gcctttgatc ggagcctcat cataaacaaa caggcacaac atccggagtt tggttcctgg 3600 cccgcggcta caaatccctc ttatcagtac aaggtgtggg ttcgtgactc agctgtaaca 3660 gctatgggaa tggatgctgc taatcatctt tctgaggcgg aaaagtattg gaactggatg 3720 gcctctgttc aaaatacaga tgggacatgg catacaaatt ataatgtatg gaaggcaaat 3780 gaatggatct cgtttgtgga gcctgaacac gatgccattg gactttttct catcggggtt 3840 tatcaacatt acagtttact caaatcccgc gattcctcgg cagcgacgac ttttctgaat 3900 aacatttgga cgcagataac ccgcgctggt gatttcatct acaaaaacat tggcgcttct 3960 gggtttggtc cggctgatgc ttctatctgg gaggagcagg tcgagtataa tatttttact 4020 caagttactt atgccgcagg attgaatgct ggacggttgt tagcccaaga aaaaggtgat 4080 attactcgtt caaataacta tttgtcgggt gctcaaacca tcaaggatgc gattctacga 4140 tcgtttttgt cttcaccacg aggtctctgg aataaatcta atcgctattt taatcgggcg 4200 atcaatacag acggtacagc gcgaacgacg gttgatgctt catcggactt gatttgggtt 4260 tttggtctcc tttcaccgac tgatactagg attcgagatc accgcattaa ggtactatca 4320 cggctgaccc atgataggta cggcattgct cgatatgaaa acgatgagtt ctattattct 4380 agtccatata gccccggtgg acagtatgag gctggcgcag ccgaaccagt ttggccacaa 4440 atgactatgt acgcgtctat gattgagcat tggaggggtg atgatgccac tgcactggct 4500 cggcttaagt ggtatgtcag ccgaactgct cgcggctatg tcacacccgg tgaagctgtg 4560 gactggacca atggtcaacc gcttatcagt acagcagttg aaccagtaac gggctcctgg 4620 tttcagatgg cggtccttac ttacttaaac cggtttgatc tacgattacc tgatttttaa 4680 4680 <210> 2 <211> 2463 <212> DNA <213> Artificial Sequence <220> <223> DDase coding sequence <400> 2 atgatttatg taaagcgtac gataaccaca ccgccagatg gacagtatga agcagaatat 60 gctattaaaa gtggcactaa catcaatacc gatcatacag gatatactgg cagcggtttt 120 gtagacaact ttgatgctag tgataaaggt gtatcgttta ttataaatgt tccaactagt 180 gatacctaca cgcttcgatt ccgatatgga aacggcggta ctactattgc cacgcgaact 240 ttatttattg atggtcagta tgcaggtact ctccaattcc gaaatcttta taactgggat 300 gtgtgggata cagtggaaac cactgtgtgg ctttcagcgg gtgttcatca agtggtactt 360 tggtacagtt ccgaaaatga tggtgctatt aatcttgata acctgattgt tctacaacaa 420 actactccaa caagaacttc ggctcgctcc ttttggatga ataactggtc caacttgata 480 ggtattcaca tggctagcaa attaagcccg actgataatg gaaattatgg ccctcgcctg 540 gctgaacttc atttcagagg cgattggcct actaatcaaa tcgtagatgc aactgctttt 600 ttccgagatg aaacggatct tactcccata aagtatacca atgctcatag ctttgattct 660 gaagcatggt ttgaaaacga cgggactctt accgtgagat atctgaccta taatggctca 720 gccttgccag tacagattac caaacaatac gccatggtgc ctaaccaaaa ttttcttgtg 780 atcaaatata cttttttaaa ccagacaagt agcgcacgta ctttaaactt tctagaacaa 840 gttcatttga acaacaggac tagtagcgat ccgaatccag ggtggcaaca tggctggtgg 900 gacgtgagtc gaaatgcact tggtactgac atgagccaga ctggtcagtt ctatattgaa 960 ttgggtgctt ttcagactat ggatagttat caggtgggta atgacgccga ttccaatcct 1020 aacagtcaga cgtcatcacc gtggtatcag ttcgacgcca acggtgttct aaataggtgc 1080 ggtgatcttt ggtcacagaa tcttagcatg ggttttcaga aacttattac cgtgcctgct 1140 ggaggtagtg taacattggc tttttattat gctatcggtt caactcagga ggaagcggaa 1200 gcagcagcag atttagctcg atctcagaca gctgactact ggtttaccca aactgctgcc 1260 gagtataata attggcttaa cagcggccag cgggttaata cgtctgatat tggtatcaat 1320 actgcctttg atcggagcct catcataaac aaacaggcac aacatccgga gtttggttcc 1380 tggcccgcgg ctacaaatcc ctcttatcag tacaaggtgt gggttcgtga ctcagctgta 1440 acagctatgg gaatggatgc tgctaatcat ctttctgagg cggaaaagta ttggaactgg 1500 atggcctctg ttcaaaatac agatgggaca tggcatacaa attataatgt atggaaggca 1560 aatgaatgga tctcgtttgt ggagcctgaa cacgatgcca ttggactttt tctcatcggg 1620 gtttatcaac attacagttt actcaaatcc cgcgattcct cggcagcgac gacttttctg 1680 aataacattt ggacgcagat aacccgcgct ggtgatttca tctacaaaaa cattggcgct 1740 tctgggtttg gtccggctga tgcttctatc tgggaggagc aggtcgagta taatattttt 1800 actcaagtta cttatgccgc aggattgaat gctggacggt tgttagccca agaaaaaggt 1860 gatattactc gttcaaataa ctatttgtcg ggtgctcaaa ccatcaagga tgcgattcta 1920 cgatcgtttt tgtcttcacc acgaggtctc tggaataaat ctaatcgcta ttttaatcgg 1980 gcgatcaata cagacggtac agcgcgaacg acggttgatg cttcatcgga cttgatttgg 2040 gtttttggtc tcctttcacc gactgatact aggattcgag atcaccgcat taaggtacta 2100 tcacggctga cccatgatag gtacggcatt gctcgatatg aaaacgatga gttctattat 2160 tctagtccat atagccccgg tggacagtat gaggctggcg cagccgaacc agtttggcca 2220 caaatgacta tgtacgcgtc tatgattgag cattggaggg gtgatgatgc cactgcactg 2280 gctcggctta agtggtatgt cagccgaact gctcgcggct atgtcacacc cggtgaagct 2340 gtggactgga ccaatggtca accgcttatc agtacagcag ttgaaccagt aacgggctcc 2400 tggtttcaga tggcggtcct tacttactta aaccggtttg atctacgatt acctgatttt 2460 taa 2463 <210> 3 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer1 forward <400> 3 ggatccccgg aattcatgat ttatgtaaag cgtacgataa ccac 44 <210> 4 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer2 reverse <400> 4 atgcggccgc tcgagttaaa aatcaggtaa tcgtagatca aacc 44 <210> 5 <211> 821 <212> PRT <213> Artificial Sequence <220> <223> TP-DDase <400> 5 Asp Met Ile Tyr Val Lys Arg Thr Ile Thr Thr Pro Pro Asp Gly Gln 1 5 10 15 Tyr Glu Ala Glu Tyr Ala Ile Lys Ser Gly Thr Asn Ile Asn Thr Asp 20 25 30 His Thr Gly Tyr Thr Gly Ser Gly Phe Val Asp Asn Phe Asp Ala Ser 35 40 45 Asp Lys Gly Val Ser Phe Ile Ile Asn Val Pro Thr Ser Asp Thr Tyr 50 55 60 Thr Leu Arg Phe Arg Tyr Gly Asn Gly Gly Thr Thr Ile Ala Thr Arg 65 70 75 80 Thr Leu Phe Ile Asp Gly Gln Tyr Ala Gly Thr Leu Gln Phe Arg Asn 85 90 95 Leu Tyr Asn Trp Asp Val Trp Asp Thr Val Glu Thr Thr Val Trp Leu 100 105 110 Ser Ala Gly Val His Gln Val Val Leu Trp Tyr Ser Ser Glu Asn Asp 115 120 125 Gly Ala Ile Asn Leu Asp Asn Leu Ile Val Leu Gln Gln Thr Thr Pro 130 135 140 Thr Arg Thr Ser Ala Arg Ser Phe Trp Met Asn Asn Trp Ser Asn Leu 145 150 155 160 Ile Gly Ile His Met Ala Ser Lys Leu Ser Pro Thr Asp Asn Gly Asn 165 170 175 Tyr Gly Pro Arg Leu Ala Glu Leu His Phe Arg Gly Asp Trp Pro Thr 180 185 190 Asn Gln Ile Val Asp Ala Thr Ala Phe Phe Arg Asp Glu Thr Asp Leu 195 200 205 Thr Pro Ile Lys Tyr Thr Asn Ala His Ser Phe Asp Ser Glu Ala Trp 210 215 220 Phe Glu Asn Asp Gly Thr Leu Thr Val Arg Tyr Leu Thr Tyr Asn Gly 225 230 235 240 Ser Ala Leu Pro Val Gln Ile Thr Lys Gln Tyr Ala Met Val Pro Asn 245 250 255 Gln Asn Phe Leu Val Ile Lys Tyr Thr Phe Leu Asn Gln Thr Ser Ser 260 265 270 Ala Arg Thr Leu Asn Phe Leu Glu Gln Val His Leu Asn Asn Arg Thr 275 280 285 Ser Ser Asp Pro Asn Pro Gly Trp Gln His Gly Trp Trp Asp Val Ser 290 295 300 Arg Asn Ala Leu Gly Thr Asp Met Ser Gln Thr Gly Gln Phe Tyr Ile 305 310 315 320 Glu Leu Gly Ala Phe Gln Thr Met Asp Ser Tyr Gln Val Gly Asn Asp 325 330 335 Ala Asp Ser Asn Pro Asn Ser Gln Thr Ser Ser Pro Trp Tyr Gln Phe 340 345 350 Asp Ala Asn Gly Val Leu Asn Arg Cys Gly Asp Leu Trp Ser Gln Asn 355 360 365 Leu Ser Met Gly Phe Gln Lys Leu Ile Thr Val Pro Ala Gly Gly Ser 370 375 380 Val Thr Leu Ala Phe Tyr Tyr Ala Ile Gly Ser Thr Gln Glu Glu Ala 385 390 395 400 Glu Ala Ala Ala Asp Leu Ala Arg Ser Gln Thr Ala Asp Tyr Trp Phe 405 410 415 Thr Gln Thr Ala Ala Glu Tyr Asn Asn Trp Leu Asn Ser Gly Gln Arg 420 425 430 Val Asn Thr Ser Asp Ile Gly Ile Asn Thr Ala Phe Asp Arg Ser Leu 435 440 445 Ile Ile Asn Lys Gln Ala Gln His Pro Glu Phe Gly Ser Trp Pro Ala 450 455 460 Ala Thr Asn Pro Ser Tyr Gln Tyr Lys Val Trp Val Arg Asp Ser Ala 465 470 475 480 Val Thr Ala Met Gly Met Asp Ala Ala Asn His Leu Ser Glu Ala Glu 485 490 495 Lys Tyr Trp Asn Trp Met Ala Ser Val Gln Asn Thr Asp Gly Thr Trp 500 505 510 His Thr Asn Tyr Asn Val Trp Lys Ala Asn Glu Trp Ile Ser Phe Val 515 520 525 Glu Pro Glu His Asp Ala Ile Gly Leu Phe Leu Ile Gly Val Tyr Gln 530 535 540 His Tyr Ser Leu Leu Lys Ser Arg Asp Ser Ser Ala Ala Thr Thr Phe 545 550 555 560 Leu Asn Asn Ile Trp Thr Gln Ile Thr Arg Ala Gly Asp Phe Ile Tyr 565 570 575 Lys Asn Ile Gly Ala Ser Gly Phe Gly Pro Ala Asp Ala Ser Ile Trp 580 585 590 Glu Glu Gln Val Glu Tyr Asn Ile Phe Thr Gln Val Thr Tyr Ala Ala 595 600 605 Gly Leu Asn Ala Gly Arg Leu Leu Ala Gln Glu Lys Gly Asp Ile Thr 610 615 620 Arg Ser Asn Asn Tyr Leu Ser Gly Ala Gln Thr Ile Lys Asp Ala Ile 625 630 635 640 Leu Arg Ser Phe Leu Ser Ser Pro Arg Gly Leu Trp Asn Lys Ser Asn 645 650 655 Arg Tyr Phe Asn Arg Ala Ile Asn Thr Asp Gly Thr Ala Arg Thr Thr 660 665 670 Val Asp Ala Ser Ser Asp Leu Ile Trp Val Phe Gly Leu Leu Ser Pro 675 680 685 Thr Asp Thr Arg Ile Arg Asp His Arg Ile Lys Val Leu Ser Arg Leu 690 695 700 Thr His Asp Arg Tyr Gly Ile Ala Arg Tyr Glu Asn Asp Glu Phe Tyr 705 710 715 720 Tyr Ser Ser Pro Tyr Ser Pro Gly Gly Gln Tyr Glu Ala Gly Ala Ala 725 730 735 Glu Pro Val Trp Pro Gln Met Thr Met Tyr Ala Ser Met Ile Glu His 740 745 750 Trp Arg Gly Asp Asp Ala Thr Ala Leu Ala Arg Leu Lys Trp Tyr Val 755 760 765 Ser Arg Thr Ala Arg Gly Tyr Val Thr Pro Gly Glu Ala Val Asp Trp 770 775 780 Thr Asn Gly Gln Pro Leu Ile Ser Thr Ala Val Glu Pro Val Thr Gly 785 790 795 800 Ser Trp Phe Gln Met Ala Val Leu Thr Tyr Leu Asn Arg Phe Asp Leu 805 810 815 Arg Leu Pro Asp Phe 820

Claims (6)

1) preparing a culture obtained by culturing a transformant transformed with a recombinant vector containing a gene of glycotransferase (TP-DDase) consisting of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5;
2) obtaining a glycosyltransferase (TP-DDase) from the culture; And
3) reacting by adding the glycosyltransferase (TP-DDase) obtained in step 2) to isomaltulose; Isomaltulose-derived high polymerization isomaltooligosaccharide production method comprising a.
The method of claim 1, wherein the sugar transfer enzyme is dextran dextrinase.
The method of claim 1, wherein the glycosyltransferase (TP-DDase) is derived from a Thermoanaerobacter thermocopriae strain.
The method of claim 1, wherein the recombinant vector of step 1) is one vector selected from the group consisting of pET28a, pET, pGEX, pQE, pDEST, and pCOLD. Way.
The method of claim 1, wherein the transformant of step 1) consists of BL21 (DE3), Rosetta (DE3), Rosetta2 (DE3), ArcticExpress (DE3), STAR (DE3), C41 (DE3) and C43 (DE3). A method for producing a highly polymerized isomaltooligosaccharide derived from isomaltulose, characterized in that it is transformed into one E. coli selected from the group.
The method of claim 1, wherein the product obtained in step 3) contains 0.3 to 11.5% by weight of isomaltooligosaccharide with a polymerization degree of 5 to 9 based on the total weight, isomaltulose-derived highly polymerized isomaltooligosaccharide. Manufacturing method.

Images