KR20210040715A - Composition comprising oxytocin receptor inhibitor and use thereof - Google Patents

Abstract

An oxytocin receptor inhibitor included in the composition according to one aspect induces the differentiation of human dental pulp stem cells into odontoblasts and allows the odontoblasts to form dentin, thereby exhibiting a tooth formation or regeneration effect. Thus, the composition can be used for tooth formation or regeneration or for inducing the differentiation into odontoblast, and further can be used as a pharmaceutical composition and a health functional food for tooth regeneration. In particular, atosiban, which is an oxytocin receptor inhibitor that has been used in conventional research and clinical practice on receptor, has a drug repositioning property with a newly discovered effect, and thus can effectively reduce the time and budget spent on drug development, induce tooth regeneration to greatly reduce the economic loss on existing tooth restoration and alternative materials, and induce the growth of various materials markets that deliver drugs to damaged areas of teeth in the future, which can make a great contribution to the health and medical industries.

Description

Composition comprising an oxytocin receptor inhibitor and use thereof TECHNICAL FIELD [COMPOSITION COMPRISING OXYTOCIN RECEPTOR INHIBITOR AND USE THEREOF}

It relates to compositions comprising an oxytocin receptor inhibitor and to uses thereof.

Due to the characteristics of tissues, teeth have limited regeneration ability unlike other human tissues when damaged by dental caries or trauma.

In the case of tooth damage, most of the existing treatment strategies have been restorative treatments using materials that replace the teeth. However, in this case, there was a limitation in shortening the life of the tooth due to the physicochemical incongruity between the residual tooth tissue and the restoration material. In addition, the restored tooth has a limit of durability, and eventually disappears, resulting in enormous social and economic loss because prosthetics or implant treatments are performed in the future.

Until now, no treatment method has been established to induce the regeneration of damaged dental tissue. Therefore, it is a great challenge in modern dentistry to induce tooth regeneration by inducing biological activity inherent in teeth and surrounding tissues.

On the other hand, atosiban, an oxytocin receptor inhibitor, a kind of G-protein coupled receptor (GPCR); (1-(3-Mercaptopropanoic acid)-2-(O-ethyl-D-tyrosine) -4-L-threonine-8-L-ornithine-oxytocin)) has been widely used for in vitro function studies of existing oxytocin receptors, and has been used clinically as a preterm birth inhibitor.

By revealing the tooth regeneration effect of Atoshiban for the first time, it is possible to more efficiently develop tooth regeneration treatments through the drug repositioning process of existing formulations, thereby expanding the range of drug targets in the existing dental medical market. It is expected to contribute to the development of the health and medical industry.

Korean Patent Registration No. 10-1420005

One aspect is to provide a composition for tooth formation or regeneration comprising an oxytocin receptor inhibitor.

Another aspect is to provide a composition for inducing differentiation of odontoblasts (Odontoblast) comprising an oxytocin receptor inhibitor (Oxytocin receptor inhibitor).

Another aspect is to provide a pharmaceutical composition for tooth regeneration comprising an oxytocin receptor inhibitor.

Another aspect is to provide a method of regenerating teeth comprising administering the pharmaceutical composition to a subject.

Another aspect is to provide a health functional food for tooth formation or regeneration comprising an oxytocin receptor inhibitor.

One aspect provides a composition for tooth formation or regeneration comprising an oxytocin receptor inhibitor.

The oxytocin receptor inhibitor is L-368,899 hydrochloride((S)-2-amino-N-((1S,2S,4R)-7,7-dimethyl-1-((4-o-tolylpiperazin-1-ylsulfonyl)methyl) )bicyclo[2.2.1]heptan-2-yl)-4-(methylsulfonyl)butanamide) or a salt thereof, VPC 23019((R)-2-amino-3-((3-octylphenyl)amino)-3-oxopropyl dihydrogen phosphate) or a salt thereof, or a compound of Formula 1 or a salt thereof, and specifically, may be a compound of Formula 1 or a salt thereof:

[Formula 1]

.

.

In one aspect, the composition is L-368,899 hydrochloride((S)-2-amino-N-((1S,2S,4R)-7,7-dimethyl-1-((4-o-tolylpiperazin-1- ylsulfonyl)methyl)bicyclo[2.2.1]heptan-2-yl)-4-(methylsulfonyl)butanamide) or a salt thereof, VPC 23019((R)-2-amino-3-((3-octylphenyl)amino)- 3-oxopropyl dihydrogen phosphate) or a salt thereof, and at least one compound selected from the group consisting of the compound of Formula 1 or a salt thereof.

The compound of Formula 1 is Atosiban, and the IUPAC name is 1-(3-Mercaptopropanoic acid)-2-(O-ethyl-D-tyrosine)-4-L-threonine-8-L-ornithine-oxytocin And the molecular formula is C ₄₃ H ₆₇ N ₁₁ O ₁₂ S ₂ , and the molecular weight is 994.199.

The compound of Formula 1 may be derived from nature or synthesized using a known organic synthesis method, and non-protein compounds, peptides, extracts of plant-derived tissues or cells, microorganisms (for example, bacteria or fungi, and In particular, it may be a product obtained by culturing (yeast).

In one aspect, the tooth may be dentin, and the oxytocin receptor inhibitor included in the composition promotes differentiation of pulp stem cells into oblasts by inhibiting the binding of oxytocin and oxytocin receptors in pulp stem cells. Or you can induce. The differentiated oblastoma cells can form or regenerate teeth by forming dentin.

When the oxytocin receptor inhibitor is a compound of Formula 1, the compound of Formula 1 acts as an antagonist of oxytocin to inhibit the binding of oxytocin and oxytocin receptors in pulp stem cells to form or regenerate teeth.

In addition, in one aspect, the oxytocin receptor inhibitor may increase the expression of at least one gene selected from the group consisting of osteocalcin (OCN), dentin sialophosphoprotein (DSPP), and dentin matrix acidic phosphoprotein 1 (DMP1).

The osteocalcin (OCN) is a bone formation-related gene, dentin sialophosphoprotein (DSPP) and dentin matrix acidic phosphoprotein 1 (DMP1) are tooth formation-related genes, and the oxytocin receptor inhibitor increases the expression of at least one of the genes. By doing so, it may promote or induce differentiation of pulp stem cells into oblasts.

In one aspect, the tooth may be a damaged tooth or an immature tooth, and the damage may be caused by dental caries, physical shock, periodontal disease, or the like.

The dental caries may occur as an infectious disease caused by bacteria living on the surface of the tooth, and the hard tissue of the tooth is eroded to show a symptom of a defect. Specifically, the milky, translucent and hard substance that covers the surface of the head of the tooth and protects the tooth dentin is called tooth enamel or enamel. It is caused by acid generated when sugar and starch are decomposed by oral pathogens in the mouth. This means that the enamel of the tooth is damaged, causing cavities. The main cause of dental caries is dental plaque (plaque), which is a bacterial film formed on the surface of the tooth, and saliva forms a thin and sticky film on the tooth, on which Streptococcus sobrinus, a type of streptococcus. Oral microbes such as ( Streptococcus sobrinus ) bacteria and Streptococcus mutans attach to form a biofilm to form a dental plaque and become thicker by Fusobacterium. Lose. Dental caries of the present invention is included regardless of the type of bacteria that cause dental caries, but specifically Streptococcus mutans , Streptococcus sanguinis , Streptococcus sobrinus ( Streptococcus sobrinus ), Streptococcus ratti , Streptococcus criceti (Streptococcus criceti), Streptococcus anginosus (Streptococcus anginosus), and at least one selected from the group consisting of lactic acid bacteria, and more specifically Streptococcus ratti It may be a cocus mutans.

Another aspect provides a composition for inducing differentiation of odontoblasts, including an oxytocin receptor inhibitor.

The oxytocin receptor inhibitor may include a compound of Formula 1 or a salt thereof:

[Formula 1]

.

.

The terms “oxytocin receptor inhibitor”, “damage”, “tooth” and the like may be within the above-described range.

Another aspect provides a pharmaceutical composition for tooth regeneration comprising an oxytocin receptor inhibitor.

The oxytocin receptor inhibitor may include a compound of Formula 1 or a pharmaceutically acceptable salt thereof:

[Formula 1]

.

.

In addition, the tooth may be dentin, and may be a damaged tooth or an immature tooth.

In one aspect, the oxytocin receptor inhibitor may promote differentiation of human dental pulp stem cells (DPSC) into odontoblasts.

In addition, the oxytocin receptor inhibitor may increase the expression of at least one gene selected from the group consisting of osteocalcin (OCN), dentin sialophosphoprotein (DSPP), and dentin matrix acidic phosphoprotein 1 (DMP1).

The term "pharmaceutically acceptable" means exhibiting properties that are not toxic to cells or humans exposed to the composition.

The term "pharmaceutically acceptable salt" refers to a salt prepared using a specific compound according to an aspect and a relatively non-toxic acid or base. When the compound contains a relatively acidic functional group, a base addition salt can be obtained by contacting a sufficient amount of a base with the neutral form of such compound in a pure solution or a suitable inert solvent. Pharmaceutically acceptable base addition salts include salts or similar salts of sodium, potassium, calcium, ammonium, organic amine, or magnesium. When the compound contains a relatively basic functional group, acid addition salts can be obtained by contacting a sufficient amount of acid with the neutral form of such compound in a pure solution or in a suitable inert solvent. Pharmaceutically acceptable acid addition salts are salts of inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, hydrogen carbonate ion, phosphoric acid, monohydrogen phosphate ion, dihydrogen phosphate ion, sulfuric acid, hydrogen sulfate ion, hydroiodic acid or phosphorous acid, And salts of organic acids such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-tolylsulfonic acid, citric acid, tartaric acid, methanesulfonic acid, etc. And salts of amino acids (eg, arginine) and salts of organic acids such as glucuronic acid.

The pharmaceutically acceptable salt can be synthesized by conventional chemical methods from the parent compound containing an acidic or basic moiety. In general, these salts are prepared by reacting the form of the free acid or base of these compounds with a stoichiometrically appropriate amount of a base or acid in water or in an organic solvent or in a mixture of the two. In general, a non-aqueous medium such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile is preferred.

The pharmaceutical composition may contain an active ingredient alone, or may be provided as a pharmaceutical composition including one or more pharmaceutically acceptable carriers, excipients, or diluents.

Specifically, the carrier may be, for example, colloidal suspension, powder, saline, lipids, liposomes, microspheres, or nano-spherical particles. They can be complexed or associated with the vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids. It can be delivered in vivo using known delivery systems.

When the pharmaceutical composition is formulated, it may be prepared using a diluent or excipient such as a lubricant, sweetener, flavoring agent, emulsifier, suspending agent, preservative, filler, extender, binder, wetting agent, disintegrant, surfactant, etc. I can. Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient in the composition such as starch, calcium carbonate, and sucrose. ) Or lactose (lactose), gelatin, etc. can be prepared by mixing. Also, in addition to simple excipients, lubricants such as magnesium stearate and talc may be used. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc., and various excipients such as humectants, sweeteners, fragrances, preservatives, etc. can be included in addition to water and liquid paraffin, which are commonly used simple diluents. . Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. As the non-aqueous solvent and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycero gelatin, etc. may be used, and a known diluent or excipient may be used in the preparation of eye drops. have.

In addition, the pharmaceutical composition may be administered in combination with an existing oxytocin receptor inhibitor or a pharmaceutical composition for tooth regeneration, that is, mixed and provided, may be administered simultaneously, separately or sequentially, and may be administered single or multiple. . It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all of the above factors, and this can be easily determined by a person skilled in the art.

The term "administration" refers to introducing a predetermined substance to an individual by an appropriate method, and "individual" refers to all organisms such as rats, mice, livestock, including humans capable of carrying myeloid leukemia. As a specific example, it may be a mammal including a human.

In one aspect, the route of administration of the pharmaceutical composition is not limited thereto, but is oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, Includes topical, sublingual or rectal.

The composition may be administered orally or parenterally, and when administered parenterally, external use of the skin or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection injection method may be selected.

The pharmaceutical composition is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type of disease, severity, drug activity, drug Sensitivity to, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field. Specifically, the pharmaceutical composition may be administered at 0.01 to 1000 mg/kg/day, more specifically 0.1 to 500 mg/kg/day. The administration may be administered once a day, or may be divided several times.

Specifically, the effective amount of the pharmaceutical composition may vary depending on the patient's age, sex, condition, weight, absorption of the active ingredient in the body, inactivation rate, excretion rate, type of disease, and drugs used in combination, and the route of administration, obesity It can be increased or decreased depending on the severity, sex, weight, age, etc.

Another aspect provides a method of regenerating teeth comprising administering the pharmaceutical composition to a subject.

The terms "regeneration", "tooth", "administration" and the like may be within the above-described range.

In addition, the tooth regeneration method may further include administering an existing pharmaceutical composition for tooth regeneration or an oxytocin receptor inhibitor to the individual.

Another aspect provides a health functional food for tooth formation or regeneration comprising an oxytocin receptor inhibitor.

In one aspect, the oxytocin receptor inhibitor may include a compound of Formula 1 or a food pharmaceutically acceptable salt thereof:

[Formula 1]

.

.

The terms “oxytocin receptor inhibitor”, “tooth” and the like may be within the above-described range.

The term "food wise acceptable" means exhibiting properties that are not toxic to cells or humans exposed to the compound.

The term “food wise acceptable salt” refers to a salt prepared using a specific compound according to an aspect and a relatively non-toxic acid or base, and may be within the above-described range for “salt”.

The health functional food may be used before or after the onset stage of the disease in order to regenerate teeth, and at the same time as or separately from the drug for treatment.

In the health functional food, the active ingredient may be added to the food as it is or may be used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined depending on the purpose of use (for prevention or improvement). In general, when preparing food or beverage, the health functional food may be specifically added in an amount of about 15% by weight or less, more specifically about 10% by weight or less based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above range.

The health functional food may be formulated as one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, further including at least one of carriers, diluents, excipients and additives. Foods to which the compound according to one aspect can be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gums, teas, vitamin complexes, and health functional foods.

Specific examples of the carrier, excipient, diluent and additive include lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose. , Polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, and mineral oil It may be at least one selected from.

In addition to containing the active ingredient, the health functional food may contain other ingredients as essential ingredients without particular limitation. For example, as in ordinary beverages, various flavoring agents or natural carbohydrates may be included as additional ingredients. Examples of the above-described natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, and the like; And polysaccharides, for example, common sugars such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (taumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. I can. The proportion of the natural carbohydrate can be appropriately determined by the choice of a person skilled in the art.

In addition to the above, health functional foods according to one aspect include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and heavy weight agents (cheese, chocolate, etc.), pectic acid and salts thereof. , Alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like. These components may be used independently or in combination, and the proportion of these additives may also be appropriately selected by those skilled in the art.

Redundant content is omitted in consideration of the complexity of the present specification, and terms not otherwise defined herein have meanings commonly used in the technical field to which the present invention pertains.

Oxytocin receptor inhibitor (Oxytocin receptor inhibitor) induces the differentiation of human dimensional stem cells into oblastoma cells, and can exhibit a tooth formation or regeneration effect by forming the dentin by the odontoblast.

Therefore, the composition containing the oxytocin receptor inhibitor can be used for tooth formation or regeneration, or for inducing oblast differentiation, and further, can be used as a pharmaceutical composition for tooth regeneration or a health functional food.

Particularly, in the case of Atoshiban, an oxytocin receptor inhibitor that has been used in existing receptor research and clinical practice, it has a drug repositioning characteristic that has found new effects, so it can effectively reduce the time and budget spent on drug development. In addition, by inducing tooth regeneration, it is possible to greatly reduce the economic loss for existing dental restorations and replacement materials.

In addition, it can induce the co-growth of the market for various materials that deliver drugs to damaged teeth in the future, which can make a great contribution to the health and medical industries.

1A is a diagram showing the composition of a tooth, and B is a diagram showing a process of inducing dentin of a dental pulp stem cell (DPSC).
2 is a diagram showing the expression of the oxytocin receptor in human dimensional stem cells, specifically A is a diagram comparing the expression of oxytocin receptors and vasopressin receptors under human dimensional stem cell culture conditions, and B is a human dimensional stem cell (hDPSC) And other cells (hGF: human gingival cells, hPDLSC: human periodontal ligament cells, hMMC: human uterine muscle layer cells). This is a diagram confirming the expression of the receptor.
FIG. 3 is a diagram showing changes in expression of a G-protein coupled receptor (GPCR) gene in human dimensional stem cells that induce osteogenic differentiation. Specifically, A is an expression of GPCR using a microarray technique. It is a diagram that analyzes the change in pattern, and B is a diagram that analyzes the change in the expression of oxytocin receptors in human dimensional stem cells under various differentiation conditions using real-time PCR (control: undifferentiated, osteo: bone differentiation conditions, adipo: Fat differentiation conditions).
4A is a diagram showing an overall schematic diagram of an embodiment or an experimental example, and B is a schematic diagram showing the effect of the invention according to an aspect.
Figure 5 is a diagram showing that the mineralized tissue of human dimensional stem cells is induced upon treatment of atosivan under osteogenic differentiation media, and specifically, A is the time course of treatment of atosibane in human dimensional stem cells ( 1 to 3 weeks) is a diagram showing the results of Alizarin Red S staining, and B is a diagram showing the results of Alizarin Red S staining according to the concentration of atoshiban (0 ~ 100 μM).
6 is a diagram showing a change in expression of differentiation-related genes in pulp cells by treatment of atosivan under conditions of normal cell culture medium and bone differentiation inducing culture medium through real-time PCR analysis (GM: general cell culture medium OM: bone differentiation Induction culture), and specifically, A is a diagram showing changes in the expression of genes related to bone formation differentiation (BMP1: Bone morphogenetic protein 1, Runx2: Runt-related transcription factor 2, OPN: osteopontin, OCN: osteocalcin), and B is It is a diagram showing changes in the expression of genes related to tooth differentiation (DSPP: dentin sialophosphoprotein, DMP1: dentin matrix acidic phosphoprotein 1).
7 is a diagram illustrating the effect of inducing tooth formation using mice deficient in oxytocin receptors. Specifically, A is a cross-sectional view of the tooth tissue of ^{mice with normal oxytocin receptors (WT) and mice deficient in oxytocin receptors (OXTR -/- ), and B} Is a diagram (Inc: incisor, M1: first molar, M2: second molar) showing the results of analysis of the volume of enamel and dentin between teeth of each mouse group through micro-CT image analysis.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Reference example

Reference Example 1. Reagent

Atosiban (A3480-10M) having a concentration of 1 to 100 μM was used as the atosiban used in the examples according to one aspect, and was purchased from Sigma-Aldrich.

Reference Example 2. Cell culture

Human dental pulp stem cells (hDPSCs, Lonza, PT-5025) contain 10% (v/v) of Fetal Bovine Sera (FBS, WELGENE, S 001-07) and 1% (v /v) of Penicillin-Streptomycin (Penicillin-Streptomycin, Gibco, 15140122) supplemented with Dulbecco's Modified Eagle's Medium (DMEM, WELGENE, LM 001-05). Patient samples were collected from extracted third molars (wisdom teeth) of healthy 15-25 year old patients. The experimental protocol was approved by the Institutional Review Board of CHA Bundang Medical Center (CHAMC 2018-04-046), and all patients received prior consent. hDPSCs were isolated through cultivation of pulp tissue extracted from the extracted teeth. HDPSCs from passages 3 to 7 were used in all experiments in this example. Human myometrial cells (hMMC, American Type Culture Collection, CRL-3046) were cultured under the same conditions as pulp stem cells by adding 2 mM L-glutamine (Sigma-Aldrich, G7513-100ML). The complementary DNAs (cDNAs) of periodontal ligament stem cells (PDLSC) and human gingival fibroblasts (hGF) were provided by Dr. Il-Ho Jang of Pusan National University. Bone formation differentiation medium was added 50 μg/mL of ascorbic acid (Sigma-Aldrich, A5960-25G) and 10 mM of beta-glycerophosphate to DMEM containing 10% (v/v) FBS. It was made by doing. Adipogenesis differentiation medium is 10 μg/mL insulin (Gibco, GIB-12585-014), 500 μM IBMX (3-isobutyl-1-methylxanthine, Abcam, ab120840) , 200 μM indomethacin (Tokyo chemical, I0655 ) And 1 μM of dexamethasone (Sigma-Aldrich, D4902-25MG). All cells were cultured at _{37° C. and 5% CO 2 in a CO 2} incubator (Thermo Fisher Scientific, BB 150).

Reference Example 3: Quantitative Real-Time Polymerase Chain Reaction (qPCR)

Total RNA was extracted using the RNeasy Mini Kit (Qiagen, 74140). cDNA was synthesized by SuperScript III First-Strand (Invitrogen, 18080-051) with oligo-dT primer according to the manufacturer's instructions. SYBR Green PCR master mix (Applied Biosystems, 4309155) and CFX Connect?? The Optics Module (Bio-Rad Laboratories, 788BR06586) was used for qPCR analysis. Cyclic parameters of the PCR were as follows: 95°C for 15 minutes, 95°C for 10 seconds, 60°C for 15 seconds and 72°C for 30 seconds, after 40 repetitions, 72°C for 10 minutes and 95°C for 10 seconds. Relative gene expression levels were quantified by the delta Ct method. The primers used in this example were shown in Table 1 below.

Target Gene Primer sequence (5'-3') Sequence number BMP2 Forward AGCGAGTTCGAGTTGCGGCT One Reverse AGCTGCGCACAGTGTTGGCT 2 DMP1 Forward CCTGAGGATGAGAACAGCTCCA 3 Reverse GATCTGCTGCTGTCTTGAGAGTCAC 4 DSPP Forward TTCCGATGGGAGTCCTAGTG 5 Reverse TGAGCTTCTGGGTGTCCTCT 6 OCN Forward CCCAGGCGCTACCTGTATCAA 7 Reverse GGTCAGCCAACTCGTCACAGTC 8 OPN Forward ACACATATGATGGCCGAGGTGA 9 Reverse TGTGAGGTGATGTCCTCGTCTGTAG 10 OXTR Forward TTCTTCGTGCAGATGTGGAG 11 Reverse GGACGAGTTGCTCTTTTTGC 12 RUNX2 Forward AACCCTTAATTTGCACTGGGTCA 13 Reverse CAAATTCCAGCAATGTTTGTGCTAC 14 AVPR1A Forward CTCAAGACTCTGCAACAGCC 15 Reverse AGCAGGTACCCAAGATGACC 16 AVPR1B Forward GTCAGCAGCATCAACACCAT 17 Reverse TGTAGATCCAGGGGTTGCAG 18 AVPR2 Forward TCTTCATTGGCCACTTGTGC 19 Reverse GGCCAGGATCATGTAGGAGG 20

Reference Example 4. Immunostaining

hDPSCs were fixed with 4% para-formaldehyde (paraformaldehyde, Tech & Innovation, BPP-9004) for 20 minutes, and phosphate buffered saline containing 0.1% (v/v) Tween-20 (PBST). buffered saline) 3 times. After permeation with phosphate buffered saline containing 0.1% (v/v) of Triton X-100 (PBSX) for 15 minutes, cells were washed 3 times with PBST, and PBS supplemented with 10% (v/v) FBS Blocked with Then, the primary antibody diluted 1:100 in PBST was added. After incubation overnight, the samples were washed 3 times with PBST, a secondary antibody was added, incubated for 1 hour, and washed 3 times with PBST. Rat tooth samples were descaled in EDTA (ethylenediaminetetraacetic acid, 500 mM, pH 8) solution until the tissues were sufficiently softened. By cutting the block, a 30 μm paraffin-embedded part was obtained and cooled with ice. For DAB staining, endogenous peroxidase was blocked using 1% (v/v) H ₂ O ₂ in PBS for 10 minutes, and the samples were washed 3 times with PBS. Thereafter, the samples were blocked with 10% (v/v) FBS solution for 60 minutes. After blocking, the primary antibody was added and incubated for 60 minutes at room temperature. Then, the slides were washed 3 times with PBS and incubated with secondary antibody for 60 minutes at room temperature. After incubation, the slides were washed 3 times with PBS and incubated with DAB until a strong signal was seen. Goat's polyclonal anti-oxytocin receptor antibody (Abcam, ab87312) and Alexa Fluor ^™ 488 donkey's anti-goat IgG (H+L) (Invitrogen, A11055) were used for the immunostaining process.

Reference Example 5. Microarray

hDPSCs were placed in 12-well plates and differentiation for 2 weeks was induced in bone morphogenic differentiation medium. Clariom™ S Assay, Human (Thermo Fisher Scientific, 902926) was used for the microarray platform. cDNA was synthesized according to the manufacturer's instructions using the GeneChip Whole Transcript (WT) Amplification Kit (Thermo Fisher Scientific, 902390). The sense cDNA was fragmented and biotin-labeled with TDT (terminal deoxynucleotidyl transferase) using the GeneChip WT Terminal Labeling Kit (Thermo Fisher Scientific, 900670). About 5.5 μg of labeled DNA target was hybridized in Affymetrix GeneChip Array at 45° C. for 16 hours. Hybridized arrays were washed, stained on GeneChip Fluidics Station 450 (Thermo Fisher Scientific, 00-0079) and scanned on a GCS3000 Scanner (Thermo Fisher Scientific, 00-0210). Array data transfer processing and analysis was performed using Affymetrix® GeneChip Command Console® Software (AGCC). The software was used with Affymetrix Power Tools (Thermo Fisher Scientific, APT 2.10.2.2), R Project 3.5.1.

Reference Example 6. Micro computed tomography (micro-CT)

Oxytocin Receptor (OXTR) knock-out (KO) mice (B6.129(SJL)-Oxtrtm1.1Wsy/J) were obtained from The Jackson Laboratory (008471; Bar Harbor, ME, USA), and were compared with C57BL6/J. Maintained by backcrossing. Genotyping of OXTR KO mice was performed using PCR with the following primers: 5'-GCTGAGTCTTGGAAGCAGGA-3' (SEQ ID NO: 21) and 5'-GGTACCTCCTTTGAGCTTCTG-3' (SEQ ID NO: 22). Animals were managed according to Ewha Womans University's Animal Care Guidelines through the permission of EWU-IACUC (No. 19-015). Five-week-old old female rats were euthanized with 2.5% (w/v) of avertin (avertin, Sigma-Aldrich, T48402, 20 μl/g body weight), and the lower jaw of the rat was dislocated after removal of skin tissue. Made it. Thereafter, the samples were fixed in a 4% (v/v) paraformaldehyde solution. Micro-CT images were obtained by SkyScan 1173 (Kontich) under 130 kVp and 60 mA conditions using a 1 mm thick aluminum filter. Images were reconstructed by NRecon Reconstruction Software (ver. 1.6.9.8, Bruker-CT) and analyzed by CT Analyzer (ver. 1.14.4.1, Bruker-CT). The image axis was aligned by DataViewer (ver. 1.5.1.2, Bruker-CT), and all image processing and analysis were performed by GENOSS.

Reference Example 7. Alizarin Red S staining

hDPSCs were cultured for 1-3 weeks in osteogenic differentiation medium and fixed in 4% (v/v) paraformaldehyde. Then, they were washed 3 times with PBS and stained with 2% (w/v) Alizarin Red S (Sigma-Aldrich, A5533-25G) solution for 15 minutes. Staining was performed at room temperature and pH 4.1-4.3. After dyeing, the specimen was washed 8 times with distilled water.

Reference Example 8. Statistical Analysis

Data are provided as mean ± standard mean error or ± standard error. Statistical analysis was performed using Microsoft Excel. The F-test was used to confirm parental uniformity, and a two-sided t-test was performed for the significant level. Multiple comparisons were performed using one way analysis of variance (ANOVA), and post-hoc analysis was performed by two-sided t-test with Bonferroni correction. . All experiments were performed at least twice for biological replicates.

Example

1. Confirmation of the possibility of tooth regeneration effect of oxytocin receptor inhibitors

(1) Confirmation of oxytocin receptor expression in tooth regeneration pathway and human dental pulp stem cells (hDPSC)

The tooth is composed of enamel, dentin, and pulp from the outer layer, and inside the pulp, dental pulp stem cells, a kind of pluripotent mesenchymal stem cells that can induce tooth regeneration. Exists (Fig. 1A).

Upon external stimulation, pulp stem cells are differentiated into odontoblasts that form teeth to form mineralized tissues (dentin) to replace damaged tooth tissues (FIG. 1B).

As a result of confirming the expression of oxytocin receptor (OXTR) under culture conditions of human dimensional stem cells (hDPSC) extracted from human teeth, Arginine Vasopressin Receptor 1A: AVPR1A, Arginine Vasopressin Receptor, a structural analogue to the oxytocin receptor. 1B: AVPR1B, Arginine Vasopressin Receptor 2: AVPR2) showed a significantly higher level of expression compared to (Fig. 2A).

These oxytocin receptors are expressed in other cells than human dimensional stem cells (hPDSC) (hGF (human Gingival Fibroblast): human root fibroblasts, hPDLSC (human Periodontal Ligament Stem Cell): human periodontal ligament stem cells, hMMC (human myometrial cells)). ): As a result of confirming the expression level of the oxytocin receptor in human uterine muscle layer cells), it was confirmed that a characteristic pattern was exhibited in human pulp stem cells (FIG. 2B).

In addition, the expression of the oxytocin receptor in human pulp stem cells was also confirmed through Hoechst staining and immunofluorescence staining (FIG. 2C).

(2) Confirmation of the role of oxytocin receptor in human pulp stem cells

As a result of confirming the change pattern of G-protein coupled receptor (GPCR) gene expression in human pulp stem cells that induced osteogenic differentiation by microarray technique and real-time PCR, the oxytocin receptor gene was significantly reduced. It was confirmed that (FC = -2.11, P = 6.85 × 10 ^-20 ) (Figs. 3A and 3B).

These results imply that the oxytocin receptor plays an important role in the differentiation process of human pulp stem cells. In addition, it could be expected that the oxytocin receptor has an inhibitory effect on the differentiation of human pulp stem cells through the pattern of decreased expression during osteocyte and adipocyte differentiation (Fig. 4B).

2. Confirmation of the effect of oxytocin receptor inhibitor Atoshiban in pulp stem cells (Fig. 4A)

(One) Effects of Atoshiban Treatment on Induction of Mineralized Tissue in Human Pulp Stem Cells

In the culture conditions of human pulp stem cells (osteogenic differentiation media), cells treated with Atoshiban and cells without treatment were differentiated for 1 to 3 weeks.As a result of confirming by Alizarin Red S staining, oxytocin receptors were treated with Atoshiban. It was confirmed that the osteogenic differentiation was promoted in the cells that inhibited (FIG. 5A).

It was confirmed through Alizarin Red S staining that this differentiation promoting effect showed an increasing pattern according to the concentration of Atoshiban (0 ~ 100 μM) (FIG. 5B).

(2) Changes in gene expression of hDPSC according to osteogenic differentiation

In human pulp stem cell culture conditions, Atoshiban was treated and differentiation was induced with osteogenic differentiation media, and genes related to bone morphogenetic differentiation (BMP1: Bone morphogenetic protein 1, Runx2: Runt-related transcription factor 2, OPN: osteopontin, It was confirmed that the expression level of the osteocalcin (OCN) gene, which has the function of inducing osteogenic differentiation, among OCN: osteocalcin) was increased (FIG. 6A).

In addition, it was confirmed that the expression levels of dentin sialophosphoprotein (DSPP) and dentin matrix acidic phosphoprotein 1 (DMP1) genes, which are genes related to tooth differentiation, were increased when atoshiban was treated in normal growth media (FIG. 6B).

(3) Changes in tooth tissue in oxytocin receptor deficient mice

To evaluate the effect of the inhibition of oxytocin receptor on the actual tooth tissue, the tooth tissues of 5-week-old female oxytocin receptor deficient mice (OXTR ^-/- mice) were photographed and analyzed through tissue section staining.

As a result, it was confirmed through the tooth tissue cross-sectional view that the density of the oocyte layer present in the boundary region between pulp and dentin was increased in oxytocin receptor deficient mice compared to normal mice (FIG. 6A).

In addition, as a result of comparing the thickness (volume) of tooth components by micro-CT image analysis by mouse group (Inc: incisor, M1: first molar, M2: second molar), oxytocin receptor deficient mice were compared with normal mice. It was confirmed that the volume of dentin was significantly increased (Fig. 6B).

Therefore, it was confirmed that the inhibition of the oxytocin receptor actually has an effect of inducing tooth formation.

<110> SUNGKWANG MEDICAL FOUNDATION Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> COMPOSITION COMPRISING OXYTOCIN RECEPTOR INHIBITOR AND USE THEREOF <130> SUP-1911-KR, P2019211, PN129160KR <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP2-F <400> 1 agcgagttcg agttgcggct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP2-R <400> 2 agctgcgcac agtgttggct 20 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DMP1-F <400> 3 cctgaggatg agaacagctc ca 22 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> DMP1-R <400> 4 gatctgctgc tgtcttgaga gtcac 25 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DSPP-F <400> 5 ttccgatggg agtcctagtg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DSPP-R <400> 6 tgagcttctg ggtgtcctct 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OCN-F <400> 7 cccaggcgct acctgtatca a 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OCN-R <400> 8 ggtcagccaa ctcgtcacag tc 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OPN-F <400> 9 acacatatga tggccgaggt ga 22 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OPN-R <400> 10 tgtgaggtga tgtcctcgtc tgtag 25 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXTR-F <400> 11 ttcttcgtgc agatgtggag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXTR-R <400> 12 ggacgagttg ctctttttgc 20 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> RUNX2-F <400> 13 aacccttaat ttgcactggg tca 23 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RUNX2-R <400> 14 caaattccag caatgtttgt gctac 25 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AVPR1A-F <400> 15 ctcaagactc tgcaacagcc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AVPR1A-R <400> 16 agcaggtacc caagatgacc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AVPR1B-F <400> 17 gtcagcagca tcaacaccat 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AVPR1B-R <400> 18 tgtagatcca ggggttgcag 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AVPR2-F <400> 19 tcttcattgg ccacttgtgc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AVPR2-R <400> 20 ggccaggatc atgtaggagg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gentyping of OXTR KO Mouse primer forward <400> 21 gctgagtctt ggaagcagga 20 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Gentyping of OXTR KO Mouse primer reverse <400> 22 ggtacctcct ttgagcttct g 21

Claims (17)

A composition for tooth formation or regeneration comprising an oxytocin receptor inhibitor.
The composition of claim 1, wherein the oxytocin receptor inhibitor comprises a compound of Formula 1 or a salt thereof:
[Formula 1]

.
The method of claim 1, wherein the tooth is dentin (dentin), the composition for tooth formation or regeneration.
The composition of claim 1, wherein the oxytocin receptor inhibitor promotes the differentiation of human dental pulp stem cells (DPSC) into odontoblasts.
The method of claim 1, wherein the oxytocin receptor inhibitor increases the expression of at least one gene selected from the group consisting of osteocalcin (OCN), dentin sialophosphoprotein (DSPP), and dentin matrix acidic phosphoprotein 1 (DMP1), tooth formation or Composition for regeneration.
The composition of claim 1, wherein the tooth is a damaged tooth or an immature tooth.
Odontoblast differentiation induction composition comprising an oxytocin receptor inhibitor (Oxytocin receptor inhibitor).
The composition of claim 7, wherein the oxytocin receptor inhibitor comprises a compound of Formula 1 or a salt thereof, inducing differentiation of odontoblasts:
[Formula 1]

.
A pharmaceutical composition for tooth regeneration comprising an oxytocin receptor inhibitor.
The pharmaceutical composition for tooth regeneration according to claim 9, wherein the oxytocin receptor inhibitor comprises a compound of Formula 1 or a pharmaceutically acceptable salt thereof:
[Formula 1]

.
The method of claim 9, wherein the tooth is dentin (dentin), a pharmaceutical composition for tooth regeneration.
The pharmaceutical composition for tooth regeneration according to claim 9, wherein the oxytocin receptor inhibitor promotes differentiation of human dental pulp stem cells (DPSC) into odontoblasts.
The method of claim 9, wherein the oxytocin receptor inhibitor increases the expression of at least one gene selected from the group consisting of osteocalcin (OCN), dentin sialophosphoprotein (DSPP), and dentin matrix acidic phosphoprotein 1 (DMP1). Pharmaceutical composition.
The pharmaceutical composition for tooth regeneration according to claim 9, wherein the tooth is a damaged tooth or an immature tooth.
A method for regenerating teeth comprising administering the pharmaceutical composition of any one of claims 9 to 14 to a subject.
Health functional food for tooth formation or regeneration, including oxytocin receptor inhibitor.
The health functional food for tooth formation or regeneration of claim 16, wherein the oxytocin receptor inhibitor comprises a compound of the following formula 1 or a food pharmaceutically acceptable salt thereof:
[Formula 1]

.

Images