KR20210017726A - Methods for improving alcohol-based gastric inflammation and manufacturing of GABA-containing compounds using Pyrus Ussuriensis extract - Google Patents

Abstract

The present invention relates to a Pyrus ussuriensis extract. More specifically, disclosed in the present invention is the possibility of a pharmaceutical composition or a functional food composition for alleviating, preventing or treating alcohol-induced gastritis containing the Pyrus ussuriensis extract as an active component. In addition, disclosed in the present invention is a complex fermentation method for enhancing a gamma-aminobutyric acid content in manufacturing the functional food composition.

Description

Method for improving alcohol-based gastric inflammation and manufacturing of GABA-containing compounds using Pyrus Ussuriensis extract}

The present invention relates to a sandolbae extract.

As a deciduous broad-leaved tree belonging to the rosaceae family, fruits, roots, bark, stems, leaves, and pericarps are not only edible, but have antipyretic, dry stomach, chigal, diuretic, and antidiabetic effects, and have been used as a folk medicine for a long time. In this regard, several studies and patent activities have been known. Republic of Korea Patent Publication No. 10-2018-0049355 discloses a pharmaceutical composition for the prevention or treatment of atopic dermatitis using a plant extract of the genus pear as an active ingredient. Korean Patent Laid-Open Publication No. 10-2010-0087068 proposes a composition having antioxidant activity through mixed extracts of natural substances, and discloses that the bark of a pear tree can be used therein.

However, studies on the improvement of gastric digestion and gastric inflammation of the pear tree have not been known. In particular, research on the possibility of using the pear tree for alcohol-induced gastric inflammation has not garnered interest. Gastric inflammation is so common that it is called chronic disease in Korea. However, it is highly likely to develop into a larger disease as it is often neglected. According to data from the National Health Insurance Service, the number of gastritis patients as of 2010 was 5.41 million, increasing by an annual average of 4.9%. By gender, women were 1.6 times more than men, and women in their twenties were more than twice as high as men.

Alcohol is mainly absorbed by the stomach and small intestine, transferred to the liver and metabolized. Depending on the person, up to a third of the absorbed alcohol is decomposed by alcohol dehydrogenase (ADH) in the stomach, thereby minimizing the absorption of alcohol through the blood.

Alcoholic gastritis refers to a condition in which the gastric mucosa is damaged by chronic irritation caused by alcohol. Alcoholic gastritis is difficult to digest and sometimes complains of a sore sensation, but most do not have any special symptoms, and then serious symptoms are found through endoscopy and ultrasound. Chronically drinking alcohol causes related diseases by damaging not only gastritis, but also the pancreas or liver, and also increases the risk of esophageal cancer, stomach cancer, and colon cancer. In particular, gastritis and gastric ulcers caused by alcohol require the most attention. Alcohol stimulates the cells of the stomach wall to increase acid secretion, and excessive alcohol consumption causes swelling of the gastric mucosa, causing bleeding and inducing the production of inflammatory cells. . In addition, by inducing necrosis or apoptosis due to oxidative stress, the gastric mucosa is damaged, and gastric bleeding occurs.

Conventional treatments for gastritis and gastric ulcer include antacids that neutralize excess gastric acid, histamine antagonists for the purpose of inhibiting acid secretion, proton pump inhibitors, choline inhibitors, and resistance to gastric lining. And gastric mucosa to help increase and recover. However, such treatments are synthetic drugs, and have problems such as loss of appetite, weakness, and allergies.

In order to avoid this problem, interest in various natural extracts is increasing. Prior patent documents related to such research include Korean Laid-Open Patent Publication No. 10-2009-0046425 (composition for preventing or treating gastritis or gastric ulcer containing Cheonma extract), Korean Patent Publication No. 10-1091025 (Containing Bokbunja extract) Composition for the prevention and treatment of gastritis and gastric ulcer caused by non-steroidal anti-inflammatory drugs), Korean Patent Publication No. 10-2012-0051904 (Gastritis and gastric ulcer treatment composition containing poison ivy extract), Korean Patent Publication No. 10- No. 1204981 (Composition for the prevention and treatment of gastritis and gastric ulcers containing Gorose sap), Korean Patent Laid-Open Publication No. 10-2018-0085079 (An alcoholic gastritis containing an outpost extract from which flowers and roots of thistle and white dandelion are removed Prevention, improvement or treatment composition), and the like.

The inventors of the present invention reached the completion of the present invention after long experiments according to scientific methodology in order to confirm the possibility of utilizing the pear tree as a health functional food or a pharmaceutical composition.

Considering the modern lifestyle, habits that are good for gastritis are prevalent among our modern office workers. It is very necessary to know clearly about the cause of gastritis and the treatment in life and to try to improve it. The inventors of the present invention have been studying the possibility of utilizing domestic forest resources to develop a product that can be used for gastritis prevention/treatment/improvement that can be used for gastritis, which is one of the frequent chronic diseases in the modern society. If it is successful, it will be able to provide a new momentum for creating added value of domestic forest resources. It is an object of the present invention to propose the fact that the extract of pear tree is suitable for commercialization related to the prevention/treatment/improvement of gastric inflammation in such a large project, and the most preferable methodology based on data supported by the results of animal experiments.

On the other hand, other objects not specified of the present invention will be additionally considered within a range that can be easily deduced from the detailed description and effects thereof below.

In order to achieve the same problem, the first aspect of the present invention is characterized by a pharmaceutical composition for improving, preventing or treating alcohol-induced gastritis, comprising an extract of Sandolbae as an active ingredient.

In the pharmaceutical composition for improving, preventing or treating alcohol-induced gastritis according to a preferred embodiment of the present invention, the Sandolbae extract is preferably fermented using at least two strains of lactic acid bacteria, yeast, and Bacillus bacillus.

A second aspect of the present invention features a functional food composition comprising, as an active ingredient, an extract of gamma-aminobutraic acid with enhanced gamma-aminobutraic acid as an active ingredient.

In the functional food composition comprising the extract of Sandolbae according to a preferred embodiment of the present invention as an active ingredient, the complex fermentation process is preferably fermented step by step using two or more strains of lactic acid bacteria, yeast, and Bacillus bacillus, respectively.

According to the present invention, it was confirmed by the data of specific examples of the efficacy of improving gastric inflammation of the extract of sandol pear. Therefore, it is possible to prepare a pharmaceutical composition or a functional food composition for the prevention and treatment of gastric inflammation.

In addition, according to the present invention, by performing mixed fermentation when manufacturing a functional food. It can improve the production amount and efficiency of gamma-aminobutraic acid.

On the other hand, even if it is an effect not explicitly mentioned herein, it is added that the effect described in the following specification and its provisional effect expected by the technical features of the present invention are treated as described in the specification of the present invention.

1 is a view showing the comparison of ulcer values for each test group through gastric ulcer quantification in a comparative example of the present invention.
2 is an electron micrograph showing the shape of the gastric mucosa of each test group. A shows the morphology of gastric mucosa of CMC group, B and C group NC, D group PC, E group T1, and F group T2.
3 is a photograph showing the histological change of staining of gastric tissue of each test group.
Figure 4 shows the comparison of detection results of PGE2, Histamine, and cAMP levels of each test group.
※ The accompanying drawings are exemplified as reference for understanding the technical idea of the present invention, and the scope of the present invention is not limited thereto.

Hereinafter, the contents of the present invention guided by various embodiments of the present invention will be described with reference to experimental data, tables, and drawings. In describing the present invention, when it is determined that the subject matter of the present invention may be unnecessarily obscured as matters obvious to those skilled in the art with respect to known functions related to the present invention, detailed description thereof will be omitted.

< Pyrus Ussuriensis extract>

Preferably, a sandol pear extract was prepared by hot water extraction. To illustrate the method we proceeded exemplarily, after boiling in distilled water equivalent to 9 times the amount of dry sandol pear (Pyrus ussuriensis Maxim), the dried sandol pear was added and eluted for 30 minutes. Then, after crushing the soaked sandol pear using a hand blender, insoluble substances such as seeds and skins were removed using a strainer to obtain a sandol pear extract.

In addition, it should be noted that alternative methods such as alcohol extraction and medicine turbid extraction may be used.

Then, a hot water extract was obtained from the above sandolbae extract. Preferably, 50% ethanol extract was optimal. The results of the experiment to set the extraction temperature and extraction time of the 50% ethanol extract are shown in Table 1 below.

Ethanol(%) Extraction volume ratio (g/ml) Time(hrs) Brix% 100℃ 90℃ 80℃ 50% 1:20 0 15.5 15.5 15.5 4 17.5 17.2 18.8 6 17.5 17.3 19.1 8 17.6 18.9 19.2 10 16.9 19 19.2 12 17.2 18.8 19.2

As a result, the extraction temperature of the extract was 80°C and the extraction time was 6 hours to obtain a 50% alcoholic acidol pear extraction sample and analyzed the extraction sample.

As a result of physicochemical analysis of the sample of the Sandolbae hot water extract, the pH was 4.49 and the acidity was 0.32%, and the total sugar was 5.6% and the reducing sugar was 2.7%. In addition, the protein 36.3 μg/mL and the total flavonoid content were measured to be 29.5 μg/mL, and the polyphenol content of the extract (w/w) was found to be quite high as 400.4 μg/mL.

In addition, a total of 7 kinds of inorganic analysis were performed on the sample of the hot water extract of the sandol pear. Potassium showed the highest content at 127.6mg/100g, followed by phosphorus 8.52mg/100g, sodium 5.11mg/100g, magnesium 4.78mg/100g, calcium 3.51mg/100g, iron 0.23mg/100g, manganese 0.05mg/100g It confirmed that it contained. Foods high in potassium include avocado, potatoes, and spinach, and many studies have been reported that inhibit sodium absorption and affect obesity. Therefore, it was judged that it would be possible to develop a product that has a positive effect by inhibiting the absorption of sodium and obesity, which is the cause of adult diseases, as well as gastrointestinal protection by using Sandolbae.

[Preliminary animal experiment]

Sprague Dowley (SD) rats with an average weight of 70-80 g were used in the preliminary experiment. Experimental animals were purchased aseptically bred at Orient Bio (Gyeonggi-do, Korea) in Korea. Feed and drinking water were fed freely. Body weight and feed intake were measured daily.

In order to confirm the prevention of gastritis with the ethanol extract of Sandolbae, 10 Sprague-Dawley rats were randomly divided into 4 groups. The test groups are as follows.

Group A n=2, (only 0.5% CMC administration),

Group B: Normal Control (n=2, receiving 1 ml of 40% ethanol),

Group C (n=3, 250 mg/Kg low dose of extract)

Group D (n=3, 500 mg/Kg high dose of extract)

This is summarized in Table 2 below.

Group 40% EtOH A CMC 0 1ml of Carboxymethyl cellulose B Negative Control (NC) 1ml/day - C T1 (low dose of PUE*) 1ml/day 250mg/1ml/kg/day of PUE D T2 (high dose of PUE) 1ml/day 500mg/1ml/kg/day of PUE

* Pyrus Ussuriensis extract

The adaptation period was one week, after which each group was administered. Body weight and feed were measured at 1 day intervals.

Rat experiment was administered for 14 days. On the 14th day of 40% alcohol and sample administration, 1 ml of 70% ethanol (150 mM HCl) was orally administered to all animals for 1 hour before sacrifice, except for the control group. All animals were anesthetized with CO ₂ , then blood was collected from the heart and sacrificed by cervical dislocation. All animals were observed with gross findings, and histological findings were performed in case of abnormalities. The collected gastrointestinal tract was visually confirmed to confirm the degree of gastritis and gastritis. Some were cut and fixed in formalin, and some were stored at -70°C for genetic analysis.

There was no significant difference in body weight change in all animals including the control for 14 days. During the preliminary test period, body weight gain was maintained normally throughout the experiment and water intake was normal. After 14 days of dissection, the rat's stomach was examined.

Rats (Group B: NC Group) who consumed only 40% ethanol for 14 days had vascular epithelial necrosis and severe gastritis.

In the low-dose 250 mg/kg extract group (group C: group T1), small necrotic sites were found.

On the other hand, rats in the high-dose group (group D: group T2) showed only slight gastritis, and there was no significant difference from normal.

[Animal experiment]

To obtain the same extract from commercially available dried Pyrus ussuriensis , Tang, X., et al and Reza, MA, et al. The method described in [11, 12] was followed. In summary, dried Pyrus ussuriensis fruit was pulverized into a powder form, and dried sandol distribution 1 and 50% ethanol 20, which are the extraction ratios identified in the previous experiment, were mixed at a weight ratio, followed by reflux hot water extraction at 90°C for 10 hours. The extracted extract liquid was obtained by using a filter paper (70 mm, Advantec, Toyo Roshi Kaisha Ltd, Japan). The filtered filtrate was concentrated at 95℃ with a rotary vacuum evaporator (Buchi R-114, BUCHI Labortechnik AG, Flawil, Switzerland), and finally freeze-dried (BioTron, Gangneung, Korea) and stored at 20℃. I did.

50 Sprague Dowley (SD) rats, 4 weeks old (weight 80-90g), were purchased from Orient BioInc. (Gyeonggi-do, Korea) and were acclimated for 7 days. The breeding conditions in the laboratory were maintained at a temperature of 24±3℃ and a relative humidity of 50±10% with a sheep/dark cycle of 12 hours. Feed and drinking water were freely ingested. Experimental animal tests were conducted after obtaining approval from the Animal Ethics Committee of Kyungpook National University (approval number: KNU 2018-107). The classification of experimental animals is shown in Table 3. In this animal experiment, a total of 50 SD rats were randomly divided into 5 groups of 10 rats in each group based on body weight. Test drugs were prepared immediately before administration and administered orally.

Group Oral dose(ml) of Ethanol(40%) Oral dose of tested materials Numbers of Animals CMC 0.5% CMC 10 ml/kg of 0.5% CMC 10 Negative Control (NC) 1ml/day 10 ml/kg of 0.5% CMC 10 Positive Control (PC) 1ml/day 30mg/kg/day of lansoparazole 10 T1 (low dose of PUE) 1ml/day 250mg/kg/day of PUE 10 T2 (high dose of PUE) 1ml/day 500mg/kg/day of PUE 10

CMC: Carboxymethyl cellulose, PUE: 50% ethanol Extract from Pyrus ussuriensis

After administration of the test substance, on the 15th day, the end of killing, all animals used in the experiment were anesthetized with CO ₂ and then 1 ml of 70% ethanol (in 150 mM HCl) was administered for 1 hour, and then blood from the abdominal aorta of the rat. 3 ml was collected. Some of the collected blood was subjected to CBC analysis, and some were centrifuged at 1600 xg for 10 minutes at 4° C. to obtain serum. The separated plasma was stored in a refrigerator at -20°C until biochemical analysis.

After blood sampling was performed as above, the rat was sacrificed by cervical dislocation under anesthesia, the abdomen was opened, an autopsy was performed, and the upper and lower parts of the stomach were ligated with sutures and then removed. After that, the liver, spleen, and kidney, which were the organs of the major autopsy, were removed and the weight of the organ was measured. The isolated stomach is opened, the stomach contents are collected and the pH is measured. After washing with physiological Phosphate buffer (PBS), the gastric conditions of all test groups were examined with the naked eye. Some tissues of the stomach were rapidly excised before autolysis for histopathological study and immediately fixed with 10% formalin. The reason for immobilization is to stop the post-change and to convert to an insoluble state by coagulation or precipitation of certain tissue components to make it a state suitable for histocytologic examination. In other words, the structure of various tissues or cells constituting a living body is well preserved as in the living state. Parts of other tissues were immediately stored in a refrigerator at -70°C until analysis.

The severity of ulcers in all test groups was determined on a scale of 0-5 based on the severity of vascular congestion, lesions and lesions of the upper complexion. For the ulcer score, the wiped stomach was spread on a cork plate and scored according to Table 4 using an eyepiece dissecting microscope.

Score Remark 0 Almost normal mucosa One Vascular congestions 2 One or two lesions 3 Severe lesions 4 Very severe lesions 5 Mucosa full of lesions

The stomach and liver tissues fixed in formalin were transferred to Korea Pathology Co., Ltd., and HE staining was performed on the stomach and liver. H&E staining is the most useful staining method for testing biological samples, using two dyes: hematoxylin, which gives a dark blue color, and eosin, which gives a red color. Cell nuclei are stained dark blue and most cytoplasmic components are stained pink or red. Using this staining method, the nucleus and cytoplasm of the cell can be observed.

Serum was analyzed for quantification of PGE, cAMP and gastric mucosal histamine. First, determination of the level of prostaglandin E2 (PGE2) by ELISA followed the manufacturer's instructions using the PGE2 ELISA kit (Abnova, US catalog number: KA0326). Determination of cAMP and gastric mucosal histamine levels were analyzed according to the manufacturer's instructions using the cAMP ELISA kit (Colorimetric, Cat. No: STA-500) and histamine assay kit (Cat. No: AKR-360) from Cell Biolabs, USA, respectively. I did.

Next, real time PCR was carried out as follows. The gastric tissue isolated from the rats of the test group was homogenized with TRIzol (Life Technologies, USA), and total RNA was isolated according to the manufacturer's instructions. That is, it was processed as follows. Qiagen RNeasy mini kit was used. The tissues frozen at -70℃ are ground with a mortar while pouring liquid nitrogen into powder. It was placed in 600 ul of RLT buffer containing Mercaptanol, vortexed, lysed, and then centrifuged for 3 minutes in Qiagen shredder colum. Complementary DNA (cDNA) was synthesized from 5 ug of purified RNA using the AccuPower® RT-premix system (BioNEER, Korea). Primers used for histamine (H2) receptor, H+/K+ ATPasepump, Cholecystokinin (CCK) receptor, and Muscarinic (M3) receptor were performed together with the information in Table 5.

Receptor Primer Sequences 5'-3' Source Fragment Size(bp) Annealing
Temp.(℃) Histamine-2 Sense ATGGCATTGAAAGTCACC 21 378 60 Anti-sense GACCAAAGAGATGGCAAC Cholecystokinin Sense GTGAAAATGACAGCGAGAC 19 454 54 Anti-sense GGAGGGGGTAGGAGGAT Muscarinic receptor-3 Sense AAGGCACCAAACGCTCATCT 20 511 68 Anti-sense GCAAACCTCTTAGCCAGCGT H+/K+ ATPase Sense GCTACTGCCCAGGGATG 19 425 60 Anti-sense GTAACAGAGCCCCACACAA β-actin Sense ATGGATGACGATATCGCTG 21 568 59 Anti-sense ATGAGGTAGTCTGTCAGGT GAPDH Sense CACTCACGGCAAATTCAACGGCAC 60 Anti-sense GACTCCACGACATACTCAGCAC

[Experiment result]

The difference in body weight was not significantly observed in all test groups. In other words, there was no significant difference in feed intake between the non-alcohol intake group and the alcohol-administered group.

[Check for gastric ulcer]

As a result of visually examining the state of gastritis, almost all mice in the negative control group showed gastritis. However, in contrast, in the positive control group (PC), the low dose (T1) and the high concentration (T2) group, the gross findings of the gastric lining were significantly smaller than those of the NC group. This is shown in Figure 1.

[Histological change of HE staining]

In FIG. 2, A shows the shape of the gastric mucosa of the CMC group, B and C group NC, D group PC, E group T1, and group F T2.

In the CMC group (A), the morphology of the gastric mucosa was in a normal state with a clear cellular structure and a clear gastric region. Parietal cells have a normal color and no cell penetration. In the negative gastritis control group (NC), highly degenerative cells with inflammatory cell infiltration were observed in the gastric mucosa caused by ethanol. In addition, a decrease in cytoplasmic mucus, mucosal atrophy and inflammatory cells were observed in some structures of this group. The positive control (PC), low dose (T1) and high concentration (T2) of the group treated with the ethanol extract of Pyrus ussuriensis showed mild to moderate cellular degeneration and inflammation.

Figure 3 shows the histological changes staining of the stomach tissue. LCA (CD45) staining occurs in the cytoplasm of inflammatory cells as brown. Is the CMC group, B is the NC group, C is the PC group, D is the T1 group, and E is the T2 group. As a result of comparing inflammatory cells in the submucosa layer and comparing the treatment group and the control group, many brown-stained cells were observed in the NC group (B). However, compared to this, small brown cells were observed in the PC group, T1, and T2 groups. Some inflammatory cells were also observed in the CMC group.

[Detection of serum prostaglandin E2 (PGE2), cAMP and gastric mucosal histamine levels]

4 shows the detection results of PGE2, Histamine, and cAMP levels.

The plasma PGE2 level was lower in the negative control group (NC) compared to the normal control group (CMC), but the T1 and T2 treatment groups were higher than the negative control group.

On the other hand, in the case of the cAMP level of the negative control group (NC), when compared with the normal control group (CMC) and the treatment group (T1, T2), the negative control group (NC) showed less.

In the case of PGE2, which inhibits gastric acid secretion, the CMC group and the NC group were similar. However, the amounts of cAMP and Histamine that promote gastric acid secretion increased in NC, and it was inferred that ethanol promotes the secretion of cAMP and Histamine to induce gastritis. However, this increase showed a decrease in PC, T1 and T2.

As a result, it was concluded that the 50% ethanol extract of Sandolbae is supported by the above animal experiments that it has the effect of improving gastric inflammation at 250~500mg/kg.

On the other hand, the complete blood count (CBC) is one of the blood tests and indicates the health status of the experimental animal. Mainly, white blood cells, red blood cells, and platelets are evaluated. As a result of the experiment, hematologic levels such as leukocytes, lymphocytes, red blood cells, and platelets were different between each group, but were within the normal range in all groups, and no abnormalities were found. A toxicity test was performed by oral administration, but no specific clinical symptoms were found.

If so, it may be prepared as a pharmaceutical composition for improving, preventing, or treating alcohol-induced gastritis, which includes the Sandol bae extract as an active ingredient.

According to such a preferred embodiment of the present invention, the composition of the present invention can prepare a pharmaceutical composition comprising a pharmaceutically effective amount and a pharmaceutically acceptable carrier of the above-described sandol pear extract of the present invention. A pharmaceutically effective amount refers to an amount sufficient to achieve the efficacy or activity of the sandol pear extract.

When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used at the time of formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. It is not limited thereto.

In addition, the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, mucosal administration, and eye drop administration.

The appropriate dosage of the pharmaceutical composition of the present invention is prescribed in various ways depending on factors such as the formulation method, the mode of administration, the patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and response sensitivity. Can be.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person having ordinary knowledge in the art. Or it can be made by incorporating it into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension, syrup, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, powder, granule, tablet or capsule, and may additionally include a dispersant or a stabilizer.

Meanwhile, in another preferred embodiment of the present invention, it may be manufactured as a functional food.

More preferably, the sandolbae extract of the present invention may be prepared as a fermented food. Hereinafter, an embodiment prepared as a fermented food will be described.

First, the lactic acid bacteria starter and yeast starter were used as follows.

Lactobacillus plantarum starter

Lactobacillus plantarum (L. plantarum) was used after depositing a strain isolated from Rice mill (Uljin, Korea) at the Department of Food Science and Technology, Keimyung University Food Materials Development Lab, to the Korea Microbial Conservation Center (KCCM 11545P). This strain was cultured on an MRS agar plate at 30° C. for 24 hours, and then purely cultured L. plantarum was inoculated in sterilized MRS broth liquid medium, and then stationary cultured at 30° C. for 24 hours was used as a starter.

Lactobacillus plantarum starter

Leuconostoc citreum (Leuc. citreum) strain was incubated in A agar plate (sucrose 2%, yeast extract 0.5%, tryptone 0.25%, K2HPO4 0.25%) containing sucrose at 25℃ for 24 hours and then in sterilized MRS broth liquid medium. Pure cultured Leuc. Citreum-doped platinum was inoculated and cultured at 30° C. for 24 hours and used as a starter.

Saccharomyces cerevisiae starter

Saccharomyces cerevisiae (Sacch. cerevisiae) strain isolated from traditional makgeolli was cultured on MRS agar plate at 30°C for 24 hours, and then purely cultured in sterilized MRS broth liquid medium. cerevisiae was inoculated with platinum and cultured at 30°C for 24 hours and used as a starter.

The 10% (w/v) sandol pear extract extracted with hot water was sterilized at 121° C. for 15 minutes, and then lactic acid fermentation was performed. MSG, a precursor of GABA, 3% (w/v) was added. In addition, 1% (w/v) yeast extract was additionally added to supply nitrogen. Then, 1% of Saccharomyces cerevisiae is inoculated to perform the first fermentation. Yeast fermentation was performed at 30° C. for 2 days.

Next, 3% of MSG is added and 1% (v/v) of L. plantarum is inoculated, followed by secondary fermentation. Yeast fermentation was performed at 30° C. for 7 days.

During the second mixed fermentation, all MSG was converted to GABA (gamma-aminobutyric acid).

Gamma-aminobutyric acid is a kind of non-proteinaceous amino acid distributed in nature, and is known as a major inhibitory neurotransmitter in the central nervous system such as the brain and spinal cord. Due to various pharmacological activities such as activating blood flow to the brain and increasing oxygen supply to the brain to promote metabolic functions of brain cells, reducing triglycerides in the blood and improving liver function, headaches and ringing in the ears caused by cerebral artery dystrophy , It has been applied to treatments such as decreased motivation. In addition, it has been found to be effective in the prevention and improvement of adult diseases such as high blood pressure, and interest as a functional food material is increasing. Recently, beverages containing a large amount of gamma-aminobutyric acid have been released.

As described above, it was confirmed that a functional food that more effectively promotes gamma-animobutyric acid can be prepared by performing mixed fermentation with two strains of the Sandolbae extract.

According to another preferred embodiment of the present invention, Bacillus subtilis fermentation may be grafted.

Mix dry stone pear and boiled water at a ratio of 1:9 and extract for 30 minutes. Remove seeds and husks.

Next, add Sandolbae extract, distilled water and 0%, 2.5%, and 5% of MSG by concentration, and sterilize at 85°C for 20 minutes.

Add 40% of sterilized glucose at a level of 2%, and then inoculate 5% of B. subtilis . Bacillus fermentation is cultured with shaking at 42° C. and 160 rpm for 2 days.

In this way, after the first fermentation, Bacillus fermentation, the second lactic acid bacteria fermentation is performed. At this time, 2% glucose and 5% skim milk are additionally added to the Bacillus Bacillus culture medium to increase the growth of bacteria and increase GABA production.

Next, after inoculation of L. plantarum 1%, it is incubated for 5 days at a temperature of 30°C.

When the hot water extract of Sandolbae 10% (w/v) and MSG 5% (w/v) were exhausted from the first Bacillus fermentation, the remaining MSG was all converted to GABA within 3 days of the second lactic acid bacteria fermentation.

Through the above examples, the present invention provides a functional food composition comprising a sandol pear extract as an active ingredient. It not only prevents, ameliorates, and treats gastric inflammation, but also has a functional effect of enhancing the gamma-aminobutraic acid content.

When prepared as a functional food composition that prevents, ameliorates, treats, and enhances gastric inflammation containing gamma-aminobutraic acid containing the Sandol pear extract of the present invention as an active ingredient, not only the Sandol pear extract as an active ingredient, but also during food production It includes ingredients that are commonly added, and includes, for example, proteins, carbohydrates, fats, nutrients, flavoring and flavoring agents. Examples of the aforementioned carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, oligosaccharides, and the like; And polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents [taumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)] and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is prepared as a drink, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, cephalopathy extract, jujube extract, licorice extract, etc. I can make it.

The scope of protection of the present invention is not limited to the description and expression of the embodiments explicitly described above. In addition, it is added once again that the scope of protection of the present invention may not be limited due to obvious changes or substitutions in the technical field to which the present invention pertains.

Claims (4)

A pharmaceutical composition for improving, preventing or treating alcohol-induced gastritis, comprising an extract of sandol pear as an active ingredient.
The method of claim 1,
The sandolbae extract is a pharmaceutical composition for improving, preventing or treating alcohol-induced gastritis that is fermented using two or more strains of lactic acid bacteria, yeast, and Bacillus bacillus.
A functional food composition comprising, as an active ingredient, a sandolbae extract with improved gamma-aminobutraic acid content through a complex fermentation process.
The method of claim 1,
The complex fermentation process is a step-by-step fermentation using two or more strains of lactic acid bacteria, yeast, and Bacillus bacillus, respectively, a functional food composition comprising a sandol pear extract as an active ingredient.

Images